Dasypus_novemcinctus Locus SLC35F1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SLC35F1
Dasypus_novemcinctus
SLC35F1
GeneScaffold_7229
SNORA73
211684..211882
223422
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGCCGGCCGAGGGCAGCG
GCGGCGGCGGGAGCCTGTCCGCCTCCTCCCGGGCCGGCGTGCGCCAGAGGATCCGCAAAG
TGCTGAACAGGTGAGCGGCGGCGGCGCGCTGGCCGAGGGCGCGGGGCGGGGGCTGCGGGC
GTCGGGCCGGGCTCTCCTTCGCCCCCCGTGCGGCTCCGAGACCCTTTGGGGCAGAGGGTC
CGGTCCGGGGAGAAGCAGGAGAGCGGACGAAGGCGCGCTGCGCGCTGACCGAGAGGGCGC
GGGTGTTGTCCCCGCTGGCCGCCGCAGCTTTGTCCCGGCGCCGGGAGCCCCGAAGCGCCG
GAGCTGCCGGCAGGTCCGAGGCGGGAGTTCGGGGAGAGGCGGGTCTTGAGGACCCAGCTG
TCCCGTGTGTCTCCGCACTCGCGCACGCGGGTCGCCTCACTTCCCTCTTCCACCCGCACC
CCAGCTTCGCGCCACGGGCTCCGCGGGGAGAGCGCTGGGGCGGACGCGGCCAGGCGCCGG
GCGGCGGAGGTGGCGTGGAAGTGGCCGGCCTCGGGCTGCCGGCCGCCGGGCCCCGGCCTC
CCCGACCCCCTTGCCGGCGGGAGAGGGATGCATTTCTCCTGCCGGTCGCTCCCGTCGCCG
CTCCTGCTCTTCCCGGCCGGGAGCAGGGAAGGGAGTCCGGAGGCCTGGATCAGTCCCATG
CAAAGTGCAAGAAGGCTTCGGGAAGGGTGTGAGAAGGAGGCGCCAGGTTATTCCAGACCC
GCTAAAGCCATCGGAGGCGAACGCCGATCGCCGGAGCTTGCAGTGCTGGAATCTGCGCAG
TGGATCGATCAAGGACAGGGACGTTTTAGGGTGAGGACCCGGTGACCGTGAAGATGGGGG
CTCTCCTGGCATCCCTGACTCGATTGTAATGTGAAAGAGACTTCCACTTAAGTAACTTGA
AATGAGCTGCCACGTAGAAAGAAAGGAAGAAAAAAAGAGAAAGAAAAGAAAAATCATATA
GAGAGAATGGATTTTGTGTGTGTTTTATTTGGATGAGTGTATGCTTTTCGGTACATCTAC
ACTTCCCGTCGCTCTGATCATACAGGTTTCTGTGTTGCACGATTTTGGGTAACTCAGATA
CCCCCTAGGAATTCATATCGAATTGTCTGGGACTTAAAGTTCTAGTGGGAGCACAAATAT
GTACAGAAATAGAGAGTTGAAAATATCTTCATTTTGGGGGGTATGATTTAAATTAGTTAT
ATCAAAAGCCAAACCATTCAAGACTCTCCCGTGAAGACAATGTGTATTGACTTACTTGTA
GGTACTTCTGTATGTTTCCATTTATTATCAAACAAGAAGAAATTCATTCTGAAGTAAGAC
ATGAATTAGAAAGTCAAGCCTTTACTTTCCTTTGATTTGTAGTCCAGAACAACACTTTCT
AAAAATATTACATTGAAGAGATAATGAGCAGAATAAATCAAGATGCTGCATCAGTACATA
GTACGCGTGTTTCCTATTCTTTATGGACACCTTTTATTATTTTTAAGGTATAAATATAAA
TGCCTTGACATTGGCTCTTTAAATTTTTAAGCAGAATATGTTTTTAATTATTAATTTCCC
TCATCAAACTAGAAAACTCTTATTCATTTATTGCTGCCTAATTCTAAGTTATTATGGACT
CTGTGCAGGTTATTCCTTGTCATGTAATGAGTCTTAGAGTCCAGAATAACAAGATAACTG
AGCTAGGAGCAAGGGGTCTTGAGCTATCACTGCCACTAACTAGCCATGTGATTTAGCCCA
TCATTTCCTTGGGTTTTGGTTACCTCACTGGAAAATGTGTTTTATGATATTGTTTTACCT
CCTTTGCAATGATTTTGAGATTTGATGAGTAATACTGAAGAGCACACCTGGGAAAATATA
AAGCTGCACACATAATTACTTATCCAATTCGTTTTTGTTGCCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTATAGCTTTCAGACT
TAAATTTCTTTATCTTCCAAAGTTCTTTAGAATTTTTAATATAGTGTGTTGTATTGAGTA
AATTACTTTGTCTTAACCTAAACAATAAGATGTTTCTTTTGAAAAACAACATATTTAGTA
AGAAGATAGCAAAAATCAGAATAAATAAAAAGTTCTCAATGGAATAATTTCTTTGGCTTG
CTGATTGGCTTGGCTTTTGTGCCGTAAGTGTTAACTGGAGATTGCATTAGCAGAGGCTAC
TGAATGACAGGGCTTTGAGTAAGAGCAAGAGCATCTGGGAGAGGGGAATTTTAGAGATGC
TGTGACAGTGCTTAGGTGTGGCTCCCCTCTGGGAGTCAGTAATGGCTATCAGGCAGGTCC
ACTAGGGTCTAATCATAAGCATTTTTGTTCCTTTTCTGAAAACTTAAGATTTGCTTACTT
TTTCCTTCTTTTTCTCCACCTTCTTTTCCACCTTCTCCTTCCTTAATTCTCCTTTTCTCC
ACCTGCTTTGTCCTATTCACTAGTCTTTTTCTTATCCTTTCCTCCTGATATGAAGTAACT
AGCTGCTAGTAGAAACTAGTTGCAAATCCTAAAGCTGGAGCCAATATAGAAAAGATCCTC
CAACTTTTGGCATGCAAATATACGTTTAGCTATGATCTATTGCTGTGAGCTGGCTAGGGG
AGTCTCTGTTGACCGGATGGGATCTTGCATCGAACCAGTTCTCTGCACCCCATTGGACCA
AACGGATGGTGGGTGGGGCTGAGAGACTGAGGGTGGTGCAGTGGAACGTGAAGTATTAGA
TTGTGCAACTCAAGCTTTGCCAACTGCTTCCCTTTCATCACTGGCTATCACAACAGCTAC
CTGTCAACTGGGAGGAATGAATACAAATACTAATGCTAACTCTGTCCTGTCTACTGAGGA
ATAAAGATAGAAGTACTGATTAATAATTAAAGGTACTGCTGTCAAGGAGTTCAGTTAGAA
TCACAATGCAGTGTTTCCCTTATGAAATCTGCCTCACATTACCCTCCATCATTTTAATTT
CTTCGTTCAGTTCCATGTCCTTTCCCCTTACTTTAAAGGCTTGTAGAGCTGGGCTGCTGA
ATTTTGTACATGAGAATTAGGGTACCTCACTGGTTGACTACACATTTTCAATTAGATATG
GATGTAATAGTATCTGAGACTTTGGTAAAAGAGGAAGTACTAGATAATTTTTTAAACCAA
TTAATGGGGTATTTCATATTTTCTCTCCCCACTGTCCCATTACAAGTTATTTTGGAAATG
GAATGTAAGACATTCAGGATGATTTAAATGATGGTGTAATTATTACTTCTTTGGTTTCCA
AAGATTTGGAATAATTTATTGTTTCAAACAAGGAGGAAATTATGGCAAACTCTTCTTCAT
TTGTTCCTTAGTGTGGAATAGTATTTATTACTGTATCACAGGCAAGGAAGATATGACAAA
AAGAAAGTATTTCAAGGACAAGCTGTTGATGATCCTCTCTCAGAAACTGCTGATGAAGGT
AGATTTCATAGTAACATATGGGAGTGGATAGTAGTTTGTATAGTAAAGTGTCTGAAGATT
TTCCTCTTTAAAATGATCACTTAAGGAAATGTTTTTGAAAAACAAGTGGTAGTTTGTTTG
GTGTTTTTGCATATGTGCTTTATTTACTTTTTCCTACTTGAATATTATTTTCAATTCTTA
ATGAAAATGACCTTGCGTTTTGATCCACTTTCTTCACAATAAGAGACATATTGTGTTGTC
TCAGGATATAAAGGGGTTTCCTCCTCTTTGAGTCTTTTGCAGTGGGCATGTTTAATCATT
AGACTGGAAGGACTAGTGACCCTGGGTTTTCCATTCATTTGATTTGGAACTAACTTGTTT
CCAATGTACATTTAGAGTCACTTTATTTATTTGCAAATTTCTGTAACTTTTTTGAATTCT
AAACCAAGGGGCATTGAGGAAGATATGTTGGAGAATTGGTAGCAAGCCTACTTAAAATCA
ATGTCCAAGTGGGAAACTTACCATGGAAGATGGGACAATACGTATATGTAACCTTTCCTG
ACACATTAAATAAAGTGGACAGTACATGGAATAGCTGCCAATGAACAGGATTATGCCTGA
ATTAGATATTAGATCCAGTTGATTTAGACATAGATTATAAATTAGGCATTCCTTTCTTAT
CAAGTGAGAAGACTTTTATTTAGAAATTGATAGAGTCTTTCTCAGGTTCCTTCTCCTAAC
AGATGTCAGAATTAAAAGGGGGAAAATAAGCTAATAATGAAGGTAATTAATACAAAATAT
TCCAATTGGAACTGGGCAATGTCATTAAAAGCAGACCGTTCTAAGATAAGTAGTAAATAC
TGTTTGAAGGATACATTTACCTTTAGATGAAAGGAAAAATTTATAAAAATACAAGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGAGGAGCAGGGCAGTGC
CAGAGGGTCGTTAAGGTGTGACAACCTTTCTTTTCCTCTCTCCAGCCTTGGTTGCCTCAC
TAGAGTCAGATGTTTTATCCAGTGTGGAGTGATGGAAACTTCTGCCTTAGGATATTATCA
AAGATCTGCCTATATAAAAAAGAATAATGAAGCCATTTGGCTTACATTCTTGATGTCATT
TGTACTGCCTCTGTGCAGGGTTGGGTGAAGCACATTCTATAGCTGCTGTAAGCAATAAGC
CTCAACCTGTTTAATGCTGACTCAGCATAAGTATGTCTGCAGAGGAAGATGATTAACTTG
AAGAGAAGCTGGCATCAGCAAGAAGAAATACAACCACACATTCAAACGGAATATAGAGTA
TTTCCATGTGACATCTTCAGGAGGTATCTCAGAGAGAAAGAGGAAAACATAATTGTGTTG
GATTGAGGTAAGTATGTTCTCTAGTTTCTGTCATTGGCATTGGAGTTTTTGTTCTCCAGA
GTTTCTTCTTGGTTCCTTTGTCAAGTGCATCCATTTCACCCCAGGTGGTTAGTATAAACC
AGTTGATGTATGGCATGTTCCTGAACTCCGAACCTTGAGGTTGCTATTGGTGTTAGGTGG
ATGAAGGTCTCAGGCTGGCCCAATCAGATTGACTAGAAGTACTTACATTTGATGGTTCCG
GAGTGGGGGTGGTGGGAAATTCTCTCTTTCTCCTGCTGGATTTGAACAAGGAAACAGCCA
TCTTGCTACTGATTGCTACTAGCAGCCACTTATGACCATGAAGAAAACCAGCCTTACGAT
GACACTGTTGATGAGGACAGCAGAGTGGAGAAAGAGAAGGTACCTAAGTCCTTGAAGAAA
CTGTTGAACAACCGACTGCATTGCCAAAGCCTCGGAGCTTGCTCTCTCACTAGACTTTCA
TTATGGGGAGTAATAGATATTCTGTCCGTTTGAACCAGCTTGATTTGGGGTTTATTATAC
TTGCAACTGCAAAGCATCCTTAACTGATACACCCACCTCTCTCACTTTGGCCTGAAAGTG
ATGACCGCCTCTTAATACCAGTCAGGATCCTTTCATCTCTTTCAGTTAGACATTTCTGTT
AAGGAAGAGCAGAGACACGATTGCTCCTGTCTACAGTGGAGGAATGGTTTGCCCAGAATA
TACATCCACAGAGGGTAGAAGGAAGTGGTTGTTGTGACTTGTAGAAGTCATGGATATCCA
CATCAGTCTGTAGTATAGCCGGAAGGCACCTTTTATAATCTTTAACTGGTCTGGATTAGA
AAATGATATTGAGAAGATTGCCATGCTGAGTGAACGGCTACTTCCATCATGTCACTCATT
TATTCATTTGTTCAGGGAGCATTTATTCTATGCCTTCTCTATGACAGGCTTGTGCTAGGA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGTACCCAGAACCTTGGATTATAATTTTATATGTCAA
TACTTATTAATTAGGGAAGAGCCAATCAGATTTTTTTGGTGTGTATGGATTGTTTAAAAA
CAACCCCACTCAAAATAATCAGTGAAAACTTAATTTAATACTTTGAAAAACAGGAGCTTA
GGAGAACAATACAGTACACAGTGCTGAGATGAACCTTCATATCCTATGATCAGTTTCTAA
TTTCATCTACTCTAGGGCTTGGTAGACTGTAAGCCATCAATATCTGTTGGCTCCATGTTT
GTGTGCTCCACTGTGAGATGCCTGAGTTGGGTCTTAGATGAAGACAGCCTGGATATTTCT
TGCATTTTAGACTGCAGTTGTGGAAGCTGACCTAGTGACTCGGTCCAGTGAGCTGTACAG
AGTCTGCAGTTAGCAGTCGCATTCTGTCCAGTACTGCAAAAGGATTGGGGAACAGCTTAA
CAGTTGTGATGATGACGATGGCTTTGATAGTGGTGAGGGTGATGGAATTAGCGATGTTGA
TAGCTCTCAGATGTTCTGGAATTACTATGTATCAGTCACTCTACCAAGAGCTTTACATGC
ATTATCCTGTTTAGCCTCACAAAACCTTCATCCACAGTTTAACAATGAAGATGTTGAGCC
AGAGAAGTCTGCTAAATTGCTCAAGGTCACGTAAATACTGAGTGGCATTGCTAGAGCTTG
AACTTAATTTGGTTCTGAAGCCCTTGTGCTTATAAGGGCCTATATTAGTTGGTACCATTT
TGTTTCCTCCCAGTGATAGAAACCTAACTCAAGTTGGGATAGCACACATGCAATTTATTG
TCTCATGTCCTTAGGAAGTACAAGGTGACCAGCTTTAGTTAGGGGCTTGTGGCAGTTTGG
TATTGTTTATGAATTCCAAAAATAGATATTGGATGGTGTTTATAAACTGGTCTGTTCCTT
TGGGAATACTAGATTATATTACATTCAGAGGTTTTACTTTTACTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACAGAGTAGGTACTTCGTCATACTTATGAATGACGA
TGCCAAATGATCTATAAGGGACTCGTCAAAACAGAAAATTATTTTCAGCAAGTTAATGAT
GTCTGATTTTGTTTTCCCGGATAATGTTTGTGATAATACCTAACAAGGAGTAGGTGTCAG
ATGATTTTTAGCTTTTTATAAAACTGATCATGTGTCTGAGACAAGTATATTTATATCTAT
AAATAGTCTAAGTGACTATACATATATGTGACAATACATACATATATATTTATCTGGCAC
TCAGAACACCATGGGACATATAGAAAGTCCTATTCAAAGTCATACTTCTTATTATTGCTG
TCAGGAAAAAAGCCCAGGAAAAAAGGAAGAAGGAAACTTATCACTGAGATATCTGCATTA
AGATAGAGCCCAACTTCATCTTGTTTATTGCTTTCTGCCCAGTGCCCAGCACTGTGCTTA
AACATAATAGATGTTGAACAATACTTGATTAACGAATTAGTGGTGAACTTGGAGTGGACT
GACAAGGAAAGGCAAGAGGGTCATATAGTGGTTAGAAACCTTAGCCGAAAGTAAGCAAAA
AGGAATGGAGAACAACATTTCTTATTCCTGCTTATAAATATCTTCCTAAACAATTTCTAT
CAGTTGGAAATTAATTTGAGTTAAATTTCTTCTTTAAATGCATCACCCTGGGAGAATTAG
ACAAAATTAAATTTATATCCTTTCCATGTCTGCTGTCAGGAAAGCATAGTCCTAAGTGTA
GTTAGGAGATGCAAATACAGCTAAAGTTTGGTCTCTGCTCTCAAGAATATTTTAGTCTAG
TTAGTGTGTTATTTAGTTGAACAATTAGATTTTTTTCCTCTTACATCAGAAACAGGAAGG
GTGGGAGCATTGACGGCAGGCATCTTTGGAACAAGGGTACATATAGCATGAGGGCAGATC
TGGCTGAATTTCTACAGTAGGGAAAATTGTACTACTCTACGCATTTTGGGCTAGGGTAGA
AGAGCACCCAAGTGTGGGAGGTCAACTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATT
GCTAGAGCTTGAACTTAATTTGGTTCTGAAGCCCTTGTGCTTATAAGGGCCTATATTAGT
TGGTACCATTTTGTTTCCTCCCAGTGATAGAAACCTAACTCAAGTTGGGATAGCACACAT
GCAATTTATTGTCTCATGTCCTTAGGAAGTACAAGGTGACCAGCTTTAGTTAGGGGCTTG
TGGCAGTTTGGTATTGTTTATGAATTCCAAAAATAGATATTGGATGGTGTTTATAAACTG
GTCTGTTCCTTTGGGAATACTAGATTATATTACATTCAGAGGTTTTACTTTTACTTGGTT
AAATTGTGATTAAGGCTTTCATTTGGCCACCATCAGTAAGACATCAAGTCCCTCTTGGTG
GGTGAGGACTCACAGAGAAAATGACAAAGCAGAGGAGACAGTTTGAGTTTTGATGCTGGA
GCTCCAGGAAGTAAATGCACAGAGAAGGAAGGAGGACACAGAGGAAGAGAGATAGCTCCT
CAGACAGGATCCTACTGCCCCAGAAAGAGAGATGAGACATTCACCTGATAGTTTGCAGCT
GCAGAGACCAGAGACCTGGGCAGCCAAGCCTGGAGAGAAATGAGCCCTGGGAGAGAGATG
AGATTTATCCCAGCCTACTGCTTATATTGGAAGAAGCTGGGACCATGGAGTCTTAAAAGG
AAAAAGGAAGGCCGAACCCTTGCTGACATTGCCTGCCATCTTGCTCCAATGCGTGGCCAA
TGACTTTGGGTGAGAAAGTACCTCTTATGGTACCTGGAGTTGGACTGTTTAGGGCCTTTT
ACTGTAAGCTTCTACCTCAAATAAATACCCTTTATAAAACCCAAAAGAGTTCTGGTACTT
TGCATCATCTCCCCTGTGGCTGACTAATACAGGGCTGAAAGGATGTTATCATTGGTGTGC
TTTGTTGCTCCATCTCTTGGATTTATTTATTTCTTCTTAACAATATTCTGCAAGCAGTCT
CTATCCATGAGGAAAGCAGGGTTCATATCCTCTGACTCAGTAAGAACCTTATAGCAATTC
CAGAAAAGGCTTTGCTTGCACTGTGTGCTTATTCCTGTCTAATTTACAGGTCCAAGACCT
GCAGCCCTGTGGTTGGGCCCTGCTGGGGTGGGGGCTGGGTTGAAAGGGTAGGAAGCCAAG
AGCCAGGGCATGATGACTGAAAGTTGCATTATAACAGGCAGAGTGAGGGGAGCCATCACC
ATGCTCTGTCCTCCAACGTCGACCATTCCTGTGGACTCCTCCTTGGAAGTGACTGGATCA
CTTGTCACGGTTTGACATTTTCCTAGTGGATGGCAATACCCTGAAGCCATTTTTGTGGGA
GCACCCGTTTTGAGTGCCTTGGCCTGTTTGAAAAGAAAGTCTTTTTTTAACTTTTTCCAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTATATCACGGCTTCCTTTCTAACTGCTCATCACAGACCG
ACCACCTTGCAATGGAGTTTATTTTCTGATCTTACCTTCCTACTAGACTGGGAACTTTTG
GGGGCAGGACCTAGCCTATTTCTCTTAGTAACTCCCTACACTTTCTAGTAAGATTTCTAT
TGCAATGGATGCTCAGTAAATACTTTTGAGCCAATGAATGAATCTGAGTCATTACAGAGT
AAAATAATCCATTGTGTGCTGCACTCAGAGAATTTTCGAGAGTAATTTTCTAAAAAGGCA
CAGCACAGAGGAGGGGTTATGGGCCCTGGCTCTAGGTCAGACCTGCCTGGGTTTGAATCC
TTTACCCTTTCACCCTCCTAACCTTTATATGCTCCTCTACCAGATGGAGATTATAATAGT
ATTGTCCCCACAGAGATGGTCTGAGAATATATTGTACGCACCTGGCCCACTATTAGTATT
CAGTAAACATTAGTTTACTGTTTTGTTTTTGTTACTAGGAAGTTAACAGGCCCTGTTTGA
ACCTGGCAAGCATTTACTTTGGTTATACTCATAACAGTGCCTCTCTCACATATCAGAATT
TAGGTCTGTTCTTGCTTGCAATGCAAAATAAAGAAATGTCTTTCAGATTATAGTTTGCTC
TTTTTTTTTTTCTGACATTAGTGTATATCTCAGTAAAGCTGCTAACACTGCCACCACAAC
CACTACCAATACTAGTGTGCAAGTGGTTGTTCTCCTTAGGATCCCGGTCTCAGGAATTTG
GCATGGTAAAGCTGTGGCTGGTTCATCTCAACGATGCCCAAAGATGTTCTTCTTCAAGTC
ACCCAATCTATTTTCGCTGTGAACGTGGCCCATTTCTCTCTAAGCTGATTAATCATCGAC
TAATGGATTAAACCCTATCATGTTCATTCTCTTATGGTTTAGTCACTTCCTGGCTTGTCA
TTTGACAGTCTTTCATTCCGTTTGCATCCAAGTCTGCCAGAGAGAGCGAGTGAGGGGAAG
GCAGTGTGCGTGCTGGGGCTTCCCTAGAATTTACTTTGGATTTTGCGACAGCGGGAAGGA
CTGATGCACCTGGCATAGATCTTTAGCGTTGCCACATGCATTGCAGACAAAGGACAAAGA
CAAAGGATCTGCTTAATTCTTGGGGCTGTTTTAGAACTATGGCTAGAGAGGTTTCTCCAG
ATTGAGCCCTGAAATGCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCCGAGATTAAAAAAACTAGATGAACCAAATCTAAGAAAGATTGAAGCTTTTTTACT
GGGTAGGCCAAGATATCCAAGTCCTTCTTCTTCCTCCTCTTCGCCTTTTTTTTTTTTTTT
AAAGCTTGGGATTCACTGTGTAGAATAGTAGTACCATGAATTTTTTATTTTCATTTTTTA
TTCTGTTACCATATATACAATCCAACATTTCCCCTTTTAATCATATTCATATATATATAT
TTCAGTGCTGTTAACTGCATTCACAAAATTGTGTTATTATCACCACCATCCACTGCCAAA
ATATTTCCATCATTCCAAATAGGAACCCTGTACATTGTAAGCCTTAACGTCCCATGCCCT
GTCCCCACCCTGTACCCTGGTAACCCATATTCTAGAATCTGACTCTATATGAGTTTGCTT
ATTCCAGTTATTTCAAATCAGTGAGATCATGCAATACTTGTTCTTTTGTGTCTAGCTTAT
TTCACTCAGCATGGTATCCTCAAGGTTCATCCATGTTGTCACATGTATCAGGACTTCATT
CCTTTTTTACAGCTAAGTAATATTCCATCATTTGTATATACCACATGTTATTTATCCATT
CATCGGTTGATGGACACTTGGGTTGCTTCCACCTTTTGGTAATTGTTAATAACCAATGAA
CACTGGTGTGCAATGTTCTTTGTGAGTCCCTGCCAATCGCTTCATTTTTAAAAACTTGGT
TTGTGGTACAAATTAGTACTGCCAAACCATGTCTCCTTAAGGATGATGTGAAGTTTTCAG
GAAATGAAAAGACTTCCCAAATTTGCAGTAACTGGTGGTTGATTTTCATTTTCCTTTGTA
GTGGGCTGGCAAATGTGCAGTTTAGAAGACACGCATAGGTATATGGTTGGGTTTCCAGGG
CTGGGTGATCCAGCAGTTTCCCCAGGACCCATCCTCTGTGCTTTGACATTACTAGCCTCC
TGCTTCTAGAAGTTACTCTTCAGAAAACAAGTGGCAACAAAACAAATTTCTTATGTTCAC
TTTACTATGGTTCTAAGAACAAGCTCAGAACTTGTTTGATTTCTGCTTTTTGTGCTTCAT
AAAAGGAATTGCACAGGGACTTCTGATTTTGGTGAAAAGAATCTGATGCAGTTTGAGATA
TGTCACAGGTGTGGATATAAGCACTTATTTCTTTACGATAATCAATTCATTTCCTCCCTT
TTTCACTCATATTGCTTCTTGGACACACATACATTGTGAGGAGTTATACATATTGTGTAT
TTACACCTTATTACTTTCTCAATGCATACATATCACACCATATTCAGTATTTAGACCTCT
ATCCCACCTGTTTTCTCCTTCCCACCCCTGCAACCAAAAGCAACCCTATGAAGCACTCCA
AATTGTATTGTCTTAGAGTAGCGAATTATCTTTAAAATGAGATCACACTTAAGGGACTCC
CATTTCCTTTTAAGCAGGGATTTTTTTTAGAAGAAGTTATACCACATTCCCAGTATTTTT
GAGTCAGCATAGATGTCTTGTGATGCAGTAGTTGCCATAGTAATTAATGAAGAATATAAA
TCCATGTAAATTACCCAAAACACTAGTTAGAATTGCTCCTTGGGCACCTTGGTTTTTAAG
AAGTTAAAAAAAAGAGAGATTGTTCTTCTCCTTTTCTCATTCATGGAAAGGATAGAGAAA
GCTGCTTTTGTGCTCTGATTGCCCTGTCCTCTCCCTTCCCACTGGCAAGTGCCAGAAGGT
TGAACAGCAGTTAGGCAAGCACTGTACAGGACAGAGAGGGCTCTTGTGATAACAAATTGC
AAAATACACTTGGGCATGGTGAGGTCCATCCCTTTATGAATATTCTGCATTCAGATTCCA
AATAGCCAGTGCACTTTCTAGGACCCCACGCCAGAGCTCAGAGCTCAGGGCTCGCTGCTT
TGGCATAAGTTCTGCTTTTCCTGACCTATGTCTTCTTTCAAATTCAAGTAGAATTTACCA
CTGATTTCTATTCAATGGGAATAATAAAAGTGGAAATTATTTTGAAGGTTGACTGTTGAG
CAGGGGTCTGCTGAGACAGAGCAAGGCATTGTGGAGGAAAATTCATGAACTACAGAAAAG
GGACTCACAAGGAGAAGGAGCAGTTTAAGGGTGACTTCAGAAATTTAAATTATGCTGAGC
AGTTGCCATTTGGCACCAAGGATAGGTTTCATCTTTTTAACTGCTCCTTTTAGGGCAAAA
CTCATATCTTCCTATCCTTTTAAAGACAGTTCTCCGTCATCCCTCAGAAGTATGGTTGGC
ATACAGAGCCATTTGTGATTGAGAGAATTTTTTCTAGAATGGCTCATGGAAACAATTGAA
TATAGTGGAGGCATTTTTTAGCTAGAAAAAATTCAGGGTATCATATTAAGATAATAGTCT
ATGGCAGTATTGAGGAGACAAATTTGATAAGGGTTTCTCAATAATTAGTAAAGCTATATT
TTTAGATAAATTAATAGCTATAAATAGCAACCTCAATAATTCATGTGCTTTACCTCACTT
TATAGAAGATATTTTTAAAAGTCACTTGTGAAGTGAATTCTAATCTCAGTAAATGCCAAG
TTACTTTTGGTTGAATTCAGTCACAGTCATGAAATTTATAGTTTATTATTTTGGGACAAT
ATTTGGCCTTACCAGATAACAAATGTAAGAGCACACCAACCCTTTCTATATCAAATCTCA
GTGAAAATGATTTTTCCTGATATTTTTGTTCAAAAACTTTCAAGATATGAAATTTCTTCA
TGTTTGATTCAACTGTAAGATACAGAGCAGAACTCAGTGTCACAATTTAACCTGACAGAG
CCCTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTCTGTGG
TAGATATACTGCCTTTCTTCTTGCCTCCTTCCAATAGCCCTTGCATTAAACAATTCTGCG
TACAGCTTTTTAATTTTTTCAGTGTTTTAGTCAATGAATTTCTAGCCATAATTGTAGCCA
TAGAAAGGGGAGGGGTTTAGGATCAATTATAGTAACTATTCCAGATAAAGGGTGATGTAA
TTAAATTTTTTTAAAAATCAATCTATGTTGACCTCCTATAAGAAAGAGTTACTCTCTCAG
CTTACTGTTGTCCAAATAGTTTCACTATCAATCATTGCAGTTAGCTGCTATTGTGTTTTC
TCCCTCACTCCTCACAGTTTTTTTCTGATTGTGTGACCAGTGTAGATCATGTGATTAAGT
TACAGGAACTAATACTTTATGAGCATCTATTAAGTGCTGGCACTGTGCATCTGATTTAAT
CTGCACAACAGGATTTTGGGGTAGCCATTACCAACTCCATTTCAACAGATAAGGAACTGG
GGTGCAGAGAAGTTATGCAAGTTGTTCAAGCTCATGTGGACAATACTGTAGTTGAGATTC
AAACCAAGGACTGGTTTAGTACAAAGCCCTTGCTACTTCCCTGCCCAGTGATTTTCAAAC
ATTTTAGGCAGTAGAATTCTTTTGGTTTTCAATGAAATCTTACCTGGAACAGCAACTTTA
TATCCAACTGATAAGAAGCAATGACCAAGTACCTCGGATACATTATTTTCCTTTGGTGGA
AAACACATCATGGCTAGTGTAAGCCTTGAAGCACCTCCTCAGAGCGTGAGCATTGTGGGG
CTCTGTGGGAAACCTCTGCCTGGGTAGGCTGCCTGCACCTGCCCAGAACAGTGCTGGGTC
TAAGAGGCCAGGAGTCCCTGCAACTTAGAAAATCACACATTTCTCAAATGAGCCTTCAAA
CAGGCTTATAAATTAGGTACATGCTCAGTAAGGTAGCAGAGATTTTTGAGTAATTTCAAA
TGAATATAGTAGTTTTCATATTCTAGTTGAAATGTACATATCACTGGGGAAATAAAGCTC
TCAGGGTGCAGGAATTTCATGTCCAGCATGTTTTCCCACGTGAATAACTTTGCTTTTTGA
TGTCTCCTTTCTTGATTTGACCCATTTTTTTGCCATGCCATGAAGTAACTATATTATAAC
TGTCTAATTTAGTTCAGGGAAGGATCCTAATGATTTCAGTGTTATTTACATTGAAGTTAA
GTTAGGGAAGTGAGCTGGGTTGAGTGCAAAAGTGGCAGTCAGGAATTCTGAGTAGCATTT
CTAAGTACTGCTTTCACTTTGGGAAATCATTAGGAAAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTTAAACTCGGGGAACCCAAAGAATTATTTTCCCAGAGGAGG
GCAATGCTTGTTACTCAGGGGTAACCCTGGGAGGTAGATTCCGTGAAATGTCTCGTTCTA
GGTCTTTTTCCATTTCCCAAAATTTCCTCCCCTGTTTGACATACAATAGTTTTGCAACCA
CCATTTAAACAAATATAAGAAGTGATCAGTGAAGTCATATCAGCTCGCTGCACCTGCCTA
TTGCGCCAGCTCGCCGTCAGGCTTATCCTCTTTAGGAGGCACCAGGAACCTCTAGTCCCT
GCTTTATTATGTTTCTCATTATGTTTTTTTTCTTGTGTCTCTTGTTGTGTCAGTTTGCCA
TGTCTGCCTGTCGTGCCAGCTTCCTGTCTTCTTTTGGAGGCACCGGGAACCAAAACATGG
ACCTCCCGTGTGGTAGGCGGAAGTTCAATCGCTTGAGCAACATCCACTTTCCTAGAATTC
TTTTAGAGGGTATATATATGTGGTAAGATTTCAAAGTTTTTGCAATTAAAAAAAAATAGC
CCCTTTTTCTTCCTTGAAAGGCTGAGAATAGGTTTTATGCTTAAATTTATTTTACCTTAG
TACTTTGAGAATATTTTTCAATTTTCTTTTAGTGTCTGGTGTTGCCAATGAGAAGTCTAA
GGTTAAAATGAATCTTGTTTCTTTGTAGGTAGCCTAGTTTTCTCACTGGAAGCATTTGTG
ATTCCCTTTTTCCTTGGTAATATCTGAAATTTCACCACATTTTTTCCACTCTTAAAATTC
ATTCTGCTGAGCACTTGGTAGGCTCTTGGAATTTGAAAAATATGACTTTCTTTAATTCTG
AGAAATCCTTTTTGTTTTCTCTATTCTTTAATTCTGGAATTCCTACTTGGTAGATGTAGG
AACTTCAGAACCTTTCACCAATTCCAAACTTTTCTCACGTATTTGGCATTTTTTTGGTCC
TTTTGCAGGTTTTTGCAGGTCCTATGGTTTTATCTAACTTGCTAATTTTTTTTAAAGCTA
GTGTCCATTTTGCTATTCAGTGTATCTATTGACTTGAAAATTTCTGCAGTCATATATTTA
TTTCCCAAGAATCTCAAATAAAAAGAATTATTTTATACAACCATGTTGTAGGTTTGGGTG
CAATAGCCTTTCTTATCCTTCTGAGGATATTAATTATATTTCCTTTAAAGTCACCCCCAT
TAAGTCTGTTTATTTAGATGTTGGTTCTTTTTATTGAATTTGATACCCACACATATGGGG
TTGGTTTTCTTGAAGTGTTGGGTATTCTTGTGTGTTCTCATCTTTAGAGTTGAGAGTCCT
TACTTGCTGCTTGGTAGATAATGCTTCTCTTTACTAGACTCTGCCTTCTCTGATGGTGGA
GGAGAGCTGGAGTGTGCTGCTGGCATAGTGTTCAAAGGCTCACCTTCTGAATGTGGGGCC
TGTGTTCCTTTTGGGTGCTGACAGCCCAAGTGCTTCTCTATAGTCTACTCTCCATACATG
GTGTGTGGGCACAGGGGTGAATGCCGCTGATCTTTGGTGGTGGTGGTTGGTGGTGAGAGG
TTGTGGAAGGTGGAGAGGGAGGACATACTGAACTGTCACCACCAATTGCTCTGACACTTT
CCCCAGTGCTCCTTCCTGCTACCTTGCCTGACATCTCTGAGTTTTGTGTGTCCTTGACTT
GCTCTGACTTTTGCAACTGATATTTCCTCCATATAATCTCAGTTGTGGTTTCTCCCTCAA
TATGATTTTGTCAATGTTTGTTAGTTTTGGAAATTCTCAAAATTTCTGTCATTGCCATCC
ATTCTTGTTTTCTAGCATGGTTGTGAATTTATTCTTTTTAAAAATAGATTTTTCTGCTAT
TTTTAGGGAATTGAGGTGAATAGACAAATATAAAAGCATAGTCTGTCCTCATGAACTAAT
TCCCTACTTTTTTAATTAGAAAAAGTATACAGTTCTTTTAAACAGTCTTTATATTTTTTA
AATGTCCTAGACAAAAATAACCCAGTTCTGGATTTCAAGGCAAGATTTGCGTGGAATCCT
TCATTAATGGCTTCTGTCGGCATCTACATGAACCAATGAATGGATTCCAAATTACTATTG
TTACTGTCGTATTTATTAGGATATGGATTATTTTTATCTTCATAGTTATTAAAATATATT
ATTAATTACTTTTTTTAGGCGGTACCAGGGAACAAACCCAGGGCCTTGTAATGGGAAGCA
GGCGCTCAACCACTGGGCTACATCTGCTCCCCATTAATTACTTTTTATATGAGCACCTTC
TTCCCGCTCATGTTTCCATTCTAACAGTGATGCCAGTCACTTTGTGATTCGGCATCTCAC
GTAAGCCTCACAGAGGTCCTGTAGGGTGGTGGTCGTCATTCTCATGTTGAAGATGGGGAA
GCCGGTTCCTTGGCTTTAGCTTGCTGGTGGGGCTCAGGTAGGTAGGGGGGCTTGGATCTG
ATCTTCCAGCTCTCTGGCTCCAAATCAATCAATATACCATACTTTTATAGAAGATAACTT
GATCCACAGTCCTAATTATTAGCTCTGTGAGATGTGTTCATACACGAAAAAGTCAGGAAG
ATATGCAGTATGCATGAAAAATTAAATCTACATTGGAGGAATGGTGTGGTAAACATGTGA
GCTTGTGCTAGAGCCTTCTGTTATTGGATTTTTCTTTGTGTAAGAAGGAAGAGCTGGTAG
AAGTTCATCATTCCAAAACAAATTAAAGATCAATTTAGTGTCATTATCAACTATTAAAAA
CTTTTTTCCTTTATGCTATCTATATTTTAACACAATAAAAATTGTTTTAAAAAAAATTCC
TTTCCAACTGAAGGCACAGCAATCATTTATTTAAGGAAATTAATTTTCTGCTCTCTCCAG
GGTTTTTCTTGTTGAATAAACAGATAATAAATCAAGAAATACTGTACACAGCAGGCTTCT
AGCTCTGAACAGCTCAAAAATTCTTCTGACATCTTTGTTATAAAAGCATAGAAGAGTTAC
TTAATGACTGGACTTTAGGTAGAAAAATACTGCTGCTTTGATCTATAGAGATGATGAGTA
CATTGGCAAAAGCAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATTTAGCATTTATTTCTTTCCTCAGAGCTCTTCTCTGATATTTTATG
TTTAAACAGCAAGTTAGATATGCTATGATTATGTGGGCATTTGGGACAACCATCAGCAAA
AATAGCTCGTTCTGAAATTTTCTGACACTCACTGAAGATTACTCTAAAGTTTCTGAGTCA
GTTGGAATCCAGCACACCTTTGTCTCAAATATTCCTGAGAAAGTGTCATTTAGAATGGAC
CTAAAAGGTATAAACCTGGACATATAACAAAGACATCCTCCTGCAGAATGTGTAAGTGAG
GAAGACAAGTGGGGGTGTGGGGGGTGGGGGGTGGGATTTAGCCAGTAGCTGAAAGGTTGT
GCTTATGTTCACATTTTTTTCCCTTTTCTCCTTTAAATTAGCCCAGAGAGGCAGAGCAGG
TCCAGGTCACTGTGTCGGTGCTACCACCTTAGACCCTGTCCTTGGGCCCTGCAGCCCCAT
GGCCCAGACTAGGATGACAAGCAGAAAAACCAAGGAGGAAAGAGTATGTGTGACCTCAAG
TGTCCTTGTGCCAGGCCAGGAGCACACAGTGGGTGCTTTTTGTTTTTGTTTTTTAAGTCC
ACCTTTCCCCTGCACTCTGCTGATCAAAGAGCCACTGCTGACAGTTAACTGTGGCCATTT
AACCAAGTACATGTGTGGGCAATGGTGTGAGGGACGTATGCAAAGAAGCCGTTTTTCATT
TCTACATGAGTGCAGTAGGAGTGAGACAAATACATAGATCTTTTCTGGGCTCGTTGGATT
TGATCCCTTATAAATCAATTTGCTGAATGACCAGAGGGACAGAAAGTGGCATTGCCTCTG
TTAACAGCCAGAAGAAGGCAGTAGACATGTTCTGTTGAAGTGTTGGTGGAGGGTGGAGTT
TCCCTCACCACTGAGGGTGGTCAGCTCTAAGAAAACTGTCTCTACTTACTGGCTTTGTGT
GTTTTAGATGATGTCTCTGCATCTGCAAACTCTTCTCAGAGATTCAGTAATGGCAACTTG
CATTTGTACCCATCTAGTGCTCACTGACCTAAGGGCAGGGGATTGCATTTGTTCCCTGGT
CAGTTTCTCTTTCTCCTTCAATATTTTAAGACCTGGTGCCTTTATGTTGGCTTTGCTGTT
TATATTTGTCTTAAGAATCTAGACATATCTTTCTGATTTATAAATCCTGTTTCAGAGAAA
GTGTTTTCTAAAGCAAAAAGAAAAACCCAGTACCTCTTGAGAAAAATGCAATTAGAGTAA
ATTATTTTTAGGCTTTTATTCTTCATGTAGTAAAACAAACATATTGGAAAGACTTTCTGC
TATTTTTAAAAGTTTAGAAGCAAATTAGTCTTACCATACTGTGTACATTTAGGGTAACTC
TCTGATTTCATTTTTCTATTTCTGTGATCAAAGTGGAAAGGTTTACAGAGTAAGATTTAC
TCATCTGTAGTGGGGGAAACCCCAAACTCAAAAGAAATGGATAACAAAAGCAAAACCAAT
GACAACTACTACAACTGCTGACCCTTCAAGTAAACCAAGAATCATAGCAACCTCAAGGGT
GGCTCACCAGATCCTGACATGTATCTTTAAGCTGGGACTTTCTTCCTTTCTTTCATACAA
TATTCTGTTTGCATTTGGAAATTATTAATTCAGTTGCAGATAATGCAACAAATTAGCATT
ACCACAGATTAGAAACAAATTCACCCCATGGAGTGAGATGTTCAAATACCATTGATGATT
TGAGTCTATGCTCAAACAACCATATATACTTAATAATATTTCTTATTTATTTGAGGCTTT
TCTGAATGAAAACAGACTTTAAAAAAGTACTGTTGCCAGGGAACCCCCAATCATGTAGGG
AAAACACTGATGCAGTTGACAAGATTCAGTGTTATTGTTGATTGCCCAGTTGTTAGCCTA
GTTGATGTCCTTCATAATATCACCACTAGCACAGTGGTTTCCTTATACTGAATACCTACT
CAGTCACTCCTTTCAGACCTCAGAGGTGGTGAATGGTGCAGGGAGGACCCAAGTCTCAAT
GACCACAAAGCCTGTGTTCTCGTTCTTGGATTTGGACCTAATTCTTTTGTCATTACAGAA
AATGAATATGTAATACAAATTATGTAAACAGTATGAACTTAGGCATTGTAAATGTCCAGG
AAAAATAAAGAGGGGAGAACAATTTTTTGAATATGTCATAAAGATCAACACCTGTTTGAT
ACAGGATATTTAGATCCTGAAGATGTTCATGACCTCAGAGTCATGAATTAAAAGTTTTAA
GTAATAATTTTAGTATTTTTTTGAAGCAGTCTTCATTCTATATAAAACAGTTATTACATT
TTTCTGTATCTGTTTTTATTTCCCTGAAATTACTCTTTTTGGATTATTTATATTTTGAAT
AATTTTTAAAAGTGATTTAATATATGATTCCATCTTCCAACATATATTGAAATGTCAATT
ATTATAGCTTCTGTTAATGAAGTTGTTATTTCTACAACATCTAAACTTCTTGGTCAAATA
ATGGCATGATTGAAATTTTACCAAGAAGATCAAATTCTTCCATTAATTGTTAGCCATTGG
CAGTTTCATGTTGATTATTTCTACTAAACCTAATTTCCTAGTTTAACTTTGTAGTTATCA
TTGCCATTATCAAGAGAACATGTGTGATTTAAGCTATCATAAATTTTGTTTTATATTACT
TATTCTTACATTTAAGAACGAATAAAAACCTGGTAGTTCTTATTTCTTTTTGAGTCACCC
ATGAGAAAAATATGATTAATTCCTCTCAGTCTGTGATTTATCCTTTGTCAAAGTCCCATG
CCAGCTGCAAACTCTTTCAACTCTAACACATTTCAAGTGGCTTTGAGACAACTTTTCCTG
TCAAATACATTGATCTTGTTATTGATGTGTTTGGGATCAGATCTTATAGATCCTGTTAAT
GAATTTCCATAATACAGGGTGCATTATTTCAGATTCCATTTGAATGTGATATATGTATCT
ATAACCAAATTGTAGATAATTACTATTGATTAATACTTCTTTTTGGGACCAGACCTGTGG
AGGTAAGAAAAAAAAATTTTTTTCTGAACCAATTTTAAAGAGGTTGTCATTTTTCTAATA
TATTAGCTACTAAGGTAGTCAGTGAGGCCCTAGTTTACAAGTGGAGTGAAGGCAAATGAC
ACAGTTATCCATGAACAAAATACTTGTTATTAGGTGCGCTGTTAACATTTTCTTCTCCAA
TTTTCACTGGATTGAAAAAATCTGAAAATTTTAATCTCAGGGAAAAATCGAACAGATTGA
ATTAATGCCATTTGTTAAGACTATGGACATTGATGTCAATGTGACGTTTTGTGTAAACTT
TTTGGCTTTAAACATACATCAATAGATTGGAGAAAATTGTAATGATCTTGCAAAAGAAAA
TACCTAAATCCTTGCCAAAAGAGCTGACTTTTGTTTTAAATGTTCTGTGAAGGAAAAATC
TTTTCCTTTGATTGCTGCAGTAAGTATAAAGACTATTGGCCAGACCCAAACAAAATAAAT
ATTTCTCATATTTACAAGGCTGAAAATATTCTTGAACCTCAGTTTACATCAACACTGTTA
GTTTTGCTGGTTCTGGAAGAAGTACCTATAGTTTTACATCACTTTTTGTCATCTCATCTG
CCTTTAGTTGTATGTGGATGTATGTACAATTCCTAAATCTGAATTAAGAATGCTGTCTCA
AGCCTTACAAGCATCAGTTGTAGGAACATGAATTTTGGCAACAATGCTTCCATGAAGATG
CTCCTTTTCTCATCCGTAGAGCCAGTCTTTTCATGGCGATGTGAAGACTGGCTTTTCAGG
TGTGAGACATACTAAAATTGATACTTCCCTTATCATTTATTTTTGAAAAACAGAATAAGT
GGTCATTATAAGATAATTTTCTGCAATTATATTTGATACCCTCATTGTTGCATATTTTTG
CTTCTTATTCAAAAACAAAATATGAACAGTTTTGGAGAATTATTTCTGTAATTGAATTTA
CTAGTCCAATTTGCTTCCTATGTGCTATCTGTACACGTTGTTGGCAGCTCAAAATCCATT
AGTTAGTAAAAGATAAAGGATTTGGGCACAGGAAAAGAGCAGGTTATCTCCGAGGGTCAA
AGTTGTGAGGTCAAAACTTCCCATTTCATTGCCAAATATAGTGTAAATTTTATTGTTGGG
CCCAGACAGAGTCATCCTGAAATTGGAATAGCTGAAAAGTTCAAAATGTATTGAACAAAA
ACTGAGTAAGTTTATTATACTGACAGGTTAATTATTATTTTTGTTTTTTTCTGAAAAAAG
TTTCCTACTTTCTTTTTGAGATCCATCATGCTTATAACACACACACACACATACATACAC
ACACAGTGGGAATATGTTCTAAATGTAAGCACATAAGTATTTGTTGATTTGTTGCAACTT
CCTTTACTACCATCTTTATGGATGCATCTGTTCTGCAGAGAGAATGCCTGCATACAAACA
AGAGAAATTTAACTAAACTTTACAGGATTCCAGTTTTAAAGAGCAATTTGTAAGCAGCTT
CTGAGATGTGATTCTTATTTCTCTATGAAGCCATTCTTATTTTTAGTTTCAATTATGCCG
TCTAAATCAGAGTGTTTTTACTATGCTCCCAAATGGCTTGGATTCTTGCAAAAATGTAGC
TGGCTTTGCTTTGACAAGGCACAGCAGGTTTGCAGGTTGGGAGGGTAGAGTTGGGAAATC
CCTTTGGCAAGGCACTTGGGCAAGCTGCCCGGTCTCCAATGGCCAGTGCTGATCCTATCC
ACAGGTCAGATGGCTATTGCCCAGTGGCTGTCTGATGCTGCCCATTCTCATTGGGGTGCA
CTCCCACTCATTTTATATTATATAGAGATACAGTTCACCCTATTTGGAATGATCTGCTGT
AACAGAGGGTGTGTTTCTCCTGGTTTGAGTTTTATCATTTATAATCACAAATTTACTGCC
CTCTATTTGGCACTTGCTGCATATGTTGTATCATTTAATCCTCATAGCATCCTGCAAGGT
AGACAGTATTGATCACTCCATTTTACAGATGAGGAGACTGTTATTTAGAGAGAACAGTTC
ATATTGGAAGCCCAGATTTTGTCATAGAATGGTGACTGATATTACATCTTTTCTGAAAAA
TAAAAGATAACTGCTCATGATGATTGTTGTAGAGAGAGTTGCAAGTATTTAAAATGATCA
CTTCTTAAAATTTAGAACTACCATCCTTTCCTCTACCCTCTGGTTTTCAAACTTACAAAC
ACAGACATGCTTGTGGTAGTACAGGGTTTCTGAGACTCTGTCTTCCATCATGGGTGCATA
TTTGAGTTGTGTAATGTCTCAACAGGATTGTAATGGGAGGCAATTTTCTTCTGGATAGTA
ACATGTTTTTCCCATTACTTTGGGGGGACATTTTTAATTTTGGAAAAATATAAGTTGGTC
AATGTTGTGATGCTCCAGAATGAACTTTTAGTGATGGAGCTCAGCAGAAACATTGCAAGG
TGAGAGCAAGAGTCCCAAGAGAAAATGATGTTAAAATGATGACCAGTTTGTATGAGGAGC
AAAACATTTGGAAAGGAATTGTAGTTTATGTTTTTGTTTCTTTTTTTAGAATTGCAAAAC
AAAACCTTTTTCTCTTTTATTGTGCTCCATTATTTTGACCAGACTTTGGTGCAAAAATTA
CGAGAAAAACAAACTTGAATGGTTTCCCAGTACTACTTATTTCCCTCCATTTTCCTCTCA
CCTAATTTCCACCTCCTGACTATGGTCTCCCACCATGCATTTACAGAGACTTTTTTTTTG
GCAGACGGTTGAATAAGAGAAGAGGATAGTCTCTGGATTTGTGCCTACTCCAACATTTGA
ATTTTTAAAATTATTACTTTAATAATAAAGACATAAATATAGATAAAATCATGGTTGTTG
TCTTGGTTTCCCAGGGCTGTCATAACAAAATCCCACAAATTGGATAGCTTAAAACAACAG
AAATTTATTGTCTCAGATCTGGAGGCTAGAAGTCCAAAATCAAGGTGTCGGAAGGGTCAT
GCTCCCTCTGAAGTCTCGGGAAGGTTCTGCTTCATGCCTCTCTCCTGGCTTCTGGAGGTG
GCTGGAAATCTTGGGCATTACTTGCAGCATAACTCATTCTCTGCCTCAATGATCACGTGG
CCATCTTCTTTTTCCTCTGTCTGGGTCTCCTCGTCCTATGAGAACACCAGCCATATTGGC
TTAAGATCCCACCCTGCATCTGTATGACCTCATTTTAACGTGCCTAATGTGATCTGTAAC
AACCCTATTTCCAAATAAGGTTACATTCTTAGGTACCGGAGATTAGGACTTCAGCATATG
TTTTTGGGGAACATATTTCAGCACTTAACAGTTGCAAAAGCAATCTGCAAATCGCTGTTC
AGATATAATTTCACAGCAACTCTAAGTTGACGGAAAGGCTGATGTACTTCTTAATTCAAA
TGTCAGTAAGCTGATGTTTTGAGAGATTGATGCTCTGCTCACAGACCCCTTGAGGGGTGG
AGCTTGGATAAGTACTCAGGTCATGTAATGTTCAGTGAGGTCTTTTTCAGTTCACTGTGT
TGCTTTCCCGTTTAAACTAAGTTTTTATCAAAAGTATGAAAGGCCATATAATGCATCCTA
TTTGAGGTAATTTTAACAAGGTCTCTTTTCGCCACAATATAAACCCTGTTAAGAGGTTTG
ACCTAGATGAAAACCATTAGTGGCTAAATGGAAACTTGGTGCTTTGTGTCATTACCAAAG
AAAGGAAAAATGTCCTTAGAAAAACAGTCACCAGTGTGGTCACTGAGAGTATTTAGACCA
CCTTATATTGAATTGTAACCACTGCAGACATTTTTAGACATTATAAAATCATTTGTTTTA
TTTTCAAAAAATAACAAGATTTCCAGTAGAAAAGCTATTTATTTAACATGTCCATTAATT
CATTTAACAGGTATTTATTGGGTACCTACTATGTGCTAGCACATTTTTAGATTCTAGGGA
AAAAGCAATGACAAACTAGATGAAAATCTGTTTTTATGGAGCTTCCATCCATTTGGGAGA
AGACAGACAGATAGACAATAAATAAATAAATAGTATGTTAGCAGTAATGATTAGGGAGAA
ATGTGAAGTATGACATGAAGTATAGAAGAGTTCTTGGAATTTTAGATCACTTGGTCAAGG
AAGGCCTTCCTGAGAAGCTGACTTTTGAGTAAAGACCTAAAGGACATGAGGGAACAAGCT
GTGTGGGAACCGGGGAAGAGCTTTTCCAGAGGGAGCAATAAGTATAAATGCCTGAGCTTA
TAGGTGTCAGGTAGTTCAAGAAATAGCCAGAAGGCCATGTGGACTGGAGAAGATTAGAAG
GATGGTAAGAAAAGAGGTTTGAGAGGGGAAAGGGGGACTGATCATTGGAGGAGGGCACTG
TAGACCATCATAAAGACTTTTACTTTTACTGTGAGTGAAATGAGAGCTAAGTGGGGTTAT
GTTGCTGAGGAGTGATGTGGTCTAATTTATAAGAACTATATCACTCTGGATTCTGTTTTG
AGAGGAGACAGCTATAGGCATCAGTAATCTAGAACAAGATGACAGCAGTATAGAGAGTGA
AAAGTGCTAGGATTCTGGATATAATTTGAAGGTAGAGACATCAGGATTTCTGGAATGATT
GGGTGTGAGGTATAAGAGAAGGACAGGAGTTAAAGACTACGTAGAGGTTTTTGGTCTAGA
TCCAACTGAAGGACAGAATGGCAATCAACTAGGTTAGTGAGGGTTGCAGCCCGCAGGAGT
GTGGGAAGATCAGCAGTCCATCATTGTCTTTGGAATGTGCTCCATGTATCCATCTGGAGA
TGCTGAATAAGTAGTTGAATATAAGAGTCTGGATCAAGGGAGAGGTCTGACCATTTGGGA
GTCTTCTGTGTTTGGGAATCAAAAGAGACTTGGTGTTTAAAACCAAGTGAAATGTCCAAG
GGATTAAGCATAAGTGAAGATGAAGAAAAGAAGACCAAGGAGAAGAGTGAAGAGCCAGCA
AAGGGGATCAAGAAGCAGCTACCAGTGAGGTAGGATAAATCAACATTTTGTGTATTATTT
GATTAATTCCTGTTTCTATATTTCTTGTTTTGATGAACCAAAGGTCAGTAAAGGACTATA
AGAAAATGTGACCAGTGGGGTGGGGGAAAATGAAGAGAATGTTCATAAGTGACAGGACTT
TAACTAAAACGAACCTTAAAATTATGTTAGCAGAACTAATTTAGCATGGGGAAGCAATAA
CAATTTCATTCTTTTTCCAACCTTTGCCACCGAAGATGTACCATTTCTAATTACTTTGTA
TTTGACTTGGGATTAAAAGATGATTTAGGGTAGGGTATCCTGGAGACCAGGCAAACATTA
CCCACTCCTTCACTTTTCAGTGAATTAGGTCCACTCCCTTCAGGTTGTTTTCATATGCTT
TGGGGAAAGGATTTGTTAAGTTTTCTCTCTAATTTGATCCCCATTTACATACTTTTATCC
AGATTCTTGAGAGTAAGAGGGCTTTTTTTGGCATTTTGGTGGAGGGTCAAGACTGGTCAT
CATGGCCATTTATCCATTTATTTAACAAACTTCTCGGGATACATGTAAAAATGAGTACAC
TCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTGATTTTCTTTTTCAAAGAAAACATA
AGCATGGTGAAATCTAGTGAGAGAAGTAGAGTCTATCAATGTGGAGTATATTGGGAGCAT
GCATAAGATACAATATGAGATTAAAAAGGAGATACAATAAGAAATGTAATGTATATGGAA
ACATTTCTGCAAATTGAAGGCATGATCTGATTTTTTTCTTGCAAATTTATTTGCAAGAAT
AGTTTACAAGCTTGCTTCTTTGTAGTGTGTTGATCAAGTTATGTGTTAGGGACTTTTCTG
TCCAACCCTAGCCCCTAGTGTCCAAGGACTCTGCGAATGTGCTTTTTGCCAGATGCCTAA
CCCTTGCCAAAGCATGACGATGGTACAGATGAGGTGGCTGGGACACGGAAATGGATGCAG
TCTCGGTCCCCAGGGGACTGTGTCTAAAGTGTCCCCTAAGCCCAAGAGATTCCCTGCAAA
GTGGCCCTGGTGGAATGCAGGGCTTCTGAAAGGAGCTTGAAAGTGCAGCTGGGAGTGAAA
CGTGGCCTGGATGGTGGTTGCCCAGCCTCAGGCCGGCCTCACGCTGAGCCCTGTCTGCAG
AGCAGCCATCTGCTGCAGCTTTCATGAATGAATCTCTCTTGGTTTTGGTGTTTTGGTTTT
TTTTCTTTTTGACAGAACAATAGCTTCCATGCTGTGCTCTGCATTCTGATGAACTGAATC
CTTTGCTCGCACTCAGCTGTGTGTGTAGGGATGAGGAGAGTCATCAGAGAAGGAGGAAGA
GATGGTGTGTGCCTGAGTCTTCTCAGGCAGGGAGATGGGGGCTGTTGTTGAGAAAATTAA
TGTTTTAAGTTTATTTTTGATTGGACTGCAAAATCAACTTTCCCTTTGGGTATGTGTATA
ATTGGGCTGTTTCTCTTTCCTCTACATTGTGCATATCTGTTGTTTCCCATTCTATAGCTT
ATTTTCCATAAACCCTGAAGGATTCACTTCTCTCAAGAAATACTATAAAGTACAGATCCA
TGCAATAAAATATTTAAGAGGATTTCTTTCTTTTTAAGTCACCCGCCTTTAACTTGAGTT
GATTAACCCCCTTCTGTTCCTCCTGCCTTGGCTGGTGCCTTGAAATCCATTTGGCTGTCT
TTAATGCTGAAGGGAAACTTCAGCAACGAACGTCAAAATGTCTTTTCCCCATAGTGTTCA
TTAAACTAGAGGCAGTTTCTTAATTACAAAGGCAAGAAAGAAGCACCCCGAAAGACTAAT
CAAAAACTTTGCCAGGAGAGGATTGATCTGGTCTTGGTTTAATCATTCTTGGAAACAGAG
AAAATCCTATTTTGCCCGTCAATAATGGTCCCGTGTTGTAACCTTTAGCCTGACAGAACT
GAAGTAGAAGTCAGTTTGCGTGAAATTTCTGAAGATTGCTTATTGGACTCTAATTTTCAA
GAAAAAAAATATTTCAAGTACGATTTACTCAGAACCTTTACATATAAACCAGACACAATT
GCAGCTGCTCTGTTTGAGGTGGAGAGAAGTGGGAGGGAAGGAGAAAATCGCCCCTCTGCA
CCAGCAGGATAGTTTGTGGAGCCCAGTCATTGAGGATGTTTATTGGTTTTGGGATAGGAT
TCTGTTGAAACTGTAGTAGAGAGTAGTTATTATTTATTTGTATTATTATTATTATGCCTT
TTAGCAGAAAGGCTATTTTATAACCTTCACTGAGAACCTTTCCTCTCTCATCAATTTGAG
CTATATTAGGCATATTGTTGGGTCATCTTGTTGTGTCAGCTCTCTGTGTGTGCGGTGCCA
TTCTTGGGCAGGCTGCACTTGCTTTCGTGCTGGGCGTCTCTCCTTAACGGGGTGCACTCA
TTGCGCATGGGGCTACCCTATGTGGCAGACACCCCTGCATGACAGGGCAATCCTTGTGCA
CATCAGCACTGCACATGGGCCAGCTCCACACAGGTCAAGGAAGCCTGGGGTTTGAACCGC
GGACCTCCCATGTGGTAAGGCAGACACCCTATCCATTGGGCCAAGTCTGCTTCCCCCCAT
GACAACTTTAATCCACACTTTGCTTTCACATGGTCTGGTGGTATCATACCACAGGCTGAG
ACTTTCTGTGTGTCAGTTTCGCATCTATGTACATTGTTAAATATGTCAGAAATATAATGA
TGATCCCAAGGTATTCTTACTCATTTAATAGTAAAATATGCTCAGTAAAAAATTGGAAAT
GTTAAGCATATTTTATTTTATTGAAATCTTTGAAAATATTAAGTCATCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATACT
CAGGCATAGTCTTTGCACATAGACTCAGGGACACTTTCTGGAGTGCAGGATTGTATTGCT
TCTGGCTTCAAGATCCTGAGAGGAGGCTTGATGCTCCAAAGTTAAGAATAATGGATGAAA
CTCCCAAGTTTCTAAGGCTGTTTCAAGAATTTCCCCACCTTCCCACTTCACTAGAGACCC
CAGGTAGAAAGAAAGAGGCTAGAATAATCAGGAACTAGAAGGATTTAGAGAACCACAGGG
ACAGTGTTAGGACTTGTGCTCAGTGAAATTTTGCTTGCCTCCAGTGTTAACCCCTTTGTC
CATTCCAAGCCGTCCCTGGCTCAGCTGCTGCATTTGTTACTTTGCTCAGTTGAAAGTTTG
ATATCTGAGCTCAAGTGTGTAACTCTGCAGGTACCCAGCACTGCCCGAGGGTGGTCTAAG
GTAATAAAACCAGACCTAGCATAGAATTAGTGACTGAAAAGCATATGTGCTGGCATTTTA
TAATTATGGAAGTTATCTGTCAATGCAATAATCTTTAAGAGATGGCATGAAGGACCAAAA
CTGTGCCTACTTAAACCAGTGAGCTGTGGGAAGAGCCCACTTGGGAGAGCTTAAAGTATA
AGCAGCTTTACAGGAATATCAGGAACCTCCAACCACAGTTGACTAGAGTTCCTGCTTTCA
AGTCCACTGTCACTGGTCCTTGCGTGTCTATGGTTGACATCTCAGGGTAGATCACAGATG
CCTCTCCTTCAGTTCTCAACTAGGTATTAGCTTCAAAATGGCAGGTGTTTCCCTGGCAAA
CAAAATGGAGCATCTCAAGCTCTTTGTCTCCTGTCAGTGACTGGCATGAGTGCACCACCC
TTCCTGACACTGGAGACTTGGGGTACTGTGGACATCAGGCTTTCCCAGGAGGTGAGCAAG
CGCTGGTCTTTTTGCCTTGCCCAGCTGGAGAGAATGTCTATGGGGTCGTGCAGTGCGATG
GTCTTGTGTCTTTTGATGTGCTGCTGGGTTGTCTTGTGCAGTGAAGGATTCTGGCTCCTC
CATTGTGGATGTGAAACTGTGATTAAACCCTCAATGAGCATTCCTTTACTAGGCAACAGG
CAAACTGTGTCTGGAATCTAGTCAGTTCATTGATAAAAACTCAAGGTTGAAAGCATGACT
GTTCCTTTGTCTAAGTGCATCCAGGCCCTCATTAACGGGCTACTGCCAAGCTTAGCCATC
CCTTGCAGCCGCTGACTAATCAGAGCCATTGCAGAGGCCATTTTAGAGCACCTACAAGTG
AGGCTTTTAATGTCTCCTTCGAAAATTTCAGGATGTGCCAAATGTCACTGAGGCCTCTGT
TGATAGGCTAGAATTTCAACAGAGGCTGTGAAAGGTAGAGATTTCAGTTGATCTTGGGGA
GAGTAGGGAACTGCCATCCTTAATAGGGCACACATTGTTAGTATTTTCTTCAAACAATTA
TCTAACTTCAAAGCCAGGCATTTGTCATAACTCTTACCATCAAAATGAAAAGCTTTCTGA
AAAGGGAAAGAGGATGAATGAGGACACCTGTTTCCCCACTCTTGTCCATGGGGCAGTATT
ATTCTCTGCAGTGAGGGCTTCCTTCTTGGCACCAATTAGGGTGGTTTTTCTTTAGAGATA
GGCGTGGTGAGCAGCTCTCTGCACCACTCAGGTGTCATAACTGATTTATGATTCTGCCTC
TTCATGTAGGATGTCATTGTTTTTTTTCCCATTATTCTCCAGGCTTATTTCTAGATTTAA
AAAATGAGCATTTATCTAAGGAAAGAATTACCCATGTGTATATTTTAATATTTCTTGGAT
CTAACTTCTTTATGGCCACTCTTCATCTCACATAGCAATACCTTTGTCACATTCAGTTAC
CAGAGGTTAGTGAGACTAAAGCTAATACCACACAGGAGCTCTGTGCTTTGGAAAAAGCCA
CAAGAATTAAAGGAAGAAAGAGAGCACCAAAGCATAAAGCATCATAGTGGCACTTAAATA
TGAATTAGAATTTCCAAAATGGGTTCTACCAAGTATCCCAGACAGCTTGAATTTTAGTTA
AGAAGTGTGATAGAAACTTTCACAAAAATAGTCTTGTATCATCCACTACCTCTTTGGACT
GTTTTCTGAGGTATCTAAACGTTTGAGTGGCTAGTTGAAATTTTATATGTAGTGCTGTGA
ATTTTTACTGCTACTATTAAAATATCTCTTTATGCCATTTAAAGAGGAACACTTAGGTTT
TTTTTTCCCTCTTTCTCTCACTTTGTAGAGAGCGCTTAGTGAACGACAAAGATCTTCAGT
GAAAAACCATAGTAAAATATGCAGTCATTTAGTAGAACCCTACATTTTTGAGAATTTCTG
AATCCCTAAATAACTTGTTCCATGGCTGTGGAATTCATACCCTGGAGAGGTAGTTTGGTG
CAATCAGTGGTGGACTTCTTGGTTGAAATCTGGATTTCTCCACTTGGGTAAATCACTTAA
ACTATTTGTACATCCAGTTATTCATCCATAAAATCAGGGTATTTGTTGGGCTGTTAGAAG
GTTTATTGAGCTGAGCATGAAGAACAGTGCAAGGCACATTGTACGTATCATGTGAGTGTT
TGCTATTTCCTGGCATTCTAAGTCCCTGGCTTGGGCACAGTCCTGCTCACTGAGCAGGAT
GGGAAATTGCAAGTAAGGAAGCAGAAGAGGGCCTCCGGTTCCTTATTATGGCTGGGTTTG
AGAGCTGAGTACCCTGCTCTTTAAGCACACTTCATCAAAACGCTGTCCTCTGGGGCTCAG
GGCTTGTAAGTGAGACTTCCATTTAACAAAGGCTTTTTGACTCTTTGTTGACTAAATCTC
TGCCTTTGGGGCCTAAGACAAAGTTTCCCCATGCTCAGGATTGTTCTACAACAAAGACAT
TTTTGTCTAAGTTCAGCGTGTCATATTGAGGGAAGAAAACAATTTGAGCATCAGAAATGG
ACATACCTTGCTATACTTGAGAAGTAGGAAAAAGAAATAAAATGTATTTTTACATAAATA
TAAAAATAAGAGTCAACAAACAAACTTTTGGCTAAGTAATCCATGCTACATGGAAAGGAA
AGAACGAAAGCATTTGGAATTCCTCTCTTTTACACACAGGTGAAGAATAGTCTATGTACC
AAGAGATTTCTAAGAGACACTATGTATTAGCATAGATTCAAAGTGCATATAGAACCTGAC
ATACATAATTGCCTATATAATACTTATAAACTGAAACAATTATTTTTGATCACCTACTAT
GTGCTAGATGAATTCATGTTTCCTCTTAATGAATATCCTTCACAGTAGTATGAGTAATGT
ATTACCATCTTCCTTTTGAAAGAGAGGAAACCTGAGGTTGCGAGAGATGTTTAAGGTCAT
ATACAGCTGTTATGGGTTGAATTACGTCCCCCCAAGAGGTACATTGAAGTCCTAATCTCC
AGTTCCTCAGAATGTGGCCTTATTTGGAAATAGGGCCATTGCAGATGGAATTAGGCAAGT
TAAAACGAGGATATAGTGGAGTAGAGTGGGTCCTTAATCCCAATGACTCATGTCCTTTGC
CAGCAAGCCAACACCAGAGTCCAGGAGAGGGGCATGGAACAGATTCTTCCCTACAGACTT
AAGAGAAAGCACTGCCCTGCCACTACCTTGATTTCAGATGTCTCAACTCCAGAACTGAGA
TAAAACATTTCTGTTGGCTTAAGCCATTTGGTTTATGGAAATTAAGACTATAGCTAATAA
CTGATGAGGCAGCCTTCAAATCAAGGACTCCTAGCTTTGAGGCCACAGTTTCCACTATAA
TCCTGTTGTAGGTGGGATGACAAATATTAGTATTATCTGTATTTGTTTCTCTTTTTCTAC
CTGTGCATTCCTAGATGTGTGGATTCAGACACTGCCACTATCTTCAGTATAATTTAAGCA
GTTCAGAAGCCCCATTTTTCCCTTGAGGATAGTATTTTTAAATGTCCTTATTTGTGCAGA
AACATATACCTCTCCGATTCTCACTGCCCAATTACTTAACATTGCCACCTGACATGATAG
TTACAGACTGGATTGAATATATTATAGGCTCATCAGCCATTGCTTACTTCAAAAGATCAG
TGAGAGAATGGTAATATTGCAAGTTATAATATATTTCAGGTTAAAATAAGATATCTGATT
ACATCTGCTTTCTTAGTCCCAACACGACATAAGGAAAACTAAAATTGATCTGTCCTGATA
TCATGGATCTCATGCAGAAAGGGGAAAGGCAGAGCAAGAAAGCATTCCCTCTATAGGATT
TCTGCCAAGAAGGTGGATGGGGTGTGAATGAAATGTCTTTTGTCTAGGAAAGAAAAGTTA
TATGTCACCTAAGCCTTAATGGAGAAAGAACAAATTATTAATGTGGGTATGAGAGAGCTG
ATCAGGGGAGAAGGGAGAGGGGTGATGGAGTGCTTTAGAGCAGATTGCGTTCTTTGTTTC
TCACTTCTGCATAGTTGCAGGAAAGTTGCATTCTTTCATTTACCAGGTTGTTTGCATCTG
GGATCTGTTCCTTGGTCTCATGTAAGAGCTCAGGGGGAGAGTCGTGTGCATTGTGATAAC
CTGCTGTGAGTCACTCATCTTTGACTAGCTTGATACCACCTAACATGGCATTACAACATC
TGCTTTGGGTCTACATCAGTGAAAACTAAAACAATGGAAAGAGAATCAAATGGAGAATCA
GAATGTGTTATATTTCTTTAGATGGACTGCAAATTTCCCTCAGGTCTAGTGTGTTTTCTT
TATTTGTCCTGTAAACCCAAGCAGTTGTTCATTTATAATGGGAAACCTTAGAAAGAATGC
CATGAAAAACCTGGAAATGAGACTACTGGGTGTCCATGAATGGTTAACTACAGAATCTCT
AGCAGATTCAATTATTCTGACAACATTTTCATTGTGCTTTATCACTGAAACTATTCAGAA
AGCCAGAACAATTGCAGGCAGGACACCAAGACTCTGGTCATCTCCACAGGATGAGAACAT
TTAATAAAACCAAATGGAAAACATGTGATCCCTTCCTTCACAGCTGACTCTCGGGCAGGC
GAACAAAGGACTGATTAATAGAAGAGACCTCAGCCTCAAGCTCTGGAGTCTGTTGGTTGG
GTCTAGACAGGAAGTGGTTTCCAGGGCTTCTCTATTAGGGCTCTTCCTTCCCCACTCCTC
CTCTCAGTTGCCTTTTGTGCTTAGTTCACAGGAGGCCGTCTCACAGTGTTTCCTGGAGGA
CACGGCTGCCATTTTCTCGGAGCCCACTATCAGTTTCTTTAATCTAAATACTAGTACCTT
CTGAAGTTTCATGTTAGGCATACATTCCAACATATAAATATATGTTTCCACTGTAAAATG
AGAAATTTCTTTCCAGTATTAACCACACTAATGCATGACATATCTCATTTTCCTTAATTC
TAATTCAACAAAACCAAGTCAGTAGCCATTCTTTGCATTTTTATGTCTAGCCTGTAATGC
CTATCCTATAAATTTTAGATAAGTTTATGTGGAGAAAAGTCTTAGAGTAAAATAAAGCAG
TCTTTGCAGAAAACAGTGAGAATCAAGGAAATGCCCCAAAGAGATTGTTATTCGTGTGTG
TGAGGACTATTGAGGTACGGTAGTTACATTTCTAATATCTGAATGTTTACTGACTCTCAT
ATTACAGATTCAATCTTTCCGTTTCCATTTAGAGGTTTGGGATCCTCAAGACATAAGATT
TCTTTCAAAATCAGGATCAATCCATTGCCAGCCTACGTGTAATCAAATATAAGAGGTGAA
ACAGGCAGGGACCTTGCTTTCCCATCCTGTCTCCTCATTTCCATCCTCAGTGCTTGGATG
AGGAAGCAGCACTACTCATAAAATATTCCCCCAGTATTTTAATATGGAGGACCCAAACAC
CAGGCTTAATGTTTTGTACGACAATGAGAATTATTGATCTTTTTCTCTTCGTTTATTAAA
ATTCTATAGATCCTTTAGCATTTTGAAATGACCCTTGCCTTGCTTTTTAAAAAAATGCAG
GTCCTTGAACACCATCACACACACAAATGGACAAAAGGTTTTAAGATCCATTCTCTTTGA
TGTAAAACCAAGGGGTCTTGTATAATCATCTGCATATCCTGGAGAGCAGATGCTGCTCTC
TTTCTAAGCAAACAAAGCTCGGCTGGAAAGGACAGCAACGCAGGGACGATGTTAACGCCC
ACCATTCCTCTTCTGTGACAGAGACCGGACTTCCCCAAGGGCCTGCCAGCTCATGTCAGC
TGTAAGACATAGGGTGTTCGTGAATGATCAAAGAGGAAAGCATCTTCCCTATATAATATG
CTGGGGAGAAACATTGAAGAATGAGACTCCAGGTCAGCCTGCGGTATTCCTTAATTGTGA
TGGCTGCTCTCCCCACTTTTCAGAATATTGGAAAGCTCTGCCTTATGGGTGGAAAGCACA
GTAGGTGACAGTATGTGCTTGAAATCAGGAGACACCTGGGGGTAAAGCCTGACTCCACCA
TGTCTCAACTATGTGATCTGGGCAAGTTTATTAACCTCTCTAAGCCTCAGTTTCCTTATG
CAGTGGTATGCTAATAAATTGGATCTTCACATGGGTGTGAGGGGGTGGAGCTCTGATTTG
TAGAATTTGCCAATTTCCATGGTGTGTCTACTTCTACTGTTGCTGATTTCAATCTGCCAA
CAGCTGTGATTCGAAAAATTCCTGATTATTTAACAATAGGCATATTAGCGCACTCAAGCA
CATCATTGCTAATCTGTAAAATGGTGTCTTAGTTTGTCAGAGCTGCTATGACAAATACCA
CAAATGCATTGGCTTAATAACAGGATTTTATTGGCTCATAGTTTGGGAGACTGGAAGTCT
AAAATCAAGGCCTTAGTAAAGCCATGCTTTCTCCCTGGAGTCTCTAGCATACTAGTGCTG
GCTTGCCACAGTCTTTGGGGCATCTCTTCCTCCCACCATGTGGCAATCTCTGTCTGCTCT
TCTAGTTTCTGGCTTCTTCCCGTGCCTTTCTCAGGTTTCTTGCTTCTCTGTATAAGGCCC
ACTCTGATGCAGTTTGGCTACACCTAAATAGGATATTTATCTAATAAAACATCTTCAAAA
GAGTCCTATTTGCAAACGGATTAGGATTAAGATTAAGAACATGTCTTTTGTTGGGGGTAC
GTGATTAACTCTACCACAAATGGGCAAAACAGAAATTATCTCATGGGGCTGTGTAAGAAT
TAATGAGACAATGTGTGCAAAGTCCTCAGCATGCTAAGTTCTAACATAGCAAAGATTAGT
GAATAGTGACTATTTTCATTGTTTTCTGGCTGCATACCACTTTTAAGAAATCTTTACACT
AGGGATTCTCACTCTAGGTTCAGGTTATCACATGCCACAAAAATGTTGTGAATTAAAAAA
CACGTTCTGAAGATAAAATTAATCATAATTTATTTTAATTCTTAAAGGCAATCAGTGTGT
ACTAGAGGGATAGGAGGTATTTTTTAACATGTGAAAATATACTTTTCCAAAGAAACTGTT
AATTGATGCATTTTAAATTCCTACAGTCTTTCTAGATATTTTTTTATGAATCTGATCTTT
GTGCTAAATCTCGAGCTTTTTATTTTCAGTTTCTCATCCTGTTCCTGTTTTAATCATTTT
ACTGATAAACCTCACTTTGGTTGCATATAAACTTGCTTTTAATTGCTGCTGTTTTCACTT
TTAGCAGTGGTCGCTCACACTCTTCTTACTCAGCGATCACATCCCTAACCTTCCGGTCAC
GTTTGCTTATTAGTAATTTAGCTATCTAGCTTAAAATTTCATTCTCATATCTCATTCAGA
GCTTACTCCCTCCTCCAGTGCACCCTCCATTTGTGCAAGGGGCTTTGGGGTGAGAGAAGG
GCCTGGATATGTTATTTACATACCTGACCTCTCTCTGTTCTAGGCGAGTTCCAGTGCTGG
GTTAAGAAGGGGATGTTTAGAAAGGGTAATGCTCCATCGTGGAACTGCGTTAAGTTACGT
TCTCATTCTCTCCTTTTGCTGTTTCTTGGGCTGATAGTAACTGGTCATTGATGAGGTCTC
CCAGTGTTCCGCATTCAGATGTACTTGCTCCTGGAGAGTACATGGATACTTTGGAGGACT
CAGAGGGGCCTCCTTATTCTACCTTTCCCTGATGTGGAGGTTTAAGCTCTGGCTTGACCA
GCTTCTCCCTACTGAGCCCCAGGCACCAGCCACTAACCCCACCGCTTCTTGAGTCTCACC
CGACTGAGCCTCTTTCATGGGCCACTAGTAATATGGTGCAAGTCTAGCAACTTTCAGTAT
GTACTTAATCCATGGACAGTTCATAAATCCTTGCCATGCCAAGCAGTAAGAGCACCTGTT
AAGCCAATGGCAAGTTTTCTCCAAGCCCTATTTTCTCTCTTCAGGTCTCATATTGACAGT
TTCAGGCAAGGCTGCTGCCACAGCAGAAGTCCAACTGCAAAGCAAAATATTGGTGTCCCC
TTCTTACATGGACCATGTCTTTTTAATGAATTTCTTTGAGGCCCTCCCACTTGTGTTAGG
GAGGGGAGAGCACCCTCCATTCTTTCTCCGTGGAATTCTCCACTGTGAGAACTGCTCTCC
CCACAGAACCAAGGGCTCCCACAATTCCCTCCCCCCAGCTGGGTGAAAGGGCTGGTTTTG
GCTCCTCCTAGGAAGTGTGTATGCCCCAGGTGTCTCTCCAATGTTTCTTTTTAGAAAATG
TGATTTTTTTGTGTTTGTTTCAGTTTTGGGCCTTATCCCTCAATTCTGAGACAAGGGGAA
AATGCCCACACAAAATTTTACTTACTGGAAACATTTTGAGGCCATTACTTTGCCTGCATC
ATGCAAAGAGAGATTGAAAGTATAACTTGCAAGGATACGGAATTACTAGAATACTTACCA
GGAGAAGCAGAAAAGAATGAATGGAAAACTTTCCACCCAAGGCAACAACAGGAAGAAAGG
ATCAAAGATATAGGAAAAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACTGCACGCTATCATCAGAAAACACCACTGAAGAATGTTTTACCAATTTAAGTCATTG
CCTGCCAATAACATAGAAGTTAGTAGATCTTACTGTCACTTTTGTTAACATCCTGTTTAA
TGGTTTATTTAAATAATGCTTTAGCCTTAATGAGGGCTTTTTAACACCTCAAGATAATGT
TTATTCAACTTGACAAAATGACCCATTTTGCCACTTTTTTCTTGAAAGCTAATTGTTTGC
TGTCCAGCAATTTCTGAGTGCTAAGAATCATTAATGTTCAGTTAAATAAATAAGCCATTG
AGAGCAAAAGGATCAGCCAAACATTCTACCATGATGAATGAGTTAATAAAAGTTAGCTCA
GTGAATCTGCTTCTTACCAAAATCACCTTTTGCTGCCTTAAGGTCATGTAAAGGAAATAG
CTAAGAGTAGCTTTGGGGAGTCATTTCAATCCAATATGAGCATAATAAAGAAATATAAAT
TCATATTTATTTAAAAGACTCCTTTGTTTTAAATATTGCTGGATATATACATGTGTGCTT
GTGTGTGTGAGAGAGAAATAATGATATACTGCAAAGAATGGAAATATTATTACATGTTTT
CCCAGAGTACTGTTTTCATTTAATTTCTAAAATAACTGTTAGAGGGATTAGCATAAGTTC
TGGTAATCATTCCGTCTTCAGGTGTTTATGTGAATTGTACTTGAGTTTTCCACTGTTTTG
GATCCCTTCTGTTTGCTTAGAGTACCATAGAAACACATTCGTGCATGTGCTTCAGCACAC
ACTCTTTCATCCCTACTCTGGATAATATCCCTATTTTCCTATGGAAAATGGGAATCTTTT
TTTTTTTATTTTGTAAAAATAATGAATCAACTAGCATCTAGGTTAGTTGGTATTGGGGTT
TCTCACCGAGATTGGCTTTCCATATGAGGGATTCATTAACAATGGATTTTATTTGCCCAC
TTTATATTAGATTTCTGAATGATTCTCATGCACATAGAACTCTGAGAACCACTGTTAGAG
GAAATAGAAAATTTATTTTAGTAGCATTGCTACCTGTCTATTAAATCTCTTCTCTCTAGC
ATATAAATTTACCAAGTACCCACTTTGTTACAGAGAAAGTTTAGGTGATGATTCTTTTAT
ATGGGTAGCATTATAACCCAGGAGTTTTGTTGCTGTTGTTGTTGTTGTTAACTGAACGTT
CTTTTATAATTTCAGTATAGGAGTATGTACTATATGTCTCTTACCTGGAATGGCTATGTT
TCAGCTGACAGAAACAGAGAGATGGTTCTTTCTGAAGAGAGAAAAAAGGATTTTATATTA
AAATGTTTACAATTTCATTATAAATTTCTCTGCAATAGATTTAAAAATTTCATCTCTACA
CTGAAACAGTTTTGTGTGTATTTTAATAAAATATATTCTTTATTTGTTTCCTTATTTTAC
AAAAGAACCAAATAGAAAGAAGGTACTCACAGATTTTTCCTCCTAGTTTGTGATCAGAAC
TCCAGAGATGTGGTCAATATTGTGAAAATTTTTTAAATTGTTTTTATTTCTTTGCTGATT
CATAAAAGTAATATAAGGTCATTGTAGAACTTTTGAAATATAGGAAAGTATAAAAATAAA
TAAAAGCCACATGGGTTGCACAACCCAGATAACATTTTTGGTGTATCTTTCCTTTTCTAA
AATATACAGAGCTATTGTTAATATTTTACACATAAACCTGTGTAGACATTCCTGACCGTG
ATTTTCTATATATGCTCTTTTTGGATAGTGTTTTGTAGGTTGGTCTTTATTTCTCTTGTT
ATTTTTTGTTAGCTCCTTGAGAACAAGGGAGGTTGACCACACACTGACATGCTACCTCCT
GTCCACTGCAGAGCCCTCCATATCTAGAAACCCTGTGTGGAATCAGGGCTACTACTGTTT
TTCTTCTCAGAAAGGTATCTAGATGTAACAAATGTATAAATACAATGATGGATGTGGTAT
TTTTAAAAATACAATTGGGTGACAGAGATAGGCTGATTTATTTATTTATGTATTTATTCA
CCTAGCTAAAAATAGATGTTCTTGAATGTGTGCAGCGGATTCTCTTGGAAGCTGGTAGAC
TTCCAACTCTGCCAAGGTAAACTAACTCCAGTGAATCTTGTAGTTGTTTTGGGTTTTGCT
GTTGTCGTGTGCGGCTAGTCTGAGACCATGCTGGATGGTACCAGTTATAATGCAGTGGTT
ACAAGTGTATATTCTGCTGGTTTAATACTGTCCCTTCCAGTTAGCAGCTCTTGAACCTTG
GACAAAGTACTTAATCTCTGTGTTCCAGTTTCCTCATCTGTAGAACAGGAATAATAACAA
CTACATAGAGTCCTTGTTAGAAGTAAATTCGTTAATGCCAGTAAACGCTTAGTACAATGT
CTAGCACATATTATGTGCTTAATAAACTTTAGAACTTATTATTTAAAGGTAGCCATGTAT
TTTTCTTTTCAGGCTAATGAGATACCATTTATTTCCCCAAACTAGCATTACCAAACATAG
TGCACTCATGGTAGGTACTCATAAATTTTATTGAATCGATGAATGAATGATATTTGAAAT
TTTCCTATTAGGAAGTTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAATAATTTGAACATTAATCTAAAATAAAAACCAAACTCATTATG
GATTAACATAATAACATATTTTTATGAAAAATATATTTTCCTAAAAAAAAAAAATCAGTG
GTAAGAATGGGCACTGTTTTACATTTTTGCAACCTATTCAATGTCTGGGCTTAATAGAAG
ATAGCTGGATTCCTATATGTGCTTCTGCATCCATCTTTTGTAATAGCTGAAACTATGCAC
TTGTAAGAGAAGGAGAGTGAAAGAAGCAAATCACACATTAATACTATTATGAAAATTGTT
TTGATGGTGTTGCTATCCTGCAAGAATCCTGGGGACTCCCTGGGGTCTCCAGACCACACT
GTGAGAGCCCCTGGTCTAAGCCAACTCCATTTGGAATCCACAGCCTCTGAGTTCACAGTT
CTCAATTTACCAGCACTAATGAGTGGAAGAGAGGGAAGTATTTGTTTCTTTCCATTGATA
AATAGAAATAAGTTGACCAGAATCATTTTCCAGTGCCATCACCCACTTCCTGTGATAATG
CCCATCTTCAACATAAATGAGAACATTACATAGCTAGAAAAATGTAGTTTGTTAATGGTG
TTTGATTTTAAAAAAAGAAGAAATTGTGGTTAGTGGTGACTATAAAGGCCTAAAGACAAG
TTCAAATTTAGAACTCAATAATCGGGTATGCAAATTAAGCTTTGATCTGGGATTGGCTGC
AGTGTTAAGTATAGATATGGGACCTAGTGCCTTGAGAATTTCTTTTCATTTTAGTATGAT
CCTCCCACCTTGATATGTTATAATTAATCATGTAACTCAGCCTGTCAGGTGTGATAAGAC
TATAGTAACGTGTAGTAAATAGCCCCCAGAATAGAGTATAGAGTGATGGGATATACTATT
CTCTCCCCCATTCTTTTTTTTTTTGGTAAAAGGTACCATTATGTTAAGGAGAATTCATTC
TGTCTTACCTGTGCCTGTACTGTGTTGAAGATGTCCTTGTCTCCAGTCTAAATGGCCTCT
CATGCAGATTCTGTTTTTGCCTAACATATTGTTTTTATTATTAAATTTTAATTTATGACT
TTTTACATTAAGAATTTACAAAATCGACTATCTTCTTTCATGTCCAATAGATTTAACTCC
TTTTCTGGAAATTCTGACCCTTAGCTTGTAAGCACAATGGGACATATTTGCCACGGAGAA
AATTATTTTATCCTCCACAGTGATAACTATATCTAGCAGTGGCAGCAGTGCAAGAAAACA
TTTGGGTTACTGCTCATGAATTTTAAGACAAGCCAAAACTCATTGGATGTCAGGCATCTT
CCCATACATGTGCATTGTATGTTGAAAACCTAAAGAATCAGGAATTCTGTAATGACTTGG
CTTTGAGGGGTGTGGCCTTTTCTGTCTGGTGAGCACAGTTCTGTGTTTTCCCCTCTGGCT
GAAATGCACGGTATCCGTTCTGTTGCCATTCAGAAGGCAGTATGTAAATATAAAAATATA
AATGGGTAATTTTTAATTTACTAAATAACAGGGTGTACAGCTCTAAATATATTTTTTAAA
TGCTCACAAGAGGGCGCTAATTCATATCTGTGTGTAAAGCGGCAACAATAAATTTACTCA
CATCTGTTCAAGGTCAAACGAGAAATTTTGGCCATAGGAAAACTGCTAGTTGGCTTCTTT
CTAGCAGAGTAATTTCAGGTTTCAAATTTTATGTAGTGAAAAACAAATAAACATATCACA
GACTTGTTAGATTATATGGCACACTCAGTTTTGAGGGGAAAATAGATTTGGGGAGCAAAT
CTATTTATTGTACAAATCTGTTTATTGCTCAAGAGTGGCAGGAAAGAAGGCAATCTGTAA
ATTTAAATATGAATATAAATGGTTAAATATGTACTAAATAACAGGATGTATAGGTTTAAG
GCTTGTACATATTCTTAGAGTAATCCAGGTTCCTATTTTCCTTGTTATTTTAAAATACAA
CAACAAAGCTTTTTAGCTTAAGTTAATTTTACTCAGTTTTTCATCTGATTGAAAAAATAG
TACACATTTATTCTCAGGTGTGCTTATCTGGGTGAACTTGATTTCTTATCCTATTGGACT
GCTCTTCTCCCCCAAACAGTAAAGAGATGCCTCGTTTTTTCATACCAGATAACAGCCATA
AGGACCTGTGTTTCTCTTTAGTTCCACTTCCTGTGGGAAATGAGCCTCTCTCTCTCTCAA
TCTTTCCCTCTCCCTCATTCTCTCCCTTTGCCTCTGTTTTTCTAGTTTGCCAAGATAATA
AATAGTTCTCGCCAGATTAGCAGATGCTTGGGGTCTGTCACTAAATCCAAGTCTGCCTTA
GCATGTCTTTTAGTTTTTTTTTCTTCAGGCTGGTATAATTCCAGCACCCCACGTCACTTC
CATCTGCAGCACAATGAACAATAAGCTGTTCAGGCTTAGCATTATTTATCTATAGCGCAT
ACTTATGCTTGATAAACATCTTGCTTCTTTTCCTTCCTTGCAATGTTCTGCACCGGCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTATACTGAAAAATTATTTGCTTATGAAAT
TCAAATGTAATTGGGCATCCTGTATCTTATCTGGTTGACAACCCTTCTCTCATCCCGTGC
ATCATTTCACCTCATATTGTGGGTCACACGTAGTTCTGCCCCTCTTCTCACATCTACCTC
CTGAACTCTCAGTCCCATCCCCACTCAGGTTGATCTCTGCCCTTCACTCCTGGTGTTATT
AATTCTTTTACATAAAATGAAAACATTTTTCCATTTACCCTATATTATTATCTGACTCAC
TTATGTTAGTAGATGCTGTGTGGTTTTTAGATGGAAAGCCACTAGAGAGCAGAAACTCTC
AACTCACCCCCAGCACATTTTTTTCTTTGACACTGCCTCCTGTATCAAAGGGCTTAAAGT
CTTTCCAATTCTAAAAGCCAACTCTAGAGCCCCATGACTCAGGTTGGTGCATTGTTCATT
GTACTGTCGATAAAAATCTCAACTCTTCCTTACTCTCCTAGATTTCCTTATGAGGTGTTG
CTTTCTGGTCCCTTGAAAACTGTTAAGAAGATTTTACTGTGCATGTAAATCAAATACCAG
CAGACACAGCTTAAGGATTAGTTTTGCCTCATGAAGTTTTTCCTTTTTCGAACATAAGTA
GATTTCAGATGTATTCATTTTTACCTCATCCGGATATAGAAAGTATTAATAGCTCTTTTC
TTTCACTAACACAACTTGTTCTCTAGCAATCAGCATACTGGTGTGCTTCCTATCCTGCCG
TGTCTTGCCTTTACATCCAAAAAGAAAATTTTGCTTCAATCACTTTTTTTTAAGCACAGA
GGCATTAAATTTCTATTATCATTTCTTCCTTTTCTGTTTGTAGGTTCTTAGTGCAAGTTT
GTGCAAGAAGGTCTGTGGTAGCAGAGCAGGAGATAGGATCCAGTTCTGTTTTGCCAGGGC
CTGCTGCATGTTCATCACCATCATTGACCTTTAACTTCTATCCAGTGAACCCAACTGGTT
TAGTTTCCAGTATTGGAGACTTTTGTTTCCCAGCATGATGGGATAATGGAACTTTTCATA
CACCTTGGCAAGAATATTTGATTCATGTACCTCTTAGCTCTGCCAGCAAAAATTACTACC
TATTGGATGTTTTTTTCCCTTCCTTCCTTGTGGTGGCAAGTTGCTAAGGGCCGAATTATG
AAAATCCTTTTTTCCCCCTTGTGCTGAAATTGGAGCCTCAGATTCTTTTTCACTCACCAG
GTGGGTTTCTGTTTGTGCAGGTGGATTTCAGCTATAGAACCAATTGCCCTCAACGGTTAT
CTAAATCCTTACAGATAAGATTGCAGTAGACGAAGTGTCTCTTTGTAGCTTTCTCTCAAC
TTCTTCGTTGATAATGAAACAACACTTGAGAGGAAGCTTCAGAAACCAACCTGACCAAAT
GTCCTTACCAAGGTGCAAGGTGCAGGTTGTTAGATGGGCGTTGGAATGGATGACCCCCAA
ACCCCTGCTAAGTCTGAGATTCTAGGAGCTCCATCATTAAGGAAATATGGGGATTGATGG
AATTTTTGGATATCCTTGATCATTCTGGAGGAGAGCTTAATTATTCCCATGCCATGAAAC
CCTGATGACCTTATAGAGATTGAAGAGTTAGGTTAAATAGCACAGTTCTAATGGTACATT
GAAGAGCGTACCTAATTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACGAGCTGGGTAGCTGGTGCCTGTGTATGGCTGCAATTGGATGGTG
GCCCCATCCACCCAGTCTGCTGCTGCTCTGCTCTATGTCTTAATGGATGACCAGGATTTG
GTGAAATTTGGTTGATGCGTGAGGACTAGTGGTAGTGTCCTCAAATGTCAAAAATGAGGT
GTGAATTTATAAAGTGAGTGGTTTGGTGATTCTTACCATTTTTCTTTTCCTGATTAGAAA
GTTAACTGAACATTCTGATTGCAGAAATTATTAAAAATGCAGGAAATCGTAAGAAAATAA
AAATAATTTGTAACCAGGACAAGATCAAGACATTAAGAGACATGAAGCAAAGAATGAAAG
AAATATCGTCCTCAACCCATGTATTTCAAAGTGAAAACAATAATAAATTATATAGTAAAT
GTAAAATCCCACCGTACTCTAATTTTTCACATGATGACTAATTCACTGCTTTAAAAAATT
AGTAGAACATTTGTAGGCTTACAGAAACATCATGCAGACTACAAAATCCCCATATATTTA
AAAAAAGTCATGGTATTCTCTCAGAAAAGAGTATTTTGTTGGTACCTCTGCTCTCCTGGT
AACCTAGCCACATGCTCAGTGATCCAGAACTACTTCTTCCTCCACAAACAAAAGAGAAGC
ACTGTTTTTATTTTGGTGTGTGTTCTTCTGGAGTTTTTTTTTATAGGTAAAATATTTTCG
CAACTGAATTTGAGTATTGAACATATTCCTTATCCTAAGTTTTCACTTACTGCATCATGA
AGATATGCCTTAGAAGACATTTTTAATGGCTGAACCATAACTATATTTAACTGGTTTCTA
AGATTTCCAGTTTTATATGCTTAAATTAGGTTCTAAGAACATGTCCTGTGACGTGTCTTT
TAATCCATCCCCAATTTTTTATTTGTAACAGTTTACCTAGATCTGGTTTATATGCTGACC
GCTAAATCTGTCCCTCAGTACCTTTGACAAATCCTAGTGTTGTTATTTTAAAAGGAAATA
AAAAACAACCTTTCTCATTTGATAGAAAAAAAATAGTTCATTGTTTTATTTTACACTTAA
CTTGGTTAATAGTGGGATAAATTTTTTCATATATTTATTTGCCATTTTTTTTCCATTTGA
ATCAATACATTCTTTAGAGTTTTTTCATTAATTAGAAAACCTTTCCTCGTGCTGAGATGT
ATTCCAGTAGATTTTTGTGCTTTACTTTGTATCTTGCTAACTTCTCTATTCCTTCTGCTT
AATACTTTGTTTTACTCAGAAGATTGTTTCTTTTCATTTATAGTTATTTGGCATCATTGA
ATTTGAAATATTCAGAGAGGATGATCTATAAGGACCAAGAGCATCATCATGTCCTCTTTT
AATATTCTGTCTCCTGTGCACTGAAGCAAGTATGAATTTCCCAACCACTTTTTTAACACT
TCCTCTCCCTATTCCTTTCCTCTTCATCTGCTTTCCTCTTTACGTCGGATCTTCCCACAA
TCAACACTTGATGAATGTGAAATCTATCTTTGGTCTCCCCATCTAGGCAGGTCTGATGAC
CTTAGCCACAGACACAGTTAAATTGGGAAATTTGGCTACACTGTACATAATATCCCTTTC
TGACTGAGAGAAATTGCCGGGTTTTGGAGCCTATTAGAAATATTTCTTATTCAGCTCCAT
TTATTTTTCTATGAAATTTAAATAGGACAGCTTAAGGTTAGGTTTTAAGTGCCTTGAATA
AATAATCAGAAGTGAAAGATTTTTAAAACTAGCATGATGCAGAGAGAAAGTCCATTTCTT
ATTTTGAAATTAACTGATAGCCTCCACAGGAAATATCAGTATTTCTCAAGAGTATTTTAG
TTTCATTAGCAGCACCCGTCTACAAACCATATCAGAAAGATAGGATTTTTGCAGATGGCA
TTGGGCCATGCTCCATTTCTTGTCAAATCACACCGTAATGATGCCACTTATTCAACCATA
AAATCTTGTGGAAGTACAGTGAGCATCTGCGCATAATACAGCCATTCATGCAGAGAAAGC
CCAGGATCTGTGAGCTCACTCTTTCTCCCCTGTCTGCCTCAGAAGTTGCAACTGCCCTGG
GAGAGACATGCCAACAGTCCATTAGCCTGATGAGCCAAGCCACAGAAACATGTCTGCCCT
TGTGGGTGCCTGGCCAGCACGGGGGCACGGCCAACGTGCATTTAGTTCTTTTGGAGCCTG
AGCAGCAGCCTCTTCCTCCTTTAACACCTATACCCCAAACACTGGTTGGACATATGGCTT
CCTGTGGTAATGTTTACCCTTATCCACATGTTCTGTATAACATTGAGCCAGAGCATAATT
TGAATTTTTTTGGAAATTGAATCTATTCCTTAAACAGGTGTTGTTTACAAAAGTGCCAAT
TCAATGAAAAGCATAGAAAGGTCTCTGTTTGCACTCACTGTAAATACTTTTCATTTATCC
AGTTAAGAGATTTTTATTGAGCACCTACTGTGTGCCAGGCACACAAATATAGTGGTGAAT
GAGGAAGTTTTAGTTTTACAGTACAATGGAAGAATTTGGAGTCATCTCTTGAGAACTTTT
CTTTATTATTTTCACAGAGAACTACTCAGCTTTCACTTATTCATAATTACAGCATAATTT
AGACTATAACCTGATGAAAAACCTGAGAAATCTGAGCAGCCTTACTTCTGACATTTGTCC
TCCAATCATTTGTCTTTAAATAGCTTTCTTGTTTCATTAACTGAAATGTATTTCACGTGT
ATCCACAATAGGAAACCCTTTCTGCCATCCAAATTTGCTGTGATGCTGTGATGTAAAGGA
CAGGCAGTGAATGGCTTTTGTATTAGTTTTACATTGGTCCATATCCAATTACCACAAATT
TATCAGCTTAAAAGAGCCCAAGCTTGTTATCTCACAGTTGTGTAGGTCAGAGGTCCAAGT
GACTTGGTCTGGGTCTCACAAGACAGAAATCAAGGTGTCCCCTGGCCTGGGCTCTTCTCT
GGAGGGGGTGGGATGTGCACTCAGGCTTTTCCGGGATGTAGGCAGAAGTGGATTTCTTGC
AGTTGCAGGACTGAGGTCCTCATTTCCTTGCTATCGGCCTGGAGCCTCTCTCAGCTCTCT
AAGACTACCTGCGTTCCTCATCACGTTGCCTCTCTTTCTCCAAATCCACAATGTCACATT
TCTTTGAATCTTCACACTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGACCCGCGACCACTGAGCTGCATCTGCTCCCCAAGTCAAGTCCCT
TTTGCCATGAAACGTAACATATTCACAGGTTCCAGGGATTAGCACATGAGCACCTTTTGG
GGAGACATTTTGCTTCCCAAAACTTTAACTGCCTATTCACAAATACCTCTTTCTACCTAT
TCAAGTTCCTGTGTCTCAATCTTGTGAGATGGGTACTATTAGTAATACCATTTTACAAGT
AAAGCATCTGAAGCTCAGAGGAGGTAAGCTACTTGTTCAAAGTCTGGCAGCTAATAATGT
TGGCATTGGCATTTCAGTTCCATCTGTCTCCAAAGCCTCAGCTCTTTGCTACACATTACT
GTGTTTTGTCTGTGAGAAAAATAGTGTAAAAGACGTTGATTGATTGAAATCTGTCTGCTG
GCATAATGAGATAATTTGGTAAAATTAAATCTCATCAGAATCCTTAGAGATCCCCCCAAA
ATAGTCAGATTAGGACATGTATGCATCTTCTTGATTATCTTCTACATCAGAAATATATAT
TCCTTTTTTTTTTCAATTTTCAGGCAAACCATTTATCATAACTTAAAATGTTATTATGGG
AGCTGGTGTAGCTCAGTGGTTGAACACTTACCCTGCATGTACGAGGTCCTAGGCTCAATC
CTCTGTACCTCCCCCACCAAAAAATTAATCTCAGTGGGGAGTGGTAGCTCAGTGGTTCAG
TGCTTGCTTCCCATGTACAAGGTGTTGGGTTTAATTCCCGGTAGCTCACAAAGGAAAAAA
GAGAAGAGAAGAAAAGAGAAGAGACGGAAAAGAAAAGAGTTATTATGAAGTGAGTATCAA
TGCCTTATCCTTAGCACATTTGGCAGCTCACTATATATTCTTGTCTGTAAGTCCTGTTTG
ACAACACCAGCCCTTTATGATTTAGAATAACTCTTAGAGGTCAGCTCTCCTAACTCCTCA
CCTAATGTAGGAATCTCCTTTGCGGTATTTTACTCCCTTACTTCATCCAGCTTGATATGT
CTCTATCTACTAGAATACTAACAGTGTCACAGGGTTTATTATTTTGCAAAGTAGCTATTC
TCACTAGTGAATAGCTTTAATATTCATTTCTTCTCTATTCGATAATGAATTATTTTGGCT
CTTCCATTTTCCACTGCTGATATTTATTATAAACTTCAGGAAAACTTCCAAATGTATTTT
CTCATTAGGGGGGTGAATTGGACAGATAGAGCCAAATGTTTTGGTAAATACCAGTGAGGG
CCTTTGAGAATTTGAGGGATTCTACTCTAATTTTAAGTTCAGTGAAGTCAGGGATGTAGT
TTTGTATGCCCAGTATCTACATTCAATCTGACACATGACAGGTGCTAAATAAATATTTTT
TCATGAATTAAGCAATAAATGAATGACAAATTTATATTTTTCACATACACAAGTGGGCAA
AAATTTTCAAGTTCTGTTAAAGAAATGCCCGAATACATTTACTTAGACATTTTAGTAGAA
TGGATGGATTGTATGTATCCTAAAATCTAACAGTCTCTATTTGAAGGTATGTGAGAAATG
AAAGTACTTTTTTTTTTTTAAACAAGAGCAGACAATCACTGCTGAATACATTCTAAATGA
AATGAAATATCAGAGAAGATTCATTAATTTCAGTTCCCATTTTTGGAGAAACAAGTGTTC
TCCATGGCTAAGTGAGCATTATAAAAATTATCATGCTCATTTATTTCCTCCATATTTTTG
GTATATGAATAAATGTCTGTGAGACTATCTTTTTTTCCATGAAATCTCCACATTTAAAAC
AAGAGTATGAAAACTCCATATTTATATATAAAAAGATATATATATATATATATATATATA
TGTGTGTACCTTTTAAATATTCACAGGGAGCATTCAATGTTAAAATTCTGCCAATGATTT
AGCACAGACTTCAGAATTGGATGAGGGCAAAAGCAAAAACTTGCACAATTGCACTAAGTA
AGAAAAGTTTCTTTCTTTTCAGTTTAATTAATGGTTTCTCAACATTATATTAGACCCTGT
CTCAAGTGCTTTTTGCTATCAGAGACAATGTCTAGGCATACAAAATTTAATCTTTTTCAT
GATATGAGAATTTCTAATTGTCTGGAAGAAATGGAATATGAGATAGGAAAAAATGGTATC
AGAGAGAAGAAACTCAAATTAGTTTTGAGAACTTGAAAAAACTTTGGCAGTCATTCCCAC
AATCCCCCAAAATGCTATTATTAGATTGGTTGTATTTTATTCCAGCAATATGTGCTTCCT
CTCTTTACACTTCCCTTTGGCTATGAAACCAAGCTTGTGCAATGTTGCTGGAGAATGTGC
ACAGTCTCCACATTCTGCACAGTAAATCAACTATTGTATATATTGTTCCTCTAATTTATT
TAGAAGGAAAAGGAACCACATGTGGATTGGCAATGAGGTACTCTTAAATTATATCCACAG
AGGTTTAATTGTAAAATATCAGGTGGATCTCAGTTTAAACTAAATTAGAATGCAGGATTC
TTCAAGGATCTGCCATGTCGTAATTTCCTTTGTTGTGGTGTGACTGTGTCTCTGTGTATG
TGTAAGCTTAGGGCTGTGTGATGGATGGAACTATATGTACCCCAGAAAATCATGCTCTTG
AAGCTAATCCATTTGCGTGGGTATGAACTTATTTTAAGTAGAATCTTTTAAGGAGGCTGC
TTCAGTTAGGGTGTGACCCTCCTGATTCAGGATGGGTCTTAATCTTCCTTCTGGCCCTTT
TTCCTCTCTTTGCCTGAACCAGCATGCAAGTATACCTGAGTACCTATAATCTGTTATTTT
CTCCCATTTCTATTTGCCTCTCCCATTTCCTTAATAAACTACTGGCCTAACTAAAAAAAA
AATCTTCCTTCTGGAGTCATTTATAAATGGAATGAAATCAGAGAGACAGAAAGAAAGCCA
CAGGCGCTAGAGGATGAAAGCACTGAAACCCAGAGGAGAAGGGAGAGACCAGCAGATGCC
ACCACGTGCCTTGCCATGAGACAGAGGAGTCAAAGATGCTGGCAGCCANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACTGCTTAGCAAACATTTCATGGTAT
TGATTAAGCAGCTAGAAAATAAAACAGCTGTCTGAAAAGTAGATGACTTTTCCAACAAGC
TCAGAATAATGAAAAGAGCTTGTTTCTGAGATTCTATAGATGTGGGTTAACACCATAGTC
ATCTTGATAGTGTGAAAGTCCCAGTCCCAGGCATAAGAGGTTCTGGAAGTTTCTGGGTCC
TGCTCCCATGGCACCTTACAGGTGATGGCATCTGGTGGGGTCTCATCTATGTGGCTGGGT
GAGCCAGGAGGTTGTCCTTCACACGGTGCTGCCCTGGCTAGAGGTATAGGACCTGGCATC
CTTCACAAGAGACATTTCCAGATATAGAAGAGTGAGTCATTCAGATGTCAAGAGAGAATC
ATAGGAAGAGAAAGAGAAAACCTAAATCATAACTCAGTTTTTCATCTGTGAAATGGAGAA
AATCATAGTGTCTACTACATGGGTTTGTTATGAAGATGAAATGAGTTAATATACATAGAG
ACCTAAAATTTCATTTCTTACTTAATTTTATATTAATAAATTGTATTCTTTTTATTAAAG
AGTACACTTCAAATTGTTATAAAGTTTCAGATCTTATAAATCTCAGAACTCCTCCTGCTT
GGTAGAAAGGGATTAAAAAAAAAAAGCAAAGTCAAAAAGTAGAGTTCATGAGCTATTGTG
AGACTTACATGAAAAATGCATGTGGAAGTAACTTAAAAAATGTAAATCAGTAAGATATTA
TTTTTATTGTTATTTAGCAGTTGTTATATGCAGGTCCTGTATTGTGAAAATGCTATAAGC
AATCTGGATAAATGTATACCAGCTCATCTTCCATTCACTTTTTTTAGCTAAGCATGTATT
TCCTCTTGAAAGCTGATGATTTCACAAGATGGTTTAGATATCAGAGAGCACTATTTTGAA
GTTTTTATTTTTGTTCATTTCAGATCTTGAAATTGAGTGATGCTCTCTTGTGATAATATA
AGCAAAAAGTTTTTTTGTATTCCATTTAGCATAAAGGAGTTCTATTTTATAATAGAAGTT
TAGCAGTGATTGAAGGTACTTGGTTAAATTGTGGATATTTTACTTATTGTCTGAAAGTTT
TATCCTTACAAAACAAGCTAACCGTTAGTTTGAAAAATAAATTTCTAATTCTTTAGGTTC
TAAACTCAACTGAAAATCCACTCTACAAATGAATTTTAGATGTCTGCTCTATACCAAGGA
TTGTTCTAGTTGCTGGGCGTACAAAAGCTAATACCAAGGAGTAGATGTGGCTCAAGCAGT
TGAGCGCCCACCTCCCACACGGGAGGTCCCAGGTTCGGTTTCCAGTGTCTCCTAAAGAAG
ACAAGCGGGAAAGTGAGATGATGCAACGAGATGATGCAGTGAGATGATGCAATGGGGAGA
CAGAACAAGAGTAAATAAATCTTAAAAAAAAAATAAAGCAAGTACCCATCTGGTCCTTTC
TGTCCAAGAGATTGTAAAAGTTTAGGGTGGAGAAACAGAGAAGTAAAATTAAGCAACATG
ATGAATGTCACAACCGAGTGCCTGGGTGTCCCAAGAGAAAGGTTTACTCATTTAAACTGG
TGGATCTGAGAAGGTGTTTCCAGAGGAGGTGACACAGATGATTTGAAGACTGCGCATAGC
CTGGTCTGATGCGTGTGCGATGCTCACATGCACACACGTTGTAGAGAAAAGAGGAAACAG
AGCCAGTCATGAGGGAACCTCAGTGTGACACGTAGGAGGAGCTTGACTTATTCTAGAAAT
CGTGGGGACTACTGACTGTGTCATCCCTCTTTCTGTCAGTGAAACCATCTTTATCCTAGT
CACAAAGGTTTGAAATTGTTGTATCTTTACTACCCTTTTAAATCGTCCTCCATGCTGTCT
CTAGGCATTCCCTGTTTTTCCCAGTCTTACCATGTTTGCCCTATTTTAGGCTCATCTTTG
CACTCTGGGATCACACCTGGCTGCACTACATGCTTCCCCTCCCTTCATTTTCCCTCACCT
CCAGCCTGTTCTGGCTATCCTGTGAGTTAATCTACTTAAAGAACTTTGGCCTGAGAAAGC
TTTAGCAGCTTACTAGTACTCACAGTGTTTTCCTAAATGTGGTAAATCAGTACTGATTTG
AATTAGAATGAATTAGAAACCTCTCAACTTGGCTCTCGAAGCCCTGATCCAGCACCAACT
GCGGCTCCTCGTCCCTGGCCCCATGTCTGATCCAGCCTTACTGGTCTGGTCTTCCTGCAG
GCTTCCCCTGAAGCTGCCATTGCCCATTCCACCATGTGGAGGTTTATTCCTCTGAATTTC
GCTTGCTGCTTCAGCCACACATAGCCCAGCACACCTTGGCCTGTGTACACTGCCTAGACT
ATTAGGGTTTCATAATCGTATTTGAGCTCTTCCAATAAATTTAAAGATCCTGGAGGGGAA
ACTTTATGAGATAATATGTAAAGCACTTAACCGAACGCATGGGGCATAGTAGATGCTTAA
CTGTTGTTATTATGCCTTAGTTTGTCTTTAGGATATTGTGTCTTTGCATCCCTGGAGCAT
CTAGTAAAATAACTCCTCAGAAAGTAATGCTGCCAATTGAGTGAGAGGATCATCATTTTT
ATAAGTGTCTGGCCCTTTTGAGAGTTACGAGAAAAACAAAGTTATGAGGTTTTCCTCTTG
TAATTTTAAATTTTAAAAAGTGTTTGATGCTCTTTAATAGAACTTTTTTTTTCTTCGAAC
ATACCTTTTGTTATTACAATTACATATTTATTGCAAAAATTTCTGAGAGTTTAAAATACA
CACTGTAAAAAGCGAATGTCTTTGCATAGCCACCCATCAAATTCACCTCCCCAGAAGTAA
CTCTTGAAAAGTATAGCCCTTTCCTCTGTTACATGGGTGGGAACATGGTGTTAATTTCCA
GACACTGCAAAATTTATCAAGTGCACACTGAATCATCGAAGAAATATGCTTGTTATTTTC
TTTATTCTTAAGAAAGATAACATTTTGTTTAATAATCAAATCTAGTCTACATTTATTAAT
TCAACACATATTTATTGACCACCTACTATGTGCTAGACATAGTACCAGGCAGTGCAGAGC
CTCCTTTCTGCCATGAGGCTGTCATGCCCTTGGTGGTAGTGACTTGCTGGTAGCCTTCAT
GGCTGATGCCTCGTGTTCCCCTTACCAAGTAGATCTCAGTATTAAAGGACAGTCCAACTA
TTGCTAACTGGAGCATATCCTTCCTAATCTTCACACCAAATTTGACTTCCTTATCATTCT
GTCCAGCACATGCTGCCATAATGTTCTCATGGCTTTCTTTATCCATTGTATTAGATTTCT
GTTGCTGCATAGTGAACTGCCATAAACTTAGTGACTGAAAACAATACTATTCATTATCTC
AGTATCTGTCGGTCAGGAGTCCAGGTATGAGTTAGTGAGCCACTCTGCTCAGGGTCTCAT
GAGGAGAGGTTGTGATTCTCATCTGGAGCCCAGGGCCGTCTTGGCTCATTCAGGTTTTTT
GGCATATTGAGATCCTTGGGGTTGTAAGACTGAGTTCCTCATTTTTTTGCTAGTTGCTGG
CAGGAGTCTGTTCTCATTAACTTTAGGCCACTTGCAGTTCTCATGGTCTCCATAGACTTT
CCCACAACACAGATGTTTGCACTCTTCCAGGCCAGCAGAAGTGTGTTTTTCTCTGTCTTC
GAATACCCTTCCAATCTGCTTTGACAGTTTTTTATAATTGTCACCTTATCAAGGCAGCAA
CTATCCCATCATATTAACAGGTTCTTCCCATACTTAGGGAAGAGGATTATGCAGGCCATG
TGCACCAGGAAGCTGGAATTTGGGGAATCATTTTAGAATTCTGTCTCCCACACCCATGTA
AGACATTCATATGTTGGTGTCAATATTTCAATTACTTGCAGGTTTGACATTAAAAAACCA
AGAGGAGAAGAGCGGGTGTAGCTCAGTGGTTTGAGTGCCTACTTCCCATGTACCTAGTAC
ACAAAAAAGCAAGCAGACCCTGGATTATGGGGAGGCTCATTACAGTAGGGAGCGTGTGGC
TGGTGTCCTCACTTGGTGCTTAGTTGGGGCATGGGCCTGACCTTATGGAGCATTCTAACA
TTTCTGCTGCAATAGGAGATTCAGCGTGTGATTCAGAAAGGTTAACATGGGGTAAGTGTA
TTGATGAGCCAAAGGGGTGCTGATACAAAGTACCAGAAATCTGTTGGCTTTCATAAAGGG
TATTTATTTGGGATATAAACTTGCAGTTACAAGGTCCTAGAGAGTCCAACTCGAGGTATC
ATTACAGGTATTTTCTCACCCAAAGTCTGCTGCCACATGTTGACGACGCAAGATGGCGAG
AAACATATGTGAGGGTTCAGCCTTCCTTTTCCCTCTTAAGGCTCCGTGGGTCCGGCTACT
TCTGATCTCAGCTGTAGGCTGGCATCGGGCTTGTCTCTTTTCCAAGGGCTTGTTTCTTTC
TGGGCTGAGCTGTTGTGGTCTCTTCAGAAGGTCAGCTGTAAACTATCATCTGAATGACTC
AGCTTCCTTCCTGGGGTTGCAAGATCCTCTTCCAGGTCAATGGAACCTTCTCTCTCTCCT
GGCATATCTGCTTCTCTGTGTTCTTGATTGAGCATCCATTTATCTAGCCCACCAAGGGGG
CTGGCACTCAACCCTGCATGCCCTAATGACATGGTCGAATCAAAGCCCTAATCTTGATTT
ACTCAAGTAAATGTAAAGCCTTTGAATCTAAGTCAATCAAAGGGTATCATGCCCAGAGGA
ACAGTTTAGAAACATGATATCTCTTTTTGGCATTCATATTTAATATCAAACTGCCACGGT
AAGAGAACCCTTTCTAGAATTTTACTTGGAGCGACAGGATTTATACTTATATACAATGCT
AGTGACATGCCAGATTAGACCTAAGCAGATGGTCAGTGACTTCTGCAGATGGTAACAACC
TCAGCATAAACAATCTGTTACTGCGGGGAGTAACAATCTTTCATATTTTGTTTCCGCTGT
TCACATTCCCTCTGGAGTTTGATTTCTTTGTACTTTTCCTCAGAATCTGGTTCTTTTGCT
CATGTTTTCATTTAGCAAGATCTGGAGACCTGTACAAAGAAGTTCAGATGACACTGCTGC
GATTACTGAACATACCATCCTGGAGAACTGGAAATACTGACAGTACTAAAAAATATTTAG
TGTCTTTGTTTCTCCTTTGACACTTGCACGCTGCCCTGATGTGCTTTTTGCTATTTTCTG
TATGTGTAGTCAACAGATTAGGTGAAAGAGATATAGCGGGTCGATTATCATGCCTAGGAT
TATTCACTTATTGGTGTGCCATGCACTGTGCACCAACCAAGAACACAGCAGACCTGGCTC
CGTCCTTCAGGGGCAGGGAATAAAGAGTTTAGATAGATAAAAGAGAGCGTATTGATCATT
TTGTCTCTTAATCTGTAAGATTCATATCGTGTTTACCTACAGACGGTAAAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTACTGACTGGGCTAGCCTCATCATAC
CCTCTCCCCATTTTTAATCAAAGGGAAAGCTACGTAGAACTGGTTTGGGAAAATAAAATC
GCTATGAAGAAAACAGAAAACACTGATATACCCTTCTCTTTCTACTTTCTATGCCCTAAA
CTAATGCAACTAGGTGATTTTTTACCAGGGTCACAACTAATTAGGGTCAAGGCAGAGATT
TGAATCGGGGACTTATGCCTCCAAGTCCACTTACCTTTTGGCTAGAGCTCTGTAAAATAC
TTTAACATGCTCTCTTCTTTAGTCCTTCATTGCCATTTTCAAGTTTGCTAATAATGACCC
ATGCAGTGAAACTACTTTCAAAAGGACACTCTCAGTTGTTTAGTATACATTTTATTCTGA
TTTTCTTAAAAGATTTTTAGTTCATATGGGTCTAATCATATTTTCAGGTATTTTCTCTTG
ATTTATGTCCCACCCAAGTCCACTAAAGAGTAAATTTTCCTAGTTTCACCTGACACTTGG
CTTCCAGCCAATATTGTTAGAATATTTACAAGGAAATTTGCATACTAACAAAGGAACAAC
TTGGAAATTTACTCTTTGCCTATTTGACCAGCAATTCCTGAGGGTAGAAATCTTGTGCCT
GTGTGATGTGTATATTGTTATTTGAGGTTCTTTTTAAAATGAAATGTGCTTTCCTAGGTG
GTTGTTGACTAAAAAAATCCTTCTTCACTAAATTTTATTGTGGTAGAACATAGTGGAAGT
TTTGTGTTCAGAGGATTTATTCCAGAGTTGGACATGGTAAATTTTCCCTGGTGGTCCAAC
ATGTCTTTATATCCTAGACCTAAGTAGGGATCCAAGACTTACTGATGTATCAACACAAGT
GTTCTATTGTTTCTGAACAGTTATGCCACTTAATTTTAATGTCTCCTTATAAAAAAATGA
CAATGATGCCTTCAGTATTAATGCATTGCAAGAATTAATTAGTTGCTTATAAAAACCACT
TTTAATGTTTACAAGACTGACCTTGTCGATAAAGATGAACACCGGAAACTGAAAGGGGAC
TAGGATAATTCCAGCATGAACACCTATTCTTAGTAATTTTTACCATTTTATCAGGTCTAA
TTGATATGGCCTAACAACAAACAGATGCCAAAAAATGTTGACCTGTTAACACGGACAAAA
GGTTGATAAATGGAGTCTGGTCTGTTAGCCTTAGTCCACTTAGACAACATAAACTATTGT
CACTCTTCAGTATTTTGGGGTTTTTTTCAGGTCCCATGGCTTCTGTCCTTATTTGTACTT
GCTAATATGCTAAGTGGCCCCTGGCAAATCATTTAACCTCCCTGAAGTGAGAATAAACTT
CACTTTGTTTGCTTTCTGTAACTCAGTTGGGAATGACGAGATACCACGGGAGCTTTGAAT
TCAGAGATATGAGTCATTTTACAGGGGCATTGCTGTAGCATCACCGTTCATTAATAACAT
GGTCAATATCAAAATGGAAATTAGTGCTGCTATTACAAACTGCTAAGTACTCCTCTTAGA
GACAGACTGTTTTGTGTTATTCACAGTAGGTGCTGCCATTTTGCAAGCTACGTATTCTGC
CAAAAGTAGCTTCCTTGGAGGTTACTTGGAATTTGGATATTATGTATTTTTTTCTTTTTT
GAGCAATTTGTTCATTAGTATAGCAGTCATCAAGGAAATGGGTCAGAGCCCTCAAAGAGT
TGGGTTCTCAGGTCTCCTAGAGAATAGAATTTAATATTAATAGCATCACTTGGAAAACAC
GGCAGCTATTTCCCTGTTTTGTACAGCTCAATGAAGAGTTGTTCAGTGGGTCCCCAGTGC
TCTTCCCTCATGAATGGACGTGATTGTGAGGAAAACATCTCCTACTAAGGCGAGACGTGA
CACCAAACAAAGGCTGGTTTTAGCCCGATGAGATGAGCTCACTGCAGTGCCCATGTGGGG
ACTTTGAAGCTTATCCGGGGGCCAGCTTTCTGTGTTTCTGACATTCTTGGTGGTGCTTGA
GAGACTGAGCAGCAGGCCTTTAAACACTGATCTGCAGTTTATGAATGGCAAGGTCAGGTG
AGGTGAGATGTCATATTTTCTGTTTAGCATGAATTTCCCCCAGAGGAGACATATTTCCTT
CACCCTGAGTAAGGGAAATCACAGTATTTTCAACTGAGGTGAAAAACCAAACCACTAAGG
GCTTTTAAAAAGTAAATTTAAATAACTATTTTCTAGGGTAGGTGTGTTTGTAAATAAGGA
AGTGCATTTCTCCTTTTCTATACCTACAAGTCCTTTTGCTGAGGAGGGAAAATAAGCACA
GTGATCAACTAGGACATGAAGTTCCTCCAGTTGTATATAAGACACCCAGCACAATGCAGA
TACTTAGTACACGTGACTGACTATTACGAAGATCCCAAAAGGTGTGCTCTCCTATGAGGT
TACACAGGATTCAGAGAAGAACATACACTTCATGGGTTAGAATTCTTCGTGTGAATGGAG
CTGAAATTGGACTCTCAATGACCTGTGAGAAATGGTGGGCCCCAAATTGATGAGAAATCC
ACAAATGATACTAGGATGTCTTAATCATGGTAACATTTTGAAAATAAGAAAGGACAAACA
AGATTTACTGCAAATTAATTCTGATATTCAACTTTTGAAACCCAAACGCATACTTGCCAC
TTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAATCTTCC
ATGTTAGCCTCTTTTACATGATTTACAAAATTAGTCATGATGCTCTAGAGTCCAGCAATG
CTTCTATCAAGTAAATTTTTGTCAAAGATAGCATCCACAACTGCCTTTGGAAGCTATAAC
CAATTTCCAGAACATGTACCCATTCTCTAGTGTCCTCCATGAGCTGTAGAATTCAACTCT
CTTGATACTTGCCACACTTTAGTCTTGAAATCAGTTTGCTGTATTTTATAGGAGTCTTTT
TCTAACCCCAGCATTCATGTTTACTCCCATGGAATGTTTCTAAATCAGCCCCACAGCGCT
AAGCAGTACCTGAAATGGGCTATCCAGTCCCCTGTGTTTTGAGTGACTGCCTTTACAGCT
ATAACTGCCACCACTCATGCTTCTTTTGTGTCATTTCAAACCTTGGAGTCATCGACATGC
TGAATGTTTACTGTTCTGTGCTGAATGCAGGAAGAAAATATCATTCACTATATAGTATTG
TTTCCACAGAAATAGTAATCTAAAAAAAGGTAAGCAATCTGAACTCTGTAAGCCCTTTAT
ACATTTTTAAAAGTTATTTTGTTTAACCTAGTTCATCTGCAAAGATGGGTAGGAGACATA
GCAGGATTTATGTCCTATTCTTTTAAAATTGAATAGAATTCCTTTCTTAAAACAACATTT
TAGGATTAAATTGCAAATATTCTTTAAGAACTTCTATTTTTATAGAAGGACTCTGGTTCC
TAGCTATTGTGTGAAATGAGTCTGTAGAATCAGTGCCTACACCATGTCTGGTAGTTAATA
TTTGCTTCAGGCTGGAATTCATCAGCATTGAATTCTTTGCTGGTGTCCTTGGTTTTTCTC
ATCCAAGAAAATTTTTTAGGCATGTAATAGTCCTTTTCTTCTTGTGCTGAAATTGCAGGC
TTTTGCCCTCTAATATGAGGCTGTCTCAAGAGATCAAGGAGGTTGCAGCCAGCATGGTCT
CCAAACCTCTGTGCTAAACCCTGGAAGCATACTTGACCCTGTTGGGGCTTGCCTGGAGAA
GAGGATCCTCCCTGGGAGATTTCTGGAAAAGCTAACATTTGTTTAAGAGCCAATCCAGGA
GAGCAAGAATAGGCCCAGTTTTGCTCACCTGAGAAATGACTTAAACCTTTGTTGGCCACT
TTGGGTTTGGGGTGAAGCTGCAAGCAAGGTGAGGTCTGGGCTGTGGAAATAAGGGGCAAG
TGAGTCCAAAACAAACTTGGGCTTTGCATTGGTGTTAAATTTCCCAAGAAAGGAATGCCT
CATATGCCTTTGTCCTCTTCTTTTTCTGGGGCTGGGGGAAGTGTGGGAGTCACATTGTGT
TGTCCCAGGCAATCCAGGCTAGGAATGTAGCTTCTCATTAGGGACCTCTCAACAATGCTT
ACTGTCAACGGTGTTGTAAACTAATGAAATGCTCTGGAATTCACAGCAGGATCATCGGCC
CTTGGGTTACCATCTTCAGTTTCTGCTGATATTCAGTGGTTAGCAAAACTCAACTTGAAC
TAGAGAGTGCTCTTCTAAATAATAGCAACTTGGCAACTGCATGAGCTCATACTAATTTTG
TTTCTGTCATTCATCTGCGGTAGATCTTTTGTATAAAATAGCTCCAGGGTATTATTTCTG
CACACTTATGTAAGCTCTGCTCATTAAATAAAGTGCTTAAAGTTAAGTTCCCTTTTAATT
TTGTTTCCTAAGATCATCGTAACAAGAGGGACTGGACTGTAGTGAGTCCTTTTTGTAGAA
TAGTTAATAGCAACTTGATATGAGATCAATTTTTTAAAATGCATAAAGAAGTCTTACCAT
TGCTTTACCTTGTTTTTAAAGTCCTTCAGCATTAGCCCAAAGTGACACAGAAACAGTTCA
TCTGGTGCTTCCCAAGTAGTCATTATCAGAATCTGGGTTCTATAAGTGAAAGGAGCATCA
GACTTGTAATCAAAGTAGGAGCTTTATCTCTACCCCTTAGCAGCTATGTTAAGTCCCTGT
ATTTCCTATCTTTTATCATTTGAATATGTGCATAATCATCTCCACCTTTCAGAGTTATTA
TGAGATTAAATGAGTGATTCTTTTTATATGTCCAAACCACTTTGTATATTGGCAAATTAT
GCACATCTTTTTTGTTGTTATTCTTATTACTGCCAAACTGCTTTAGTTACTGTTAGGCCA
CACTACACACACTCCTGACTTAACCTTTGCTGGCTCTTTCTAAACTTGGCCAGTTTGGAG
GACATTCCATTTATCTTCATACCATGACAGAGAATTTCAGTTTGCTTTGTAAAAGTAGTG
CTTTGGTGAGGACTGTCACATTAGAGTTAAAATCGTTAAAACCAGCTCTTTAAGTTGCGT
GTGTCAATTCAAACAAGCACAGTGGAATTGCTACCTCCATATATCTTTTCACTTATCCTG
AAAGACAGTGGCCTGAAACTTCTGCATGTGTAAACGTATACTTATATAGCATGTAACTTT
CTAAGTTCTGGTACTCCTTAACACTGGATTTGAGCAAATAAAGGTTTGATATTAGAACAA
GTATATTGAAATGTATGGTATATTTGGTATTTTACACTGTCAATAGTGTTTTACTTTGTC
AATGCATTTTAAATCATATGTACACATATTTTATATAGTAAATAAATAAACCTTTACCTG
ATATTTTCAATGCCAAGTAATGAAACATATTTGTGGTGTGGTCTTTTGAATGTATCTTCT
GTATAAGTGTGTATAAAGAATAATAAGATACTAATATAGAAATGGGTAGTTGAAGCAGGT
AAAAGGATTTATTTTTGCTGTTGATAGCTATGTTTCATTTGCATCATTAAAAGAGACTTA
GAATCCACTATGCATTGAGACTTTCTTGTAGGTATACTATGGGTTGGAGAAGAGAGACAA
GGGAGAGAAATGTCTAAAAAATTAATATTGTTTTTTAGTTTCTAGGTATAAATAACTCTT
GCATTTATCTTTCCAATAGCTCCATAGTCCTGGTTTCAGATTATATACTGCACAGAATCA
CAGAATAAGATATTATCCTAAGTGATTATAATGCCATCCATTTCAACTCCCCTACTTCAG
ATTAAACCCCCTGGGTGATGCTAGTGGGAAAATGTAGGTGTATTTTTATGTAATAGCTGG
ACAGTGGTGATACTATATGATTCAGTTGCGATTTGTCTTTAGTGAAAAGTCATTTTAACA
AAACCCTTATAGTATTTATGTTGTACCTTTTACCATGATGGATCTAATTCATCATAATGG
ATATTTTTCTGTGAGGAGTGTTTTAAAAAGTATTAGACAAATGTCCCAGCACTTGAAACA
GTATCAGAAGCTGGCCTGTGGCACATTTGAAGATTCAGTGAAAACGGGCATGATATTTTT
CTCCTTTTTACCTGTAATGAGTTCTTTTCAGTGTCACCATTTCTGTTCCCTTTCTCAGAG
ACATCACTATTGGGAAATGTAATGCTGTACTTATTATATAGAACTCAAACTGAATACTAA
ACACGTCCTACAGGCTACACAGGCTGTGTCGTATCTGCCTATAACCTACTAGTGTGCAGG
TTAGAATCTTTTGACTGCTAATAATGAGGTGCCAAGTGTTATAAGGTCACCTGAATAGGG
TGTGATATATGCCCACACCCAAAAATTGTAGTAGTTGATTGGAAAGTCAAGGGAGGATGA
TCACAAAGGAAACATTGAGACAGAACCTTGACTGGAATGAAGGGATCAGGTCTATAATGC
AAGAGAAGACAGGAAGAAAGGGTTTGGTCTGGATTGAATTCTCCAGAAAGGTTCAATCCC
TTTAGAATACAGATGCAGAAACTGAAATCATTCATTTGGGTTCATACGGCCACTTAGGGC
AGAACAAGGATTAGCATCATGTCTCTGATTTAGGGTTCCAGAACTTTATGGAAGAAGTAG
GACTTGAGCTGGTTCCAGAAGGATAGAGTTGTAGATGGTAAATGATGAAGATGTGCATGA
TCAGCTAAGGCAGGGAAATAGGATTAAGCACTTTTAATGTAGCTGTGAAAATTGGAGTAG
TGGGGTAAGAAGGAGATATAGAATAGAATACTGAGAAAGAAGTTTGGATAGATTTGGACA
GTGAAATTTTGGGATGGGGGACCAAGAGTGATATAGAATTATTGACTTGATGAAAGAAAA
AAAGGAATTATTATAGACTTTTACATGCGGAAAAAATAGAAAGCAATTTGTTAAGAAGAT
TGGCCTGAATGCTATACTTAAAATTTTTGGAGGGCACAAGGCTAGGGTCTGGAGACTAAC
CAAGGAATTACTGCTGAGTTCACTTGGGGACCTCTAGTGGGGAGAAGGGTGGCACCTGAG
ATTGAAGAGAAAGGACAAGCCAGACATTTTGAAAAAAGTAGTAACAGGATTCTAGAGAAA
TTGAATATGGGAGATAAAGTGGAAGTAAGAGTCAAAGATAATTCATAGCATCCTAGTTTG
GTATGCTGTAAGTAGGACAGTGAGTGGGGAAAAAGTTGTGGGAACTAGTGAGCAAGTACA
ACTTTTCATCCAGTGCTATGGCTATGCCTGGAGGAATTTCTCCAGCAACCAATACAAAGC
CTCTTCAGTGACATCAGAAACCTGCATGTTCTATTGGCTTTCCTCATTGGGATAGGGTGA
CTGTTAGCACTTCAGGCCTGACCTTGGTGGACCTAGAATTGCATTATCGCAGTGAACAAC
TACACAGCAGCAGAACACACCTATTCTGATGGAGCCTGAGGGTCTATTTGATACACAGAA
TTATACTGTATTTGCTAAGGGTGGTTAGTTTCTGGGACAACCTAATACAGAGATCGTACT
TTCATTTATGTCCCCATGGAACTCTGTACACAAGCTACCTATTGTTCCATAGAAAATCAC
CCCAAAACATAGTGACTTAAAACAAAAACAATTTTCTTTGCTCATAATTTTTTGGTTCTG
CAATTTGAATTGCTAAGCAATTCTTCTCCTGGTCTCTCCTGAGATCACTCAGCTGACTGC
AGTCATCTAGTGACTCAGCTGTGGCTGGATGATCTAACATGTGCTCTTTCCCAAGTCTGG
TGGTTGATGCTATTGGTGTTAGCTATAGTCTGGGGTGGGCCTGTCTGTCTAAGGCAAGAG
AGGAGAGACAGAGAGACAAGACAGAAAGCACTCCCACAGTATCACTTTGCCAGTCTTTTC
ATCAAAGCAAGTCACAAGGCTGACCCAGAATCAAGGGAGTAAAGAAATAGACTATACCTC
TTGATAGGAGGACTGCCAAAATTGCATTGCAAAGAGTACATATAGGGATGGGAGGAGTTT
GTGCCCTTTTTTTTTTTTTCAATATGTCGAAGAACATGATCAGATTTCCAGTGTACTTTA
TTATCAGCATGAACATAGATTTCATGATTGGGAAAAAATTTAGACTAGAAATGTGGAACT
AATAAGGAATCTATTGTAGTAACTCAGGAAAGTAATTATGGGTATACTAATTAAAGCAAT
GATAAAGAGGACTGACAAATGTGAAGAAGCTATTCAAAGAAATTTTAAGATGACAACTGG
AGAACCAATTTGATATGGAGGAGAGTCAAGGATAACTACTACATTTTTATTTGGACAATG
TGATGATTAATTTTATGGGTCAACATCCTTAGGTTACAGTGTGCAGTTGTTTGATCAAAC
ACTGGCTTAGTTGTTCCTGTGGAGGTATTTTGTAGATGACTTTAAGTAAAGGAGATTACC
CTCGACAGTGTGGGTGGGCTTCATCTAATCAGTTCCACATCTTAGAGAGATAACTGAGGA
TTTCAAAAGTCAGAAGGAATTCTGCCTAAAGACTCCACCCTCTGCTGCTCCCTGGTCTCC
CCTGTAGACTCACAGTAAGGCTCAGCATCACTCCTCTGGGAATTTCCAGCCTCAGATCTG
CCACATGGAATTCAGGCTTGCCAGCCCTCACAATCGTATGAGCCAAATTCTTACAATAAA
TCTCTTAATATACACATAGATCCTGTTGGTTCTGTTTCTCTGGAGAACCCTGGCTAACAG
AGAGGACCAGGAGGAAAGAGATGGCATTCTCCCAGGTAGAGAAGACGGGATGAGGAGCAG
ACTTGGATGGGAAGGTGAGGACTACTGTATGGGTAACGTTGAGTCTGAGAGGCCTCTATG
ACATCGAAGAAGAAAAAGGCAAAGCTGTCATATGAGAATAAGTGGGAAGGAGATGCAGTT
TAAGGCAACTGGAATCATTGGGAATAGAGGAGACAACTGACTGGGAAACAGAACAGTCTA
GAGGACATGGCAGAGAATGAAAATCATGGACGTGGGGTGGCTCAAGGCCACAGAATTGGA
CAGTTTTTTCCCAGTAATTCTCAGCCACCCACATATAGGCATAGAGAATGCAGTGGATCA
ATCCTGACATTTAGTAGGTGCTCAGTAAAATTTCTTTGCTCAATATAGGGAAAGAAATGT
AGGTGGAGAAACACAATGGTCAAAACAAGATATCTTAAAAGGCAGTAGGCAAGACTAGCT
TCATAATTTGCTGGACACAGTGCAAAATACTAATTAAAATGTGGGGTGCTTTGTTCCGAA
ATTATAAAGAAGTTGAATATGGCCATAGCAGAACATTAAACTAAGCTTTGGGTTCTCTTG
AATGAGTTGGTCCTGGCAATGGGGAAACCATTTGGCGACTAAGGAGAATACAGTCACTGA
GGAAAAAATTGGGGCATTTTTCTTTCAACATCTTTTTCCTTCTTCATGTCAAAGAGCCAA
ATAACTAAGGTAGTAAAAATGATGACTCCTGGGAAAGTGGTGGGCAGGGAAGGAATTTGG
TGGCATGATATATTTAAGGGCTACCCCTCAATATTCATCTGTGTCAGTTTAATTGGGAAA
GACTGGTCTCTCTGGCCTCAAGTCCTACATCACAAATTTCTGCTCCATGATGGCGGCGGT
GAGTTCCCAAACAATATTATTATTATTAAGGTTATCATCTTAAGCAAAATTTTCTTAAAA
TCATTGCTATTTTCTCACAAAGGTATAAAGCTTTCCTCATCATGTTTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCAAGGGAACACGAAACAAATTTTGAAAT
GGAAGTTGAATTAGGTGTGCTGGTCCCAATGAGTCATATCTTCTGCAGCACAGATTCTAT
TGCAGAAACATAAACTCCCATCCCTATTTCCAGTCATTTCAATGAGAGTCTACACTTGAG
AGGCTGTGGGGTTACAGGCAAATCAGGCTCCCTGTATTTATTTGAAAGGCAAATGTGAAA
TTATACTCAGACTTTAGAATTCTGTAGCTCCAAAGAATTTGGAGATAAGGGACTATGAAT
TATAATCTTTCCATTTTATAAGTTGTGATTTGTTCGGGTTAGTTAGCTGGACAGCGATGA
GTTGTGACTCCGGGGGCTCATTCTCGCAGGATCTGAATATGCTCTGTTATTCTCATCCTA
AAAATCAAGCAACTAAACAAAAAGCAGTCCACCCCCAGTTCTTTTTATTACAGTAATTTC
AACATAGGTTCAATTCATGCAACAAAAGGAACTCATAATACTAGCAATAGAAAATGACCA
GGATTTTACTGTTAATGAATTTTTTCCAACTTATTTTGGAAGGAAAGTTGTGAAAATTAA
GGACATAAATACTTTTTATACTAATAGGGAAATATAATGTCCCTTTAAATGGAAAGGGTA
AGGACAAAAGAGAAATCAATCATCTCTTCATTCTTTACCTTCAATGTAAATAAAGTTGAC
AACAGAGTGAATTTTTGTAAATAGTCATTCATTTTTTCAATGGCTTTCAAGTATAAAATT
GCATTACCTTTTTATGAATCTAAGGTAAAGGAAATCACATACAGTAGTGAAGCCAGTATT
TTAAATTGTATATTTAAAGACAACAATCTTAGAATAAATATTAAAAATACCCAGTTTAGT
TGTAATCCAGAACTTCATTTGCAAGTTTTCCCATGGGAGTAGAGCCCCAGGAGACTGATA
TCTGCTCAGGGATGTGTTTCTTTTTAGGATGAATCTCACATCATATAACTTAAATCTTGA
TTGCCTAGAACAATTTCATGTTTCAGGATAACTATTTAACATTTGAAATTTGTGTATTTT
TTAAATAACTTTTTATTTTGGAACAGCTTTAGATTTACAGAAAAATTACAAAACTAGTAT
AGAGTTCCCATATACCTCATACTCAATTTCCTCTATTATTAACATCCTGCTTTAGTTTGG
TACATTTGTTATAATTTATGAACCATTAATTACATATTATTGTTAACTCATACTTATCCG
AATGTCCTCTGTTTTCCCCTCATGCCTTTTTCTGTTCTAACATCCCCATGAGGGAGACCA
CACTCCATTTAGCCATCAGGTTTCCTTAGATTCCTCAGACTTCCTTGTATCTGGATGCCT
TCAAGAGTTTTGAGATGGACTCATCAGGTACGTGTAGGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAATATGGTGAGCAGGACCTGGCTGTGGAAAACAATGGTCCACTCTGGGCACA
GGCAAGTAGTTCAGGGTGGAATTTATAAGTGGTATGTTTAGTGGGTGTTTTTACTTCTTT
TATAGACGTAGTTCATTGTTAGCTTGTGACTGCACATTTTTTAAAATGGGAAATATCATT
GGGACTGTATTGTGTAAGTAAGAATACTGAATCACTCTTAGTGATCCACTTAATTTCTTG
TTTTGTTAATCTACTCTTTGTGATTCCCTAAGTTGTTGACATTTCACAATGTAAAATTTT
ACTCCTGTTTTGTTTGCATAAGGAAGCTTTTAGATCCAGTCTTAACCATGCCTTTATTAT
TCAAACGATTTAGAAGGTTGTCATTTTGAAGGCTGAGAAATCTATTTGCATTATGAAGAT
GGTTGGGGACAGAAGTTAACAAGGAGGTTGGAATGAGAAAAGTAAAGGATTTGCTTTTCC
TTTTCTGATTATAAAAACAACTTTGATTTTTAAAGTCAGGTCTATTGAGGTATAATTTAC
ATATAGTAAAATTCATACCCTGTGTAGCAGTTTGATATGGTTTATGAATTCCAAAAATTG
GATTATGTTTATAAACTGGTCTATACCTGGGTGTGATTAAATTATGATTATGACTTTGAT
TGGTTCAATGTCAGTAGGACCAAGGGGGGTGGGGACTCAGAGATAAAACTAAACAGCAGA
GCAGAGGAGTTAGTTGGAGTTTTAATGTTAGAGTTTTGATATTGGAGTTTTGAACTGAAG
CCCGGGAAGTAAGCACACAGAAGAGCAGAGCAGCCTAGCCCAGACAGAATTGAGTCCTGA
GGAGAGAGACGAGCCATTCACCTGATAGTCTACAGCTGACCTTGTGGAGCAAGCAGGGCA
GCTGAGCCTGGAGAGAAGCAGAGCCCCAGGAAGAGAGGAACCCAAGAAACCTGAACCCTG
GCAGATGATGGCAGCCATCTTGCTTTTGATGAGTGAAGTATCTTATGCTTTATGGCCTGG
TAACTCTATGCTTTATGGCCTGGAACTGTAAGCTTCTATCCCAAATAAATAACCTTTATA
AAAAGCCAACAAATTTCTAGTATTTTGCATCAGCACCCCTTTGGCTGACTAATAATACCC
TGTTTAGGTGTAAAGATCAATGAGTCTTGACAAATGTATTCAGCTGGGTAACCACTACCA
CAATAGAGAGACATAGAATATTTTTATCACTCCAAAAAGTTTTCTTGTGCCCCTTTGAAA
TCAGTTTCCTACCGCTCTAGCCCCTGACAATCACTGATCTGATTTCTGTCCCTATAGTTT
TGCCTTTTCCAGAATGCCTAATAACTAGAATCATGCAGTGTGTAGCCTTTTGTGCCTGGC
TTCTCTTACTTAACGTAATGCTTTCAGATTCATCTTTGTTGATGCATGTATCAATATTCA
CTCCTTTTTTCTTTTTTAACATTGCCATTTCCTTTATTTCTAATCATTTCTTTACAAATA
TCCATGCTAGAATAACTCTCCAGTCATATTCCTCCACTAGAAAGTCAGATTCATATTTCT
CATTCTAGGGACACATGATCCGTTTGGTCCCATCAACCCCCCATAGCAATATAAACCCCT
CCCCCAGATTACCATTCCTTTTCTTGTTCCCATTGAACAGCTGTCTGAAATTGAGGCTTC
TGTGTTTCTTCATGGTATGCTTATATCCTAGGTTTCAGTTTCCTAGTGCTCAGAATGGAG
GCATTGGTGTGCACCCAGCTAGACAAGCTTATAGCAGAGGCACAGGATGGGTCTCGGGTC
ATAGAAGGTCCTTTTGCCACAGTGAGGATAAGACTTGGCCCAGGTTCAGATCATGCTGGG
TCACTGCCTCCTACAGCATCCACCTCAGCCTGGCATAGAATTGAGCAAGTCTCCGTGAAT
GGGAAGTTCTGTTAGTGTCTCCGGAGTTCTCCAGAGGGGTAGGATACAGCACCTAACTTA
ATTGCTCAGCCCGACAGAGAGCTTCAGCAGCTTCTCCAGGACACCTATGGAGACAGGGAA
TCCACAGAAGTTGAGAGACCATCACCTGTGACCAATGGCCCAGGGTAAGCATGATGGCAC
TGAATTGGGAGTCCATTATCCTACATTCATCTAAATCCAGGTCCTGAAGGGTGGCTGAGG
CTCTCTCCAGCAGAATCTTAAGGGGCCCAGGACTCATTCTGGTCAGGCTGATGCCATTTA
GGTGCATGTCCTCCTGATGACTGGCATTCAGGCATAGGAACAGATGCATCAGGTCTAATT
CCAAAAGCTGGCAATAGTGATGGAGAGGGTCTCCAGGAAGTCTTCAGGTACCTGAGCACT
TGGCCTGAGTGACCTTCCAGAAAGGAGATGGAATACAAATGCTGCTTGTGGAGATGGTGC
AGACTGAGGAACTGAGAGTAAACTGAGTGGCAATCTGCTCTCTCTTTCACTGGGAACATG
TAGGAAGATGTGGATGTTGGAGAGGAGTAGCCTGCAGATTAACCTTCTGGCACAGGTGAG
AAGCAAACCTCCCCAGGTTGGACAGTTTCCACATGCAATTCACTTTCAAACTCTGAACAA
TAAGAGTCCAGGTGCATCACCTTCAGGACCCTCTTAATATTTTGGGTTGGCATGGCAAGA
ATTTCCAGTTTCTTAAAGCACAGATGTAGTCATTGTTTTCTCTGCTTGACGTTCTTAATG
AGATAGGTGAGAAATCTCATCTAGGGTGGCCTCATTGAGGCTCCCATTCTTGAACACTCT
CACTTTTTGCCCCTTAGTCATGGGTTGGGCTGTCTCTCGTTCGGTCAGTGAGAACACATG
GGCCAGCAGTTTCCATTGCATAGAAGCTGGCTTCTGGTTCTTTCTGGAAAGAAATCTCAC
AAGATCTTGGGGATTCTCAAATGGTGTTGACCAGGGAATCCAGCGTATATGGGGCTTGCT
TTCTTGGGCTGGGGTAAAAGAGGTGGTAGATAGATGGAGAGCTAGTGGGAACGGCTGGGC
CTGGGGTGAGCAGAGGGAACTGGGATTGGGATGAGACTGAGGGTGGAGGAGAAAGAGGTC
AATTGGTGGGATGAAGGTGGTGGGGGTAGGGAACTCAGTTAATTCGTTTTTGTTGCTCAA
GTATGCCATTGCATTATTTATCCATTTACCAGTTGATGAACATTTGGGTTGTTTCCAGTT
TTTGGCAATTATAAAAAAGCTGCTATAAACGTGTAAGTTTTGAACAGACATATTTTCATT
TTTCTCTGGTAAATATCTAGTAGTGGTAAATACCTACCTGTCTTGTGTGGTAAATGTATG
TTTAACTTTGTATTAAATTGCCAAGCTGTTTTACACGGTGCAGTACCTTTTTGCATTCCT
ACTAGCAATGTATGAGAGTTCCAGATCCTCAAGGTAGAGGAGACTTGGTCAGAATGTTTC
TACTCTGACCTATTCTACAAAAGCAGAGCAGGATTTTGTGTGGCTTTAGAGAAACAGGTA
GAAGCCAAGTAGAGCATACTTAAAACTGGCTAAGGCTTTGGAAAAAAAGGAGAGAATTGT
TGATGCATACACCGGAGATTGGGAGCAATAGAAAAAGAGTGTGGAGGTCTTTGGGAATGG
TGAGGAGAGGGAGAACAGATAGAAAAAAACGGCTCTCATATTTATGGGTTTAATATCAAT
CAAACCTAAATTTGTTGGAGATCTTTTTGCCTGGAATTTTGCAAGTGTGATTTATAAAAT
TCGATGTCCCTAATGATTTATAGCTTTTCTCCATTTGAACCGTTTTTCTTATTGTATTTT
AAGAAATTGTCTGTTATCTTTAATAACATTTGTTTTATATCAAATGCCCTCTAAGTAGGT
ATTAATATTTTTTCCACAATAGCATGTAAAATATTAAAGTCGGGATTTATTTTTAAATAA
AATGAAATTACAAGTGAAAAATTTGGTTCTTTTTGAAGCAGGTGTGATTTGGAATGCCTC
TGTTCACTTGATATTTGTCAATTACAAAACTCCCAGAACCACCTCAGACACCCCATATTT
AAGACTCTCTTCCCCAAGAATCACTCCAGGTACCAAGCTGTATTAGGGTTCTCTAGGGAA
ACAGAATCAACAAGAGATATCTGTCAATAATATGTGATTTTATAAGAGTTTCTCACGTGA
CTGTGGGGATGCACAAGTCCAGGTTCCACAGGCAGGCTGCAACCCAGGGGCTCTGATGAA
AGTCCAGTGAAGGCTCATGATGAGTTCTGGGAGACGTTGGCTGTCCAAAGAAGAGCTGGG
AAATTCTCAGTCAGTGCTGGAATCACTTCCCCTTTTAAGGCATTCAACTGATTGGATAAA
GCATCACTCATTGCTGATGGCAATCACCCTGATTGATGTAATTATAATCAGCTATCTATG
ATTTACCACTGCAGTAAAGAGAGAGAGCATGGGAAGAAGCTGGAAGTCAACAGACCAGAG
CAGGAGAAAGGAGATATTGCCATGTGCATTGCTATGTGACAGAAAACCAAGAACCCAAGG
ATCACCAGCATCCAGCTTCAGAACACCACAGTCTTTGGGAAGAAAGTATCACCTTGCTGA
CACCTCAATTTTGGGTTTATCCTAGCCTCAAAACCATGAACCAATAAATTCCCATTGTTT
AAGCCAACTTATTGTATGGTATGTGTTTTAGCAGCTGGGAAACTTAGTATTTTTTTTTAA
ACCTGGTTTCTTTGTCACATTCAAAATTTAGCAACAATTTTTAAATTAATGTATGTCTTA
AATATTCTCTTTATGCATGAAACCTTACTTTCAAGGTCAGATATGAGGTCTATTTAATTT
TAGCTAATTTTCAGATGATTAATTTTAGCAAAAGATTCACACAGCTCTGAGATGAAGGGA
ATTCCAGATTTCCAGTTGTTTAGATGGATGTACCGGTAGGTTCTGCTAGACCAAAGGATT
ATTATAGCAATTGGTTAGTCTGAGGTGGCTTCAAATGGGGACATGATAAATGAATACTCT
GAAATCTTATTACAAATATAAATGAAGCATGGCTGCAGTTCTTACCCAGATAGCTATTTG
GGAGGAAGTATGTGTGCGTGGGAGAGGGGGGAACATATTTCACAGTGTGTTAAAATCAGA
TGCTTAATTTAGCTCAATAAACCCAGAGACATTTTCTCTCTGGTTATTCATCTTTGTAAT
CCATCTGAGAAAACGTTTTTTCTTCGTATTTGAAATCTAATTTCTATAATTATTGAATTT
TGAACATAGAAACAAATTAAAGGGAAAGTAGAAGGGCTGAGAAACAGGGTCAGGTTACAG
CTATAATGCCATAAACCAAAGGGATTTGTCAATTTTTCATTAATTTGATCAATGTATTCA
TTGATTCATTTTGCAAACTTGATTAATCACCTACATATTTCAGACACTGTGCTCGGGACT
GGAAACATGAGCATGAATAAGTGAAAATCTCTGCTCTATAGGTAGTAGAGTATATATAGA
TGCTTCAACTTAAAACATTTCCCCTCCAACGTTCCCTCATTGTCTTTCCTTTCTCTCCCA
CTCTTTGGGGGTAGAAATAATCAAAGGAATCAGACCTTGTACAATGTGGGTTGTTTCTCT
TCCTGCCTGATTTAACATTGTAAGTGATTGCGGCGTGATATAAAATTGATTATTAGAAAG
GTTGTTGGTGACTTTTTAAAAGCAACTTGATGTTATTCAATCTACTTCTTTTCCTTAGGC
AGTAATTTGTCATCATGCTCTCCTACAACATAGAAAAGCTGTTGGCTTTTAACATCTTGT
CTTTACTTATTAAATGCCTTTCATGAGCCAATTCAGTCTCTTGACCTTGACTTTCAATAT
ACTTTTTAGGTATTTTAAAATCCTTCTTTTTGTATTCTTCAGTTTTATAATCATTCCTGT
TTAGTTTTTCTTACTTTTTTCAAATTGTCCTCTTCTCATGGGAACTGATGCTTACAGATG
ATGTGCCATTGGTCTTGTTTCTTTTTTCTTTGGTGACGTCTCTTCTGCATCTCCAAAATG
TTCTGATTGTTTCGATCCCCATGTTGCCTTATATACATGATAGTTTTATTCATTACTCTC
ACATATATGTTGCCCTGGCAAGTCTTCCCTCCACCAAGTTTACTTTATCTGGGAAATGAC
CTCAACTGCATTTTTTGAATCATATTTTATGTTCTGCCAATATTAATTTTGCCCCTTGAT
TCCTTTTTATAATATCTCTTACACTCTTTGGATTTAGAACCAAAATACCATTCGGTGGCT
AAGTAAATGTTAGCTAATGTGTTCAACACATTAAGATACATATTCTGTGGATTCAAGGTT
TTACATTAACTCTAAAAACAGGAAGATATTTTTGGATGCATTAATAAAACCTCCTAGGCA
TTATCTTTCCCTTATGTTCCTTAACATTAATTTTAATTTTCAATATGAGATTTTAAGAAG
GAGCTTCACTTTGAGAGAAGGGTTCATGATTTTAAAAATTTTTTTGAAAAAAAAAAAAAG
AAAATTTAAAAATACCCAATTGAGGAAGAGAAAAGCCAAAGTATTATCTTTTATCTGTGT
CTGTAAACATTCACATTAATGTATGCTTTATCTTGGAAGTGTATTATTATCCCTGTACTA
TAATAATAAGATACCTCTGGTCCATAGAAACATCTCGTCTAATGAGTTCAGAGTAAGGGT
CAACAACAAGAAGATGGAGCAGGCCTACGAAGCTTCCTACGCTGACCCAACCATTGTTAT
CCACTGGTCCTGGTAAAACTGCTGGTTTCCTTGATAGATTGATCGATTCATTCAATAGAC
ATTTACATCTTTTCTGGGAGCCTATAGGCTCACTGAGGCTGAGTTGTTATCTTGTTCATC
ATTATGTCACCGGTACTGGCAGTGACTGATATATAAAAGGACCTTCCTACATATTGAATG
AATGAATTCATCAGTAGGGACATAAGCTCGGTTGAGGGAAGAAGACAGGAAGGCAGTTAG
GAGGCCTGGTTTTTTGAGTCTAGTTCTAGCTACTCTCTTCCCCTGAGTGGAATAGTGAAG
TGACTCATCGTCATAAATTTATCATTTCTCTAACAAGAGATGGCAAACTTCTTGTGTCAA
GGGCCAGACAGCAAATATTTTGGGCTTTGTTGGGCCACTTACAGTCTCTGTCACTGCTTC
ATTTTCTATTTTTTTAACAATCCTTTAAAATGCAAAAGTTATTCTTAGCCTTCAGGTAAT
ACAAAACCTAGCTGCTGGCTGGATTTGGCAGGTGGACTGTAGTTTGCTGACCTCTGCTAT
AGGATAAAATCATTAAAACATTATCCATGGAGTATACATTATACTGTAGGTTTTACCTGA
GGCTGTATTATAACTGACCTTCTAGGTTTTTCTGTAGCTAACGTCACTTGTGTTAGGGCC
AAGACTTTGTTACAGGTACATAGTGATAGAGCTCACTATGTTTTTATTTTAACAACTTTA
TTATCATATCATTTGTAATGTCTTAGGTTTTGATATTGAATTATGTTGGCATTGTAAAAC
AAGTTGAACAGTATTCCCTACTCTTCTTTAAAATTTGTTGGTGAAACCACCTGATCCTTG
AGTGTTCTTTGAGGAACAACTTTTGACAAAGAATTCAATTTCTTTAATAGATACAGGGCT
GCTGTGCAGTTTATATTTCTTCTAGTGTCATTTTTGCTCAGTTAAGTTTTTCAAGAAATC
TGCCCATTTCATCTAGGTCATCAAATTGGTTGGCATAAATTGTTCCTAGTATTTCTATAC
CTCTTAATGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTTTTCCC
ATGATTCTGCTTTACTTTATATTTCCTGCTCTCTACTACTCATGGTTACTGACTTTTCCT
GTATTCTAAGGCAGAAACTTATACTTAGATTTTAGATCTTTCTTCTTTTCTTCTGCAAAC
ATTAAAACCATAAGTTTCCCTCAAAGCACTGCTCTGGTTGCATCCCACATATTTTGATAT
TTTTGTAGTTTTAATGTAACTCCAGTAAGCACTTCTTATTGTGATTTTGCCCATGTGATT
CTGGTCCATGTATTATTAGGAAGCATATTGTTTAATTTCCAAATATTTGGGGTTTTGCTA
GATAGCTTAATGTTATCAATTTCCAATTAAATTCCACTGTGGTCAGAGAAAAAATTCTGA
ATGTTTTTGATACTTTTAAATTTATTAAGATTCACTTTAATTTCCAACCCATTGTTTAAC
TTGGCAAATGCATATGTACACTTGAAAAGAGTGTATATTGTGCAGTTGTAGGTTGTAGTG
TTATATAAATGTCAATTAGATGAAAGTGATTGTTCAGATCTTTTATGTCTATTAAATTTT
TTGTCCAGTTGTTTGTCAGAAGGATGTTAAAGCCTATAATTCTGACTGTTGGAATAGCCT
ATTTCTCACTTTAGTTCTGTTAGTTTTTGTTTCATGTATTTTGAGGCACATACAAATTTA
TAATTGTTATATTTTCCTGATGAATTGTTCTTTTATCACTGTGAAATATCGCTCTTTATG
TTTGGTAATACTTTTTTTGAAGCCTAGTTTATCTGATGTTAAGATAACAACTGCTACCTT
CATATAACCTTTGCATATTATACTTTTTCCATTCATTTTCTTTCAACCTCTCTGTATCTT
TGTATTTAAAGTCTACCTCTTTTAGATGGTATATAGTTGGTTCTTGCTCTTTATCCAATC
TGTCAATCTTTGTCTTTTCACTGGAGAATTTAGACCACGAACATTTAAATAGCCATTAAT
AATTGATTATTATTAACTATAATGATAATGTTAGCTTTTCTTTATCTGAGTATGTTTTTA
TTTTGACAGGGATTGTGTTAAATCTGAAACTCAATTTGGGGAGTATTGCCATCATAACAA
CATTCAGTCTTCCCATCATTGAATAAGGGATGTCTTTTTATTCATTTAAGTCTGCTTTAA
TTTTTTGCAGTAATGTTTTATACTTTTCAGTAAAAGTCTTACATTTCTTTTGTTAAGTTT
ATTCCTAAATATTTAAATTTATTTGAAGCTACTGTAAATTAAATTGTTTCCTTAAGTTCA
TTTTTTGGATTTCTCATTGCTAATGTATAGAAATAGAATTGATTTTTATATGTTGATCCT
GCAACCTTGTTGAACTCATTTATTAACTTCAATAGATTTGTGTTTATATGTGTGGGAGTG
TGTGGATTTTCTAGAAAACATTTTTATTTTGCCTTCATTCATTAATAATAATGTTTTATG
GATGTACAATTTTGGTTTGACAGTTTTTTTTTCTTTTAGCATTTTGAAGATTTTCTGCTG
TCTCCTGGCATCCATGGTTTCTTATAAGAAATCCATGATTATTCAAATATTAATATTTGT
TTCCGTGTATGTAATATCATTTTTCTCTAGCTCATTTCAAGATTTATTTCTTTATTTTTG
CTTTTCATCTTTTTTTATTATGATACATCTAAGCATGGTTTCCCTTGAGTTTATTATGTG
GGGGCGGAGTTTTGTGAATCTGTAAATCTATGTATTTTTAAATTTCAACATAATTTGGGA
TAGTTTCAGCCATTATTCCTTCATATATTTTTTTTCTCCCTCAGTTTCTTTCTCCTCTTT
TTTTTGGGTCTTCAACATCAAGTATTTTAGATCTTTTGTATTGTCTCAAAAGTCCCTGAG
ACTTTGTTCATTTTTCATTCCATTTTTCTCTCTGTTCTTCAGATCAGATAATTTCTATTG
CTATATTTTCACGTTTTCTGCCCTTTTCTGCTCTCATTGCCATTCTGCTATTGAGCCCAT
CCAGTATTTTTTTAAATTTCAGCTATGGTATTTTTCAATTCAGAAGGATCCAGCTGTTTT
TTTTTTTTTTTAAATAATTTTTTATTTATATACTGTGATTTCCTTTTCATTTCCATTTCT
TTCAAGTATGTTTTCCTTTAACTTGTGTGGCATAGTTGTAATAGCTGCCTTAGTGTCTTA
GATAATTCTTACAGCCTACTCAGCTCAGGGTTGGCTTCTGTTAATTGTTTTTTCACTTCA
GACTGGTTTAAATTCCTACTTCTTTGTATGCCAAATAATTATAGATTATACTCTTGGAAT
TGCAAATGTTATGTTGTGTCAAACTTGGGTTCTTTTATAACCCTCTGAAGAATGTTGTTT
GGTTTTAATAGGCAATCAAAACTTGGTTAGGATCAAATTGTAGTTTCTGTTTGGCTTTCT
TTTGGCAGTGTTCTAAATCTTAGTTCAGTTTGCTAAGCTTTTGCTATGCTTGTTTGGGTC
TATCCACATATGTATTTATGGTTCAGGAGTTAGGCTGGGACATGCATGAGTCTTAAATAG
AATTGAGGGTTTCCTTCTCTGTCTCTTACCCTCTGGTATTCCTCCCACACTCTAGTGACA
GGGATTTCTTTCCTTTTCTTCTGGCTGGAAAGATGGCAAGTTTTCTATAGGGGTTTTACC
TGCCTACACTGCAGAGTTTTTCTTTGACTAGAGCCCGCACTCAAAGTGAAGTCATAAAAG
GAAAAAATAACCAGTAAACAAACTCCCATGCTAGTCTCTTCTCCAAGTTCTGGCTGCCTG
CGCAGTTTTCCTGCTTTTGTTTGTTTTCATTGCCCAAAGTAAAATCTTTGCTATTGTTTT
GCTCTGTTTTGTTTTGTTTTGTTTTCCCCCCAGAGTTTAGAGTTATAATCAATGGGGAGG
GCTAGACTATAGGGAATGTATATCACTATGGCAGAATTGAACATTATCCAGTATCTTTTT
GTAAATAGAGAGAAAACTTATTTATATAAAGATTAAGCAGTGATAAGTTGCTGGAAGTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTGGAGAGCTGCGTATACTCTACTCTAGGCAGATTG
CCATCTGGGGATGATCCTGCTGATCCTGAGGCAAGTTTATTTGGGTGCTGGTCCTAGGGA
GCATGATGAGGGAAAGGAGACATGAGATTGGGAAGTGGTGAAAGCCAATAAAAGATGCAT
TAATGAATGTGAGCAACTAGGGCTCAATCCCCCTTGAGAACCCTTTGAGAGACTGCTTAC
AGCACGCCCCAGAATCGTCCCCCTGAAGGGCCAGGAAGCTGGCCACGATAACTGTAAGCA
AAATACTGTTTGAGGTAGGGTGCTTCTGGTTTATAAGTGAACTTTCTGTCCACATTGCAG
GGAACTGCAGTAGGGATGTATATGGTACCAACACTATCTGCTATTTGGTTGTCTTGGTTT
GCCATGTCTGCTGTAACAAATACCACAGACTGGTTGGCTTAAACAAGAGGAATTTATTGT
CTTACAGTTTGGGAGGCTCATAGTCTAAAATCAAAGTATCGGCTGGCCATCTTTTCTCCG
AAACATCTTCCATATTGCTCTGGTGGTGGCTTGCCAGCAATCCGTAATTCATTCTGCCTC
TTGTCACTTGGTGATATGGTTCCTTCTGTCTCCTGCTCCTACTGTGTCCAATTTCCTCTG
CTTATGCAGTCTCCAGTCATGTTGAATTAAGGCCCACTCCAGTTCAGTTGGCCTCATCTT
AAGTAGGAGATTCAAAGATTCTACTTATAAATGAATTCACATCCACAGCACCAGGGATTA
GAACTTGGACTTGTCTTTGAGAGGAACACAGTTCAATCCACAACACTGGTCTTTAGCCAG
AAATTTCATATTTTTGTAGGAACTCTTCTGATTTTTAAATATTGGCAGGTAATCAGTTTT
TTTTAATAACACTCAGAAGGCCAACTGATATTTATCTGGGCCAGATATAAGGATGAGCAT
TTTATGCACATTACATTATTTAGTTCTCAAAGAAAAAAAAGGTTATCCCTATTTTATACA
TGAGGAAACTGAGGCACACAGAGGTTGTGACTTGTCCAAGGCCAAATAACTGTTAATCAG
TGGAACCAGGATCTAGGCAACTGGCTCCAGGGCCACTGCATTCACTGCCTTGATCTATTC
TGATTTTACCCAAACCTAAAGTGCATGGGAAGAGACATACCCAAAACCCATCAGCAGGGG
ACTTTATCCCACCTAAACTTTCTCTGGTTCTGTAATAAGATGGTTCCTAAAATAAAAGAT
TAGACAAAGAAAAACATTTTTTGTCCTCTGATAAAATTTTTAGTTTCAGGGGTTTTCTTT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNACTTATTTAATTATCATTTCATAATTCATTTCTTA
GAAACGTTATTTAATTTTCTTAGAAGTTAGCTTGAGGTACATTTCCTTTTGTTCTTTTAT
TTAATATGCACCAATTATTACCAAGTATCTATTGTGAAGCTAGCACTGTTGACAGGTTTA
CACTTGACTATTGCTTAGTACCTCACTGAATAATTGAGTAATTTTCTAATTATACATTGT
AATGAATGTTATGCTTGTGGTTTTTTTAAAGATAAATAAAAGAAATTTCCAAATGTTGTA
GTTAGGAGGAAAATTAAGTACTAATTTGTCATTCGCCCACCATACAGCCACCTCTGTGCA
AATCTCTAGAGGGAATTAAAAAAAAAGTAAGATATGTAATAGTTATTCTCTTGGAATTCA
CAATATACTTGATGAGCCAGATCATACATGAAAAAAAAAATGGGGATAATACAAGACAAG
AGCTATTAAGAGCTGAGAGTAATGGTGGAACTACAAAGTATAATAGGGATTCAAAGAAAA
GGGAACTGGTATGAACCAGAATAATCAAGTAAGGCTTCTTGTAGGAGAGATGACTAGAGC
CTGGCTTGCAAGCTAACTGGGTATTAATGGCTTGTCTTGCTGGATAAGGTTTTATGTATG
AAAATATTATTGATGCCAAACATGGTGCCAAGGAGATTCAAGGTAGTAATGTTGAAGCAC
TGTATATCCTTCTTTTAAAGCCCTCATGTCACTGCCCTGCATAAGTCACTCTCCATGACC
TGGTTGCAAACTCCCTTCCTCGTTTTACCAAAACCCCATTACTCGCAGGCTAGTTTCCGG
CCAGTCTGCCATACTTTATGACTCCAGGAAGTAAATCTGTTTCTCTCCATCTTGCACACT
TTCTTAGGCTTTCACCTACCAGGGATTGCCCTCCCTACTCTAAGTATGGCCCCTCTCCAC
CACCACCGTTTTCCTGAAAACATTTGGTAGCAAACACGGCCATTATAGAAAAAGCACCTT
TATCTCCTATCTTTGGGGTAGTCGTGGAGTCAGCTTCCACGTTCTCTTTTTCTCCTATCT
CTCCTGCTTCGGAACCCTATGGGCTCCCATGTGATTAACCCAGCAGATGGGAGATCCTTA
GATTTCTTTACATGCAATCTCAAACTACTGAAACAATGAAAAACAAAACAAAACCAGAAT
TCCTTAAATACTAATAGGAGACTGAGGAAGGTTAAGGAGACTAAATCTGAACTTTCACTG
CCCTTAAGACTGACTGACTTCCTTATTTATAAATAAAGGCAAGACAAAGTTACTACAACA
CGGAAAAGCTCTGAGACAAAGTAAGGTATAGATGGGAAAATACTTGAAAAAGTGAATTTA
AAAGAAACCTTAATAATACAAAATATAAGTAGAAACCTGAACAGGATTTTAAAGTGCTTT
ATTAGCTAGCATGCTCAGACATTATCACCTTCTTTTCAGACCACTTTCATGTGACCAGTG
AGAAAAGCAAAAATAAGATTTAGGAAAAAAGTTTTATTAGCTATGAATTACATCAATTTC
TATATATTATTTCTGTGTATTCTTTTTTCTAACTTAAGGGAAAAAGTTATTAAGTTGTGA
AAAAATTACTTTGAACCTAAATATGATGCTTTTTAAATCATGGAATAAGACTTGGAATTT
TAAGAGAAATATTTTATCCTTAGTTAATATCAGTGAGCATCTTTTCTGGAAAATTTAGAG
ATTCCTCTCTTATTGTGTATTTGCAATAGGATTCTCAGGAGGTAAACATTTAAATGAGTG
GAAAATTTAGAGGTAGTCTTTTCAATAAACTGTCTGTTAAGCTCAAAGAGTGTTTGTTGG
GAAGCAGATGTGGCTCAACTGATAAGAGTGTCTGCCTACCATATAGGAAGTCCAGGGATC
GAACCAGGGTCTCTGACCATGTGTGAGCTGGCCACATGCAGTGCTGCGCATGCAGAGTGC
TTTGCATGCAGGGGTGTCCTCCACGTAGGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGCTTTCCTAAGTAAGAATGCATTACTTTACTAAATAATATTTAAG
ATGAGTAAGAAATCCACATTATTGCCTAAAAATGAGAATATGTGATGTTTTATCTAGGGA
GGTAGGCCAGGGCTTAGTATCACAGATATAAATAAAACAGCAGTAGCCTTCAGGAAGGTA
ACCCAAATATGTGGGGAAGAAAAAAATACTTCCTTATCCCAACAAACCTTATTTTAAATT
AAAAAGTAGTAGTATGACAATATCAATACTTAAAATTATTAAATAAGCTCTCCATAATCC
CAGCATCCTACCACATTTGATTACATTTAAAGTATTTTCTCTTTGCAGTCTTTGTCCCTA
TCATTATGTATATTTTACCAATTATAATTATAGTGAGCATATAATTGAGTATTTATTTTT
CACTTAATGGTGCATCGTTAACATTTTTAATGTTGTTTTTATAGCCATCATATTTGTATC
CTACTGAAAAGAAGTGCCTCCATTTACTTAAACATTTCCCTAATTTTAGTGTTTTTATGT
TTGGTATCATAGGCATTTATGCAGTAAACATTTTCATCCATATATTATTATGCTTGAGTG
GTTTCTTAGGATAAATTGTATAATTACTGGGTCAAAGATCAAGAACACTCTTATAAGTAT
AGATATATAATGTCATTTTATGTTCCAAAATAGTGAAATATAGTACCATGTAACTATAAG
CAATGTATTTGTGTTACGGTGCATTGACAGCACTAAGAATTTTCTTTTTTTCTGTATTTT
CTATATACTGAATGGCACTTTATTGTTGTTTTAATGTGTATTTCTTTGATGGTAAGGATG
AAGATCACTCCATGTTGAATTTTGTCCTTCCTTTGCAATAATTGTTAATGTCCTTCAACC
ATTTATCTTTTGGATCCTCGATTTCTTTCTAATGGCCATCATAACTATTGCAATTGGTTA
GTCATGAGCAAGGCTTTTTTGGGCAAAAGAAGCACTTTCAAGACAATGGGGTATTCAGAG
AGAAAAAGCCCTGGGAACATAATTTATTTGGCTGGGGTGAGGTAATATGGTAATAGAATT
CTCTCTGATAAATGTCTACCCATTGTGTGAATGGAAATAAATAGGATACTGTTTTAGTCA
TATATTGTACTGCTATTTCAGAATCCTTAAAGAATGTTTTCTGACTGAGTGAGTGAAATG
TTTTTTTACTTCAGGATAACAGATAAAGGTTATTTTCTGTCTTGGAGTATAATTCCCTGC
TCCTGGCACAGAAACTCATTTTTCAGGGTCTTGCATTTGCGATGTGCCAGTGTGGTGCCA
AAGGTCATGTGGATTTGTAGGAGTTGTTTCTCAGGCACCTCTCGTATTCCATATTACCTG
TCACCTCATTTTCTCTCTGACACTAATATGTCCTCCTCTACTGGCCTGACAGAAGCAATG
TGGCATGCTAAGAAACCCGCTGCTGGGTTGATTGTGTGAGTCCATCTTCCAGCCTTGCAG
TCAGCTGATGAATATATTTGGTTATTGAAGGATTTTGGCTATTAACATCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGAAAAAGCCTCTTTGCTTTTGGATATCTGCAAAATCATT
ATTATTGGTGTACTCAAAGAAAGAGGTAATTTTCATTTTAGTGAGGGACCTATTGTTTTA
TTTTTTTATTTCGAGGAGGTACTATGATCGAACCCGGGACTTCTTACATGGGAAGCAGGC
ACTAAACTACTTGAGCCACAGCTGCTCCATAGGACCTACTTTTAAAGTAGAGAAGTATAT
GGTTTTCCCCCCAAATTTGGGGATCACAGCATAAATCATAGTAATGCTTGGTTACCTTAT
GAAAATGGTGGGAGAAATTGTCAATCTAATAAATTATTTCTGGAAACAGTCTTTCTGTAG
TGTGATTGGTAAAGGATCTGATCACCAAGCACAGGCAAGTTTAGAGGCAAATCATGGACA
AGGCTTGAGCCAAAAAAATGTGTTTGTAGGTAAAGTCTCTGGAGGAGATAGTTCTTTGGT
CATTGACTGGAACCCATGACCAAAGCAGTCAGGCTAAATGGTGGTCAAAGTGAGGGTTGA
GTTTGCCCTGTGTCTATGACAGGCTGGGCCATGGTTCATAGTCGAAAGTCAGGGCCAGAA
AGGGTCCACTAGGGACAAACTTCTGTGACTGCCAGAGGAAGAAATCTGTGTGGTTTCTCT
TCTGGGATGGTTCAGCTCTTCCCTAATAAACCTTGTGTCTGGAACTGTCCTTGGCATGAA
AGCTCTCAAGATGGGCCCTAATCCCCTGGGTGTGTGGCTAGGTGCTTAGTTGCTCAAGGC
CTTTCCATTTCTGTCTGAGTTCTCTTTCCAAATGAGAAGGAGCTTTGGGGCAATAGGTGA
GTGGGAGCAAGGAAGGAACACATGTCCCCTGTTTGATATAGTCCACATAGTAGGGGGAAA
AGGGAGATCAGGAAGCTAGAGGGGAAAAGCCCCCATGAGCCAACCAGACCAAACTGAAGT
GATGGCTTGAAGGATGGGGGCCATGGGGGCAGCAGAGAGAATCTATAGACTTCAAAATGG
GGCAGGAGTGCTGTGCAGCCAGGGGAAGGTGAGGCCTGGACAAAGTCTCTACAGTGTTGA
CTCAGAGACACTATTAAGAAGATTCTCAGACTTCACTGTTGGCTAGGCAGCAAGATATTA
AGGGTTTTCAGTCAATTCAGAGAATGTCTAAAAGTACTATATTATCTTCTGAGAACACTG
GAGATGCTTCATTTGAGAGATTTGGTTCCTTTGAGGACTGACAAAGGCTGATTCCTTGAT
GATTTCTTAGTCATTGGGCTGAAGCTCATAACTTAGGTCCAAAGGACTTCTTTAAACCTA
CCCCCAAATCTCAGGATCTGCCACTGCTGGGCTAATTCTCGTAAGAGCCTTTAGGGCCCA
GCAAGAGAGTTAGGAGAATATGAAAGAGCCTAAGCTGACTCTGGAACTGCCATAAAGGTA
GACGCAGAGTGAGTTTTAATGCAGCAGCAAGGAAGAAGGAAGAAGAGAGCTATACTCCTG
AAAGTGAGCTGTTCTTACATTTGTTAATGAGCTCGGTCAATCAGTGTCTTGCAACCAGAC
CAAGGACCAGCAACTCCTCCTCCCTGGTAGAAGTGTGAGGAAGGCTTTGAGGAAAGGGAC
AACCAAGGAACGGTGTCCTCTACCTTTGCATTGTGGAAAGATGGTTGTTAGTTACCCATG
TCATACCCATCCCCATCCAACAGTTACTGATTTGTCCTGGTTTTGAGTATTGAGTCTATC
AACAAGACAGTTAAATTAAAACTGGAAATATTCAGAGGACAATTTGAATAATTTATGAAA
CTTGCCTAAAGTGTTTCTGTGGACTCAGATACTGTGTAAATGGAGGTCATTTTTTTCTGT
ATCTTATTTCTTTAACATATAAAAGTATCCTTAGATTTGTTTTATTATTCATATGGCTTT
TGCTTGAAATACAGTTTAAATATCTGATTTTCATTTTTAGATGATTCTTAAAAAATAATC
CATTTTAGTTCAATTTTTAAATCCTCCGTAACAGCCTTCTCCTTTCACTAAAAATCAATA
CCATTTCTTCCGGGAAATAAATCCTGACTGAGTATGAGCAGATTCCTATAACTCTCAAAA
GCAAGGCTGGTCTTATGACAGCTATTTGACATTTCAGATTTAGGAAACTTAAAAGAAGAT
ATTTTGATGTTTTCCTTCATTTGGTTGCAGGTTTCCAGAGGAAGGTAGTCCCTTCCACAT
TCTAGATGTTGTTTTGAAGCTATGCATATTCACCCAACACTAAATCAATCTTGATAGAAG
CCAGACAGTTTTGCAACTCAAATCTGGTTGCATCTCAAGCAGACACAATAACACAGTCAA
CTGGATCATAATAAATGGTGAAGTTGATACCTTATTCTAGTTCAGTGAACCTGAGAATAG
TGTGTGTATTCAAGTGTGGCAGAGAAAAATGGTTTTATTTATACAAAGACATTTATGGGA
ATTTTCTTGAGCTTGATAATCACTACCCTGGTAATTAAGGCCCTGGGATAGTATGGAATT
GGTCTTATTGTATCTGTCTTGCATTTGGGAAAACTAAGAAAAGGAAAATGTTAAGAATGA
TTTGTCCAGCAATGTTCTGTTTTGTTTATAAGGTCATCTTGTTTGGCAGTGCTGACAAGC
AGGGATACTTTTCTTTTTACCTTGTTAGTTACAACTGCTTAATAAGAATAAGCAAACAAG
GACAGTGAGAAATTAAAGGTGAAAAGTGTGCTGGTCCTAATTTAGTTCTCCACATATAGA
TTTGGTGATAATGAGCTAATTCCATTTGGGAGTGATTACCTTTGCTCCATGTAAAATTTA
AACTCCAGAATTTATGAGAAGGCGGCCTTAAGGTTGCCATATCACATGAGCCATTTAACA
GGGGCAAATGAAATTAAGCAATGAATTGGTTTGATTAGTGTTTACTGTACAGTTATACTG
AAGTCATGCTAGAGATATTTGCATCTTGCCATTCAAGTTCTTTAATATGGGCTTTCAGAG
TGAAGTTAGTTGGAAGTATTGCATAGGCATGAGATCCTGCTGGGATAATACCCCTGCCAG
TCTCTGAGGATCAATCTGGTGGTCTCAGTGACCTTGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTATAATCCCGATTTATGAAAACGTTGTGGCAAAACTCAAGAAAGAGTTCTCGTTGTT
ATGTGCAGTATGTTGGTTGGTAGAACAAGTAAATGATTATTCACAGCAAAAACTCTTACA
AAAGCAGGAAAAAGACATTTGAGGTGTAGATTTCTGTTGTTCAGAAACAGCAACCTTGTG
GAGGGCAGCCGGTCTCCTTTGCCAAATATTTGAGGGCTTTAACATCAAAAGGTGGGTGGG
AAGTTGGGGAAGGGATAGGGAAGAGATTGTTCATCAGCAGGAAATTCATTTCTGAGGGAC
TGGAAAGACACCCATGTGTCCTTCTTGCTGTTATGTCACAATGGATGGCAAGGTGGATAC
AATTCTCTGGAGCATAGGAAGAAAATATTATAGCTTTAATCAATTTATATAATCTATCAT
TTTCATGTATTTTAATGTATACTGTATTTTGGCACAGATGTTTACATATACAATTTATGA
ACAGATACATAGATGTAGTGTATGGGGGGTGCATGTTAAAAAATTTACTTACTAATGGGG
CAAAGAATCTAAAAGTTTTGAAATCTAGAACCAGGTAGCCCTCTTTCCTCTGAAAACTAA
GCCTGTGTGCTCCCAAACACTCCATAAACCATAAAAAAAAAACAAAAAAAAACAAAACTG
ATTTGTTTTCATCATGTAAATTATTGCTTCAGTTTATTAACTGATCTTATTCCTGGTTTT
GAAAACAATTAGTTTTCATAGACACTGTGGTAGGTTGAATTATGTACTTCGGGGTGGGGT
GGGGGGTGGGCAAAACTTGTTCTTAATCTTAATTCATTCCTGTAGGTTGTAAATAGGACC
TTTTGAAGATGTATTTTTGGTTAAGGTGTGCCCAACTGAATGAAGTTTGGCCTTTATCCT
ATTACTGGATGCTTTATGAAAAGAAAGGCACAAAGAGGCCAGTGGAACCCAGAACCCAGT
GACAGAAAAAACCAAGAACCCAAAGATCTCCAAGAGCCAACCCCCAAATACCACAGTCTT
CAGGAAGAAAGTGCTACCTAGTTGATACCTCAGTCTTGGCCTTCTCCTAGCTCAAAACCA
TGAGCAAGTAAATTTCCATTGTTTAAGCCAACCCATTGTGTGTTTTGCCTTAGCAACTAG
GAAACTAAGACAGCCTCCATTTCCTCATTTCATTTTTTAATCCTCTTGCTCTGTATGTAT
TCATGCAGACCACCTTGGGTTTTTTGTGGAACAAATGGGGAGCATATAAGTTGAAAGTGC
TTAGAGAATCCATTATTCATCAAGCTATTAGGACTTTCCAAGGCAACTTCACAGTTGGTA
AGTGGATATTTCTATTGTGGTACCTCTAAGTAGCATGAAATAGTCAACTTATTACAAATG
CTATTGTTTTGGTAGTCATGTTTTTCTTTCTAATAAATCTCTACTTTGCTGTTTTTCTGT
TGCCCTCAGATAATAAAATAAGTTGGAATTGTGAAAACAATTCTTAAAATAGAATGCAAT
TCTTTGCCTATAATAAGAGCAGCTTTAATTCAGTTTCAGTGCAATGAAAATATAATGAAA
ATCTCAACATCAGAACATAGAATCTGGTGAAAGTTGCTGTCAATACCAAGGAGCTATTCA
TAATCTTTTCAACATATAACAAAACATTTCATTTCTCACTCCGATTATTTGTGGGGCTTT
AAAATATTCTTCTGATAATAAAAGGTGTCACCAAGTAAACCTTAACAAGATGATTTTATT
GCAATTCATAATTACAAGAATAATTTAATTTGTTATTCAGGATGTGGGAAGGCATACAAT
ATAATATTTAATCACTAAGTCCAGTATAAATGCATCCCACGCATTTTAGTTACTCTCATC
TTCACTGCAATGGAACAGAGAATGCATCTCATCTCGTACTTCTGTCAACCTGGATCCCCT
TATAAAAAATAAAGAGCTAATCGTATTGTTTGGTACATTCAGTACACTTGAGAGAATGGC
TGCTGTATTATGCCAGCTGCAACTTCCTGCCCTCATCCAGTTCACACTTAGGGTTGCACA
AAAATGGCAAGAGAATACAATTTAAGGAGATGAAGTCTAGTTCTCTGGGCTTCCATCTTG
TGCATTGCTATTAAGTGCTATGGTAAAGTTTTTTTCTTTCTCTTAAAGAAGTTGACCTTT
TGTAACATTAAATTAGCATCTTAAGGTAAATACCATATTTATTAGATTCTAAGATGATAC
ATCAGACAGTAAAACTACCAAGTTATGTTGTAACAACTCCAAAACCTCAATGGCTTACAA
TAACCATGTATCTGGCTCACTTTACATGTTCTTTGCAAATTGGCATTATGCTTACCCAGA
AACTCAGGTGTGGAGGTGCCATCTCCAACCATGATTTCACAATAGCTGAGACAGGGAAAA
GAAAGCATGGGAGGGAGGGGTTGTAGCCATGTTCTACTACAGAAACAATTCTTGTCATTT
CCACTTAGAGGCACACCATTTTCAAGCAAGCAGAATACACTAAAATTCTACCATGTACCC
AGCAAGAGATCCAGGATTTGTGAACAACCCTAATAGAATCACAGAGGCCACTGATTGAGA
GATGTACTACCAATCTAATGAGAGTGATTTTTTTTTTTTTGAGAGGTAGGAGAAGAAACA
CTATATTGTGCTCCCATAAGGTTTAGAAGATATGCTTTAGGACTGCAGTATTTAAAACTA
AACATTGTTTGTATCCTCAAATAGCTTGAGGGAGGTATGATGATATCTGGTTAGAGGAAA
ATACCTTAATTATAAGTGCTTATAAAGGAAGGATAAAAGCCAACATAACAAATAAGGAAA
AACAAACTCTCCATACTTCTTAGAAGCTTTCTGATTTAACCTCTCTGATTCTGTATACAG
GAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTTGCTGGGGGGGGG
AGAGGTGGGGTGGGGGGGTGGGGTTGCCATGGGACCTCACATATATATTTTTAATGTAAT
ATTATTACAAAGTCAATAAAAAAAATAAAATAAAAAAATAAAAAAATAAAAAAAATAAAA
TAAAAAAAAAAATGGTTCTTCTGTCACAACACGAGGGATACCCACATTTTGCAGTGTCTT
GTGTTATCATCCAGATTTTCCCTAAAACATTAAAAAACCTCAAATATTGGACACACCTGA
TGAAATATGGTCACTTTAATAAGCAAAAGAGGCTTAACAGTATAAAGTCAGGCAATATGA
AATAGATGAATGTCTAAATGAATGAATCATAAGAAAATTAAACTTTTGTGAAGTAAGACA
CAATCCTATATAATTTTGCCAGTTTAAATTGAGGCTATTTAGTAAAACAGATAAATAATA
GCTAAAATGCATTAATTCATTTAATTCTTAAGTCAGGGGCATCTGTTTTTCAAATTTTAA
AGATATCGACCCTGAGGCTAGTAGATAAGTAGCTTGCCCTTTGTTGTACAGAGGAAGGAG
ACCCAGAGTTGAAACCACATGGTGTGGTCTTAAAGCCCAAGCTTGGGCACTACAGCCCTG
TCACTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTTTC
TTTCTTCAGTAAAATCATTGACACTCACAATTCCAAACATATTGCAAATCAGCTTGATAA
ATTTATCACCAAGTTCAGACCAAGTGACACTCACAGAACAGATAGTCATTAGTAGTCTCA
ACTGCCTCCCCATACTAAGGAGAACATAAAAAGGAGCAGAATGGACCATCCACTCCCCAG
AGAGGCTGGAGGCCACCATCATGGACTTGAAATTGCTTTTTACATGCATCAATTGAAATG
GCCTCCGCATAGCAATTAGTTTTAATGAAGGGAAGCTGTTGATAGCTAAAGGCTGCCAGA
CCTTCTGTTAGTTGTTTTTAGAGGAAATAGATTGTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGAAGCAGGCAATCAACCACTGAGCTATACCCACTTCCCAGAATTTCCTTTTAAAAGA
TATTTTATTCATCTCCACATTCAGGGATTTTCATCATATTAGATGTTACATAATTCTTTT
GTATCTTCATGTTTATGTTATAAGAAAAAAAGCTGTAATTGTTTATGCTGTGTGGCCACC
AGAAGACTGGGAAACTGCAGTCTGTAATTGGAGGTGGAGGAAATAGAATATACTTTGGGT
GAACCTTTCCATAAATTTTCTGTGATTGATTTGTCATCAAATTTCCACAGAAATGTTTGT
TTTCAGTGTGAATTGACTCTGCCTGCTTTGTAGATGTTTTCGAAAACAAAGGAAAGAAGA
TCTTAATTGGCAAAAGGATTGCATTCCTTTCCTTTCTGTATCTGCTACCATCCTTACTCC
AGTCCAAAGCTTCTCAACACTTGTACCTTTGAGTATTCTAAGTTTAAGGACACAGAACAG
AACAAAAGGGCAAAAATGATACAGTTTGACAAAGGTAGTCTCTAAAGGAAATATGCAACA
TGTGTGCATCTTCTTGGTATTTTCATTGGTATGCTTTGCTTTTCAGTTATTCACGGAATA
AAAGACTGTTTCTGAAATTCCCAAGTGGGTCAGAAGCCATCCTTCCCTTCCTCTCCCCCA
TATTAAATATTTGAATACAACTGAGCCCAGTGTTCCTCACACAGTGAAATCATTCTTCCT
TCTCAGCAATCACTCGGGATTGACTGTTGTGAGTAGCTGATGCACATAACCATAGTCCTT
CTAAATTTCATCCAAGGGGAGGAACTGTGGTCTGGTGCTACCATTATTGTTGATTCTCAT
CTGAAAATATTTTTAGCAAATGCCTGAAAAGAAATGTGGAGTAACTTTTTTGAAGAATTT
GTATCAATTCCTTAAAAAATTATAGTAAAGGTGTCATAATACACAGGAGAGTGACATGAC
CAATCATGTAGACAAAAGTGTCTGCCTAGATTGGAAAAAACAAACTCATGGTCTTAGTGC
CTTTGCAGGTTTTGATTATTTTAATTAAATGGCACTTGGGGAATTGTACATTTCTTTCGT
GTCCTTGGCTGACATAGATAATAGATCATAAGTTCAGAACCACAATGCACTTATAATAGC
CACAACACCTTTCAGTACTCCTCAGAATTGTCCAGGGTTCCCTTGTTTGGACAGCGGCAG
CTGAGCAGCACTAGTTTATTATGTAGGTGATGGCTCAGGCGGGGAGGTTGGGGACGTGGA
GAAAATGGAAGAAAAGTCAAATATGAGTCGGCTCAGCCAGACTTCGGTGGACTCAACGAG
TGCATAGTGAATGCTTTTGTTAGGAAGTTTCAGATTCTGCCTGTGACCTGTGTGACCTCT
CGTCCCTGGAAACTTCAGACCTTAATCCCTTTGAATAACAATAAAGCTGAAATTCTGACC
TTGTTTTCTGAACTTCTTTAACTGCCCAGAGGAATTGATTACTTTCTGTATTATACCACA
TGTAGTCGTTATCTGCAGTCAAGACTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGTCATAGAACATCTAAGAGAAGAAGACAAAATTTGCTTTTATCATTGTTTAAAACGTAA
GTGATAGGAAAATGATGGGAAACCTCTAGGATCTGAGGGCAAACTCCATCCAACAGTCGG
TAAGAAGCTAGGGCCCTTAGTGATATAGCTTCAAGGACATGAATTCTGTCAATACCTGAA
TGAGCTTGAAAGTGGCATGACACCTGGATGGCAGACTTAGAGACTCTGAGCAGAGGATGA
GCTAAGTTGTGCCAGGACTCCTGACCCATAGAAACTGATAATAAATGTGTGTTGTTTCAA
ACTGCTAAATCAGTGGTGATTTGTTAGCAAGGGAAAGACTCATGTAAAGACCAAAGAATA
GAGTTCAGGTTATTGGTAAAGGCTGACCTTAAGCAGCAGTTCGTAAAATTTGGTAGTATA
AAAATCAATTAAGATATTTACTTAAAATGCAGATTCCCAGTCCCTTGACCCATTGGAAGT
CTGATTCAGTTGAGTCTAGTTTGAGTTCCAGGAATTTTGACAAGCGCTATAGGGGATTTT
GATGCACTGTTTGGAATTACTCTTTGAGAAACAATTAACTAGGACTATAGCCATTGATGC
AGAGGAGAAGGATAAAGTTCTAAGGTATTGAATAATAGAATTGAAATGATTTGTGAGCAA
CTGCTTGTGGAATATAAAGGTGGAAGATAAAGGTCAATGAAATGGTTGACAAGGTCATAA
ACTGGGAAGAAATGTGAGAGAAGGAGCATAGTTGTTGGGGTACACTTGGGAGATATGTGG
AATTTGAGGCCTTTATAGGAAAATAGGTGGAGGTATAGAAGTCAATTTGAAATCCATTCC
TGTAGCACAGAAGAGGCTGGTGCTGGAGATACTGGTTGAGAGTCAAGTTAAGACTTGACA
GTAGATGAGATTGCCCAAGGACAGAGAGTCAGAGTGAAAAGATAAGAAGATGTAAAATAT
AACCCAAGAAAATCCCATAGATAAGTGGTGGATAAAGGAAAAAACACAAGAAATGAAGGT
GTCATTCGTGGGATGGAAGGCGTCTGGGATAAGATTGATGTCCTGGTAGTCAGGAGACAG
TGAATTTCAAGAGAAGTGTGACTAATAATCTCAAATGATAAAAGTTCAAATGAAACAAGA
GCTAAAGACGGAATTTCAGGCAATGAGATTATTTCAAGAGAAAGTGCAGTGAGTTTTAGG
GATTTAAACCAGATTGCAGTGGGATGAAAAACAGGAAGGAAGAAATGGGAGACGAGTAAG
TATTCTACAGGCTTTAACATGCATCAGAATCATGTGGAAGACTTGTTAAAACACAGATTT
CTGGGCTCCACTCCCATATTTTCTCATTCACTATATCTAGGGTAGAGCCCAAGAATTTGC
TTCTTAGAAAGTTCCCAAGCATATTAATTTTCTATTGCTCCTGTAAAAAATTACCACAAA
ATTTAGTGGCTTAAACTATGTGAATTTATTACCTTATGTCTCTACAGGTTAGAGATACAA
CAGGGATATCACTGAGCTAAAATCAAGGTGTTGGAAGGGCCGCATTCCTTCTGGGACACT
GTGAGGGAGAATCCATATCCTTGCCTTTTCTAGCTTCTAGAGATCACCTGCATTCCTTGG
TCCCCTTTCTCCACCTTCAAAGCCAGCAATTCTGCATTTTTTTCACCATTCATCTGTAGT
CACATCTTCCTCTCTTTACTGGGAAAGCTTCTCTGATTTTAAGGACTCGTGTGATTAGGT
TTAACCTAACTGGATAATCCAGGATGACCTTGATAGCTCAGGATCCTTGACCTTAATCAC
ATCTGCAATGTCATTTGGCCATGTAACAAGATAGTCATAGATTCTGGGGATTAGAACACA
GACATCCTTGAGGGCCATTTTTCTACCTACCATACCAGGTGATGCCGATGCTCCTGGTCT
AGGACCAGACTTTGAGAACCACAGTGTATAGTAACGTCAGAGAGAGAGAGAACAAGAGCC
AGCCCTAGGTTAAGGGAAATTTTCTGAGGAAAACTTGGGCATGCTTTGGCGGGGGGGGGG
GGGGGGGGGGGGGGGGTGGTTGCCTTGAAAAAGGGAAAAATCCTGTAAAAAAGGAAAAAA
GGCTTGTCCCAAAGAGGAGAGGGGCTCAAAAAACCCTTTTCATAGGGGGGGGGGCCCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCCCTGGTAACTATATTCTAGTTTATAACTCTGTGCATTTGAC
TATTGTAATTATTTCATATAAGTGAGATCATACAATATTTGCCCTTTTGTGTATGACTTA
TTTCACTCAAAAGGATGACTTCAAGATTCATTCATGTTGTCACATGTAGTAGAACTTCAT
TCCTTTTTAATGACTGAATATTATTCCATTATGTATATATACCACATTTTGTTTACCCAT
TCATCAGTTGATGGACACTTAGGTTGATACCATCTTTTAACAGTTGGGAATAGTGCTGCT
GGGAACATTGGTTTGCAAATATCTATCCCTGCTTTAGATGGGATTCTGAGTCTTATTGTA
ATTCTATATTTAATATTCTGAGTAACTGCCAAACTATCTTCTACAGCGGCTGTATCATTT
TACATTTCCATCAACACTGAATCAGTGTTCCTGTTTCTCCACATCTACTACAACACTTGT
AATTTCCATTTTTAAAAATAGTAGCCATTCTAGTGGTTGTGTAATGGTATCTCATGATTT
TGATTTGCATTTCTTAATGACTAATGATGTTGAGCATCTTTTCATGTGCTTTTTGGACAT
TTGCATATCCTTTTCGGGAAATGTCTATTCATATTTTTCCCATTTTAAATTGGGTTGTTT
GTCTTTTTGTCATTGAATTGTAGGGTTTCTCTATATATTCTGGATATTAACCCTTATTGG
ATATGTGGTTTCTACATGTTTTTTTCCCTGATTGTTATTTTACTTTCATAATATAGTCCT
TTGATGCAAAAAAAATTTTAATTTTGATGAGGTTCCATTTATCTATTTTTTCATTTGTTG
TTTGTGCTTTTTGTGTAAAGTCTAAGAAACCATTCATTGCCTATCACAAGGTCCTGAAGT
TACTTCCTTAAATTTTTTTCTAGGTGTTTATTTTTCTAGTTCTTATATTCAGGTCTTTGA
TACATATTGAATTAATTTCGTATATGGTATGAAATAGGGAGCCACCTTCATTCTTTTGCA
TATGGTTTTCCCAGCCCCATTTGTTGAAGAGGCTGTTCTTCCCCTGTGGTGGACTTGGCA
CCCTTGTTAAAAATCACTTGGCCATAAATGCAAGAGCTGATTTCTGAACACTTAATTCAA
TTCCACTGGTATATTTGTCTGTCCTTTTGCCATTACCATGCTGATTTAATTACTGTGGCT
TTGTAGTAAATTTTAAGATAGAGAAGTGTAATCCTTCAACTTAATTCTTTTTCAGGATAG
CTTTGGCTATTAAATGCCCCTTTGTTTTCCAAATAAATTTGATGGTTTGCTTATCCATTT
CTGCAAAGAAAGCTTTTGGAATTTTGATTGGGATTCTACTGAATCTGTAAATCATTTTTT
TTTTTTGTAGAATTTATTCATAACAATATTTAGTCTTCTAATCCACGAACATGAAATTTT
CTTCCATTAATTTGGTTTCTTTGATTTCTTTTAGCAATGTTTTATAGTTTTCTGTGTACA
ATTTCCTTTATATTCCTGGTTATATTTATTCCTAGATATTTGATTGATCTATTGAAGATC
TGTTGATCTTTTGGGTGTTGGTCTTGTACTCCATGACTTTGCTGAATTAATTTATTAGCT
CTGACAATTTTGTTGTGATACACATTGTTCATAGTATTCTTCTACAGTCCTTTTTATTTC
TGTGGGGTCTATAGTAATGCCCCCCTTTTCTCCTTTCTGATTTTAGTTATTTGTGTCCTC
TTTCTTTTTAATTTTTCTGTCTAGCTAAAAGTTTGTCAAGTTTTTTGTTTTTTTTTTTTT
TTATCTTTTCAAAGAACCGATATTTGATTTTGTGGGTTCTTTCTTTTTTATGATCAATTT
CATTTATTGCTGCTCTAATCTTTGCTATTAATGTCCTTCTATTAATTTCAGGTATAGTTT
TCTCTTTTTCTAGTTTGTCCAGTTTTGGGGTCAGGTCTTTCATCTGAGGTCTTTCTTCAT
TTTTAATGTAGCATTAAAAGCATAAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
GCATTTATTGAAGAAAACCTAATAAATCTTGATAAGAACAGCTGAAGTCTGTGGCAACTG
AGCTAGAATCTGCTACCATTCTGGCTCCACCTCTATGTTTTTTGTTTTTTAAATTAATTA
ATTTTTAATGTTACATTAAAAAAAAATGAGGTCCCCATACACTCCCCACCCCCCTTACCC
CCCTCCTCCCATAACCACAACCTCCTCCATCATCATGGGACATTCATTGCACTTGGTGAA
TACATCTCTGAGCACTGCTGCACTACATGGTCAATGGTCCACATTACAGTTTACACTCTC
CCCCAGTCCACCCAGTGGGCCATGGGAGGACATACAATGTCCAGTAACTGTCCCTGCAGT
AACACGCAGGACACCTCCAAGTCCTGAAAATGCCCCTACATCACATCTCTTCTTCCCATT
CTCACCCCCAGCAGCTACCATGTCCACTTTCTCCATCTCAATGTTACATTTACTTCCACT
ACTAATCACATTAGTTCCAGAATAGAGTATCAGTAAGTCCACTCTAATCCATACTCTATT
CTTCCATTCTGTGGACCCTGGGATGGCTATGTCCACTCCATCCCTGTATCGAGAGGGTGC
CTCGACTCAACTTGGACAATGGATGCAATTCTCCTGTTTGCAGTTGTAGGCACTCTTGGC
TCCCTGGTGTGGGTGGTTGACCCTTCTTCACCTCCCCTGTTAGTTGGCTGGGGTAAGTCC
AATAAACTAGAGGGTAGGAGTTGCAAGTCTGTTGAGGCTCAGGGCTTGGCTATCACATGG
ACAGTCCAGAGATTCAGGTCCCCCAAGTATACACGAAACCCCAGCGCCAACCACAGGTCT
GGTAATAGTGACAGGAGAGGCTTGTGAGCAAAGATCACACCTGAGTCCAACTCCCTCACA
CTCAGGACCACAAACTCCAAAGTAGGGCCAACTGATATGGCACTGAAGTCCATCTGCCAT
GACCATAGAACCTGTGGGTCTCTGTAGCCCCCAGAAGAACCAATACCTGGGGTTGTATCT
ACTTTAGCTGTCTCTGGGACTCTGCTGAGGTGTGCATAAGGGGCAACCCCTCTGATGACC
TCCCGGCTCTTATTTGGAGACTCATAGCCATATAAACTCATTTGTCCTTTCCATTTCCCC
CTTTTATTCAGGGTCAAAAAACATTTTTAACTCCTGATATTACATGTAGGCTGAGATATT
ATGCTGATCTGAATTGACCCTTTTATTCGAGGTCATTCTCCAGCCACATCATCAGCTGGT
ACTTGGTAGTAATCCCTTGGTGCCAGGGAGGCTCATCCCCAGGAGTCTTGTCCCACGCTG
GGGGGAATTTACATGCTGAGTTTGGCTTTGAGACTGGCCACATTTGAGCAACATGAAGGC
TTTCAGGAGGTAACTCTTAGGCACCCTGCAGCTCTAGGCCTAGTTCTTATTTCAGGCCCA
CAGGCCTACAGGCATAGTCATTAGCATCAAGGGCTCATTGTTGGCCCATCCTTCCTTATT
GGTCTTAGCCATTGCACTCAGAGGATTGTTGCTGTTCCATTGGGGAATGCAACAGAGCCC
CCCCGGCCAGGAACTCAGCCATCATTCCCAACTGTAACCATTATGAAAATATCCAAACAT
TTTTTTGCACCCCACACATATGCCCTGGAGAACTCCCTCCCAACCATGACTAGTGATTCT
TAAGGCACAGTTTGCTGAGTTCTACCCTTAGAGTTTCTGATTTGTTGTTGGGGGAAGTGG
AAAGGAGCAAGAATTTCTATTTCTGACAGGTTCCCAGGTGATGCTGCCCCTGCTGGTCAG
GGATCATATTTGGAGACTACTGGTGTTGAACCCGGCCATGTAGTACATGAACATTTGCAG
GTTTCTCTTATCAAGAAGGGGCAGTGGAAAGTTGGAAGGGCAACCAGAAGAGTCTCTCTC
TGCTAGGTAACTTGTTCAAATCTCATACCAATGAGGACAAGATTTCAGTTTCACTCCCTT
GATGGAAACTAGATTTCTTCTAGTCCCTAGACATAGCCTTTAACTTTGGCTATAAATATT
CTGATGCCAGTATGCATCATAAGAGAGACTTTCTTAGCAAGCCTGAACTAGCCAGTGCCA
GCCACGATTGCTGGGAAAAAATAAACAAGTATATGTCTGACCAATGGAATATTAGAAGCA
GCCTCTTTTTGTTATAAACAACTGTATATACATATGCATACACATATATGTATACTTTAG
ACAGGCGGAAATCAGAGTGGAGCATAAAGATTGAATGAACCCGAGTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGAGATAGGTACTTCATATCAGTTCAGTTA
CACTTCTGAAAAGAATATTTTTTTATCCCTTCTCTTGTTTTTCCCTGACCATACACACAA
ACGGATCAATAAAGGAAAAGAAATGATTTTCAGACTCTATTCAAATCACCTTCGCAGTCA
GGAATAAAATTGTAGAGTGTCGAGGGACCTGAGGATAGAGTTGAAAGTCTCTTCTTTAAA
GACAGTTCAAAATATTAAAATGCCTGGAAATTGTTTCTCTCGCTAAGAAGTAGGTATGCC
TTACTGGGACATGATTGGTCCTAGAACACTCAATCTTAAAGTGCCTGGAACCACATGGGT
ACCATGTGAGCATCATTGGAAGGACGTTGTTTTAATTTCCTAAGCTGCTCAAGCAGATAT
CATGCAATGGGCTGCTTTAAACAATGGGAACTTATTTGCTCACAGGTTTGAGTTGGGGAA
AATGTCCAAATTAAGGCATCATCAAGGTGACTCTTTCTCCCCAAAACCCATGGCATTCTG
GGGCTGGATGCTGGTGGTCCCGGTTCCTCTGTTACATGCCTAGGCACGTGATGGCATCTC
CTGGTCTCTCCCTTCTCTTATGGATTCCACTGATTTCAGCTTTTGGATGCTTCTTCCTTG
CTTTCTCTCTCTCTTGTGTATTATAAAGGACTCTGCTAATAGGATTAAGACCGATCCTGA
TTGAGATGAGCCACACCTTAACTGAAGTAACCTTATCAAAATGTCCTACTTATACAGTGG
GTTCACACCCACAGGAATGGATTAGATTGAAGAACATGTTTTTCTGGGGAACAAACCACC
CGACACTGACTATGGAAATAGTTCATCTTCCGGGAGGAGAACCACAGGACTATCTTTGGG
TTGTGGGGGACCATGATCGGTTTAATATAGCAGAAGTCTTCCAAGGCTATATGCTTTTTT
GATTCCAGAAACAAAGAGGGCAGCAAGTGTCTTTTCTTTCCATCATATGAATCCCAGTGC
CCTCTTGATTAATCTGTGAACCAGAGCTATCATGATGCCTTCCACATGGTTCTGAGGTAT
CAGGATGCATCACTGTGGCCATTGTAGCAAAGGAGCATTAGAAGATTCTTAGAACTTGCA
GGGGGAGGGTGAGATAGGTAGAAAATATACCTTTAGCAAAAAATTGTTAGGGTTATTGGA
GTGTTCATTTTTCAGTCAACAAAGTTTAATTTCTTTTTTAGTGGAACTTTAAAATAATTG
AAGGAGGCCATTCGCATTTTTTTTATTTGAAAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCGGCCTTAGATCCC
ATGAGGCCAGATGGATGGAACTGTCTTGCTTGCAGTGTTTTATACTCTGTTTTTTGGGAT
AGGCATTGTCCATCATCATACTTTCGTTATTTGTCCTAAGTAAGTCTGATAAACTGGAGA
GTAGGTGTTGGCTGCAACTCTGCTGAGAGTCAGGGTTCAACAGGCATACGGACAGCTGGA
AGATTTAAGTTTCTAATGGGTTCAAACCCGCAGGAATCGAGATGAAGAACACGTCTTTTC
TGGAGGATTGATTCCATCTACCATACCTGCCTTCTCCCCAACAGGTCTTTAAAAATCCTC
CATAGATCCCCCTACCTCAGGAGCTTTCTTTCCCTGTGGTCCATCCGTCTCTTCTCCATC
TTAAAGGCAAGGGACTTGCCTTGTCCTAATGTCCTAAATGGACATTGTCCACTGTCCTAA
ATGATGTTGCAGGGACAGATGCTAGACATTATATATCCTGCCTAACCCACCGAATGGACT
CGGGGAGAGTGTAAACCACAATGCAAATTATAATCCATGTAGTACAGCAGTTCTACAAAA
TGTATTCACCAAATACAATGAATGTGCCACAATGATGCAAGAGGTTATTGATGTGGGGGC
GGGGGGGGGGGGGAAGAATATATGGGAATCACTTATATTTTTTAATGTAACAGTTTTTGT
GATCTATGTATCTTTAAAAAAAAAGACAATAAAAAAATTAAATCCAAATTAAAAGGCAAC
TGTGAATTTTTTAGAACTTCCCACTTAAAGACATTCCTTTCTTCTAATTGCTTTTTTCCC
CTATTACATTAGAGCAGGAGTGGCAAAAATATATTTGTTTATTAGGATACTAAACAAATA
CAAATCTCACTATATCAAATTTCTTCCCAGTAATTATAATATTCAATTATGGTAAATATC
CAATTTTCATTCATACAGAAGACCTTTTCCTCTAGAATAACTTCTGTCTAGCCCATGCTG
AAAAAAAATAGAATATTGGTGTCATTTTGAGGTGTTTTTCAAGGCAATCTGTCAGAGGTC
CTGAGATAAAATTACTCCTTTATTTTCAGGTCCTTGTAACAAGGCAATTGGAGTCATCTT
TTGATCCAAAGAATGGTGAAGAAAAATGTCACCTAGCCTCCAGTCAGAGAATCCTTTTAT
TACATGAAACAAAAGGCAGGTGTATTTGTCTTCTAAAATGAGGCATAGCTTCCCTGCTTA
GTTACCCTAAATTCCCTGCATGTTCTTCCAAGGAAACGACATAATTGATCATCTCAGTTG
ATTATACATTTTTCAGCATGTTTTAATTGTGTGTGAAGAAGTCCAGCACTTAGTGAACTC
TAATTTTCCCAATTTGCTCTCCTTCTAATATACTATACTTCATGCATAAAAATTTGGTAA
ATATGTGATAAAATAATGGACTTTGACATGGGTCATTATTTTTAAAGAAAGTGCATCACG
AAACCACTTACGCATACTTTCTTGGTTTTTATTTATTCAATAGATTTTGAAGTTAGATGT
TTGTCATTTGGCTTCAGGGGTTCACTAACATAATTCAAAATGCAGAGTTAAAAGCATTTT
GTAATGAAAAATGTCAAAGTCGTTTAAAAATGCATAAAGAAAGAAAACTGCAACACAGTT
GGGCCTAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATCTGGGATGCAGATTTTCTTCTGTAAGT
ACAATAATGAAATCTTATAGGAAGGATTTCAATAACCAGTAAGAATATTGATACTTCTAA
GTGGAGCAAAAAGCATTAAAACTAGTATTCTGAGCTTCTACCATGATTCAGATACTATTG
TAGGCAGTTTATATAAACTATCACATTTAGTCCTCCTGACAATCCTGTGAGATATATTTT
ATTATCTCCATTTTACAGATGAGGAAAATGATCACAGCTAGCTAGTGGCAGGTGGACATA
GAAATCCAGATTTCTCTAGTTTCAAAACATGTTCTCCTTATACTACAATATGCTGCTTCT
CCAGAGAAGGATGGCAAAGGCTGTTAAGTGCCAAGCTGATGAAGAAAAAATTATCTTCCA
AGTTAGTTGTCTGCAAAGTGAAGGTACACAGGATGATCCCCTGAGATCAGGGAAGGAAAT
ATCATTATATATGTGAAAAGAAAAAAAATATTTTACATATTAAAAAAAGAAAGTAATTAA
ACTTTCCTAATTTTTAACACACAAATTGACACTGGTGCCATCATTCAGTTTGTAGATCAG
ATGGTCCATGTTTTTGTTTTGTTTTGTTTTTTGAACTGTCATGTAGTTACAGTTTTCTTT
TCTTTATCTTTTTTCTTTTTTCTTTTATTCCTTTTTTTCTTTCTTTTGGAAAAAAATAAC
ATCTTTACTGAGATATAATGCATCTACCATACCACCTACCCATTTAAAGTGCACAATATA
GACGTTTTTAGTATATTCACAGACATGTGCAACTATCATCAGAGGTAATTTTAGAATTTT
TACAGCACCTCAGACACCAATGCCCATTAGCTCTTGCTCCCTTATCTTCCCATCCCCTCC
CCCTACCTGCAACCCTAAGCAACCACTCATCTACTGCCTGTCTCTATAAAATTGCCTATT
CTGGACATTTCATACAAATGGAATCATATTCTGTGTGGTCCTTTGTGACTGGCTTCTTTA
AATGGCTGAATTTTTCTAAGGTAAATGAGATTTTGTGACAGAGGAGGGGGTGTTATCAGA
TCGGGTTTACTTTAGCACCCTGACTTGACAGGTGATTCTGACTTCACTGGGTTTATGTGG
GTCTTGGTAAAAGATTTAGAGATTATATCACCTAACCTACTAGACTTCACAAAAATGACA
GTTGGCTTAAATAAGATCCTTCACAAAAGTTGAGAGTTGAAGATAATTCCAAAATTTAAC
ATGAGTAAATCACCAAAAAATTGCAAAATTAGAACTTCACTTATTCTTAATCTGAATTTT
CATCAGCCATATTCCAGAGTAAAACAAACAAAATTAAATCTAATCATATGTAAAAAAATG
TATTGACTACAAATTGTAATTACCAACATGACAATGTTAAATATGGACTTACTTCCACTT
TTATTCAAGATTGTATGACAATTTGAGACTATTTGTGAATCTCAAAAAGAGAAAGATTAT
GTTTGTAAACTAAACTATTCCTCTGGGTATGAGACCCTTTGATTGCATTAGATTCAGCTG
CAATGTCTTGATTAAATTACCTGTTAAGATTATGGCTTTGATTCAACCTCATCAGGAAGG
TGTGACTCAGGTTGAGATCCCACCCGCTTTATGGGCCAACATAAACCGACACTGACTCAC
AAAGACACAGGGAAGAGAGAGAGTGCTGTCTTTTTTTTATCATGGGGCCCCAGGGAGAAA
TAAGCCATTTGCTTAATAGTTTGCAGCTGATAGAGAGGAAGCCCTGAGAGAGAAACCCTA
GGCCAGCCTACAGCTGAGATTGGGAAGAAGCTGGGCCCACAGAGGAGCCTTAAGAGGAAG
AAGCCCAGGAAGGAGAGACCAGGCAGGGATCAGTTGGCCATCTTGCTTCAACACATGTTG
CTTGACTTTGGTGAGAAGCAGCCTTGAGCTGGACTCTTTAGGGCCTTGTAACTGTAAGCT
TTTTCCCCAAATAAATACCCTTTATAAAAGCCAACAGATCTCTGGTACTTGGTATTGGCA
CCCCTTTGGCAGACTATCACAAATGGGCTTCATTCTAAGTACAAAGGCAATTCATAAGCC
AAGCAACCATAATATAAAGACAGCTTCTGCAATTTTTGTGGGGAGGGCTATGTTTAAGGG
CATGCAACCCATTCCTTTAAAAATTTTTATTAAGCTTAATAATAAGTGTTTAGCCTCAAT
TGGGAATATTTACCTATTAATAAAGGACCAAAATCCTTATACTATTGGGGAAACCCCTCC
TCTTTCTATCATTCTAAAAATGGCTATAATACACAATGAAAACAAGATGGCAACAGACAA
AAGTACATTCCTGTGTCAACAATTATTTTTGAGTGTTGCATTGAAAGCCACACTAAATAT
TTGAAGAAATGAGTATTAAAACCTTGCAGGTTTGCAATGCTGGGATGAAAGAATAGATGT
ATTTAGCATGCTTCAGGCAGAGGTGGCTATATATGAAGCTAATGGAGTTTCAGGATGCCT
CACTTTCATAAGGAGATCTCTGATTCTTCAGCCATGCCTCTTATGGAAACTTTTTCCCCA
TAATAAAAGGAGGATGTGGTTCTAACACAATAGGCAGAGAAATCTGGTGACATGATGGCA
ATAGGGTACTACATTTCCCCTCATCTGAAATTCCAAAGAACAATTCCTACTGAATTAAAT
CTCTGCCCTGTTGGCAGTTCCTCTGCCATGTCCCTCTATTTACCTGTCTCTTCTGTTATT
TATAATTATACCCTGGTCAGTCCAGTGACTCAGTGTCCGTCTCTGCTTCTAAGATAGCAG
GGCATTTTCTTTCTTGGAATAACATGTCAGCTTCTCAATATCAGATTATATCTCTTCCAT
TATAAAATATATACAGTTCAAAACTGTGTTCTCCAGGGAAACATTTGTTAACAAATCAAT
TTTATTGATACATATTAATAAAGCATAGATCCATCTAAAGTGTACAATCAATGGTATTTT
GTGTAATCATGTTTGTGCCTTCATCACTTCAGTCATTCTTACAGCACTTTCATTATCCCA
ATAATAATAATAAGCAACAAACAAAACTCATCACCTGTCAGTCTCTCTATGCTTCCCCTG
CCATACATAGCTGCTACTCTTTTTCCTTATCTCTAATATATTTGTATTTATATTTTGTAA
AAAGTCTCATATATGTAGTATCACCCATAATTGTTTTTTTTCCCCAAATTCTACTCAATT
TATTCATTTTTTAAAAAATATTACATTCAAAAAATATGAAGTCCCCATTCACCCCCACCG
CCCCTACCCCACCACTCCCCCCACGGTAACACTCTCCCCCATCATCATGACACATCCATT
GCATCTGGTGAGTACATCTCTGGGCATCGCTGCACCCCATGTCCTGTGGTCCACATCATA
GCCCACACTCTCCCACATTCCATCCAGTGGGCCATGGGAGGACATACATTGTCCGGCAAT
TGTCCCTGGAGCACCACCCAGGACAACTCATCACCCATATTTGTGTATCACATGAGGCTT
CACTATCTTATACAGTCCTATGTTACAGTTTTTAGCTTTCCTTCTAGTAAGATACATGAC
CTTAGACTTTCCCTTTCAACCTCTGTCATATCCATACACTGCTAGTTACAAACAGCATGA
TATGCTTTAACCGTTTCTATTCATTTCCAAAGATTTACATACAACATTTTTACCAATTCT
GCACAGATTAACCCTCAGCTTTCCATTCTCTACCCTCCTTCTGTTTTCTGGTGACCTGTA
TTCTAATTATTAAGTTGATGAAGTTACACAATAAGATTAGTTGATAATAGTGCAATTTTA
AGATTTGCTTTACCCGATAATTTTAAGGACTGAAATTATCCGAATAACTTCTCACAGTTT
TATATAGACTTTTTTGAGCACACATAGTTATTTTTATGTGTTCTTATATTTCAGAGTTTC
TCTTATGTATGTCCCATGGCCCTCTAAGCATACCATTTTACTAACCTGCCCTCTACAGTC
CTTAGCAGATGCTGCTGACTGATCAGTTTCTCTATGGCTTATCCCCAAACTCACAGAGTT
TGCACATAATAAATGAGTAAACTTCACTGGTAACTCAACTACCCAAGAGTTTAATCAAAT
ACACAAAAGAAATAGACTTTTAAGATTGAAGATACTAATTTTAAGAGTAAAAGTGCACAC
ACCAGTGTGTTCTAAAAGTAAATCAGATTTATGGAGTAGAAGGAAATACAGAGCTCGTTG
TCTTAGCTTGAGTTGCCCTGAAAGGCGGCAGAAGCACATGTGTGGCTACGTTGTTAAGAA
GTGCAATCCCAGAGAGCAAGAGGGAGGGGGAGACAGAGGCGGAACCAGCACAAGGGTGCA
GAACCCACAACGGGGGCTCTGGTTTGCAGGATAGCCCTTGTGAATGACTGCTTCTTGGGA
AAATCTGCCTGGGGAAGGAAAAAGGAAAAATGTATGTCTGCCTGCTTTAGTTTCCCATTG
GTGAAGTTCAGTCATGCCCCTGCACTGCCAAGTTGCTTGTGTGTGTGTCAAGCAGGTCCC
CACAAGGTCTGACCCCTCAGCATCAACTGGGAATGCCCAGATCAGAAGGCACAAGGCACG
AGGTGCACCCTGTGAGCATGGGAAACAGAGCCACTGGTTGTGCCATCAACTGCTGCACAT
GGTCTATGCCCAGCTGCTCACGGAAGCATGGCAGGAGCTGAAGTAAGTGGCCAGAGGCCC
TGCATGCAGGTGAGACTGCGAAAGAGATGTCTGGCATGCTTGCCTATTATGATGTCTTTA
TTTTACATGAAGAAACTCAACCCTTAGTGGGAGATGCCCAAGATCATGGAGCTTAAATAG
TAGAAGAGGCAGCAGAGAAATGCAAGGAGACAGGGACTTCCTTCTGGCTATTTGTTACCT
TAATTACTCTTCTGTGCTGCTTCTCTAGACAATACAGCATACACACGCATTCGTATCTTC
ATTCTACTCAAAAAGTTTTTAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAGCACTAGTATTTTTTAAGCC
AAACAAACAGTCATCTTTCAAATCTTCTAAAATTTCACCCTTTTCATTTACAGTATGTTC
AGTCATAAATTTATTCATTCCATTCATTCTGTATTTATTGAGCACCTAGTTCCCTTCCAT
CAAGCACTCTGCAGGCACAGGAACATAGAAATTTATTCCCTCCTTTGAAGGAGCTCATGA
GATACACTGTATAGTGCCAGGGATCTTAACAAGGGGTCAATGGCTTGAATTTGAATTAAA
AAAAAAATTCTTGTGGGGACATGTTGGTGTGGGTGTGATGTATTTATTAATAATACACAG
TATAGTGTGGACTTAGTAAGGGGTCCATGGAACAAAAATAGTTAAGAACCCCTGGTGTAG
TGCATACAAATAGACATAGGGACATACAGATGAAGATCCATAACCCAGCCATGGGGAGTC
GCGAGTGACTTCTGGAATAGATAGTGCTTAAGGATGTGAGGAGTTAGGTGAGAGGACCAC
AGGTCTCTTGCATAAGGGAAAAAATAGTTTGGAGGGATGGGGCAGCCGTACATGAACCAA
AAAGATCCTAAAACAGAGAGAGTCAAGTCATAGGGGGAACATTCTGTGAATCAAATCACC
AAATTGCTTTCTCCTGTACTAAAAGAGAACAAAAAGAATTTGATGAGGGTGGTATGGTGG
GGGTGTCACATTATGCAGTGAGCAGTGTGTCGATGTTCATGTTTATTTCTATAGCTTATT
TATTTATTTAGCTTGGGTGACTCTGATGACTAGCTCACAAGAGCTTACTGCAATTGTGAC
AAAATCTAGCTCCCTGCATCTGGAAAGGACTCGCAAACTAATCTGATAAAATGTTTCTCC
CATTCCTTCCTGTTTTACATGTCATGTTCATTAGCATGACCAATAAACCCATCATTTACA
TTCTCTATCAAATCACACCAGCAGCAGCTGAATGACATGGCCACTAATTAAAAGCAGAAA
TTGAATACAGCAGAGTTACTGTTTTGTTTGGCTGAAGAGGCAAGAATAGGCTTGTGTTGA
CCCCTTACTGAAAGGCATGCATTAGACATGTCTCAGTAGAAGAGTTTTCATCAGAGTGTG
TCTGGCCAGCATTTTTTGTCTTCATGTTCCCCAGATATTTATGGAAACCTGCCAGTTGTG
TTTCTAGCACTATGCTCTTTAATGGTCTGTGAGGGCAAAGAATATTTTTTAGAAGCATAA
TGGTGAGATAGCATCATAATGAAGAACTTGAGATTTGGAATCATATAACCTGAGTTTCCA
TCCAAACTTACCTATAAACTGGGAACAATAATAATGTCTGCCTTGTAAAGTTATTATGGG
GATTAAATAAGATAGTATATAAATCTATGCCCAAGTTTTGACACATAGTAACAATTTATT
AAATGTGAATTATTGTTTGTTACTTCATCTTAACTGACTCCATTTTGTAGTAAGTTACTT
GGGAACTCAATTCCAAAATCCTGGTACTAGCTCCCTGATGACAAGAACTGCATCTTACTC
ATCTTTGCATGCATAGTGCCTGGCATATAAAAGGCTACTTTATTGTAGATTGGCATTCAT
ACTTCGGAAGGACTAAAATTTTGTTCTCTTACCTAAATAATCTGTCATGTGTATGTGTTT
GTGTGGTTGGATTTTGTTTAGGAAAAAACATGATATTGCCAAATATTGCCAAGATTTCAA
TTACCATGGTTGTAATGTAATCACCATGTGATAGCAGTGACTTTTAATCTTCTTTTCCCA
AGAAGACCCACTCCCACTCAGTAAACTGCATTCTCCAGTACATCTGTTCAGCATCATGAG
CAGCTCCATTACATTAGCTGCAAAAGTACCTGTTACTCCTCCACTTTAGGATGTAAATTA
TTGTGCAAATAGTCAAGTCACACAATTATAGGAAAATCATGAATCCACTCTAATTTTTAA
ATCATTCTAAACATTATTTTAACTATCATTGTTATAGTGTATGTAGTGACTAAATCAAAA
TTCTTCAAAATCAACAACTGTATATCCTTATCACTTCCTATTTCTTTTAGTCACTGCTAT
CTCCTCAATGACAATCTCTATTTCCTTGATTTCCATGACACCAAATTTCCATGACACCAA
TAGTGCTTTGGTACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAAACTGGCTCCAGCTCAACTGGAACTGAATGAGCCAAATCGTCACTCACACATCTG
ACTTCATCTGAGGCTGCTGTGGCTGACTGGGTCTCTTTCTCTTTCCCATGTGTTTTCTCT
ATATTCATTAATCTAGCATGGGTTTCTTTGCACGGACACTGGAGCCTAAGAAAACAAAAA
ACTGGAAGCTGCTGGGTTTCTAAAGGCTTAAGCCCAGCATTTACATGACATTACTTCCTC
TGCATTCTATTGGTCAAAACAAGTCAGAAGACCAGGTCCCATTCAAGGGGAGGGGAAATG
ACTCCACCTCCCTTTGGGAGGAGCAGCATGAAAGTAGAGGGATGGGAGGAAATGTCAACT
GCTGTTTTTGCTGGAAATCTGCAACTGGCTTTGAAGGTCCCTGAATTCTATAGGGAACCA
TCGTATAGGATTTTAATCACAGGGCTAACGTTTTAAAACATATATCCCTTTTGCTCCTTT
ATAGAGATGGAATTCAAGGTACCTGGAGTCAGTGCAATCAATGAGACTGTACAAATACAA
GTGAACTTCAGGATAGTCTTCTACATAAGCCTACATGTCTTGCCAAAATTTTTCCTTCTC
ATGGGAAGGATATTGAATTAGCAAAATGTAAATGCTAATTAAAAACAAACAAGACGTCAC
CAGGGTACTGCTCAGATCACTGTGCCCTTTCCAGGAAGATGGACTGGACTCCTATCTGCC
ACGTGGGAGGAAATAGATAGTTCCCAGGAATCCTCTGACTAAAGATTTTTCATTTAGAAA
ACCTGCTGCTGGCTTGTTTTATATTTTTGTTGCTATAAATAAACCCACGAAATCAGATCA
GACTTCCAGGGAGAGCAGAAGCTTGCTTTGTATTTCCCTTCCTGCCTCAGACCACGGTGA
GCGTTTGTATACGTATGGCCATAAAACCTGGGTGGACATTTTTTTCCAACTTCTTGATTC
CTACATCATGTCCCCATTCCAGTGGTCTACAGGGCCAGTGCCTATGAAAAAGCCACATAC
CTCAGGCACCGGATTTCTGTTACTAATAGCAATTTTAATGTGCAGGCAATTGTAACTCGA
ATAGTGGAGAGCAGAGACAAATGCTTATTAACTCTTTCTAGAGCAAACTGAGAGCCAAGG
ACTAGAAATAGACTGGAAGTGATTCTCCTGGATTTTCAGGCATCTGCACAGCCCCTTCAC
CTAAATGTTCCTGGATCCAGGATTTGCTCTTTAAAGGAAATAGTCTCTCTTTATTGATAC
AAGAAACTGAGGATGATGTTGAAATATGGTCCCTTTTGGTCAGGGTTCATGAACTCTCTT
GGCATCACTGAGCAGTTTGTTAATGCAATAGTGGGTGTCAAGATAGCATAAATTTTCCCC
ACAGGCTCTAAAGTGCAGTGGCTAAAGGCTGGGTTCAATTGGAGAAATCTGGACACAAAT
CTCTTTTGCCACTTCTTCAGTATGTAACTGGGCAACCTCCTTAACCGTCTGAGCTTTGGC
TCCCTCCTCTGTAAAACCTGTTATAATTGTACCTTCCACATAGGATTGCTGTGATGGATT
AAAAGAAATAACATTGATTACACTTAGCCCAGTGCATGGCACGAGTGCTCAATTCATGTT
AACTGTTCTTGTTTTAGTGGACTTCTTGCTGATCTTTGCTGTATTTCTCTATTTCCCAGG
GAGATGTTAGTCTCGGTGGCTCTGGGCCAGGTGTTATCCCTCCTTATTTGTGGAATTGGC
TTGACCAGCAAGTACCTGTCAGAAGATTTCCATGCCAAGACACCCGTCTTTCAGAGTTTC
CTCAATTACATCCTTCTCTTCTTGGTCTATACCACCACACTAGCTGTCAGACAAGGTAAG
CTCATGGGAACACCAAGAATGGGGCTTGGTTTCTCTTTTAGAAACAGGTAAAAGAATGAT
GATCCATGACCAGATAACTCTTTATCTCTTAATGGCATCAGAAAAACCATTTGAAACCCC
AAATCTTACTCTTCTTTTTACAGTGATATGGCCAAAAGAATAAGTCACAAAGAAACTCAA
ATTGTGTGAATTCAGCAGAAAGTGGGAAAGTGCATATATAGGCAGATATGTACTTGCTCA
CTATATGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGACTTCCA
CTGACCCGTCTTCTGTATGTGGAATTCTCTCCTCTCAAACATGAGCTTGTTGACTCTCTC
CTAAAGAATTATGCTATGATAGCAGGGACAGGATGTTATTTTAAAAAAGGCTGTCTTCCA
CTTTGAGCACTCGCTTTCTGTCTGTCTGTCTTTCTCTCTTCTCTCTTGAATTACTCACCC
TGAGAAAAGCCAACTGCCATGTTTAGAGCAGACCAGCAGAGAGGCCCTTTGGAGAGGAGC
CAAGGCCTGCCAACAACCATATGAGTGAGCTTGGAAGCAAATCTCTTCCCATTTGAGCCT
TCAGATAATACTGCATCCCTGGTAGACAACTTGACTGCAACTTGATTGGAGATCTTGAGC
CAGAGATACTCAGCTAAACTGTATGCAGATTCTTGGCCCACAAAGACAATAATATAATAA
ATATTTGTTTTAAGCCACTATGTTTTGGGATAATTTGTTATGTATCAATGTACAACTAAG
AGTGTCACCATTCACTTAGAGTTTCTATATATTCCACATCCCCTATAAAGAGCTCACAGG
TTAGAGTGACTCCGGAGAGTCATTATTATTAGACAGCATCATCTACACTGCCTTGAAAAA
TAAGATTTTTTTCAGGCCTGTAATATATGTGAAAATAAGGACTGAAAGCTAGGGGATTCA
AAGTCTGTTCTGAGGCTACTAGTCTGAGATGCAAGATGCTACAAATTGCAGTTGTTGGCA
GCATTAAGATCTATGACTTTCTTTTCCATCTGAGAGTGGCTCCCAATTTCCGGTCTCTTC
CCAGCACCCACACGCCACAAGAGTATATAGCAATGTTCAAAGCTGAAAGAACTCTCAGGG
CAGCCCTCGCGAACCTTACTATGGATCTGCTGGCCCGCACAAGCCTTTTTCCACTTGGGT
ACCTTCTTTCCATTTCTATCTATTCTGCCACAATCCTAAAATATAGGATGATTTGGACTT
CACATGTTTATGCAGCCTTTCTGGCTCACCTTCCTTTTTATTTCCACATGATGTAATTAA
TTTTTTTCTTCAAATGTTCATGAAAATATGCTTGCTTTGCCGAACTAATGAACTGCGGAG
GTCATTAAGAAAGTTAAGAAACTCCCTGAGAGCCAAAATCTATAATGGAGAGTATTAGTA
AAAATGCATGAGACTTTGATACTGTCGATTCATTTGTTCCTCTCATGATATGGTAACGAT
ATGGTTAGAAAAGATACCGATATAAAATCTTAGACTTCTTTTTAAGTATGTAGTTTATTA
TGTGTCAAGAACCTAACACATTTCTTCTTAACTTCTTAACAAAGGAGAAGAAAACCTCCT
CGCAATTTTACGACGAAGATGGTGGAAATATATGATCCTGGGACTCATTGACCTGGAAGC
AAATTACCTGGTGGTCAAGGCTTATCAATACACAACTCTGACCAGTATCCAGGTACCGAT
ATCTCTTTTTCTCTTCTCAACTTCCTTATTTTCCAAATGTAGTTTACTTTCAATTTATTC
TCTTGTGAATCTGAATGCTAGTCTCGAAGTTTTACAATAAGAGGGGGACATTGGCTGTAT
AAAAAGTAATTTGAACATTATTTCCGTGTTTTATTAATATTTCTTAAGTGAAGTGTGATT
GGACATCTTTTCCCTCTTTTTTATAAATGCAACACAATAACCATTTGACAATGTAGGAAA
ATAATTTGTGGCTTTGAATACTGCCAATAATCTGTCAGAGGAGAAATATTTCTAAGCATT
AAAAAATTTATTTTAATCTTATAACTCTTTAGAATATGTTAATGGACTTTAAGTGATCAA
AGTGCTTAATATTTTCTTTTCCCTTTCTTTAATGTGTAGAGTTTGCAACCGGAAGGGTCG
GGATTTTCCCTAAAGGTTTTCCATACATGCCTGCACACACATACACGATTGCCAAATCTA
AATTTCGTTTTCACATTTTTTACCAGACAATTATATTTCTTGTTACACCATAGATAATAT
GCTTGACTATTTTGTGTCAACCTCCTATCTCTTTTCATGACAAGATTACGAATTTCATAG
CCATTTGAAAACTCCAGGATAAAAACAAATCACTGTTCACTTATTAGATTTAGCTTAGAT
TTGGCACTTCAGTAACATTCCTGGCAGCCTATTAATTTGCTTTGAAACACAATAACAACA
ATGGAGAAACAAACAAGCAAACAAAGCACCTGAATATATTTAGATTGGCATCGATTGGAT
GGAAACATCTGATTTCCAACATCTGATTTCGAATAAACTTCAAAGTCTTTGAATCAAAGT
GATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCATATGGCCGA
AGTGGTAGTGCAGCTTGCACAGCAGCCTGGACCTGACACAGAGCCTCTTCTTGTTCTGGT
CCCAAATCAAATCTAGCAGCTTTTCTGATCACCCAGTAAATGCGCTGGAGTAGCACACCC
AAATGAGGAAAGTGTTGTCTCCAAAATCCAGCTAAGTGTTGTGCCTCTTTTTCAGTCATA
GGAGGGGCTGGATGCAACAGTTTATCCTTCACTTTAGAAGGGATATATCAACATGCCCCA
CACCACTGGACACCTAGAAATTTCACTGGGATGGAAGGACCTTTTTGGATTTATCTCCCA
TCCTCTCTCAGGCAAATGCCTTGCCAATAAGTCTAGAGTCTTTGCTATTTCTTGCTCACT
AGGTCCTAGCAACATGATATCATCAATATAGTGGACCAGTGTAATGTCTTGTGGGGGGGA
GAAATGATCAAGGTTCCTGCAGACAATATTATGACATAGGGCTGGAGAGTTAATATACCC
CTGAGGCAGGACAGTGAAAGTATACTGCTGGCCTTGCCAGTTGAAAGCAAACTGTTTTGG
GTGGTCCTTACTAATAGAAATTGAGAAAAAAGCATTTGCCAAATCAACAGCTGCATACCA
GGTACCAGGCAATGAGTTGATTTGCTCAAGCAGTGATACCACATCTGGGACAGCAGCTGC
ATTGGAGTCACCACCTGGGGCAGGCTGGAGGCTGGATGATACAAGCTTGACAAGGTGTGG
TCTGGACAGGCAGGCCATTGCAGGCTTATCTGGTAAAGTCTCAGGGGAATTCAGGGTTCC
AGTGTCTCCACCAATATTATCATCATCCCATATATCTCCATCCCAATTCTCTGGATTCCA
CTCTTTTCCAATCAATGCCTTCACTTTAACTGCAGAAACCCTGGGGGGGGTGAGATTTTA
CTTTCCTTTGTAACTCAGCTTCTCATACCGTGAGAGTCTGAGTTTGGTCTCAGATATTTT
GAGCTTGTGGCTACAGGAGACAAGATTTTCTTTTGGAGCACACATAGAAACTTTTGCATC
ATTCATATGGTGTTTAAGTTTCAAATTTGAAGCCTTTAACTCATCTCTTTCTTTTGTAAC
AGTATCCAGAGTTATCTAGGAGGAGACAGCCAACATCATTATACCATTTGACTCCACTGA
ACTCTGTTAAGGTGTTGAAAACACTCTCACCCAGATCCTTGTTTCTTTATAAGTGTGACA
ATAGGGGAATCCTGTGATGATATTTTGCATTTTTCGATTGCCAAATTGCCCCATGGACTG
TTAGCAGCCTCTTCGTTACTGGACAGGGAGTCATAAGTACCCTTGAGTCCAATTACAGAA
GAAAGCCAATTGCAAAACTCTCAGAACCACCTCAGACACCCCATGTTTAAGACTCTCTTC
CCCAAGAACCACTCCCTATACCAAGCTGTATTAGGATTCTCTAGGGAAACAGAATCAAAA
AGAGATATCTGTCAGTAGTATGCGATTTTATAAGAGTCTCTCACGTGATCATGGGGATGC
ACAAGTCTGGGTTCCTCAGGCAGGCTGCAACCAGGGGCTCCAGTGAAGTCCAGTGATGAT
CCTTGATGAGTTCTGGGAGATGCTGGAGGTTCCAAAGACAAGCTGGAAAATTCTCACTCA
ATGCTGGAATTACTTCCCCTTTTAAAGCATTCAGCTGACTGGATAAAGCATCACTCATTA
CTGATGGCAATCTCCCTGACTGATGTAATTGTAATCAGCTATCTATGATTTACCACTGCA
GTAAAGTCAATGATGTCTACAGTCCATAAATGCCCTTGTATTACATTTAGCCTAGTGCTT
GCTTGACCAAACAGCTGGGCACAATTACCTGGCCGAGTTGACACAATAGCCTAACCATCA
CAAATGGTTTCTCATAAAGGAATGGTGGAAGTTAGGAGCCAAAAAATTTAAGGTTGGGCC
AAGCTGTAGGAGATCTTCAATGCCCAGATAAAGAGTGACTTAATTTTGTAGGTTAAAATG
GTCCTGAAATTTTCTGAGGAAAGAAATAAGATTTTATCAAAGTATATATGTTTTAGCAAG
AGAGCCTTCATTAAGAATTGGCAGAGCACCCAATACTCTTCTTTTTTTGATTCTGTCACT
AGCAGAGATGTAGAGCAAAAGGACATGAAGAGCTCCTTTTTTTTAATCCTCTTCCCTTTC
AGTTCACTCATCAAAATTGTGGATAAATGAACCAAACAATTGATACATGGTGCTTGAAAG
GAAAAGTATATTTTGGAAATGATTATAGACCTACAGGAAACTTTAAAAAAAAAGTGTACA
GGGTAGGGATAGGGAATGGGAAGTTAAGACTTAAAATTTATAGGGTTCCTATTTGAAATG
ATGGAAATGTTTTGATAATGATGGCAGTGATGGTAGCACAACATTGTGAATGCAATCAAC
AGCTCTGTAATGTATACTTGAAAGTGATTAAAAGGGGAAATGTTAGAATGTATGAATGGT
AACAGTAAAATTAAAGAAATCCATGGAACTATACTTTACAAACAAAGAACCCTAAGTTAA
ACCATGGATTCTATAGTTAATAGTACAATTATAAATATATGCTATCATCAATTGTAACAA
GTGTTCCATATCAATGCAAGATGTTGATGAGGGGCGTGGTGTATGGGAATCCTGTATTTA
AACATGATTGTTCTGCAAACCCATAATTTCTCTAATAAAGGGGAAAAAAATGGATAGAGG
AAAAAAAAGTTTACAGAGTCCCTTGAATCCTTCCCCTTCTTCCCCCTAATGGTGGCCTTT
TATATGACCATAGTATATTATCAAAACCTTGACATTGCTACAACTCTTTTAACTAGACTA
CAGACCTTATTCCATTTTTTATCAGTTTTTACCTGTACCCAGTTGCATGAGTGTTTGTGC
ACATAGTTTTGTGCAGTTTGAGCCCATGTGTACATTTGTAATCACCACCACAGTCAAGGC
ACAAGAAAAGAACTCCCTTGTGCTACCCCTTTAAAGTAACTTCCATCCCACTGTCCCCAT
CCCTGTCATGTGGCAACCACTATAATTTTGTCATCTGGAAAATGCTATGTAAGATGAAAC
CGTAAAGTATTTAACCTTTTGAGACTGATTTATTTCATTAAGCATAATGCCCTTAAGCCC
ATTCAAATTGCTGCAGGTGCCAATAGTTTGCTCCTTCTTATTGCTGAGTAGTATTCCATG
GTATGAAAGCCCCAGAGTTTGTTTACTCATTCACCTGTTGAAGGACATTTGGATTATTTC
CAGTTCGGGGCTATTGCAAATAAAGCTGCTATGAACTTCCATATACAGGTTTTCATATCA
ACATTAACTTTTCATTACTCTGGGATAAATGCTCAAGAGTGCAATTGGTGGGTCATGTGG
CAAGTGCACCTTGAGATTTTTAAGAGGGCTGTATCATACACCAGCAGCATATGAAAGGTC
CAGTTGCTCTGCATCCCAAACCTTTGTTCTTATCATTATTTTTATTTTAGCCTTTCTAAC
AGTTAGGTAATGATATCTCATTGTGGTTTTAATAGGCACTTCCTTAAACGTAATAATATT
GTACATTTGGGGGGAGAAATATTTTTTAACTTTGCCTTTGTACTCAGAAGCTAAAGAAAG
TTAACCGTAACAAAAGAGATCAAGTTTATGCAGGAAAAAGATGATGAAAGAAAGACTTGG
AAATAAAGAAACTCCACTGTTTTCTTTATTAGTACGTGAAAAGAGAGATGGTAACACTCG
CATATGCAATTTATGAGGATTTTATTTCAACAACACATTTTTGGGTTTGTATCTCTTGCC
TTACAGAGAATTAATGGATTGTGCCTGTGACTTTGAGACAGATTAGCAGTAACATTTGGA
TAAATTTTAAAAGCTATGCTATTTTTATAACTGTGTTATATGAACCATTTCAATAGAAAT
ATCAGCTTTATGACTTCTGGTCCAAAGATTATTCATCTTTCTTCAGTCATGTAGTACTAA
AATGCAAACAGATTAAACTACTGCTTCTGTGAAATAAGAAGAAAACAGTTGTCTTCAAAG
ATGATAGTTTGATAATTAAATAACTCACATTGTAAATAATTTCTAGTACGCTCACTAACA
GTGCTGAGGTCTCTCCATACCCCTACCTCGACTCTGCAGACTTCAGAGCTCTTTCTATTC
TTCCAGGCAGTTTCCACCAGAAGCAAAGGACAAGAAAGTAATCCCTGTAGCCCTGATGAT
TTTACTTTCTGCCCCACTCCTCCGACTTGGACCTTCAAAGTTAATGTGGAACAAATGTCA
GTCTCCCCAGTGTTTCACTCTGACATGCAGTGCTGAGACCAATTGTATAAGGCACATACA
ACATATATACGCAACAGTTTGTCTTATTGTTTTATGTAACTTAGGCCTTGTCCGCAGAAT
GTGCCTTTGCCTCTTGGTCAGCTAATAGAGGTACCATCAGAAAATTCTAGATTGGCACAT
TCAGAATTTTCAGTAGGCTAAGAATTAAGTTATACTCAGATACAGAGGAAGGCCAAGTAG
TCTGTACCATCTTGTGTCACTGAAGTCTAACGTTTAAGCCATGCCAATAGACTTGGTCTG
TGTATACCTTCATTGATCAAAAAATGCCAATGCTGTGTGGCTAGGTGCTGAGAACACAAA
TACTGATCAGACTTGAGCCAAGCTGTTGAGAGACAGCTACCTTAACAATTAGAATACATC
ATATTTAGTGTCAAGAAAATTCAGCTCTAGGAGACCTTAGGAGAGAGGTACCTCCCACTC
TTGGGATTTATGTAACTGTGGCCCCATAGTCAAGAAATTTTGTTTCACCACAGTAAGTCA
CTAAGCAGACATTTTATTTGCAGTCAACTTGAATTTCCATTTTCATGGATGAGCAAAGAG
AGAAAGCACGCCGATGTACATTAAAAACGAGTCCCCTGGGCTTGAATTTATGATTATGAG
CTCAATTTTTAAGACTTATTTCCTTCTTTACCCTTGCCATTTTTACCTGTCCCTGGCGCA
GGACTGTGAAAGTTTAATGACTATTCAAGAGCTATTTTAAAGTACATTTAAAGGCAAAGC
TTTCAAAAGCAGACCAAGTTCTTACCCCCAGGGGCAACATGATATTCTGAATCTCTTTCA
AATTTTATAGGTCCAGACTTCTTATTGCTGTGATTGTGAAAATACGTATGTAGCAGCTCA
AATCGCAATGTTTGATCAAGTGCTGTGCAGTTTTCTGTTACTATACGGGCCTGATGCTGC
ACCCCTGCCCATCACCAGCGCTCTCTCTCTCTTTAGCTCCATTATTGTGCCCAGCCCTGT
ATCTGTATGTAAATGTGTCTATAGAACTTTTACAGGAGGGAGCTTCCATGCCCCACCTCC
ACTGACCCTGGGCCCTTGGCTGGACCTGCAGGTGCTGTAGGTAAAGCCATCAGAAGGCAG
GGGAGCAAGCTCTCCCTTTAGCCCACCGCGCCCTGTAATAGCCATGCTTGTAGGATAGGA
GGCTGAGCATTTGAGCCTGCCTGGATTTTTTGTTTGTTTGTTTCTTTAGTTTTACTTCCC
TTATGGTAACTGTCACTTTATATTCTATATTATAGCTGTTTATTTACATATTTCCTCTCT
CCTTTGAGTGTAGAAGAGAATGTGGGATTTGTGTTCTTGGTACACAGTAAGAATGGAATA
AATTTTCTGATGTTTGAATAACTGTGAAAATAATTCATGTCTGTTTCCTTCACAGAATTA
TTAACATAAGTGCTTACAATGTATCAAGTAATTGAGTTAAATAAGCTAATGAATGAAAGG
ATGAACCTTCCAAAGGCCAGTTATTGGGCAAGGCAAGACAAGCTGCCTTCAGTTGCTTTC
ATTGGCAAAGCATTTATTCCTATAGGACACCTATAAGAATACATGGAAATACATGGGACT
CTAACCACTTCCAGGCACTCTGCTCTGCTCTGAGAATGTAAAGATGCAGAAACTGCCCCT
GCTCCCAAGAAGCTCAACTGTTGTAGACATAGCATCAATGCATATTCATTCATGCTACAC
TTAGATGTTCAATGAAACTACACTTTCTCCTGTTCCTATACTTGCTCTTCATAGTGAAAC
GCTCCCCCAAATACCCTCAGGTTGGCTGAGTAGCAATGAGTGGAGGAAAGGGCACATTGA
ACATAAAACTTGCCCATCTCTGCCAGTTTCAAAACTTTCTGGATAGTTCATTGGATTTGG
GCCAATGCTCAGCCTTTCGGGTTTCCCTCTGTCCTCAGAGGTGGCTTGTGGGTCTTTTGC
AGGCTTGAGGGGCCCTTGGCCTCATGGTGGGCTTTGGCCAGTGTCCACGGTGGGGCAGCC
AGCTGGTCGGTGCGTGTGCTCTTGCAGCACCTGATGTGGAGCAGCTGCTCAGTGCTGCCC
CTGACATTCTCTTGTCCTCTGCTGCTCCCTCAGCAACCTCCTCTTGCTGACCGGCCACTC
TTCAATTCTTGTTTATGCTGTGGACTCCAGCTGTCTGGTGGTGACTGCATTTGAGCCCAG
CCTCAGTGGCCTCTCCACATGAAACACCCACATCGCCTTGCGTCCACTTCCCTGAACCCC
TTGCCAAGCCCTCGGATTTCCAGACATTTTCCAGCAACCCAGGAGCGGAGGAGCCCTGGG
GAGCTACAGTGCAGCCTTCCCTCTGCTAACCACACTTCACCCCAGTCGTACTTGCATGTG
GCCTCTTTAAGTTGTTCTATGACTGTCCCCAAAGGAAACAGTTGCTTTACTTTCCAGTTT
CCCTTCAAACTGACATTCTTCTCGCCTCTGGGATCTCTATCCAGAGAGGACATCTCTGGA
CACATGTGACTCAACACATTTCTCCTCTGTCAGTTTCCTTTCCTCCTTCCACAGTGCAGG
GGTAGGAGGGACAAGTGCATCCCTCCCACTTCTTCTCTTGCCTGGACACCCTCCTTCCAG
GGCCACCAGGCCTTCTGGCTCAGCCTTAGTGGAGAAAGGAGCAGCCTTCCACATGGCAGA
AACCTCAGGTGTAGTTGGCAATAGCAAATCTCGCTGTGGTAGAGGGAAAATTGCAAAATT
TAGAATCCCTTCTCTCTCCTCCCACCTGACTTTCTAGAGCCTTCTTTGCTAAAGAAGTCA
AGAAAGTCAGCTTTGGGAAGTGAACTTGGCCCAGTGGTTAGGGCGTCCGTCTACCACGTG
GGAGGTCCGCGGTTCAAACCTCGGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGCGCA
GTGCTGATGCGCGCAAGGAGTGCCCTGCCACACAAGGGTGTCCCCCGCATAGGGGAGCCC
CACGCACAAGGAGTGCACCCTGTAAGGAGAGCCTCCCAGCGTGAAAGAAAGTGCAGCCTG
CCTAGGAATGGCACCGTACACATGGAGAGCTGACAACAAGGTGAAACACAGATTCCCCGT
GCCACTGATAAGGATAGAAGCAGTCACAGGAGAACACACAGCAAATGGACACAGAGAGCA
GACAACTGGGGGGGAAGGGGAGAGAAATGAAAAATAAATCTTTAAAAAAAAAAGAAAAGA
AAGTCAGCTTTGTGTTTGAAAGATGATCAGTGAACTCTTAGTCCTATAAAGAGCCTGCTC
TCTTTTTTCCTCGTGGCTCAGTTTTATAGGTAGGAGGCTACACAGGCATGATTTGGGAGG
GGGGTATAAATTTCCAAAGTTTTATCCCAGTTTCACCACAAGACAGATCTCTGAACCAAT
TGCAATGCAACAGGAAAGGTAAAATGGAGCTGTACATAAAATGCCATGAGATGGGGGAGA
AGGGGCAACCGACTCCACCCTTGACAGCAGGAACACCAGAGGGGACCTCTGAGCAGGTCT
ATAAATCCAAGCCTTATTGGCAGCATGGATCTGGCAGTAAAGCAGGACTGCTTGGTTCCC
TGGTGATTTTCAGCTCCAATGGCTTGTGTAGACAGATTATAAATGAGATACCCTTATATA
TTTCTTTTCTCTCTCCCTGAGCATCAGTTTTCCCACCTCTAAGTCAGAATAAAAGTCTGC
CCCTGTGTGTGTGGGCATGCAGAGGTAACATTGATTTTGGTGGCCCGTGGTTCTCCACCA
GCCCTAGGCAAAAATAATGAAACACATAATCATACTTCTGTTGCTCAATCCAGCCACCAC
CTCCTGCTGCTCTCTAATCCTCAGGTATCCTCAGTCCTTCCTACAAACAGACCTCTCAAC
AGTGTCCCCAGTGGCCTTCCCAATATTCTCAGACCTGTCTGGGATCCACTGGGCAGTCAT
CCAAGTTGAGACACCCACTGCCTTAGCAATGCGCCCTACACAGTAGATGCTCAATAAATG
CCAGCTCCCTTGACTTACATATTGCCCACTTCATATATTCTTTCAACTGATCAAATTTAA
GAAAAAAAATAAAAAGACATCTTTTCCCCTCACACACTGTCACTTCTGGACAGCAACTTT
AAGATGAGCAATGAATTTCACAATTGCATGCAGTGTGGTCTAGGTGAAGGGATTTGCTTG
GGTTGAAAAGAGAAGGGTTAGGAAACCCAGATTCCAATTAGCTTGGACACTGTGATTGAT
TCCTGTGTTACCTCAGTAAGACCATTTACCCATCCATAGAGGTGAAATCTCATAAATATT
AATGAGGTTGCTGCTAGGTACAAACAAGATTCTTCCAACCCACTGTTTTGGAGTGAAAAT
ACCAGGGGAAATTGTACAAGCAAATATGGTAACACCCTATTTGGAACTGTGCTTTCACAG
TAGCAAGGGCTACATAAACACTGGAGCCTTGGAAGGTTTCTGCCTGATGTGTGAAATCAA
GAAAATTTCTCCTATGGTACAGGTGCACCTTTTCAGCAATGAATATGTTCCTGAAATGAT
GCTTTCCACTATGTTTGTATATGTGATTCATGCAGTATTTCATGTAGGTTGAAAGTTACT
TTGTTCTATGAACCCAACTTTGTTCCCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATTAAATAAATG
AAAATTAGCCAAATTGTCTTTCTGCTTTCTTCAAGCAATTCAGTAAATACATCATGATAA
TTTCTCACAATTTTTCTCCAGGTAATTTCTCCCTGGTTCTTGAAACATTAAAGATTATTG
AGATGAAAGAGAAAGTCAAAGCTTCTCTGTATTGAACCCAAGATTTGAGGATTTTTAAAA
AACCAATAATCTAGTTGGCGCTCTTTTTAAAAAATGCAATATCCTATGAAGGATTTAATT
AGAGGGCTCAAAATGAAAGATAATGAACTTGGAAAGAGCTGGTTTGATACAAATAGCTTC
CACAATTAGGCAATGCAACATGAGAACTAAGAAACAAGGAAGCTACAAATGGTTTCATTA
GAAACATCTTTCTATGTAAGAATTCTCTTCATTTCAAATAAAATGTCTTTGAAGTAATAA
CTGTAACTCATAATGGAAGATATAAGCAAAGTAGTTCAATAAACAGCAAAACGTATACAT
CTAAGTCCATGTTATCCTTCAGAGTGCCTATCTTTTAATAATATACCTTACTCTAACATG
GTTACTATTGTTCAAAATATTTTAGAATTTCACTTTTGAAATTTCCTACAATGTCAAAAT
TTTTAAGTCCTACAAGTTTCTTTATAATTTATCCTTTCTTTGGACCCAGAAAGTATTATC
TAGCTTACCTGATAATTTTTATCCTTTCCAAAAACTAAAACCTACCCTCCAAGAATAAGC
AGTTGTTTCCATTAAGGATATTCCAATGAGTGTTCTGAAGGCAATTTCAAACAAAGATTC
CAAAATGTTTTTCACTGATGTGAGCTTCTTTCTAATACATCCATGACCTTCCGGTTTGAC
TATCTGAATGACATCCATGTTTGATGAATGAATTCCAGTGTTTTTTTAAAAAAAAGATTA
TGTATGTAAACATCTACACATCACGCTTAATAAATGGCAATTTTCTTCTTCCCTTAAAAT
AAAACAAAACAAAATTCTCATTTTAAAGGTACACCTTTCTTTATGCATGAACAGAGCTGG
TATAGTAGGCAGGATAATGTCCCTTGATGTCAATCTAATTTCTGAACTCTGTGAATTTAT
TACCTCATGTGCAAAAAGAACTTTGCAGGTATGATTCAGTGAAGAATTTTGAGGTGCTGG
GTTAATTGGGTAGCCCCTGTGCAATCACAAGGGACTTTATGAGGGAAGGCAGGAGGGTCA
GAGTAAGAGGAAATAGGACAAAGGAAGCAGAGTTCAGAGAGGAATTTTAAGATGTGACAC
TGTTGACTCTGAAGATGGAAGGAGGGGTCACAAGCCAAGGAATGTAGGTAACCTCTAGAA
GCTGGAAAAGGCAAGGAAACAAATTCGCCCCTAGAACGTGCAGACACCTTGATTTTAGGA
CTTCTGCCCTCCAGCACTATAAGATAATAAACCAATGCTCTTTTAAGTCATTATGTTTGT
GCTACTTAGTTACCGCAGCTTAAGAAACTTATACAGTTGGAAACAATATTTGATGCCTCC
TAATCCTGCAGGCTGGTTTGGAGGCATTGACTCTTTGATAACTTTCTCCAAAAAAAAAAA
CCCAGGAGCATCAAGGCAAGGGCAGACTTTTCTTGCTGCTTCGTGCATGTGTTTTTATCC
TTCAAGAAAAATGATCCTGCCAGAGAGTTGTCCTATCTTTGTGGTTCCTAAGATGCCAAT
TATCTCAACCCTGCCTAGATGAGTCCCTGGAAGAGCACTTTTGTGCTATTGCCATAGATA
AATATACTAGAAAACACTTCTGAGCCAAGGCTGGTTTCATTTACGGAAGTGCTCATTTTG
AGTCAATCACTACACAAAATTCATCCTATAATAAATGGTTAAATTAGGAGAGTGTCCTTT
AAAAAGGAAAAAATATATATATACACACATACACACACACATATGTAGCCTGCTCCCCTT
GGCAATGCATTTGTTTGTTCAGAAATCATAAATCACTGAAGCCTGGGAGCTTCTCTAAGG
TTGACATGTGCAGTCTCAAAGCTGCTGAGACTTTTTTAAGACTTGGACAATGAGAATTCA
TGAAAACACCAACATCTGAGAAAACAGTAGGAGTTATTTCTGTGCCCCTTCTTCCTGCCC
TCCCCCTTGTTTATATGGTCTGTGTTAGGGGCCATTTTCAATTCAAGTGCTCTCAAACAG
GAAGACAGTACATGACTGAGCATTTTCTGGGGTCATTAAGTGGGGAGCTTGGTGAGCCAT
TTAGAGCCAGGACATTCTCTGGACCGGAGAGTGGCAACAGGACTGTAACTGCACAGGGCA
CTCACCTGTATCTCTCAGGGCAGAAACCATCCCAGTTATCTCAATGGAAGGAATCTTCTC
CAAATGGTTCAGAGAAATAGAAATTTGCCATTGCTTCCTTTGTCATACATTCATTCATTC
ATCCAGCATCGACCCTTGTCCAGGCAACACAATGAGCACCTGAGGACTTCACCCAAATGT
CTCTTTTTCAAGGAGTCCTTCTCTGACCGCATTTAAATTGTAATCTTCTGCCCCATTTGG
CATTCTGTACCCTCCCCTGCTTTATTTTTCTCTATAGTCCTTATTGCCATTGACATACTA
TATGTTTTACTTAAGTATCTTTCTCTTCCTCCACCAGATTATGATCTCCATGAGATTATA
AATGCCACAAGGGCAGGGAATCTTATCACCTGGATTTTTATGTCCTAAAATAGTATCTGG
GACATAGTAGGTACTCCATAAATATTTTTGAATGGATTAATAAATATTTATAGGGGTCTT
GCTGTGTGCCAAGCATCACCGTAGTTCTAGGAGACAGAACTGAGAACAGGAGAGAGAAAT
GCCTGCCCTTATGCGACATATAGTTGAGCGGGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTATAAACCTATACCATATGTAATATAGAAAATGCAG
AACAATACTTCCTAACAGTGATCATTTTTGAGTAGCCTCAAGACTGCTAGATTGAGATGA
CACAGCTGACAACTGCTGTAATGACTGGCTCTGATAGAGTTTCTACTCTAACCAGACCTT
GATTGCTTGTTCGGTTTGTGAAAGAAGACCTGGGATCACATCCTGGCTCTGACACTTACT
ACTGTGTGACTTCCAGAAAAGTTACCTACCTTCTTTGAGGACTCTCTTCTTCATCTATAA
AACAGGAAAAATATAAGAACTTAGTGTTGTGTCTGGCTTATAGTGGACCTCAGTAAATAT
TAATTTCTTGTTCTTTTCTTTTGGAAACTGGTGAGATGATAAACAGCTTGTTCTTAAGCT
GATTAAAGCTTGGATGATGCTCACCCAGAAAGAATTTGTCCTCTGGGACAGCCTTTCTCT
CACCTGAGGCAGTTTTTTGTACAGCAGAACTAGAGAGCTTGTGTTTCCTATTACTTGTAT
CTTCCCGACACCTAGATTTCTAGGTACTTGTCCCAGTTTTCAGTGTCCTCTTTTTTTTCT
TTTCTTTTTTTTCTTTTGCCTTTGAGAGTTGAAGCAAAAAAAGCAAAATGAAAATACTTT
AACAAGTTGGAAGTTCTGACAGACTAACACAAGGGGACATATAAAATTCACATTTAAGTC
CTTATCAGTAGTAGCAAGAGAAATGGGTTGGTGAGAATCTTTTTATAAATCCTGAAAATA
GGACATTTCCTGGAAAACGACTGTCAAATAGCACAATGACACATTTTATTCATTTGGATC
CCTCGAGGGCCATTGTCCAATATGAATATTTTAAAACAGTAAATCCTAAGCATTAAGCCC
TAAGGTATTCAGTTGGTGAGGGAGAGGGGGGGGATGTTACGAATAAAATAGCCCTGGCAG
GGAAAAAATAGAAGGGTAGGCATTGTCTTCCAGAAAATTCTATTCCAAATAAAAGATGCT
ACCCCCTGGGATTATACTGCAGTTCCGGCTTTAAAATGCCTCTGGGATTGTTATGTAACC
AGACCACAGGCAATTAAATGGTTATTGATGGCATGTGAATGTGCATTTCCCAAATTACAT
TCAGCTTTCTTCCACTGTACTGTCAGTGAAAGAGGACTTAGGTTATATGTGTGAAATTTG
TCTTTTTTAAGATCCTTCCCTGTTAAAGCTTCGGTTTTACTCACCGAAGATGAATTTATA
ATATATGTCACTATTAGAAACAAGGGAGAATTGCCAATTAGAAGCAGAGGAAGAGAGAGT
AGGGAAATGTTTTCTTTGCTGGAATCTACTACCAGAGGCCTCAGGTTTAGCCTCTGACAG
CTGCCCAGGGTGAGGGGCGCCTTTTCCCTGTGAATCGCTGGAGGGAAACGTTAATGAGGA
GCTGAAAGCTGGCAATGTGGGTCTCCTTTGGGCAGAGAGCATTAGAAAAAGGATGAGGTC
ACCTCATTATGCGCCACTGGACTGGGAGCACTTGGATAGCATCTCCCCCCCCCCTTTTTG
TAGTAACGCAAACCAGCAGCTTCCTTTGAGAAAGAGTCATCAGACTGCCGTAGATTTTTT
TACACTCTCATAACGTGTAGTTTTAAAATTATGAAAGTAGTATATGCTACAGAGAGGAAA
TTTGGAAACTGCAGAAAATTTTGGGAGTGGGGTAGTGAAGATTCAGTTATCTGCATTCAA
AGGTATCTACTATTAACATGTTATTCTTATAGATTCTGATTTCCCTCTTCCAGCGATTTG
TATGCCTAATATTATATGTAGATCCTTCAGGAAGAAATGAGCATTTACATGAGCATATGT
GTCACCCAAGCCAAGCGTGGGATAGCGGGGACATAGAGAGACTCCCTCAGTGGGGTTGAG
GCCAGGGGGAACCTTCCACTTCCTTTTTCAAATCTGGGGAGAAAACTCTTTCCTTTCTCC
TCTCCATTCCTTTGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTATAAACTTTTGAGGCTAAT
ATGTATTTGTAGTTAAAGCAATCTTTTTTCTTTTAAGAATGAAACTTCAAGACAAGTTAA
AGTATCTTACTGGTGGACAGACAATTGTCTAGGAAAAACTAAGTTTAACTTTTAGGTGTC
ATCTGTCTAAATTCTAATAATTTATAAAGCATTATAAGGCATCTGCATCCTCACCTCCCA
TTCCCAGATCTACTCCTAAAGTACTGGGACAGTCTAAAATGACGGGAATGTTCTCCCATT
CCTCACATCTTCCCCTGGGCGCTGCCACGGCTTTGAGGAAGGCAGGAGGCCAAGCTGCCC
TGGACACACTAGGAGCTGCAGAATCTTGCCCCCTCCCCCAATCATCTTTTCGATTTGCCT
TCACTCCTTTTCTGCAAGACTTAGAAGAAGTTTACAATTAAATGAAAAAAAGAAAGATTA
CTTTGTTGCAGAGTTGGCTTTAACTGCACACATTCTGGGTCTAAATAAAAATCACAGGTT
CAGGGGAGATGCATAACCTTTTCTACAGAACTAAATGATTTTTCTCTGTTACGTGGGGAA
CTTCCTCCCTGAGCGCCTGCTGTTGTTTGTCCTCCTCCTTCCCAACAGCTCCTGGACTGC
TTTGTGATCCCGGTGGTGATTTTGCTCTCCTGGTTCTTCCTGCTGATCCGGTACAAGGCT
GTGCACTTCGTCGGCATCGTGGTCTGCATCCTGGGAATGGGCTGCATGGCGGGAGCAGAT
GTGCTCGTGGGAAGGCATCAAGGAGCAGGTCAGTCTCCGGGAGTTCACAGGCCAGCCAGG
GTGTGCTCATGGTCAGGCAGAAACAAGGGCATAAGCGACCTGGTCTTCCTGGCGCCTTTG
TCTTCGGACGCCCTGTTACCAATGCTAAGTAGAGTCCCTTCATGCATGGTGTTTTGTTTG
TTAGGGGAGGGGTTATTGGTATAACTCCATGGTTGCTAGGTCCACAAGGTACAGCCTCCC
GGTTAACTCGGCCTCCTCTCCCCAATCTGCTATGCAGCCTTGATCGACATGGCCTCTCTA
TGACCCTTTTTCTGGATTGCAACAATTAAAAATGAAAATAGAACCTTAAAAAGGATCTCA
ATTCCGATGCTACATAGGCCTTGTGTGACTGGAGAAAAATGCCCCCACAAACCCACACTC
GGATAACATTTCCCACACTCTAGAAAGGCTACTATTTTTTTTCATGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGTCACTTGTCTA
CGGTCACAAAATTAGCAGAGCAGGCGACTAGTACCCAAGCTCCCAGCCCCTAGGCCAAGC
CTCCTTCCCTCTTTCATGTCGCTGGAAGCTGAAGATACAACATAGTTCAAAAGAGAAACA
GGCTTGGCCCTCACCAACCTGCCTTCTGCACAGTGTCATCACTCCCCAACTCAGAAGACT
GTCTAAAACATACACCAGCATTTCCCAAATATCCTTTTATGAAACTCTGGTTCCACCAGT
TATCAATACATGTAATATGAAAAGGCCAGTTTATGCTCTGTACATGTAGTGATCCAAACA
TGTATAATCTCTTTGGATCAATCAGACTGTATTTTTATCAGATACAATGTTGCCAATTCT
AATGTCACAATTTAATCACACTTTATCTCTTTGTTCTCACTACGTAAACACAGACTAAGC
AAAAGCCTGTGCCCTTAGTTATAAAAATTATGCTTTACTTAACTCCATCCAGTCACCCTG
GAGATCTTGTATTACATAGTCAAGGAAGACGATTGTACTGATAGATCTGAACGTGTGAGC
CTAGAGTGTGGGCCTAGCTTGAGTTGACTTCACTAGAATGTATTCACTAATCCTGTAAAA
AAAGGTTTCTTACTTTCACCTGAAATATTAAAAAGAGTACTCATTAAGAAAAAGAAATCA
GTCTATTTGAGGGCTTTTCAAAGTCATTGTTTTATAAAACAATGTAGGTGTGGCTAAAAC
ATACTGGAGAGGTATTTTATCTATTCCTGTGAATCTGTTTAAGACACATGCCACCATTGC
ATTATTAACCCATGAAATACTGGTGTTTACAGAATTAAATTTCATTATTGTGGAGCATGT
TCAGTGCCAATTACATGGTATGGTGTTCTAAGGCCAGCCCAAATATAGATCCAAGGACAC
ATGGTACGAAATATTTGTGTGCAATTAGGCTCCCACTTTCCTCTACAAATCATCAAACTA
GCAGTAATAAGCTATTTATATCAAACAGTTTAAAAAGAAAAAANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTGTCCTCAAGCACATTGATAGTAGCC
TGTTCAAAGTTACTTTGACCTCAACATAATTAAACACGTTTTAATTCTTCTTTGTTAGAA
TGTTTCTTCATCAGCTATCTAGGACTTCCTCCCTTTGATTTAATCCTTGCTGAAGGAAAC
TTCTCAGAGGACACCAGATATACCAGATACAAAATATAAATGTCAAAGTACAGGATAATG
TACCATTAGTAATGCTTTTGATGAAAACTTTACCAGCAAATTCAACCACTATAGAGAGAA
GTAGGTAGAAGGCTCTGCAGCCCACTCTGTCTAGAGTGGTGTACAAAATGGGAAGGGCCC
AAACTACAGTTAGGTTCCAATTCCATGCATGGCAAAGGTACAACTGGTCAACCACCATAG
GAAGCTTCCAGACCTTTGAGCTCACATGAAAGAAGATACCTTTTCACATTTGTTAGTAAA
AATCTGTGTATGTGACAGGTGTATTTTCTTCTCTCTTTGCCCTCTTAGCTCCATGTCAGC
ATTACAGGCTCCTCTAAAAGTCCATTTCTGCATTTACTGATGCAGGGAAGAAAGATGTGA
AAAAATTGGCTCCTAAGAATATTATAACTGTTAGAGTGTGTTAAAAAATGACTTAATAAG
TCCAGAGAGATACATCTCCATGACTTTTCTTCTTTCCTGAGAAAACATATCAATATAAAA
AGGAAGTTTAGGAAGTAATAGGATTAAAATAAAACTCCATTAAAATAGGTTGTTATTATA
AAACATGTTTCTTGCCTTTCAAAATTTCCTTTTTCTACCACAATACATTTATTGAGTCTT
ATGGTTCACTCACCTAAGACATGAGACACCTATAACAACAATCTGGGAAGTGGACTTGGC
TCAACGGATAGAGCGTCTTCCTACCATATGGGAGGTCCACAGTTCAAACCCCGGGCCTCC
TTGGCCTGTGTGAAGCTGGTCCATGTACCTGTGTGGAGCTGGCCCACATGCAGTGCTGAT
GCACGCAAGGAGTGCCTTGCCACGCAGGGGTGCCCCCAGCATAGGGGAGCCCCATGCGCA
AAGGAGTGTGCCCTATAAGGAGAGCCGCCCAGCGTGAAAGTAAGTGCAGCCTGCCCCAGG
GATGGCACTGCACACACGGAGAACTGACACAGCAAGACGATGCAACAAAAAGAGACACAG
ATTCCTGTGCCACTGACAACAGAAGCAGACAAAGAAGAACACGCAGCAAATGGACATAGA
GAACAGACTACTGGGTGGGGGGCAGAGAAGGGGAGAGAAATAAATAAATAATTAAAAAGA
AAGTGAGTTTGGTGAAGCCATTATTCCAAACGTGAACTAATTCATTCCAGCTTCTTCCCC
ATCGGAAACTAGAGACTAGATTGCTACCCCAGGCTTCCCTGTGAACAAATACCTTTCAGT
TACTGAACTTTAGTTTCTCTTTATGAACAGAAGTTGAAATGGAATAAGCCCCCAACCTAT
AAGCTACGGAAAAGTTGAACCCATAATATATCACCTGGGAAAGGCTCAGAATTCCTGAAA
GTAAGGACCTGCTCAAATAAGAATTGAGAGGTAATGAAGGCCTCTGTAACTCCCTAAATG
TCTAAGAATGCCCACAAAGTTTCCTCAATCAAGCATTTCAGATTACATATCAATCTTAAT
AAAAGAGTAATGGTTTACTAAATTTGTGAAGTGACAATGGTCATTAAACAAAGGACAGTG
AAGCAGTCAGTCTAAGCTTAGCACTAACAGCTTGTTTCCTCTGGATTAGGACAGAATCCA
CTTTCATTCCTATATTTACTTACTCTAAAAGAAGAAGACAAGTGTATATGTTAAAATTTG
TTGATATAGGGACAAAAATACCTGAATCATAAGCCCATCACTGACATATTTGATGTAATA
TAGCTGTTTCTAGGTGACAGAAAGACCAAACAACAAGAAACAGATATTAAAACTTTCACC
TTCATCTAAATATTATGGCAAAAAAAAGGTTCAGATCCAACAAGACAGAGTGATCATTTT
TCACTGTTTTTCTGTCCCCACAATCAGCCCTGGAACATCAAAATAAAGAATTCCCCCATC
CTATGGGAAAGTTGACAGAAATAATAATGAAATAATCTGGGAAATGTTCAGTGCTGTGTT
AGTGGTCCCTACTTTGGAATTTGTGTTCCTCAGTGTGATCAGGTTGGATTCAGATGTGAA
CTTTCTACACATGCCTCCTCTGTCACTTATACTGAACCTGTGGTTGACACTAGGGTTGGT
GTATACTCAGGAGACTTGAATCTCTGGACTGTCCATTAGCCAGCTGAGCCCTGAGCCTCA
GCAGAGGGGCAACTCCTACTCTCTGGTTCATTGGACTTACCTAGGTCAGCTAACAGGGAG
GTAAAGGTGGTCAAACACCAAACCAGGAAATCAAGAGTGCCAACAACTGCAAGCAGAGGA
ATTGCATCCATCATCCATGTGTAATTTAAGTCCCCTCTTGATCTAGAGGTGGAGTGGACA
TCACCATCCCAGCATCCATGGAATGGAGGAATAAAATATGGATTAGAGTGGACTTACTGA
TATTCTACTATAAAACTATTGTGACTAGTAATAGAAGAAATTGTAGTATTGATGTGGAGA
AAGTGGCCACAATAGTTGCTAAGAGCAGGGAGAGGGAAGGAGAGATGTGATGTGAGGGCA
TTTTCAGGACTTGGAGTTGTCCTAAATGATACTGCAGGGACAGACGCTGGACCTTATTTT
TCCTGCCATAACGCACTGAACGTACTGGGGGAGAGTGTAAACTACAAAGTAAACTATTAT
CCATGCAATGCAGCAGTGCTCCAAAATGAATTCACCAAATGCAATGAATGTGCCACAATG
ATGAAAGAGGTTGTTGATGTGGGAGGAGTGGGATATGGGGGTTGGGGTATATGGGAACCT
CCTATATTTTTTAATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCTAAAGTTTCCAGAGAGAAAAAGCAGATGATCTTCAAACAAGCA
CTATTCAGAATCACATCAGAAATCTCAACAGTAGTACTGGAGATAAAAAGGCAGAGAATG
CCAAGTATATGGCTATATATATTCAGGTTAACTACCATTTAAATTTGAGGAAATTTCCAA
GCTAAATGAGGAAAGTGTAGTCCATCTTGAAGCTTATAGACAAATGGTAGAGGAAAGGGA
TAAAATTAGAAATGTACTTCTGGGCACCAAGGAAGCCAAGGTCTGGACTGAAGAGACCAC
CTTGGGCCATGAGAGTGTATCCACCCACGTGTGAAAAAGGTGAGTATGCCCCAGAAATGG
AGAGGGTGGACTTTCAGTCCTCTTGTTCAGGGAGAGGGATGCCACCTCAGTGCTTAGAGA
TCCTGGCCCCATGCCCAGGGGGTTGTGGGGATCCTAGCCATCCTCCTGATGCTTGGAGAT
GGTAGAGCCTTCACCCCAGTGTGAAGGCACTTGGAAGGGGTGAACTGCCACTACATCAGA
CTTGGAGAACAAAATATCTATCAATAAATGACTCTCAAACCTTGAAATGTAATGGAATTT
GCCCTGCTAGGTTTTGGAATTGTTTGGTACTCACAACCCCTGTTTTCCTTCCAATTTCTC
CTTATTTGAATGGTAATGTCTATCCTCTTTCTGCTCCTCTTTTGTATGTTATAAGAAGAA
AACTTGTTTTCTAGATTTCACAAGTCCACAGACAAAGGGGAATTGTGCCCCAGGACAGAC
CACACCCATAACTGATTTTGAGAAGTATTGTTACTAAAATAACTTAAGGCTTTTGGGATA
TTGTGACAGAATGAATGTAGAAAGAATATGTCTTTTTAAGGTCCAGAAGGTGGAGTGTGG
TGGTTTGGAACAAGGTACCCCTCAAAATTTTAACCCATTCCTATGGATGTGAACCCATTG
TATATAGGAAATTTGATGAGGCTATTTCAGTTAAGGTGTGGCCCACTATATTTGGGATGA
ATCTTCATCCCATTACTGGAGTGCTTTATAAGAGAATGAAACTAAGTCAGAAAGAGAGAA
AGGCACGGAGGGAGAAGCCAGAAGCTGAAACCAATGGAACTCAGAAAAGAAGGGAGAGGC
CAGAAAAGGCCACCATGTGACAAGCTAACCATGTGACAAGGATTCCCAGCTGCCAGCCCC
AGAATGCCACAGTCTTTGGGGAGAAAGCATCGTCTTTGGGATGCCTTGATTAGGATTTTT
TCCTAACCTCAAAACTGAGAGCAAATAAATTACAGTTTTTTTAAGCCAAACCATTGCATG
GTATTTGCTTGAACAGCCTAGGAAACTAAATCACTGGTGTTTGGAGCTGGCTGCCTTGTC
CTTGGCTCCTCTGCCACATGGCAGTGCACATCACAGCCTCCCCTGGCCTCTCTCTTCTCT
TCCAGAATCTGTTGATCTTCAGCTCTTGCTTCCCATGACTTTTTTTTTCTAATTTTTGTC
TTTATTTATTTTTTTAATATTACATTCAAAAAATATGAGGTCCCCATATACCCCCCACCC
CCCTAACCCCACTCCTCCCTGCATACAACAACCTCCTCCATCATCACGAGACATTGATTG
CACTTGGTGCAATGAATAACCCATGTATTCTGCACCTCACGGTCAATGGTCCACACCATA
GCCCACACTCTCCCACATTCCACCCAGTGGGCCATGGGAGGACATAAAATGTGCAGTAAC
TGTCCCTGCAGCACCACCCAGGACAACTCCAAGTCCTGAAAATGCCCCCACATCACTTCT
CTTCCTCCCACTCTCTACCCCCAGCAGCCACCATGGCCACTTTCTCCACACCAATGCCAC
ATTTTCTTTGATTACTAATCACAATAGTTCATGAATAGACTATCAGTAAGTCCACTCTAA
TCCATTCTCTGAGTATCATTCCACTTACAAAGGTCTTCAGTAGTAGGATTAAGATCCACC
CTTTCCAACATGGATACCTTGGGAGGTTATTCTCCCCGGGCTCTATCCAGGTGGTGCAGG
GCATAGGATTCTGCAGTGATGTACATTCCCATCCCTCGATGTTGGAGATGAATCCAGGCC
TCAAGCCTGCACCTGCATATTCCTACAGCTTCTCAGAGTCCTATGGACAATGACTGAGGA
GACAAACCATGCAGGAAACATGTCTCATATTAAAAATTAAAACTGAAAGACCTTAAAAAG
GAATCTAAACCTGTTTTATATTTGTTTGCATTCAGGAGTGAAAAGGAGGAAAGCCTCGAC
ACTGAAATATGAGGTGAGAAAGTGGATGATATACTATCTTGAAGATGATCATGGAGGGTT
TGAAAATGGGCACACATTTGTCTTCATGTTTAGCTTTTAAAAAAAAAAAACTTAATAAAT
CAAAGAATTCCAGCCTTAAAGACAGAATCATGGGAATTGACTAGAAATGCAAATTTTCAG
GTCATCCCAAAACCATATACCAGTTTAATTTCCAATGTACTATATATTATAACCCATGTA
TTCTGAGAATAAGAGCAAAGTAGATTAACCTATTAAACTAATGTATTTATGAATTCAAAT
ACAGATGATGTTGACATTGAAAGAAAAAAAGGTCCCTTCTAATTCAGGTGGGTCACACCT
TAAATGAAATAACTTCATCAAAATGTCCTACTTACAATGGGTTCACATCCACANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAGATGCCAGATCAGTGATATCATGGAAAACAGCA
AAGTAGGGCACTCAAAGAACTTATTCCTCCACTGATTCATAAACTGGCAAAGACTGACAA
AATCAACTTTTTTTCAGATGTCTGGAATTTAATCCAAAATTTACAACAACCAGAGGGCTG
CTTAATGAATAAATGGGTAGCTAAGTTTTCTTAAAAGAAAATTGTGGCATTTTTGCTCAC
CATCCTACCACCTCCCATTTCCCAGCTTAGTAGCTATGGGAACAGTGACCCATGTTCCTT
TTGTAGCTTGTTTTTTGCCAGGGGAGTGGTACTGATTTTGTTCTTTTTTTTTTTTTTTTA
AGATTTATTTATTTATTTAAATCCCCCTTCTCCCCCGGTTGTCTGTTCTCTGTGTCTATT
TGCTGCGTCTTGTTTCTTTGTCCACTTCTGTTGTCGTCAGCAGCACGGGAAGTGTGGGCA
GCACCATTCCTGGGCAGGCTGCACTTTCTTTCGCGCTGGGTGGCTCTCCTTATGGGTGCA
CTCCTTGCGCATGGGGCTCCCCTACACGGGGGACAGCCCTGCGTGGCGCAGCACTCCTTG
CGTGCATCAGCACTGCACATGGGCCAGCTCCACAAGGGTCAAGGAGGCCCGGGGTTTGAA
CCACAGACCTCCCATGTGGTAGACGGACGCCCTAACCACTGGGCAAAGTCCATTTCCCTG
ATTTTGTTCTTAAGATATTGTTTTTACCTGTCTGTAGTTCACTGAGGAATCAGGGCAGAA
GCTGACTTTTGCTTTCCCCTCCCTTGGACTGGAACAGCTTTCTGGGCAGTGGAAGCTTTA
AAGATGCACACTGCCCATGGTTGTCTGAAGCAATGAATGGTGAACAGGGCAAGCAGTAGA
AAGATCCAGATGCCCAGGAAGGAGACTGAAGACAATGTTTCTTGTAGGAATAAAGGCTCA
GAAGGGCCACTGCAGAGAACCAAATGCAGTACCAGACACATGATTTGAAAAGACCTGAGA
GGACCCTAGCTTTGTGTCTCAGGGGAATCTGTGGGCTCCACACAAGCAGGTTGTGAAGGC
TAAGGCAGAGTTGTAGGTACCCACATAGCAATGAAGGTCTAGTCCAGCTAAAAGCCAAGT
TACAAAACAAACAACAACAACAAAAACACACACAGACAGAAGACTGCTAACAAACTAGAT
AACTAGAAATGGACAATTTCCTAGAACCCCAAGAAAAACCTACACTTGACTCTATAAGAA
ATAGAAGACCTCAATAAATGAAGCACAAGTAAAGAGATGGAAACAGTCGTAAAAAACCTC
CCAACAATGAAAAGTCCAGAACCAGATGGCTTCATATAACCAGTGACTTGACTTTAAATT
CAATCATTCAACGAAGAATTAATACCAACCCAGCTCAAACACTTCCAAAATATTGAAGAG
AAGGAAACACTACCAAAATCATTCATGAGCCAGCATCACCCTAATACCACAGTTGATTAA
AGATATTATGAAAAAGAAAATTACAAACCAATCTCTCTAATGAATATAGATGCAAAAATC
CTCAAGAAAATACTTACAAATAAAATCCAACAGCACATTAAAAGAATTCTGTACTATGAT
CAAATAGGTTTTATCCCAGGTATGCAAGGTTAATTCAACACAAGAAAATTCAACACAACC
ACATTAATAAACCAAAAGAGAAAAATCACATGATCATCTCAATTGATACAGAAAAGGAAT
TTGACAAAGTCCAGCATCCTTTCTTGACAAAAACATGCTGAAAGATAGGAATAGAAGGAA
ACTTTCTCAATGTGATAAAGAGCATATATGAAAAACCCACAGTTAGCATTGTACTTTATA
GTAAAAGACTGAAAGCTTTCCCACTGAGATCAGGAACAAGACAAAGATGTCAACTGCAAC
CACTGCTATTCAGTATTATGTTAGAAATTCTAGATAGAGCAATTAGGCAAGTGAAAGAAA
TAAAAGGCATCCAAAACAGAAAGAAAGAATTGAAACTTTTGCAATACACAGATGACATGA
TCCTATATCTAGAAAGTCCTGAAAAATCTACAATGAAGCTACTAGAGCTAATAATCAACT
TTATCAAAATGGTGGGATACAAGATTAACATGCAAAACTCAGTAGTGTCTCTATAGGCTA
GTAATGAACAATCTGAGGAGGAAATGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGGAAATGATTGATTTGCTCTT
TAAGCCTCCATTTATTGGGCACTTACTAAGTGCCAGATCTATGCTAAACATTTTATGTGT
ATCATTTTATTTTATTTTCACAGTCACCCCACTATAAGATAAGGGAGCTGCAAGTCAGAT
GTTAGAGCTTGCCCAGTGTAGACATCTTATAAGTAACAGAGATGTGCTTAGAACCTACAT
CTTCCTGAAATGAAGGATGTTGCTGCTCCAGACCTTTACCATAGGATGGAGTAAGACCTT
TTCAGTCTGCTCAATTGAATTAGACATTTATCGAGAGCTTCTAAAAGGCCAGGATCCTTG
CTAGACACCACATGGAATATAAAACTAAGTCAAACTTTATGCCCTCCAACCTTACTTTGT
AAGAGAGAGTGGGGTGGAGGGCAGACAAGTAAGTTAACAAGTAACAGACATGGAACAGAA
TATGCTAGGTGCTCTAAGACAGGTACGGATGGTGTGAAATTCAGAGGAGGAGAGAGGGTA
TTGGGTTGAATGGACTTGTAATTTCAAATGTGTCCATTTACCCAAAACATTATTGCCCAA
CATGGTTTCATACATAAATGAGTGGCAGGTTTGCTGGGTCATTTCCCCCGTGAATATTGC
ACAGAAACTGGTGCACCATGTCAGTGCTTCATTGTATGAACAATGCAAAAGCTGTGGAAT
AATTCGTTACAATTTCCAGTTGACTAAATACAAATTTTAGATGCAAAATATTAATCCTAG
TACTTGCTAATACTTCTTATTATATCAAACACTTCATTTTTAACATGGTTTGGTAAAATT
ATGTTCTGATTAATTTAATTACATTTAATCAACTAAATTTCCATACCCGCTATATGTAGA
TGTATTGACTTTCAAACGATTTGCAAATTGGTAAATATACTTAACAGTGACATCATAATA
AATAATATTTCATCTTTTGCCTCTCAATTTAGAAAATACTTCTGAACTTGCAGTTACTCA
AAATTGTATTATTGGGAAGCAGATACGGCTCAACTGATAGAGCACTCCTACCATGTAGGA
GGCCCAGGGTTCAAACCCAGGGCCTCCTGGCCTGTGTGATAAGCTGGCCTATGTGCAGTG
CTGCCATGCACAAGGAGTGCTATGCCACACAGGGGTGTCCCCCGCATAGGGGAACCTCAT
GCACAAGTAGTGCACCCTGCAAGGAGAGCTGCCCTGTGTGATAAAAAGTGCAGTCTGCTC
AGGAGTGGCACCGCACACACAGAGAACTGACACAACACAAAGAGACACAGATTCCCAGTG
CTGCCAAGAATGCAAGTGGACAAAGATGAACACACAGCAAATGGAAACAGAGAGCAGACA
ACAGAGTGGGGGAGGGGGGAAGGGAAGAAAAATAAAATAAATCTTTTAAAAAATTGTATT
ATTATTACCAGTAATTATCACCATATTGGTGATGTGCTGGTAAGTCATTTCTTAAGATAG
TCAGAGGCCAGTTGGCAGAATAGGCCATAACTTTGTAGATATGGACTATAAAGCAAAAGT
TTGGTGAGATGATTTGCTGAAACAGCATGCCTCTTTTTAGGGTGTTAGAAGACAGCCCGA
GAGTATGGGTGGCAGAGTCAGCTTTAGGGATCAGCTTCATCCTCTCCCCGGATTATGCTG
ATGGCTCCCACCAAGAAGGGAAGGACCCTTCTGCCCTCAACGAGGTGGTGACCAATGAGG
CCATCAACATTCACAAGCGCATCCATGGAGTGGGCTTCAAAAAAGCACCCCTCGAGCTCT
CAAAGAGATCTGGGAACTTGCCATGAAAGAGATGAGAACGCTAGATGTGTGCATCATACG
CTAGGCTCAACAAGGCTGTCTGGGCCAAAGGGATAAGAACGTCCCATGTCTTATCCGTGT
ACAGTTGCCCAGAAAACATAATGAGGATGAAGGTTCCCCAAACAAGCTCTGTACATTGGT
TACTATGTACCTGTCACCACTTTCAAAAGCCTACAGACAGTCAATGTGGATGAAAACTAG
CAGTTAATTATCAAATAAAGTTATAATTTAACTGCCAAAAAAAGATTGATATTCTTCCAA
TTCCTATTGAAATATTTCATTGTAATTTAACTTTTCTTGATCCATTCATGAAACGTTAGT
TTTATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGGGCATAAATGGACATTAACCAAAAT
TGAGTTTAGAATGCGTTAAGGGGTCTAGAATATTCAAGCAAATACCATGAAGTGGGTCCT
TCAATAGGAATTTTGTGCTTACTGTTTTGAGACTAAAAGAAAGTCCAAATCAAGGCATCC
TCCAAGGGGTGCTTTTCCCCTAACACTGTGATGTTCTGGGGCTTGCTGCTGGCAATTTGT
ACCTTAGCTTGTTGCATAGCAAGCCTCACCTGGCCATTCCATACTCTTCTAGTTTCCTTG
ATTTCAGTTTTTACTCCCTATGGCTTCGTTTCTCTGTGTCTGAATTTCACTCTGCTTGTA
AAGGACTCCAGTTTAAAATTAAGAACCAACCTGATTACTCTGGGACGTGCCTTCTTAACT
GAAGTAACCTCATGAAAAGGACCTACTTACAATGGGTTCACACCCACAGGGAATGGATTA
AATTTAAGAACATGTTTTTCTGGGGTACCTACAGCGTCAAACCACCCCCCAAACAGATAG
ATCTTTTTTATGACATAATTAATGTGAATTATGCATAGTTTCACTCTTATATTACTTATT
TTAGGGAAGTTGAAAATCTCTACCCGTAATTCCCTTCACTGTCATTTTACAAGAAGCATA
CATTTTGCCCATGATCACAATAAAGAGTCTTGACTGCCTCTGCTGCAGCTTCTCTTCCTC
TGTAGCAGAAGTGGGAATACAGACTGATCCTTTTTGTTCTTGGGTGGAAATTCAGATTGA
CTCTGTTTGTCCTTCCCATGTACACTAAACTGTTGGAAAGTTCCCTAAAATAGGTATAAC
ATGTGCATGTATTAGCATGTATTCGTAGACACATACCTCACCAGGAGACTTTGAGCTTTA
AGGGTAGATGCAATCCAGAGGACACTGGTCTCTCAATCTCCCAGTTGGGGACACATGGGC
AGTTTTTCCTGTCAGAGCATATCTAAAGTGCAGATAAACAAACGTCACTAAATCTCAGTA
GGTAAATCGTAGAACTCCTATAAGAATGTCAGGAATAGGCAAAGGAAGCTCAGTTTGCCG
GTGCCAGATTCTTATTAGGAAAATGTTGGTGAACCTCCCTCTATTTCTTGGTTCCTAGGG
GAAAATAAGCTGGTTGGGGACCTTCTGGTCTTAGGAGGAGCCACACTTTATGGTATCTCT
AACGTCTGGGAAGAATACATCATCCGAACTCTGAGCCGAGTGGAATTCCTGGGAATGATT
GGACTCTTCGGGGCATTTTTCAGTGGAATTCAACTGTGAGTAAAAATAACAAGAAATTCA
GAGATGAATGTTATTAGGACTTTTTCTTATGTATTTTTTTCCCGTGCAATATGGCTGGTC
ATTTTATTTTATAAAAATCACAGCTGGAATCCTACCTCTAATCTCCCACACAAGGGACTT
ATGAAACCTGAAATGTAAGCATCTTTGTTAGTAAATTTCTTCCAAACTAAATATGTTTAT
TATAAATTATTATAAAGCATTTAATGAATTTTGAAGATAATTTTCAAAAATCCCTTAGAA
GTACACTGATTCTCCCAAACTAGCAGGCTCTTACTTAAAAACTAGAAAAACTAAGTCAAA
GGCCATGATTCAATGCCCTCCTGATAAGGGAAATTCTGTTTAGTAGTGACAATTGCTGAT
AGAAAACTTAGAGTTTAAAATTGGCCTTTTATAGTTTTGTTCTTTTATTGCTCATGGATT
TGCAAGAATAAGCCATATTTCAAATTCATCTCTTGGAAAATTAGTTTCCATTTTCTTTAA
AAATGTAGAGATATAGCACACACACTTGCTAATCATAAAAAAACACAGAGCCACCAATCT
TGCAATAATTATGCATTGGGGCTTATAAATCACCATAAGTAAAGGCCAGATTCTTTATTT
AGGTAAGGGGTAAAGAATGATAATATTAACCTCCAGCCTAATTTCACTAAATTCCTTATA
CAAAGCAAGTAATTCTAAGGTCACCAAATCTCCTACAAGGCAAATACTGTGTCATCACAT
TGGTTCAGCATCTGACACTATTTATGGAAGATGTTTTGCAAATTCTAGAATCTCCCAAAT
TTTGGTACCCTGAGATACAGGTGAAAAGCTCCATAGCAGACAAGGCAGATGGGGAGATTC
TTCTGAAAAGATTTTTGGTTCATTTTCAAAGTGCGATGGCATTTTAAACCTCCTACATTT
GTGCTCAGCTCTGCGAGAAGAAAAGCAGTCTCCTGGCTTAACTACTCACAACCCACATTT
TGTAGATGAAGGGTTCCTTTTATGGATTAGTGTTCGTGAAGCCAAAAGTTACATGCAGGA
CGCTAGCTCTCATTTGCTTCAGATACAGTGTAGGAGAGCTGACTGGGTCTTTTGCAGAGC
TACACTACTGCTGCCCAAGTAATGGAAATGGCCTCTAAGTGTGTTTGGCAAATGGGATAT
TGAGGATACACTGGAGCCACAGTAAGGCTGGTGTGCAGATGCCAACGTTCCTCCCTGGTC
CTCTTCTAGAGCAGTGGTTCTCAGATGTACCTTTTGCACCAGCAGCGCCGGCATCCCCTG
TGAACTTGTCAGAAATGCATATCCTTGGGCATTACCCAGGGCTACTGAAACAAAATCTCT
AAGGATGAGCCCAGGAAGCTGTGTTTTAACAAACTCCCCAGATGACTTTCATGTACATTA
ACATTTGAGAACCAGTGCTCCAGAACACTCCATCAGAAACCTGCAAGAATGGGGATTTTG
CCATTTCCTTTTAAGAAAGCATCGAAGCAAGAAGAAACAGGTACAGGCAGAGTGTTTGTG
TGAGTAAGACGGAAGGTCTGAGCTCGGCCGTGCCCCACTGGCACACTCTCACTGCTGCTG
GGAGCACCCCCTGAGGTCCTTCAGGGAGGAACCCCAGGCTGCCTCATTAGACTTACCTCT
ACGTGGCCCAAGGTTACTTTTGAAAATCCAATCCGTTGCCTCATTCTTTGTAAAAAGCTG
TTAAGTTAAAGGAAAAGAAGTCAGGCGTGTAATAATCTTGCTCATCAAGTCCACTTTCTT
TGAATTTGCAGAGCTATCATGGAGCACAAGGAGCTGTTAAAGGTCCCCTGGGATTGGCAA
ATAGGTAAGGGGTTTGCTCACCAAAGATGCTGTTTCATAAGCCTGAAGAAAGTGCTTGAA
GAGTCCTGCGGGTGGGAGGGGGGCGCAAACAATGAGGGGATATAGAATAGCAGGGGAAAA
AGGGAAATGAAAGCCCCTGGTCGTTTTAGGAATTCCTGCACAGTCTAAGAGTCTGGACTG
TATGATTCATAATGTTTCCTAATTGAGCTTCTGCCCATTATCGTTGTCCAGATGCCGTTA
GGGCAGACACAGAAGTGTGCTATTAGGTTAAAGACCAAGAAGAAAATGTCCCGAGGCAGT
AGTGGGACATAAAAGACAGCAATTTGTTCTAACCAAGGAACACCAAGCCGATATGATCAT
TAGAAGGGGGCACATTAGTGAAGGGAAAAAGTGAACTTAAAAAGATATAAAAGAAAACAA
TGTAATGGGCAGTCTAAGACTGTAAAAAACCTTCAGAAGGGACCAGTTTATACAGAAGAA
ATGGTTAACTGATCTCCAAATCACTTTGGAGGAAAATATCAGATGTGTTTTGAGCCAGTT
AATTCATGATTCATGGCACCTCAGATTCTACCTGTTTCTAAAATAACTTCTCCTCTAAAA
AAAAAAAATTAGGGCAAGACTTTACCATGCTAAGTGATGCTCTTATGATCACATAGAGCA
CCCTAGAAGGGACCGATATTTAATACCACAGCCCATAAGATATCCCCTCAATGTCTCTAC
TGAGACACATGGGTCCCAGACTGAGCATGGACCTTAACTTGTGGGAGTGCTTGGAAAATA
TGTTCAGAATAAATACAAAAGGAGATGAAAATTCTGATGTTTCCCCACACTGAAGCTGAC
TGCTTATGCCAATTCCAGCTATATAAGCTTAGAATGTAACTGGCTGCTTTAAGCAAATTC
TCATGGAAGGGCACAATGATATAAAATCCCCTTCTCCACTGTACCTATCCCCTAAACCCC
CAGGCATCCAAAGCCAACTTGCTGCCCACATAATTCTCTCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1089, 164459..164634, 166304..166431, 192468..192627, 220438..220594, 222371..222422
1001..1089, 164459..164634, 166304..166431, 192468..192627, 220438..220594, 222371..222422
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved