Dasypus_novemcinctus Locus MAP2K5
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus MAP2K5
Dasypus_novemcinctus
MAP2K5
GeneScaffold_3558
SNORA38
187220..187347
416438
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCGCC
CACGTGTGCCGCTCCCTCTGCTCGCGTGAGCAGAGACTCGCTCCTGACTGTCCCGCGAAG
GCCCTCTCGGCTTTCTAGTGGTCTGAGGCTCCCGGGGCTCCTTCCGATCAGCCTCGTTCT
CGGTTTCCTGCCAGTCGGGGACCCTCCCCTCGTCCACCAAGGAGGAGTGGACGCCTCCCG
CTTTATCTCTCCCAAACGGGCCTCTCTGTGCTGTCTCCTCATCCCCACACAGACGGCAGA
GAGCTTCTTGATCCCATTTTGTCCCCTTCTCCAACTCCAGAACCTTCCGAACTCTAGTTC
GTACTGGTCCCTGCCCCCTCCACTGCCCTCCTTCACGGGGAGACCCCATACTTAACCCAT
ACAGCCTAGTCCGGGCTCGGTGGCTGCGGGCTCCCCTTCACCCTCCACACCCCTCTTTTC
GTCCTTCCCCCACTCCTCTTTGCCCTTTTCTTGGAGTTTCCAACCAAACCAAGGGTCAGT
GGGTACCCCCTAGTCCAGGATGTGAACCCTTTTCATCTGTAATGCTGTGGCTGGCCCTTG
GCCCCTTCCCTGCCATGGAGAACCAGGTGCTGGTGATTCGCATCAAGATTCCAAATAGTG
GCGCAGTGGACTGGACAGTGCACTCTGGGCCGCAGTTGCTCTTCAGGGATGTGCTGGTGA
GTGGTAATTTCAGTGTCCAAATCCCAGCGAGGGCACTCAGGGACTTGGGGATTTAGCATC
TTGATTACTGAGCCTTTCACTGTGGCCTGAGCTAGTGGTAGTGGCCACTGCTGTCCTCCT
GTGGGGGCAGCTTTCTTGCTTCAAGCACAAGCATTGATTAATTGCAAAAACTGAAACCTG
GCAAATGTGCAGAGCCTTGGGGAAATAGAGATGAATCATACAGAGCCCCTGCCCTCAAGG
AGTTCACAGCCTAGACTGGGACATACACATAGAAGCAACTAACTGGAATATGAAAAGCAG
AGTCTACAATAGAAGTGCCCCCCGCTCCAGCCATGTTTAGAGGAATGTCCCTGGCTTGAT
TCCAGCCATGTCTTTCTACTGAGTTCTCTTACTCTGATGACCAGTGGAAAAAGGGAAATG
AGGGTACATTAATTTACCATGTTTCAGCAAACCTAAGACATCATCCATTGTAAGACATGC
AATTATCTTATGTGCCACTAAGAAAAAAAGAGCTGCCCATAAAACTATGACATGCCATCC
ATTGTTTAAAAAAAAAGGTCCAATTTCGGAGATGTTAAAATAGGGAGAAAATGTACATCT
TAGAATCGATGATGTATTTACCTTTCAGAATACTTGGAATGTATTTCCAATTAAATCATG
GAATATTAGAGCAAAGTGTAACCTTGGAGGGGTAGCCCGTTTAGCTCACTTAACTTTTTG
CAGTTAGTAAGGATCAATGAAGTGAAATGACTCTTCCGAAGCTCTGTAGCTCTGGAGTGG
GAGTACCAGAACTCAAATATCCTTACTTTTATTTAGTACTTTTTTTCCACGTGCAGCAGT
GCCACTTCTCATCTTTCTGCCATTCTTTTGAGATAGAGTGCATTTTACCCATTTTAGATG
TTGAATAACTGAGGCATCGAAGGTAGAACCAACATACCAAGAAGCACATGGCAAGTAACA
GCTCTATAGTGGAACTTACCTGCTAGATAAAATGGGGCTGTATGGCAGGTTCTTGGGAGG
AGGATGTGTGATGTGGTTTTTGATTGTTGTGGGTGGCTCAATCAAAATTTGATTCTGTAA
CTTCATTTTTTTTTTTTAAGATTTATTTTATTTATTTCTCTCCCCTTCCCCCCCCCCGTT
GTCTGTGCTTTGTGTCCATTTGCTATGCGTTCTGTGTCCACTTGCATTCTTGTCGTGCGG
GACTGGGAAACTGTCACTTTTTTGTTGTTGTTGTTGCTGTGTCAGCTCTCCAGGTGGTTG
GCGCCACTCCTGGGCGGGCTGCGCTTCTTTTGCGCAGGGCAGCTCTCCTTGTGGGTGCAC
TCCTTGTGCATGGGGCTCCCCTGTGTGGGGGACACCCCTGTGTGCCTCGGCACTCCTTGA
GCACAGCAGCACTGCATGTGGGCCAGCTCACCACACGGGTGAGGAGGCCCTGAGTATGGA
ACCCCGGACCCTTCATATGGTAGGTGGACACTCTATCAGTTGAGCCACAACCACTTCCCA
TAACTTCATTTTGAGTTCTGGATGTTACTAACCACCCAGATCATGCAAATTTTCCAGGGC
CTGGACCAAAAGTGCAGAGGCCGTAATGAGATCCTTTTGTGTACCAAATACCATCCTTTT
CTTTGCTCCCAGAGTTCTTCCCACTCACATGTACATGGTACATGGATTTCCTCTCAGGAT
AAGGCCCAACTTCCTTAGCATGGTTCTCTGGACCTTTTCCCGAGTGGCTCTTGTCTGCCT
AGCTCTCTTAGCACATCCCTATGAGCATCTTGTGCTTCAAATAGCAGAATTACTTCAGTT
CTCCTAGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCAGATGTATATCCTTCTGACTTCCCCCACTCCAGT
TTTGCAATGAGGGGTATGAGCCATAGGGGGACAAAATGCCTTGCTAAAGTCACACAGCTA
ATTTTTAGGAGAACCTGACATAGAAACCACAAGCAGTTTGTCATACTGAGTCAACTAAGT
TAATTCTAACTGGGAATATTTTAGACCTGGAGTCAGTAGTTGAGGGTTCCATTTGGTCAC
CGCTTTGTCAAATAGCTAGGAGACCTGGGGGAGGTCACTTGGCCTTTATGGGCCTCCTGT
CCTTCATCTGAATAATTAGGGCCTAGCTGGAATTTTAGTAGGCCTGTCAGATCCTCAAGA
CTAGGGACATTTGGGTTATCCCTAGTATCTTATTTTTTAGCTATCCTATGTGTCTCCTTT
TCCTTGGAGACTGAGACCCTAGTTCTGGGAAAATCCTGTAGGAGATCTGGATTAGTACAT
GGTAGGAGAAAATATTCTCCCCTCTCCTTTCTGCTCTTTGAATCCTTCTTTCTCCAAGTC
CTAACCTAGGTTCCTCTTGCTCTGTAAAATTTCTGTCTAAACTGAGCCTGTAATTTTTTT
CTTCCTCCCAAGTTCCCATATACCATTTATGTCTTTGTCTGGCTGTTAGCATACTATAAA
TGTTTTGTACAGTTACTTATCTTTCAGGTATGTATTTAACTCTGTGACCAGACAATAATC
TTCCTCAGGTCAAGGACCAAGTTTTATATTTCTGCAGCCTACAGCTTTGTGATCCTTATG
TTCCTGGCATGTTGTAGACGCCCAATTGTATTTTTGGTCTGTTAGATATTTGATTCTTTG
AAAGGAAGTAGAGGAATCAAGAAATGACTACCATCCACATATGTAAATTTAGTTCATCCT
TTGAAACCTTCTTTAGATTAGTTAAAATGTTATGTTGTTGATGGTGGGAAGGGTTACTTT
GAAATAAATAATTTAAAATATAAGAGATATTAACTGGGAAATAGACATAAAATCATTAAA
TGTATCCTGCTTAAAAATGATTAATAGATATTGATAAATTTTCAAGCTTTTTACCCCTTT
GTCATTGATAACCCCACTTTATTTGCTTTAAAGAAGCAAGATGGTTGATTGTAGTCACAT
GATTTTCTCAAGTAAATTTGCATTTTTCTTTTTCCTTTTCTCTACCTCAAAGGTAAAATA
TGTGGCACCTTGTCTGTGTTGATGGGCAAAGGATTCCCTTGTTGCCCAGTGGAGTTTTGA
GCTGGTTATAGAAATTTGCTCTTTGATTGGGTCTGCTGTTTAAAAGTAGGAAGGATTCTA
AATTTGTTCACTACTACTGTAGAGGTAGAGTTCATTTCTGAAGATTGGTTTTCTGAGTGA
TAGGATTTCCCTGCAAGTAACCAATAATAACTTAGACTTGGAGGGTTGGAGATGGAGAGG
GTTTTGTTTCTTTGTTTTTCATTTATCCTGACTAGAAAGGGTCCTCAATAAAAGGATTAA
GTATGTCATTGAATGACTATCTTCCACTGATACACCACTGATTGTTGGGTGCTGGAATTT
TAGATTTCATTATGAGATAAGCTTTGTAACGTTCCAGTGGTCAGTGATTTACTTTATTTA
TTTAACATATGTGTATATGGCATTTACCATGTGCTGGACACTTTTCTAAACGTTGTAAAA
ATATTAACTCAGTCCTATGAGGTTGATACAGTTATGATCCCATTTTACACAACAGGAAAC
TGAGGACACAGAAACTCAGTCACTCAGCTAGAGTGGCATAACCAAGACTCAACCCTAACA
GTTTGACTGCAGAGTCCTGCTCTTATCCTTTACATTAGGGGTTCTTAACTAGGATTCCAC
AGACCCCTGATTTCAGGGGGTCCATGAACTTGACTTGAAAAAAAATCAACTTATCTTTAT
TTTCTCCGACTTCTAACTGAAATCTAGCATTTCCTTCACTTACGAATGTATGCAATAAAT
AAATTACAGTAGTATTCATTTCCACTGACTGGCAGAAGGGCCCATGGAACAAAAATTGTT
AAGAACCCTTGCTTTTTCACTGTACTACATTCTTCCTGCATGTATATTTTAGTCCATACT
TGTACTACAATTTCCATTTTCTTGTCAATAAAAGCGTTTTACTAGGAATGTGTAGGAAGA
ATTTTTTTTTTAGCACTAAATGTTTTATAAATACTTCCTCAAAAAGTTGAGATGTCATTT
GCTCAGATAAAGTCAGAAGAAAAAATAATCTCTTTTGGCTCTAATGAACGAGGGCTGCCT
ATGATAGTTCTCTTTGATCAATTTTATATGTGCAGATTTATTTCTGAAAAAAAAAAAGTT
GCTGTAGAGGCAAGGCTATTATGCAAATTGCCACTGCAGCAAAAGCTTCTAAAGAACAGT
CTTTAGAAGGAAGTTGCCGCTGCCACTCTGCTAAGTGCCCTGCTTGGAAGGCCTGTGGAC
TCCCTGCTGAGAAATACTGCAAGAGGCTTTGTCAGCTGGCTGACTGGTGCCACTTCTGGC
TCAGCCCAGGAGGGATATTGTGGCAGAGCTCCCTCAAGAAAAAAGAGGTTTGCAGGCCAT
TTGGATTGGGCTATATATCATGGGGGTGGAGGGATTGTCACTCTTCCCAGAACTAAACAT
TTCTCTTAGGGGTTCTGTGTCTCTTTAAGCTGTCTCAGACTAATATTGAAATGTTTGCAA
GTTTATAAGTACAGTTAAACATTAATATCAGATTATATACATTTTTTAGATTTCTTTTGT
AGGCTCGATTAACTTTGTTTTGATCTCATTAAATATATCTTTTTCAGTTTCTTAAGAGTA
AAGGTAGAAAAGAATTGTTTGCATTAAGTCTAGCGTTTCAGGTTTGTATCATTATCATGG
AAACTTGTGTTTTGAACATTATGGGTCCAAGGCAAGGTCTTACTAGTTACATATTGAAAA
CTATATTTGTTGAATCTCTACAATGTGCTAGGCTCCAAGTTTATGTTTATTATATTATTT
AATCTTCACATTACCTACTGTAAGTATTACTGGATCTATTTTGGAGAATAATCAAATTGA
GGCTCAGAGAGGTTAAGTAATTTGTTCCAAGTAACATACTAGTACAGAGCTGGGAATCAA
CCTCAGGCCAGTTTCCTCCTATAGAAGAAACCAATATTTTGTAAATACCCAGCAGTGTAT
TTGTATACCCAGTTGAATCAAGAGTGAAAGATTATGATATTAATACAGAGTAGAAAAGGT
TTAGTAAAGATTTCTACCCCCTGGAGAGGAGATTTAAATTCTAGGCTTACATTACTGGGC
TAAGTATGATTATGAGCTAATGTTTTTATAGTTTATGCCAGCATCAAAAATCTTTTCTAG
GTTCTCATATTTCCTCTAGGATTTGCCACATGTTAGCAATAAAGAAGATGGCTAATTGTG
CCTCTTTATTCTTTCTTTGTTTAGGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACC
ACAGCCTTTGAATGTAAGTCTGGCTTGTATACTTTCTTGACTATTTCTTTCCGCAGTAAT
TTTTCAAAGGGCTTATGGGTTGCATTACTTTAGAAACTGACAAAAACATTATTTATGATC
ATCATATGGTACATTTAAATATTTATAAATTAATGCAAGTTTAATGATGATACTGAACCA
AGTAATATTTTCTTATTTAATCATATCTTGGGTGTGCATATTTCTACAATATAGCTTTAA
TTACCAACATGACCTTTATCTGCTCTTGCGCCTCACTGTAATAATATTGCTGAGACAAAA
TGAAACGTGTAAACTACCTGTAGGCCAATGATTATTGATTAAGAGATTTTAATCCATTCC
TGTTTAAACATTGCAACAAAGTAGAGCTTTTAAGCAAAAATTGCTGGGGATAATTCTGTT
TTTCGTGAGCCTTAGCAAGACTGCTAGATGGTAACAGCAGCACTTCAGGTCTTAAGTCCC
TCCCTCTTTGGCTTGGGAACAGGGTCAGAATGTATTAGAAAACTGGTTTTGACACTAACC
AGGTCATTCATTACAGGGGAGGTCTGTGTCTAAGTAATATTAAAATGAGAGTTTAGTCAG
TAGCACAGGTCTTAGCAGCTGAGAAGGATAACATCTTTTATTTTTAAGATGAAGGCTAAT
TTTCAGTGTAGAAAAATTTGAGGTTTTTCCACATGATTGTATACTTTTTGTTCCTCTACA
TTAAGAAAATGCATAATGACAGAGAAGTAGAATTGGCACATCCTCTTCAGAGGACAGTTT
GACAATACGTACCAAATACTGTTAAATATACAAAACCTTTGACTCAGCAGATCCATTTTT
AGGAAGTTGACCAAAAGAAATACCCACCTGTTAGATGCCATTCAAACAAGATGTTCATTG
CAGATTATTTTTTCATAGTGATAAATATCTATAACATAAAATTTGCCTTTTAAGTGTAAG
ATTCAATAGCATTAATATATTTGTAATGTTGTGCTACTATTATCACCTTCTATTACTCAT
ACTTTTTCATTATCCAAACAGACACTCTACCTATTTAGCAATAACTCTCTGTTCCCCCTC
CTCCAAGCCCATGGTAACCTATAATCTACTTTCTGTCTATGAATTTGCTAATTCTAGATA
TTTTTTCTGTGGAATCACATAGTACATGTACTTTTGATGTCTGGCTTATTTTGCTTAACA
ATGTTTTAAAAAGTTCATCTGTGTTGGGACATGTATTAGCACTTTTTTTCCCTGTTTGGC
TCAATAATATTACATTGTATTGGTGTGGTGGTTTGAAACTGTATACCTCAGAAAAAATAG
ATTCCTTAGATCTAATCCCATTTCTTGTGGGTGTGAACCCATTGGAAAGTCGTATCTTTT
AGATGAGGGTATTTTCCAGTTAAGATGTGCCCAACCTCAGGCAAGATGGGTCTTTATTTC
TTATTACTGGGGTCCCTTAATTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGACTCAGTTTGGGTCTCCACCCTCATACTGGAGCTTTATATAAATGGAGATACA
GAGAGAAAGATACAGAAGGGAGGTCTGCTGTTTAGACCAAGCTCTGTGAGAGAGAGGACT
TAAGGATTGCTACCAACCAATGATGAAGCATGAAGCTACCAAGAGAGTGGGTCTATGGAG
CAGCTCAAGACTGAAGAGTTGGTAAGCCTGGAGGCCAAGGCAGGGACCTCAGCAGAGATT
GGCTGCATCTTACTTTGCCACGTGCCAGGACACCAGGATTACCAATAGCTGACTTTGGTA
AGAAACTTTAATGTGCCTTGATTTGAATATTTCACAGCCTTGCAACTCTATAAGCTTTTA
CCCTAATAAATTTTCCATTATAAAAGCCAACACATATCTGTTACACTGCATTGGCAGCCC
TTTCGCAAACTAAAACACCAGTCTTCAGGAAGAAGCTTCACTTTGATGATGCCTTGATTT
GGACTTTTTTCCTGCCTTGAACTGTGAGCGAATAAACTCCCGTTGTTTAACCCATTTACT
GATATTTGCTTGAGCAGCTTAGGAACCTAAAACATACAGATATGTCATGTTTTATTTTCC
ATTCATTTGTCTATAGACACTTGGTTAATTATGATTTTTGGCTACTGTGAATAATGCTGC
TATAAACATTGGTGTACAAATATCTCTTTGAGTTCCTGCCTTCAATTCTTTGGGGTATAT
AAATAAAAGTGGAATTGCTGGGTCATGTGGTAATGCTGTGTTTAACATTTTATGGAACTC
CCAAACAGTTTTTTTCACAGCAGTTGAACTATTTTTACATTCCTACCAGCAATACACGAG
GATTCCAATTTCTCCATATCCTCACCCACGCTTGTTATTTTCTGTTTTTGTAACAGTCGC
AATTCTGGTGGGTGTGAAGTGGTATCTCATTGTGGTTTTGTTTGCATTTCCCTAATGGCT
AATGATGTTGTGCTTATTGATCATTTCTTTATTTTCTTTGGAGAAATGTGTATTTAAGTC
CTTTGTTCAGTTTTTAATTGGGTTGTTTGTTGTTTTGTTGTTGAGTTGTAATAGTTCTTT
ATATATTTTGGATATTAAACCCTTATCAGATATATGATTTGCAACTATTTTCCCCAATTC
TATTGGTTATCCTTTTACTTTATTGATAATATCCTTTAATGCACAAAAGTTTTTAATTTT
GATGAAGTCCAATTTACTATTTTCCTTTTATTTCTCATGCTTTTGCTGTTATATGTAAGA
GTCTGTTGCCAAATTTGGGGTTCTGATGATTTTCCCCCATGCTTTTTTGTAAGATTTTCG
TTGTTTTAACTCTTATATATGAGTTATATATAAGAGTCCATTTTAAGTTAATTTTGTTTA
TGGCATGAGGTAGGGGTCTGGTTTCATTTTTTTGCTTGTGGATATTCAGTTTTCCTAGCA
CCATTTGTTGAAGAGATTATTTTTCCTCCATTGAGTGACTTGGCACCTTTGTTGAAAATC
ACTTGGCTCTAGGGAAGCAGATTTGGCTCAACTGATAGAGCATCCACCTATCACATGGGA
GGTCCAGGGTTCAAACCCAGGGCCTCCTGACCTGTGTGGTGAGCTGGCCCACGCATCGTG
CTGATGCATGCAAGGAATGCCATGCCACGCAGGAGTGTCCCCTGTGTAGGGGAGCCCCAT
GTGTAAGAAGTGCGCTCTGTAAGGAGAGCTGCCCCACACGCAAAAAAGTGCAGCCCACCC
AGGAGTGGTGCCGCACATACAGAGTGCTGACACAGCAAGATGACGCAACAAAAAGAGACA
CAGATTCCCAGTGCCACTGACAAGAATACAAGTGGACACAGAAAACACACACGTGAATGG
ACACAGAGAGCAGACAACTATGGAGGTGAGGAAGGAGAGACAAAAAAAAATTTTCTTGGC
TCTAGATGTGAGGGTTTATTCTGGACTCTTAATTTTATTCCATTCGTCTTCATGTCTACC
AAATACCAGTACCATACTTTTTTTTTTTTTAAAGATTTATTTCTTTTTTTCCCCTTCTCC
CCTCCCCCCCCCCCCATTGTCTACTCTCTCTGTCCATTCTCTGTATGTTCTTCTGTGTCT
GCTTGCATTTTTGTCAGGCGGCACTGGGAATCTGTGTCTCTTTTTTGTTGAGTCATCTTG
CTGTGTCAGCTCTCCGTGTGTGTGGGCCACTCCTGGGCAGGCTGTGTTTCTCGTGTGGGA
CGGCTCTCCTTGCGGGGCGTGCTCCTTGTGTGTGGGGCACCCCTGCGTGGCATGTGCGTG
GCAGCACTACATGTGGGCCAGCTCACCACATGGGCCAGGAAGCCCTGGGTATTGAACCCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCACTGGGAAACCATATCTCTTTTGTTGAATCACCTGCTGCGTCAGCTCTCCGTGTG
TGCGGCAGCACTCTGGGCAGGCTGCACTTTTTTTCCGCATGGGGCAGCTCTCCTTGCGGG
TGTAATTACTTGTGCGTGGGTCTCCCTTATGTGGGGGTGCGCCTGCATAGCATGGCGCTC
CTTTTGCACGGCAGCACTACATGTGGGCCAGCTCACCACATGGTCAGGAGGCCCTGGGGA
TCGAACCCTGGCCCTCCATATGGTAGGTGGACACTCTATCAGTTGAGCCACGTCCGCTTC
CCAGGAAAGTTCTTGAAGGAAATTAACAGTGTTACTCCAAGGAGTATATAAATGATAAGA
AACTGAAAGAGCCTTAATGCTGATAATTTTAAAGTTTTAGTTGTCTGGAGAGTTCAAACC
AGACAGAACATTCCTTTAAGCCAAAGCCTAATTCACAACAAGGCCCTAACTGTCTTCAAT
TCTGTGAAGGCTGAGAGTGGTAAGGAAGCTGCAGAAGAAAAAGTAGAAGTTAGCAGAGGT
TGGTTCATGAGGATTAAGGACAGAATCTAACTCTGTAACATAAAAGTGCAAGGTGAAGCA
GCAAGTGCTGATATAGAAGCTGCAATAAGTTATCCAGAAAATCTAGCTGAGGTAATTGAT
GGAGGTGGCTATACTGAACAATAGATTTTCAATGTAGATGACATAGCCTTATATTGCAAG
AACATGCAGCTAGTAATGATAAAGTGGAAATTTTGGGATAGACTTCAGAAAATACATTCT
CAATCATTCTGCTGGACTTGTTTTGAAAGTTGTCATCATTTTTGAAACTGTGTATTCTGA
CTAGTCTTAAAAATGGCAAAGAGAAGGTTAATTTATACTTTCCTACTTCTTGATTCTTGG
GTCCCCCAAAATAATATGGGTACAAGTTGCTTGATGAAACTGTGCCTGCCCCACTAGTTT
CCAGAGTATATAATATGGATTATTAAAGCTATCATTTATTAATGGCATGCTTTGTGCCAG
GCAATGCATTAGATGCCTTACCTAGATTGTCACTAATCTTCACGACTCTGTGAGGTAGGG
AAATTATACCTGTGAGAAGACTGAAGCTCAGAGGTATTAAATGATTGCAGAAAGTGACCA
GCTAGGAAGTGGTCCAGCCCAGATTCAAAAGCAGTTGTCTTGGACTCTAAAACTTGTACT
CTTTATCATCTAAGTTTATTGCAAGTCTGTGAAGTGTGTTAAAGTCTAGGTTTATGTTCT
TAGAGATCGTTCTCCTTTTCTACAACACGGGCCACACCTCTATGCTCATAAGCATCGGGA
ACAATTTTAGATGAAAACAACACACAGAGACAAAATAATGACAGTTCTTAGTATTTTGTA
CTTAGATTTTCATATATTTTCCATTATAGACTTAAAATCCAATGCTGGCCTTTTTCATGA
TTGTTCTAGTGTGACCTCATTTTCTGAACCAAAAATCTGAACCAATAAATGGAATCTAGA
TATAAGAAGTATTTGGTAAGATATAGTTTGTAAGGTAATTTGCTGGAATGTTTGGGATAT
TTTGGTGGTTTGTGGTGGGTATGATGGAATAGCCTTCAAGTAAATAAAGCTTTAAATCAA
ATATTTACAGTAATATATTTAATACTGAAAAGTATATCTAATACTAATTTTGATTTCTCA
TACAAAAAGAGATGGTGTTACATTTAATGAATGTATTAAGCAGCAAGAGAAAAGGCAACC
ATCAAATTTACCTGTTTCATATAAATGTAGAGAAAAAGAGAATGTTGGTGTTATTTAAAA
AAAAAATTTTTTTTTTTTGAAGATTTATTTATTTATTCCTCTCTGCATTGTCTGCTCTCT
GTGTCCATTTGCTGTGTATTCTTTTATGTCTGCTTGTATTCTCATTAGGTAGCTACAGGA
ACCAATCCTGGGACCTTCTGGATTGTGCCACCTCAGCTCCCTGGTCTGCTCTGTCTCTTA
CTGTCTCTCCTCTGTGTCTCCTTTTGCTGCATCACCTTGCTGTACCACCTCTCCACATGG
GCCAGCATTCCATGCGGGCCAGCACTCCTGTGCAGGCCAGCACTCCGCACAGGCTAGCTC
TTTGCTTGGGCCAGCTCGCCTTCACTAGGAGACCCCAGGTATTGAACCCTGGATCTTCAA
TATGGTAGATGGGAGCCCAAGTGCTTGAGCCACATCCCTTTCCTAAGAATTGGTGTTTTT
GTTTCCTTGTTGATAAAGCACGTACCATGCAGTGGGTTGGCGTAAGCAATGGGAATTTTT
GGCTCACGATTTTGATGCTGGTAGAAGTTCAAATTAGTGTCATCAGATGATACTTTCTTC
TGAAAACTGGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATCTTTATAAAACTTCAAACAGCTTAGAAATAAAGCAAAAAGTAAAAGTTCCTCATTTC
CCCAAATCTTCCAGTCTCATTGTTAACAATTTCTTCTGTGTCCTTCCAGAAATTTTCTCT
GTACATAATATATAGTGTTCTGCAACTAGTCCCCTATATTGGACCTCTTTCCATTATCAG
TGTGCATAGATCAACTTCATTCTTTTGGATGACTGCATAATACTTAATTTTTTTTTTGAG
AAACCGGGGCTGGGAATTGAACCTGGAACCTCATATGTGGGAAGCCGGTGCATAATGACT
GAGCCATATCGGCTCCTCTCAGTTGGCTTTTCTTTTGTTTACTTGTAGTTTGTTTTTGTT
TTTAGGAGGCACTGGGGACTGAACTTGGGTCCTCCCATGTGGGAAGCAGACGCTCAACTG
CTTGAGCCACATGCCTGCCCCTGATACTTAGTTTTATGGCTATATAAAATTTATTTAACC
TATTAATAGGTATTTGAGTTGTTACTAGCTTCTGGTTTTTCAGTATTAGAAAAAACATTG
CCATGAATACCACTGTCTTATATTTTCCCACATTGTGGAAATATATTTGTAGAATAAATT
CCTAGGAGTTGGAACTATCAAGACAAAGAATACCCATATTTTAAATTTTAATAGCTATTA
CCATGAGGCTGTCCAAAAAGGTAGAACCAATTTACATTCTCATGAACGCTGTGTAAGAAT
GTCCATTTCCCTCCACCTTTCCCAGCTCTGGGTATTAGCCAGCTTTTTAGTCATTATCAA
TTCGATAGATTAAAAAGATTATATTACTGTTTTAGATTATATTTCTTTAATTATAAATGA
GATTGGGCATCTTTTCATATATATTTTGTTCACTTGTATTTAATTTCTCTGAACTCATTG
TTACCTTTGCTTATTTTTCTATTGGGTATTTGTGTTTTTCCTAACTTATTTAAGAGCTTT
TTAATATTAAGAAAATTGGCCCTTTTTTCAGTTTAGTCTTTTTTTTTTCATTGAGAAGTT
TACAGTTTTTACATGGTCACATTTATTATGTTTTCCTTTATGTCTGGGTTTATATCATAG
TTAGAAAAGTCTTTCATGGTCCAGGATACTGAAAAATACTTCATCTAATTTATTTTCTTG
TTTTATTTCTACTTTAATGGGGTTAAACACACATAAACACATGCATAAACACATATTAGG
TAGGTATATAAATATACATACACACATGTATGCATGTGTGTGTATATACCATCTTTGGTT
TATTTTGGTGAAAGGAGTCAGATGGGGATCCAACTTTTGTTTTTCAAACAGATAGTTGAC
TCCACACCAGTTATTTAATAATTCATCAAAACTTCTGAGGTGAAACTAAATTCCGTAACC
TTAAAAAATCCTGTATTTTACTTGTGTGGGCCCTATGTATACTGTAGGAGCTTGACATTC
TTGTAGGCCTGCTGATTTTTGCAATTTCATTAGATTAATGTGTATACCAACACATGAGGT
AATAAAAATTAGCCATGCCCACTAATGAGCTTATTGTACATGGCTGTTACATGTGTTCCT
TTATCTAGATTTTCTGTAAACAGGTAAATGCTATAAAATGGTTGTGGGGCTGGTGTTGCT
GGACAGTAAAATCTAACTGGTGACTTGAAAATGTATTTTAAGTCTCTTTAGAAAAATGCT
GACTTTTGATTACAGATACCACATGGCTTAATTTTTCCATGGTACTCTGACTGCATCTGT
TCTGGTCTATAGCCCACATAAGTAGCTCTGCACTTGTCGAACCATGTGTCTGAGTTTCGT
TTCAGAAAATATGAGTATAAGTACTTTTTAAAGTCTTTCTTCAACTATGACTTTTTTTAC
TCTCACTTCTCATTGAATAGATTCCTTTTCAATTGTTATATGATCTGGAAAATTATTTTG
TATTTTGGGTGGAAGCCCTTAAACAACACATTATATCTCATTTTAAATTTGTCATGTAAA
ATTGCAATTACATAAGGTATGAGTTCTCAAAGTATAGAAAATAGCTATAACTGATCCTTG
AAGTGACACCTGTAGGAGATAACCTTCATGCCCAAAGAACAAAGACATTCTCATCAAGAA
TAGTTGAATGACAATCCCCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGACACCTCTGCATGGCACGGCACTCCTTG
TGCACATCAGCACTACGCATGGGCCAGCTCCACACAGGTCAAGGAGGGCCTGGGTTTGAA
CCCTGGACCTCCTATATGATAGGCAGACACTCTATCAGTTGAGCCACATCTGCTCCCCTC
CCCTGAAATTTTACTATAAGTAGTTCCCAGCTCTGGTGCAGAAATGAGATTTACAAAAAA
CTATTTCATTCCAACTGGAGAGTGTTTTTTCCAAGTTAAGGACTTCATCAAGAATGAATC
ATTTTAGCCCACATTTAAACAAAGAATTTGACCTGTTTTTAAACAGAAATGTAAAATGCT
TTCATGTGCGACATTGTGGAGTAATATATCTCCTTAAACTATGTATGTATTTCCCTTCTG
TCTCCTGCATTTTTAACAAAACTTTTTGATTTAGCCTTGAAAATGTTAAAAGTTCTAGAA
CCTGGAAAGCAGACTTGGTCCAATGGATAGGGCGTCTGCCTACCACATGGGAGGTCCACA
GTTCAAACCCCGGGCCTCCTTGACCTGTGTGGAGCTGGCCCATGCGTAGTGCTGATGTGC
ACAAGGAGTGCCGTGCCAAGCAGGGGTGTCCCCTGCGTAGGGGAGCCCCATGTGCAAGGA
GCGCACCCCGTAAGGAGAGCTGTCCAGCACGAAAGAAAGTGCAGCCTGCCCAAGAATGGT
GCCGCACACATGGAGAGCTGGTACAACAACATTATGCAACAGAAAGAAACACAGATTCCC
AGTGCTGCTGATAAGGATTAAAGTAGTCACAGAAGAACACACAGTGAATGGACACAGAGA
GCAGACAACTGGGGGTAGGGAAAAGGGAGAGAAATAAATGAAAAAATAAGTCTTTTAAAA
AAAAAGTTCTAGAACTATGTAGAAATGGCTTTCTTCTGTTTCCAAAACTAGAATGACAGC
CTCTCCTCCCTCAATTTGGCCCTAGAGAATCTATTCATAAGAAACAAAATAAAAAAGAAA
GACACCTCTAGACTTATATATTCCTTTATGTATACAGCATCTCTCAGGAACTTGCCTTCT
TTGTTACTGAAAGTGACCCATGTGTGGCTTTTATACTGAAAACAGGTAACCCTTAGTACT
TAATTAGTAGTGACTTGATAGCTGCTAACTTTCTTGACATTGTGACTTGATACAGAGTTG
GGGAGCTCTGCTAGAGTGAATTAGGATCCAGGAACAAATCCTTTGGAAACAGAACCTGGG
TGAGAACTGTTGAGTTGGCCACTGAGTGAGGCTGGCCCAAGTGCTTATTTGCGTTATGAT
GTCATTGCTCTGACAGTTGAGGAGAAAAAGGAAGTAGCATTTTACTCCAAAATAGGCTAC
TTGGGAGAGAGCACAAGTTCCTCTCTTTTAGAGTTCTCTCTGGCCTAGTCATGGAGCAGG
AGGATATCTTCAGAACTGTACCTGGAAGGGAGGGAGGGCTCTGCTGACTTTTGCTGGGGC
AAGATCTGTGTGCTGTACAGAACTCTCTCTGTATTTTCAGTAAGAGTGCTCAGAGCATGT
CATGCAAGTTTATTCTCTCATGAGAGTTTTGTTATCCAGGCCTGTATCTCATCTTGTAAT
TAATTATATATAGGCTCATTGTGACAACAAAAAGAAAAAGGATTGGTTTAATAATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTGTATTAATTATATATAGCTCA
TTGTGACAAAACAAAAAAAAAAAAAAGATTGTTTAATAATGCCCTAGAGCCAAGGCATCC
AAATGAGAGCCTACTCTTTCCAGGTTATCACTTTGGGAGGCTATGTACTTCTTCCACCTA
TCTTGGCATTGCTCAAAATGTTTTAGCATTTTTCTTTCAGCCATGCATTTTGAGTCTCCC
GCATGGACTGTTTGCACTATTGACAAATCTTTATCTTTAGAAAGGTGAAAGTAGCTAACT
AAGTATTTAGAAATACCCAAAAGTTGTTCTGAGTCCTGCCAGGCAGTTGATGTGGGTGTG
TGATCAGGCTGACAGTTCTTTTTAGGTTGAAAATGAGATCTGATATTCTTACATGGTCTG
TCCTCAGGTTCTAAAAGCAGTTTTTGAAGAGGTATTTCAAAAATATTTTGAATAAGAGAA
GCATCATTGAAATAATTATTAATACATGTCTTGATGTGACTGCTTTGATGATAATAGTTT
TCATTTGTATATATTGCTTGTATATTTTGTCAAGTCTTATTACTATTCACTAGTCTTAAG
ACTATTAACTTATTTTAAAATAGCATAAATTGCCATTTGACACTTACTTTGGTACCCCAT
AAAAATGAAATTGTTCAGAAAGAGAAAGAGGGAGCTATAGAGAGACTGGGATATGGGGAG
AACACTGTTGGAATTGCTTTGTAAGTGAACCTTAACCTAGACCCCAGGTTTTCCATCTGA
TATAATAATAATGTCTACATCATAGTACTATTGTGAGGTTTTTAATATGTGCATATGAAG
CACAAATCATGGTGCCTTGTGTAGAGTTCAATAAATATTAACCTTTTTTTAAAATCATTT
TTTTAAAAAATCATGCTATCGTGACATTTGGGATTGCCTGTGAGAAAGGAAGAATGGAGA
AGTAGAGGGGTAGGGTGCTGTTTGGGAAAGAAAAAGTACTGATAGTAGAACAAGACTGAC
TTCACTTTTTAAAATTCTCCAAACCAAACTTGTTTTTACTTCATTACATGCATGCTACCT
GGGAACATGTCATGATTGACGTGAGCAACATTTTAATTTTCAGCTGTCCCTAATATAAGT
CCTATTTTGATATTCTGATCATATTCAGAACAAAAGCAAAACAGGACATACAGACCAATA
ACCTCAACGTTCCCCCAAAATATTGTGTTGAAGGTTTGGATATCAAGTTGTAAAAACCAA
TTGTATTATGCTCCCACCTGTTGTAGTTTTTTTATATTAAAAAAAAAAAAAAAAGTACAT
CTTACCAGTTGCAATATGTTGCTTTTTAAACAGATGAAGATGAAGATGGTGATCGAATTA
CTGTGAGAAGTGATGAAGAAATGAAGGCAATGCTGTCATATGTAAGTCCACAAATGTGGG
CTGTATTTTAAAATGTTAATGTAATTGAGTACACTATTCTGTGGGCATAGTGAAGATATG
AAAGCTAAATCACAGTCACCATAACTTTTTTCTATAAAATATGTAAGGCTTTTAAAGATT
TCCTTACATAAAAGTTGAGGGCATTCTTTTCAAAGGACTTGTACACTTACTGATCATATC
ATGAACATTAAGAATAATGCATCTTAATGACTTTTGCATTAGGTATGGTGCAGACTAAAT
GGACTATCAATTTCCTGTATTTTTTATGCAGTACTTAAAGTAACGGCTCATTAAAAATGA
ACCCCTGGGCTCTAAAAAATTTTTCAAAATCTACTTTCAACTGGATATCTCTTTCACCCT
TCCGAACATGCTATAGTTATAGTGTAGCTGCAGGCTTAATATGAATACACGATTTAAAGA
TGTGCTCTCAGTTATTTTATGTACCCCCACCCCCCTGAAATAAAGGGTTACTTACTGAAC
CAAAGTGATGTATTCATATTCATATCCTAAAATGCTTTTCTTTTCTGTTTCAAATTTCAC
TGAAAATGTGCATTAGTATTTGTTTGGGACTGAAGTAGATAAACAAGAGAAAAGGTTGTA
TTTCTAAAGCTTTAATAATAAGCTTGAAAAACTCAACTACGAAGAAGAGACAGCTTCCCA
GAGCCCTTATTTCAGCTTCCCTCTCTTTTGTTTTATTTTATTTTATCTGTGTTTGTACTC
TGCTTATAATCTGTTTGCAAAACGCTTTCTAGTGGTCTGGTGGAAAGATCATTGGACTGG
AAGTCAGGAGACCATGGCTCTTCTCTGGCTTCCTGGCCTTAGGCAAATCACTTAACCTTT
CTGTGCTGCAGTTGCCTCATCTGTCAATTGTGGATAATAATACTTGTCCTTTCTACTGCA
CAGGGTCATTGAAATGATCAAATGGGATAATAGATGTGGAAGCCCTTTGAAAAGTTAAAA
GTTCTATACAAATGCAAAGTGGCGTTATGGTGGAAATGATGGAATCAGGACCCATGCTTG
TCATTGAGGCTCTAATCCTGGCCAACAGTTAGGTTGTAGGTTTTTGATTGACTTCAACTT
AAACCAGGATATTGTTTCATTGTAATGAAAACTGTAAAATATCCGTATGGGTTTCCACCA
ATAGTTTTAATTTAGGGTAGGAGGACAGAGAACAAGAAGGATGGCATGATTAACAGAGCG
TTTCATTCCCCAACTAGCGCAGAGTAAGAAAAGTCAATTTCCCATTGACTTCCCATTAAC
TTATGTGGGAGTCTTTGTGTATTGAGAATTTAGAGCTGGGCTCATCAGTGCCTTGAAAGG
CAGAGTAGGAACATCTGCTGAAAGGTCTAGCACTAGTATTGATAGATTGGCTAACTCTCC
TGAGAATGTGACATGCTTATTTTTGGAAAACACACACACACAGATTTGTTCTAGTTTTCT
CAGATAAGTCTATTCAGAGAACTGACATCAGTGTATTTTCATTGTGTATCTGACTTAACC
ACACACAAAGGTGTGTTTTCAGTAATGTACTTTTGGAAAAATCTGACCTTTGTGCTTTTT
GAGCGTTACTGTGTGCGATCATAGTAATAATCATTTCAATGTTTAAGTGCCTGCCTTATA
CTAAATGGTTGAGATATTTAATTTTCTTATTTTTAATAACTGGTCTGTGAGGTAAATATT
ATCACTCCCATTTTTTAGATAAGGGAGCTGTGGTTAAGAGACTTACGCATGGTCTTAGAG
CTAGTATGACTGTGAATATGGACTTTAAGTTCATCTCCTCCTTATGCCAAAGCCTATGCT
CATCCACTGTTTTGTTTTGTTTTTTAGATTTTATTTTTAATTTATTTCTCTCCCCTTTCC
CCCCGTTATTTGCTCTCTTTGTCCATTCTCTGTGTGTTCTTCTGCGTCTGCTTATATTAT
CAGGTGGTACCTGGAAACTGCATCTCATTTTCATTGCGTCATCTTGCTGCGTCAGCTCTC
TGTGTGTGTGGTGCCACTCCTGAGCAGGCTATGCTTTTTTCTTGGGGGGGTAGCAGCTCT
CCTTGTGGGGCACACTCCTTGCTCATGGGGCTCCCCTACATGGGGGCGCCCCTGTGTGTC
ACGGCACTCCTTGCACCCGGCAGCACTGCACATGGACTAGCTCACCACACTGGTCAGGAG
GCCCTGGGATCGAACCCTGGACCCTCCATATGGTAGATGGACGCTCTTGTCAGTTGAGCC
ACATCTGCTTCCCTCATCCACTGTTTTACACTGTCTCTCAGCACCATCCACCACCGCCTT
GCAGATTACTATCGAGATCTTTCTCTGTTATCAAATTATCAATATTATTAAATTCTGAAT
GGTTTGTGTTTATTTACTACCTTAGTTTAGATAATAGTATATATTTACTTAAAACCTTAG
TTTAGATATCTGTAGTATATGTTCCTTTTGATTATGCTTTTTTCTTAAATTTAATTTTTA
ATTATTTTGTGTTCTAGGAAAATATTAGAGTCATATAATGACTTTAATATTACACTTACG
CTTAAAAGTTTCCAGGGTTTCTTATGAGCCACCTTTTAGTTTGAAGAGAGATCAGGGGTT
CTTAACCGTTTTTATTTCACAGACCCCTTTGCCAGTCAGGTGAAAACCACGGACCCCTTA
CTAAGTCCACACTATAGTATGTATTGCTTAATAAATGTGTCACACCCACACCAACACATC
CCCACAAGAATAATGTTTTTATGCATTTCAGTTCAAGCTTATGGGGCCCTTGTTAAGAAC
CCCTGATGTAGCTTTTTTATCCTCAGATATTTGGATTTGATGAACCAATCTAGTATTCAT
TTTTAGATTAAGGGACAGACATAGCAATGCATAGCAACTTTTAATTTTGCCGAATAAAAA
CATTGTTAAAGTTAATAAACTAGTAAAATGATCTACTGTCAACATTTCATAAATAAAGAT
AAAAGAGTAGGAGTCATTTAAAGATTAAAACAGTGGGCAAGATGTAATCTCAAAAGAAAA
AAGACCATTTCTTTAAAGTGAAAAAATTTAGTTTTGTTTAAACCTTAATACATTGTTCTT
GTTTTCCTTAATTTTCTTTTTTTTTTTTTTTCTAAGATTGATTTATTTATTTAATTTCCC
CCCCTCCCCTGGTTGTCTGTTCTTGGTGTCTATTCGCTGTGTCTTGTTTCTTTGTCCGCT
TCTGTTGTCGTCAGCGGCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCTCTT
TCTTTTCACGCTGGGCGGCTTTCCTCACGGGCGCACTCCTTGCGCGTGGGGCTCCCCCAC
ACGGGGGACACCCTTGCGTGGCACTCCTTGCGCGCATCAGCGCTGCGCGTGGCCAGCTCC
ACACGGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTCCCATATGGTAGACGGACGCC
CTAACCACTGGGCCAAAGTCGGTTTCCCTTCCTTAATTTTCTATGGATGGTAAAAACTTT
TTTATATTGTTACTGGTCCATGGTTTGTGACTGATCAGTTCCAGGTCTTTTCATTTAATT
CATTCCACAAATAAAGATGGGAAACTGAGGTCCCTAAACAATTTTAACCTCCTTAAGGTC
TATCCTTACTCTTCTGATTCTGAGTGTTTGAGTAAAATGTCTTAAAATGAAAATATCTCT
GAGGGAAATAACAAGTTAAATCATTTAAAAGTTTAATGGGGTAAATGAATGTAACTCAGG
TGTTTTGAGTGCCTGTTTCCCATATATGAGGTCTCAGGTTTTATTCCTAGTATCTCCTAA
AAACAAAACCAGCAAACAAACAAAAAAAAACCAATTCTCATTGGGGAGTGGATACAACTC
AGTGGTTGAGTGCCTGCTTCCCATGTATGAGGTCCTGGGTTTAATCTCAATCCCTGGTAC
CTCCTAAAAAATAAAAATTAAAAAATTTGATGCTATTTCCTTTTTTTCCTGTCTCTTGTA
GTAGTCCCTACTATCATATACCTTATTTTATGTAGAGTCAGGCTCTGAATAAACATTAAA
AAAATAAAGACTACGGGAGTTTCTTTCTCCAAAAGTACAATCAATTGGTCGACTGTCATT
TTGATCTGTCTGTTCCATCATATTTTGCAAAGAGAACCATTTGGATCTAATCTCACAATA
GATTTTGATTGATAATCCTCATAATTACCCATCTATTATTAAAAACTTGATTGATCTTTA
TATTTTAGAATCAGTTTGGCTCTGGAAAACTTTGATCCCAGGATTTGGTGTGGTGGCATA
GGGAAGATACCAACAGATGACCAAATATTTATTGTTTTTAAAAAAAGCAGGGAAGTGGAC
TTGGCCCCTTGGATAGGGCCTCCGTCTACCACATGGGAGGTCTGCGGTTCAAACCCCGGG
CCTCCTTGACCCGTGTGCAACTGGCCCCGGGCGCAGTGCTGATGCGTGCAAGGAGTGCTG
TGCCACGCAGGGGTGTCCCCCGCGTAGGGGAGCCCCACGCACAAGGAGTGCACCCCATAA
GGAGAGCCGCCCAGTGTGAAAGAAAGTTCAGCCTCTCCAAGAGTGGCACCGCTCACACGG
AGAGTTGATGCAGCAAGATGACGCAACAAAAAGAAACACAGATTCCTATGCCACTGACAA
CAACAGAAGCGGACAAAAACAAGAAGATGCAGCAAATGGACATAGAGAATAGTAACTGGG
GTGGTGGGGGAGGAGGAGAAAAAAAAGCAGCTTAGTTTTTCATGTAAATTTCAATAATTT
TGTGGTCACCTTTGTATTTCTTTAAAAGTAATATGGGGGAATTAACAACTAGAGGTACTC
TCATTATAAATCCTTTAATTATTGTTTTGCATTGATTACAAAGGTAAAGTGAATAAACAG
CCTAAATCTCTGCATGAGAATTAATTTTTTTTATTCATTGTCTGAGTTGAAACTTGTAGA
ATTGTCCCGCTCACCCCCACCCCATGCAAGCATTTTCTGGCTTTGGACCAGCACAATTGT
AAGTTTTTATTGGTAATTTAAATAGATTTTTGTATCTGACCTGAGAGTGTTGCCGTTTAA
TTGAAAACTTATCAATTATTTAAATCACTAGCAGCCTTAGGCTGTTAATTTTATGTGTGC
TATAATGATGGCATATAGTGGTTTTTGATACATGTGACACATGGAATATCATATTGTGGT
AAGGATTTGTCATGACAATAGGTTAATGTGTGCTGTTAAATAATAACCAACATATTAAAC
CAAAGTCTGTTGACACACATTAGTACCACTTTATGTAAGTTATTTAGAAGTTGTATTCTT
TTCTTCATTAGATATATTTTTAAGAGATAATGAGGAGAAAACTAAGCTATAATAAATTGT
CTTTTAAGAAAATGTAAAGTAATTTGGTCTCCAAGGAGATATTTAATGTATTGAAAGAAT
TCAGCAGCCAAGTGTTATTACAGCACCAATGTGATAGCTTTCTGCGTTTTGTTATGAGTT
TGTGTTAATCAACAATCTGCTTTTATAGCGTAGTTTCTTGTAAGTTATGTTGTTAGAATA
TTTCACTTCTGGGATCATGGCTTTTCCTCTGACACTATTGTATCTTTTTAATTCCTCCAT
AAAGTATTTTTTAATTAGAATTTGAAATGCTTTATTGGAAAAAAAAAATACACAACCTAC
ATATTCTGAAAACTAAATACCTGATCATTGCTAATTATTTAAAGGACCCTGTTAAATATT
CCTTTAATGTGGTTTAAATTTTTTTGGTTTAATTTTTCCCCTTCTCATTTTCTAGAAAGA
TTAAAAATAGTGTGCTACTTTTTTCCTTCCATCTTTTTCTATTTGTTGTCTGATAGTGCT
GCCTTCATTACCTTACAGCATTAGCCAACAAGGCTGGCCTTTGTATATTGGTTAATCTTA
AGCCTTATCTATCTGTGAACCCCATTTCTAGGAAGGGGCTATTTTAATGTTAATCTCTGC
TTTCTGATGATCTTTCATTAACAAATTTAGCCATACATCTTACTTTCATGAATGGATTTG
TATTTGTTTCTTCTAAATCTTTGTGTCTAGTAAAGGATTTATTATACCTGATTCTTTCAG
TACTGAGGGACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATTTGTTTTTTAGGGCAAATAGTCTTAAACTTGTTATCT
TGTGATTCTCAAGATACTATAGAACTTTATAGCTTCCCTTTATTTCAGTGGGAAAAATAA
CTTTTAATAATTTTAATAAACTTTTTTTAGAATGTCAGCTAATCAAGGAGGAATTTCCTG
AAAATGTGGTATTTAAATAATAAGCATGTATTTTTAGTATGTAAACAGCAAAGATTAAAG
GAAAGTTCTGCTCTGTGATAACTCCTCAAACATAAATCAATGGTTTCCATTGTTTGTTTT
TTTTCCTACCAAGAGCATCACTTTGTTGTCTGTCAAGTGTAAGAAGTGAGGGCACAGAAG
TCATCTCCAGGTTAAGTGGACATATGCTCACCAGTTAGCTCATTAAGAAAAATGAGAATC
AGGCTATCCTACAATCTACTGAATAATTTGTGTTTATGAAGGAATATGGACGCTTTCTCA
CTTAGAAATTTATTTTTTTGTGCCCAGAATTTTATAGTGAAATTTGGCCTGTATTAAAGT
TCCAAGTAAATCTAAAACATAAGTATGTTTTATTTCATTTCTCTTAAAACTAGGCTAACT
TTTTATCATAATCTATAATCTTTGGATGGGTCCTATTTTGTGTGCTAGTTCAACAGTCTC
TGTGATTTAGATTTCCATTATCTTATCATTTTATATACAAATGTAAATAGCATTTGATTA
ACTAACTGGCATGTAGGCCTAAGACAAATATGAAGCATCTTCATTTTGCTTTGCAAAAAT
TCAGGAAAAATGACAAGGGGCAATTTGAGATATTTCCACTAAAATGCTTTTTGTAATTTT
AATACATATCATTTTCAAAATACTTCTAAAGATCAAATACTAAAGTCTTAATCAAAATTT
TGACTGTTAAAGATAAATAGCAGTCTAGAAGATTACTTTCTACTGGATTTTCAATCCTGG
AGTATTCAGTAGAGGCATTTTGATGTGCAAGTAGGAGAAAAGTATTCCCAAGGCTGATAT
TTTTAAAAGTTAAAGCAATTTTAAAAAGTACTGTGAATTAAAAACCTGTGTCTGTTCCAG
TATTCATATGTTACTGAGTAATCTCTTTCTATAATCTCTTTGCAGTATTATTCCACAGTA
ATGGAACAGCAAGTAAATGGACAGTTAATAGAGCCCCTGCAGATATTTCCGAGAGGTAAT
GTTGGACAAATTCTAATCAACAATGATTATTTCAGCAAACTGTTTCATCAACAGTTATGT
CTTTCAAAGGTTTAAATGCACATAACATGATGTTTAGCTCTTAATTTGAAAAAACAAAAA
AAAGTATTCATTGTCATGAGGATTACAAGCTGTATTATAATTATGGGAGATAAAATATCT
AATTTACTAGGGTAAATTAAACTAACTAGATTGTTTCTGTTTTTGAATTATATACTTATA
TTTGTTTAAAGAACTCTTTGGGGGTCTACAAGGTTTCTAAACCAACGCAAATGAATGATT
TTTTTTTAAGATTTATTTTTTATTTATTTTGCCCTCCCCCCCCCCCTTGTCTGTCTCTGT
GTCCATTTGCTGTGTGTAAATGAATGATTTTAATTCTGGATATTTATAAATTGTGCCTCA
GGATGGTGGCCAAAGCTGCTACTGAAAAGAAAGCTTTCAGCTAGTACAGAAACGTAGGAT
TTACTAAAGGGTTTTAGGAGAGAAACTTTGGGGGAATGTTTGGCACCTCGTTTTTGGGAG
ATGCGTTTTCTAAATAATGGGAAATCTTCATATATAAAAATTTGATTAAGTCTCCAAAAA
TGTGAGATGAGGGTGAGTCTCAGTGAATTGCTTGATCAAATAATTTTCTTTATCTCTTTT
AGGTTTGGCCAGTATTACCCTTATATCAGATAAGATTGTTTAACTGTGTGTAGACATTTT
CCTCAAAATTTCAATAATGGTGAAAAAGAACAGTTTAATTATGTAAATCCTATTAAGTTT
TTCACCTGTTATCCATTGCCCTACTTGGAATCCATGGTTTTTAACCTGATGGAACAGATA
GGGAAATTCTCTAAGTAACTCTTCTAGAGATAACTTAATTGAAATAATTAAAAGTCAGAC
TTACCTTCGTTAACTGATACTGTACAAATAATCATAATGTAAGTTTTCCAATTAAACATT
TTATACTTTCATTACCTCTAACTCTCTGAAGTTTGAATGGCTCAATTAACCAATAGGCTC
TTATTCGCACTGATACAGTCCCCAAAGACAGTTCACTTGGCCAGTTAATGACAAGATTGG
GTTCAAGAGGAATGTGAAATGTGTCACTTCTAGCTTTTTCTTGAGTAGCAGGATTACAAA
GACTTATTACATTATTAATAATAATTAAATAAAGAGCTAACCAAATAATTTTTTTAAAAG
GGCCATTCAGGGCTAGTGATGGGTGTGTTTGAAACAAGGTTGACAATTTATCCAATTCTG
TTGTGCCTGAAGACTAAAAACCAAAAAAGAAAAGAAAAAGAAATGCTGCCATTCCTGTGT
ATTAGGCCAAGTTAATGTTCTCAATCAACTGGAGAATTTGGGCAAGTTTCAAAATTGTTT
CCCCACTAGGGATATTTTGTTACCAGCTGAAAATTTCCATTAATTGCGTCCTACTTGCTG
ACATTATAGCTCTATTGTAGCAAACCCTAGTATAGTATCCTGCAGAATTATAGTTCCATA
CTGTGGGTCTTTGTTTTCATTTTCAATGAAGTATTTATTTCTCTTCATCCAATTTGTTTT
CAAGTTGTTTTCTTTCATTTTTTCAACAGTTCCTTTTAGTCTGCATTTTCATACCATAGT
CTCCTTTCCCATGATAAAAACAAGCATTTTTAAATATCTATCATGTTTGGGCACTGATAC
TGCTTTAATGTATTATTTCTAATTCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGTCACTTA
AATACAGTCCTTCCAAGACAATTTAAACATTTTCAAAATATGGAAGTTTCAGTTTCCCTA
TCTTTGTGGGTTTTTTTTTTACATTCTATAGTACAACTCTTCCTAGTTTTTTGTAGTCTT
TTATATTCATCTTATATAGATAAGTGGGATTAGATAAATATATATAGTTAGGGTTTAAAC
ACATTGGGTATATTACCTGGGTCTTCTTATTTGGTTAGAGTCCTCAGATCTTAGGTTCCA
TCGTCAGGCCCCATGTTAAACCGAACTTTTAGACTGAGTAAGTAGGAAGGACAGGAGAAA
ACAGTTCTCTTCTAACATTAAATGTTCTGTGCCAAGAGCACATTTGCCTTAAAAAGTAAC
TCCCACCTCATAGCTAAGTCCCCTCTGCAGTTAAAAAGACATGTTAGTCAATACAAGTAA
ATTAGAGAGACGAAAACATAATAGGAGCTATATATGGTGGAGGAAGCAAAGAGAGATTGA
GAGGTGATGAGTTTTTGTCTTTTTAAATTATTGTTGGAATAGTGAAATTGTTCTAACAAT
GACTGAAATGATGAATGCACAACTATGTGATTATACCAGATAACACTGATTGTACACTTT
AGATTGTATGCTTTATTAATATGTATCAATAAAACTAATTTATTTTAAAAAAAAAAAAGA
AGTGTTAGAGGAGCGGGTATATAGCCCAGTGGTTGAGTGCCTGCTTCCTATATACAAGGT
GCCATGTTCATTCCCTAGTACTCCCTAAAAAAAAGATATGTTAAATATTAATAAGTATAA
ACATTCACTAGCTTTACAGTAACTTCTAACTCTCTAACTTCAGGAAATATGAGGTTACTG
GGTTTTTGGAATACTGTTTAGATTTCTATTCATGAAAGTTTGAGAAGCCTTTTGAGAAGT
AAGGCAGATGTTAAGATTAGCGGTAAGAGTTGATGCCTGTCTCTAATTTCTTGGTTAGGC
ACTCTCCTTTTAAATGAAATTTATGAATGCACTAGTTTTTTCAGTGGAAATACAATGCAT
TATTGTTTAAGGAAGTACTGATAGTCCCTCAAGGACCAGGCATCATCAAGTGTATGTGAC
TATTGTTTTATTCAAAAAGTTAATTTCCATTTTAAGGAAAGAAGATTTGGACTCTTAATT
TTATTGTATTTAAGAGAGAGAAATAAAAACCCTTTATTAAGGTCTAGATATATTTTCTAG
GAAAATAATGTAATAAACTGAATATACCTTAAATATATAAAATTATAGCCACTGATGTGC
TTTGTAATTATTACCCATGTCTTCTTTTAATAAGTAGCTCTATTTCTTGTCAGAAACAGA
GGAAAAATACATGAACATGTGAGAAAGAAGGAAAATATCAAATTCATCCTTCCCAAAACA
ATCAATCAAAATTGACAACCCCTTAACATACAATTTGTAGGGCACTGTAGTTTTCAAACG
GAGGCATCCTTTGTATTTTGGGGTAGGAAGCTTTTGTATTGTTAACATTTCTTGAAGAAG
CATTTGCTGAATTGAAGAAGTCCTAACCTGTAATTCAAAACGGTGTCAGGAAATTAATTT
TTTTCCCCTGACATTGCTTTATCATTAGACCTAAATATTAGCAGATGTCAAGATTTATAA
GAAATACAGTGAAATTAATTATATCTGTGTTTAAAAATAATTAGACTGCCTATGGTTGTG
CAAACTTATCTTCATATTTGAATATTCCATTGTAGAATCTCTACCAATCTTTATGGCATT
TAAAGATTCTTCTCCCATCCCCCCAAAATTATAGCTATTTTCAGAGTAATTTAAGTGCCA
GCAAATACAAACTGTAATAGAGTGAGAAATATTGCAGAAATTTGAATTATGAAAGGAATC
TAATCATTTTAGCTCAGTTAACTTGATTTTTATGTTTTAAGCAGAAATTGGAAATTATAT
GAGGTAGTGTCAGAAAGCTTTTTTGCATTTATAAATGCTCACTCCTGCAAGTTAAAAAAC
CTTGGTTCATAATTCCCACTTTGGGTCTTGGGAGCCACTTTTCAATCATTTCTCTCTGCT
AATTTTGGTGTCACCCTCATTTCTTTTTAAACGATTCATTTTGAGCAAATTTGTAAATGG
CCCTGATGTGTTCTACAATTTAGTCAATTACTGTTTCAGCCTGCAAGCCTCCTGGGGAAC
GGAACATACATGGCCTGAAGGTACGAATTTCAATAATTGTTTCAGTAAAGTTAGATGGAT
TTGTAATGCTGTGTTCCACTTATTGAAATGTCAAATAAAACTGCACTTTCTCAAGCTCTG
ACAAGCGATCCTTTTTTTTTTTTTAAATGGGAAATGGAGGGGGATTCATCTATAGTATTT
ATTCAATATGTGTGTTTATTTGGATATAGGAGTTTTGGTGCCCTGTTTTTACTATTTGGA
ATGGTTTTGTTGGTCGGTTTCCTTAGTACCCTGGGTACTGGACTGCACAAAGATTAATTT
CAGTGAAAATATAGGTTTCATTTCAGTGATTAATTAAGCACAGAAGCAGTTTGTACACAG
ATTACCCCCATCTTCTGTGGGCATATTTATGTTAGAAATATGTATCTATTTAATGTCTTC
ACATTGTTTCATGTTTTTGAGTTTGGAATTTTTCCTCATGCTTCACATTTGGAAGAGAAA
CTGGCTTTTGTATTAGGCACAACTCTTTTGTAATTAATTACCTGGATATCATTTTCCAGT
GAATAAGAAACATTCTACAGTGTTTTGTTTGGTTTCAGAGCTGGAAGGATATGACAACTT
GAGATATCCTATCCTCTTTTTAAAAAAATTTATTGTGGTAACATATATATGTAAAACAAA
CTTCCCATTTTAACTGTTTTTAAGTGTGCAGTTCAGGGCATTACTAAATATATTCTGAAT
GTGCTTTTTTGAACATAATATTTTTGTATGAGTTCTGTAACAGTTAATTAAAATTTTCTG
TCTCTCCTTTTCATCACTGTCTAAATGATGAATAATGACAAGAATAGATTATTACATAAT
ATACAGGTTGTGCAGTTCTATAACCTATATACTGAATAGACTCCAACTGTGGGCCTATCT
AGCAATAAGCTAATTAACCTTAATAGTGAAATGAAAAATTTGTGGTAAATTATAGTTTAA
TGAGAAACTGTGTTCTTAGAACCCAAGACTGATAAAGATTCTTTACCTGTAGGTGAATAC
CCGGGCTGGACCCTCTCAACACAGCAGCTCAGCAGTCTCAGATTCACTTCCAAGCAATAG
GTGAGAGCAAGCAAGTAAAGTATGCCTGAGAGTGTGATTATCTACAAAGTTAGGGGTCAC
GTGGGAAAAGAGTCGAGTTGGGTAACACCTCTTTTTCATAAGACAAAAAAAAAAAAAAAA
AAATGTGGTTAAGAGGAAATTTAACCAGTTACCTAATACTACTAATAGGGTGTCTCAAAG
AAAGATGAAATTAGACACATTAAATTATTAATTTTGGTCCATGGAATGGTTTTCTTTCAT
AGTCCTCAAATTACACAGAAAATTCAGTGCCTCTGACGAGTTCTTGCTTTGATGATCTGG
TTTATATAAGTTGTGTAGTGCTTATTTCTTGCTTGTCCATCTTTAGGCAGTGTCATTATC
CATTGGCATCTTTATCAGAAAGAGGCAAGGACAAAGTAGAGTAAGGAAATGTAAATTGAT
CAGCCCTTTTGCTCATTAGTATTTTGGTTTCTCCAGGAGTTAGAAGCTATTATAGAAGGT
AGATAATGTTCATTAATTCATGCTAACATTATCCCACACTGGAGTGGAAACTAAAGACTT
CAGTCTTTTTCAAAGTGTTCTCCTTAGAAGACTGGAGAAGCTAAGCCATGAGGTTATATA
ACTTACTTCAAGGCCATGATAATCCTAAAGTAGGAGTGAGCTACTTAAGCTGATAGAAAT
CTAGGTCTTTTTGTTTATACATTCCTTTATTCAGCCAGTAAACATCATATTACTGTACTT
GAAGATGATACTTTGAAGATGATTGTTCTGTGTGTATGGGTCACATTTGCATTGGTGACT
GAAAAGCTAACATTGAGCTGGAAAACTCTCCCATTCTATGACATGGTTTTTCTGTTTTGG
GCCTTAGGGCCATGGCCAGTATTTGCACAGCCCTTTGTTGGCTGAGATTTAGTTTCGGCT
TCTACATTCCCTTCATGACTGCCTTCTACCCCCACCCTTATCCCAAAGTCTTGGTACTTT
TGTCAAGGTGCTCTCCTGTCCCCTCCCCAAAAGTCACTTCCTTGATTGCTTCATTACAGC
ACCAGTGTATCTACAAACCCACTTTCCTGGTATGAGCACACTGCTCTTAAAGTGTGTTTC
TTTCTTAAACAATTTATTCTGTCTTAAAATACAGTCATATTGGTAATTTGCCATTGGATT
ACCTGCCTTGTGATCATGAGAGGTAGGTCTTTTAGTTCTCACTAAAGGGCTTGGTCCCTG
CGGGACAATACTTGCCAGCTTCTCTATTTAAGCTTATTGGACATGTGAGTCATGGCCCAA
CAGAGTAAAGGCACAGGGATAGAGAGTCAAATGTTACACTCAGTTTAAAGAAGGCAGGGC
AGGACATTTAAATATTATCACTAGTTGCACAAGAGATATTATCCAAACAGATGGGCTGTG
AGCCTTGAGGAAAAGAAAGGACTTTACCTGAAGTTTCACGTCAGATCTCATCATGGTATA
GAAAGTAGCAAGGATCACGGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACTTTCCATCTATCTACCTCTTGTGTTA
GGAAGATTGATGAAACTGTATTAAGGAATCATGTTTTGTTTCTTGGTTGAAAGGTGTTCT
GTAAATGCAATGAATCAAAATGTTATTTCAAATTGTAGGACATAATGGAATATCTGTGGA
GAATCATTGCCTGGGCATTGTTGGTTATTTCAGTTGTTAAAATAATTGCAAATATCAAAT
TGGAAGTCATCTATGGGAATATTTGGATCTAAATTTTCCCAGAAAGAAAAGTAAAGGTGT
GTGTGTATGTGTGTGTAAGGGAGACGGGCTTGAGCTTGATCTGTGCCTTAGTTTCCCCCA
TAAATTGGGGATAATAACTCTATCCCACAGGATGGTTGTGTGGATTAAATCAGGATAATA
AGTAGTAGCACTTAACTTGGTGCCTAACTCACAGTCATTACTCAATAAATGTAGCTGCTA
CTATTTTTTTTTTTTTAAACTGGACTGATTTTAGGCAATTGTTTATTTTTTTTTCTGTAA
GTTTCAGCTTTAATCCCCTTCTACAACATTCTTAACTGCTGCTTCAGTGCATGAATTCTT
AGGCTTGGGAGAATATTAATTAAGATTGGTATCCTTGGTTGAGGACACATTTTATGAATT
CTAGGAAAATAGGGACTGAGGCTCTATAGTCTGCATTTGCCATAGGAGAAGTTTAAGTAG
TATTTAGAGGGAATTATTTTATCTTGAAAGAGTGATTGTGATCAGACTTGAAGTCTGAGA
TTTTCTCAAATATAACCTTTTAAAGGTACCAAATAGAATGTGCTTATGTGTGTGTAATTC
ACATTAGGTCCTGAGAACTTTTGCTTTCTCATGTTTTTACTGTCTTTACTGGGTTGCTAC
GCCACCACCACCATTAAACAATAATCAGAACTATCACCGCCATTTATTGAACGCTTACCA
CATACCAAGTCACTGGGTTAGATTCAGGGTGGGAAGGGATTGAACTGTATAGAGGTGAGT
AAGATGTGGTCTGTGCTCCCTGGGAGCTCCTAGTCTTGGGATAGTGTATGTGTGGGTGTA
AGGGTGGGAGACATCTGCATAGATAACTATAACACAGGAGAGGAGAATTAATTTAGTAGA
TGGGTAGAAGGTTAGAGTGAATTGATTATTAAGGAATTAACAAGCTTAGAACATTGATGG
GGGGGCTGCTATTTTATATACCACTTTACAAGACTGGTGTACATGGATAAGAATAACTCA
TTAGAAAGCTAAAAGGGCTTCAGAGTTTCCCCTGGTTACTTCTCTTCCCTCAAGAAGGAC
TTCTAAACTCTTTCACATAATTGTTTACATAGCAATATATGTCCAGAGAAGAACATTTTA
ATATTCCCTCAGTAACCTTGGAAGCTGGATCTCATTTCTCCAATATAAAGACAAAGAGAG
AAGGTAGCTAAAATTTACTTATCTCCTGTGTGTAAGATACAGTGCTAGGCTTTTTGTAAA
TATTTAATTATTCTGGCTACCTTATAAAATTGAAAATGAGATTCAAGAAGGGTTAGTAAA
TTGCCCCAGATCACATAGCTTGTGAGTACCAGGTTTTATTTCTATTATACATTTACTTCC
CAGGAAGCTAAATTATAAATCTTAACTTAACCAGCGCTCAGACAGTCTATTTTGTCTTTG
AAGTTCTATAATCTTTGTTTGCTGTGAACATCTGAGAGTGCATGGTTAAGTGTTTCTGTG
TTTAGAAGAGAGAGTCTATATAAAATAGCCAACAAAAAGCAACAGAACCAGAGGTCTTAA
GCTAAAAAATATTCAAATGGAAAAAATAAGTCATTAAAATTCTCCTAAAATAATCTAGCT
ACATTTAAAAAAAAAATTTATTTATTTATTTCTCTCCCATTTCCTCCCCACCCCAGTTGT
CTGTTCTTTGTGTATATTCTCTGCGTGTTCTTCTTTGTCCGCTTCTGTTGTTGTCAGCAG
CACAGGAATCTGTGGTTCTTTTTGTTGTGTCATCTCTCCGTGTGTGTGGCACCATTTCTG
GGCAGGCTGCACTTTCTTTTGCGCTGGGTGGCTCCCCTTATGGGGCGCACTTCTTGTGCG
TGGGGCTCCCCTATATGGGGATACCTCTGCGTGGCATGACACTCCTTGCACACGTCAGCA
CTGCATGTGGGCCAGCTCCACACGGGTCAGGGAGGCCGGGGTTTGAACCGCGGACCTCCC
AAGTGGTAGACAGATGCCCTAACCACTGGGCCAAGTCCGCTTCCCTCTTGCTACATTTTG
ACTATAAGATTCTTTATTGCTTTGGATCGCTTATGAGGTAGTAGTCTCTTTACTGCTACC
CTTAACATTTGGCTGGTTACTTTTGAAAAAAGTACAGAGAGAAGGATATAAAGAGTGAGG
ACTGTGCCTACACCTTAAGGAAAGATGTGTTGTAGTCTGAAACTTTCAGAGGTGTCCAGA
GGTGGGATGACCTTGGTACTAAAAATTGTGTCTTCTCTTTTCAGCTTAAAGAAGTCTTCC
TGCTGAAACTGAAAGAAATTATTAGCCAGTGGCCAGGTAGGTTTCATTGCATATAAGATT
TTCTTATAGCAGTAACTTATTACTGTCCAGTTTTCTATTCATAAACTTATTAAACAGATG
AAGAGTCTGTGAATTTCTTCTTGTCATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACTGCTGTTCA
CTTCCCGTCCATGTTTCGAAGGCTGAAATCTAATTATCTCAGATGCTAATCAGTGCGTCA
CACACTGACCTCTCCAAGCCTCATTGGTATTTCATGAATCAAGTGCTTGTAGTGGAGCAT
GTCAAGAAGACAAAGCTGGGTCCTCATGCTTGTCCTTTAATATCACCTGTAACATTGTGG
CCTAATAGATGTTGCATGCCTTAAAGCGGTGACTATAGGGTAGTGCTTCTAGAAGCCTTG
CTTATTTAGCACACAGTCCTTTGAATACAGTTAGAAAAAATGAAGTCGATTTGGTTCTGA
CATCTGATAATTATCCAGAATGTGTGAATTGTGGTCCTTAAATATTCTGTATACTGCTAA
GGCAGGGGTTGTTAACCTTTTTTGTCATAGACCCCTTTTCCAGTTAGGTGAAAACCACCA
ACTCCTTACTAAGTCCATACTGTACTGTGTATTATTTAATAAGTATATCCTATCCGCACC
AACACAACCCCACAAGAATAATGTTTTTTTGAATTTCAGTTCAAGCTCATGGACCCCTTG
TTAAGAACCCCTGAGCTAAGGAGAGTCTGGTGTTGTATATATAATTTTAATAGTCTCCAG
GTTTTATGTAGTACTTATCTAATACTTTTAACTTCAAGCAGCCAAAGGTTTGTTTAGATT
GAGGTCCACAGATATGTCCTCCAGTGCCCTGATGTATTCAGAACCAGTGTGAAACAAGAC
CTGGCTAGAAGTAGAAAATATTGAGACTGGGATATGTTTGTATCTTTAACATGCTTGCAT
TCTAGTTACTAATTGTGATTTTTATACAAGTCACTTGTGCTCTTTAGCTGGAAAATATAT
TTCAAAATTGACATAAATTAAAAATCTTTAACTACATTTGTTCAACGCAGGCAATAGAAA
ATAACCCGTCTAGATTGTGCTTTCAAAAATGAAAAACATTTGTTTATTTCCACTGCAAAA
AATAAGTATTCTAAGCTGTTAAAAAAAATTCTAACCTATTTCTAATGTTTGACACAAACC
TAGTACCATAAATATCTTAGTGGTTCCAGTTATGAGATTCTCTGTGGTGGGAGATTGTCA
TGGCAATGCTTTTTGACACTTAAAGATTGTTTATTGCTTTCCCTTGGGAAAATGATAACT
CTGCATTAAATAGTATGACATTTTCTTTCTTTTAAGGAGTTATCCTTTCTTATATTTATT
TTTCATTCACTGAACATAAAAATATGAATAAAGAAAACCCACCTTTGGAAACTCTCAAAA
TACCTCCTTACTTTACTTAGTTCTCATTTTCTTGGTGCTAAAGAGTACCTAAACAGTGAT
TGAGGTTGCATTGCATTGAGGTAATGTACACAGTTGTGGGCGTCAATAAATTTCTGGGCT
GACACTACTTGATATGGAAGATGTAAGTCACATTTAACCATACTTTAACACTTGAGCATA
CTTTTTTATTTTAGTGGTTTATGCTCTCAAGCATTAATAATGATTTGCCTTTCCACTAGC
CTCCTCTTAGATTTAATAAGAAATTCATATTAATCATTAAAAGAAAGAGACATGATTCTT
CAAGATAATCAAATATTGACAGGTTAGAAATAGCTTTCTGCCTGGGTTCATTGATATAGG
TTATGTGATATAAATATTTATTTCTTTTCTGTCACTCAGAGTAAATGCCACCAATTGATT
CAGCATTGATATAGTGTCAGCAGTTCATAAGAAACATTTGACTGGCTTGTGTTTTCCGAT
TAGTCTGTGCTCTATAAAGTGGGATTTACTAAATCTCTCCAATTGTCTGCTCATAGAGTG
TGACTGCTTTCTGAAACCATTATTGCTTCGATTTGTGAAGCAAAGGTCTAGTGATAGGAC
TAGTTTCTGTCAGGCCTTTACATATAAAATAAGGATTAATTGAGCATTTTTATTTTAATG
ATTTATAAGCAATAGGCACTGATTCTTCCTAAGATAGGCAGACAGTAAACAAAGAATGTT
TTCTTTGCTGATCCATAATTGAATTCCATGTCATTTTCCCTATTAATTCCATTAATATTA
TATTAAATCAGGCACTTTTTAAAAAGTTTAATATTTAGTCTTTGCAATGGAGACATTATT
TTCCTGTTATCTCTTTATGACAGAAGTTTCCATTTTTCAGCTAAAAAAATCAATCATAAG
TTGTTTTTAGCATGTTTTATTGAAAGCTATAAATCTGTATCACTGATGTGTTTTCTAGAT
GTTTTCCCCACTTCATTTGTGATGCAGAATCATCTGTTTAACACTGGCCCTTAATTAGAA
ACTGATTAGTAGTATTCTAAGGGGTCAGTTTAAAGCAGAGGTTCTTAACCTTTTTTATTC
CACAGACCCCTTTGCCAGTCCCGTGAAAACCAGACTTCTTACTAAGTCCATACTATATGG
TGTATTATTTAATAAATTTATCATGCCCTCACAAGAATAATGTTTTTTTTGAATGTCAGT
TCAAGCTCATGGACCTCTTGTTAAGAACCCCTGGACTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGCAAAGTTAATTAAACTTTAAAACATTGTAGAAACACA
TTAACCATTTTTTAAAAATGGGCATTGTCTTTTTAAATGATATAACCCTTTTTATCTTAT
GAGACTCTTGCATTCTTATTATCTGAGAGAGTCCAAATTTCTGTTTTGATTTTTCTATCC
TTGAATTTAGGTAGATATGTGCACATGCATATACACTTGCCCCTCTATACTCCTGACACT
GCTGGGGTTATTTTGGATGCCTTCCACTCCTGGTTTAGGTTGGAGTGCTAGAAATGCTGG
GAAGGCAGCTGATCTGCTTCTCTTTTCAACCTGCTAGGTAATAGGGGTAAAAAGACTGAT
GTCAGGATTCTAATGGTTTAAGGTGTTCAGAGATGTGCCACATCTATCCCTTTGCCTTCT
CTTCCTCCAACAAAATACCCAAAAAATGAAACATCCTTCAAATTCCAAAGTCTTTCTTGT
ATAGTTTTGGAATGTATATATCTGTGTATCTTCGTGCGGATATATCCTAGGGAATGGTCT
TTTGACCTGTGCCGTATCTCCTTTTATGTGGTTGGGAATCAGGAAGGGGTAAATGCTTGA
TGGAGTAGTGAACGGGGTGCCACCATAGGCTGCGGCTCCTCTAAAGTCTAGATCCTAGAG
TGTGGAACATAGCTACATCCTACATACTCTTAAATCTCAGTGGCACTAATTCAGAATTTG
TGAACTAGAGTAAGTGAAATTTCTCTGTCCTAGAAGTTTACTTTGTGCCATGATGAAAGT
GCAGCTAACTTGTTAAGCAAGTTAATAGTACAAATTAGGTTGTCAAAGGCCTGTTTAGAC
TACCTGGAGAAGTGTTTTAAAGGAATTGGCCTATTTGCACTTGGCAGCAAATACTGTTAT
TTATGTATCCTTCATACCCACTGATCAAAGTAAACCAAATAATAATTCTTATTTTATACT
GTTTTAAAATTCATACTTGCCTTTACCATCATTTGGTTCAGATTAATAAAGTTTTCTTTT
TCTTTGTGCTAAATCTTTTTTTTTTTACAGGTTAAAAATAAAGTATGTCTTCTTCCCTGT
ATTAGTAATTTAAAGGTAGTGAAGAATAGAATTTCCTTTAAATAGGAATATAGTTGTCAA
TCCCTCTGACTTGTCTATCATTTCTCCACTGACACTAAATATAGTAATTAGCTGATTTTA
AATTGCATCAATCAGGTTGTAATACAAGTTAAATTGGGTACTGAATTGGTCTTTACATAT
TAATCTTTCAATATCCTTTTTAGGGATTGGCTGTTTCTGTTACCTACACTGTATTCCTAA
TTATTACAGCTCCCCAAAGCTTTAACTTCAGGAATGTATAGAAGACATATTTCCCTTGAT
AAATGAAACCTTTAGCATAGAGCAAAATATTTAAAGCTTTACTATAATGATCTGAAAGCA
AACTTTTCTTTTTTTCAGATGGTATTGAATTAAAAACTCCATCCATTTTCTGCCCATGCA
TGATTTTTTTCAGGCCTTGTTATGGCTTTTCCCAAGCTTTAGCTATATGGAATATAGTGC
CTTTATGGAATTCACTTAGTGAATAAAGTTGGCAGTTAATTTTTAAGCAACTGGACCAGT
TTGTAGAAAATTTCTGTATGCCTCAAATAGAATCTGACTAGTCTTAAATTCATTTGATGA
TTAATTATTTAGGGAGTTCTTTAGAACTCTGAAGCAGTTTGTGTGCACTAAAATAATTCA
CCAATATTCATGATACAAAGAGAGTAGTATTTGTGGAATAGGTTTTATAGCACCTCAGGA
AAAACATGAAAACTTTTTCTATATTAAATTATAAAAATGACTTTAATTTGAAAAATTACA
TGTCTATATGTTTTCCCTTTATGCATTATAATGTAGGACTATATGTGCTTTAAAATGCAT
AGATCTGGCATTTTTCTATAAGCATAATGTGATTTCTGTCCAGTTATTGCTGTATACTAA
TTTATCATTTGCAAAGACAAGCAATATATATACTAGGAAAATTATAGATATTATTCAGTT
CATTTGTTATTTGAGGAGTTTCCAGGGGCCAGTTTACTTACAGACCATGTATTAGATTAG
TGGGGTGGGGGTGGTGGTGCTGGTGGTGTGCACACATGTTTTTCTTTCTCAGTTTTGACT
TTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGACTGTTTTCTTA
TCTATATATCTGACCTGACCCTTTTGAGCTATGTTATATCATTCCATTTTGACACCTTTT
ATCAAACTTTAATGAAATGACCCAAGCAAACAAATTGTCATTAAACTTTCCATCACTTTG
TCCCTTGGTATCGTCTTTTATAAATTGGACAGCAAATGTTGTATTGATCTTCTCGTTCTT
GCAGCTGAACTTGAAATGACCCAGACTGCTTGTTGTTTATGGCCCAGAGTTGCTTTTCCT
TGACATTTCCATCCACAGCATGACATCCTTTTTGTTTTTCTTTCTTTCTTGTGGAGATGA
ATGAGCAAGACATACGATATCAGGACACCCTTGGTCATGGCAATGGAGGTACAGTGTACA
AGTGAGTAGTCAATTTTGTTTTAAACTTTCTCTCCGTTTTACCAAATGCTGGGTTTCAAG
TTTAAAAGGTATCTGAGTTCTCCATAGTAAAGATTTTTAAATGACCACTAGTGCTTAGAT
TTTATTTTCACATTTTACTCCGAAATTCTGCAAGGCATCTATTTTCACAGGAATTGCTTA
AGAAAGTGCATTTATATTGCCTTTTTAATATTTCTGAATCTGAATCTCTCCTGGGTGAAC
AGTTAATGGTCCACCATTACCAAGTGTGCTTTTAACTGGTCTGAAGTTTAGTGCAATTTT
TCCTTTGCTCTTTAACACCTTTTTATTTTTTAAACTTGCTAGTACCCTATGCTAGTCCCC
TACCTGTTTACATATATGCCCAGTAGAAACCAAACCTTACAAATACCATTCCTTTGCCCT
GTGTTGACACAATAAATTATTAAAAAGCCTTCTTCCTGTTGAATTTCCTTCTCTTCTCAC
CCTACTCCCCTGAGAGAATTTCTACACATTGATGAATATGTTAAGTTATAAAGTTCTCCC
AAACTCCAGTTGCAGTGATCTTACCCTAAAGGAGAGTTCATTTTCATATTAAAAAAAAAT
GCTAACAGTAAAAAATTTTTCTCTCGACAGGGAAGTCTTTCTCTTGTAGTAGTGCAAGTT
TAAACTACATAATGTAATATCTGGTACTTAATAGTCTGCAATGGTGTATGAAAAATATTC
TACTAGGAATTAAGAAATCCATACTCTGTAAGAAAGCCCTGAGGGAGTAATAAAGCTTTC
CTTCAGAGAGCTGATTTCAATATATACACTAACCCTGCATCACATTATGATTGTGTTTTA
CCTTAGATATTTAAACATTTATATTAATATATATATTCAGTGTTATAAAAGAATTAATTT
ACTTTCTAATTGGTTACTGATGTTCTTAGATCATTAAGCTCTATCTTGACCATGTGAATA
CAGATAAAAAATTGCCCCGTGACCGTAAAGGGCCACTTTTAAACCCCAGAATACCCCCTA
CATAATTAGAACTTTGGCATAGAATTATGTCTCCCAGGGTTAGGTGCTCTTTTGAAGTCA
TCTGTTCCAGCCACCCTGCCAGGGCTTCAGTCCTCTCTACAGATAGGGTCAGGATGTAAG
TCCTCTTTCCCAATTCTTGTCCTTTAAGAATTTATGTTCTAACCTTGTACAATTATTTTC
ATCTCTTAAAACATGAAAGAAACATTATGTAGGTGTTCTTTAGAAGATCCTGCCATTTGG
TATATAATCTATAATCTAGCACAAAGAAACTAGGTAATGATAAAAATGGTTTTCTTAAAA
AAAAAGAACTTACATCCACATTTTTGGATTGTTTTTTTCCTGTAGATAACTGAGTATTAT
AAATAGTTATCTGAAAGTCAAGTGCTTCTACTATGATAATCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTT
AGTCTTCTCCTTCTTACTCTTATCTGATCTGGAATTTTATCCTGTTCTGAAAGTTCTTAG
GTTCAAGTATCTTTAGAAAGGAAAGAAGAGGAAGGAACATATACACCCCAATTTGCTTCC
CTTCAGTTCTCTGGAGGGAGCAGTTTTTAAAGTCTTAACCTGTCTTCTTAATGCTCTTAT
GTGGATAGCTAGATATAATAACAGAAACGATTTCTAGCAACTCTTTGGATTCCTTTTGCT
GGCTTCAATTGGAATCCAAAATATTTCTTTATACTCTTAACTTACTTATCTGTATTTCTT
CACCCCATGTTTAGCTCTCAAACATGTTTCTGTTTTTCAGTTGCAGGTTTGTTGTGAAAT
TATTGTCCTGTTTATTCTAGAAGGAAGAAAACATAAGACCACCGAACTCTAGCAAATCAT
TTTTATTAGAGATAATACCCTAGACGTTAAAATTATAATCTTTTGTCTGAGAACATAGGT
TTACAAAATAAGGCTATATAGGGAAGTAGAAATAACATCGCTGTTTCCCAAGGAAAAATT
ACATAAAAATTATGTTAATTTTGTTTTTAGATAAGAAGCATGGCTGGAACTTCTCCGTTC
CTTAGGGCCACAATATCCAAGGGAACATTCTCGCATATATCCTTAGCACAAGTTCTTTAA
TTTGCTAGAGCTCTATAGTGGCAGTAGTGACTAACCCTGAGTTCATTTAGCTGCCATTGC
TGATGCTTGCTATGAATGTTGTATGATTTAATATGATCTAAACAGTGGTTGCTTATAGAG
AATGAGTGGAAGTATCATGATCATTTCATTATTTATATAATAGATTTCTTATAAAAAAAA
AAGATTTCACTTATTTTATTGCCTATATGATTCTTTCGGGGAAAAAGTATAAAGACACCA
ATTGCATAAACACCTCTCATTGATTATTAGCCTTCATTTCTGCCTTGGCTTCAACTTGTG
TTGTTGTTGTTCTATATCCCTGGCATTTAGTTTAGTAAAGAAAATGACAATCATTAAGAA
ATAAGAATCTACTTTATTAAACAGTATAAAACAAAGTGTTTGATGTGTTATGATTGAGTT
TCTACTACACTAAATTAACCTTAATGGTATTGACTATTTATTAAAAATTGTGACTTTTCA
AACAAAATAATTACAGGTCAGGCTATGCTATGTAAACTAGATGAAGAAAATATTGAGACA
TTCACCCACTGGTAACAAAATTGCTTAATGGACTTATTTAGTTTTTTTTCATATAAAGTC
TAATCAGACTAATAAATGCAAAGCAAAAATCTAATACTTGAGACTTATTTGCTCCATTTA
ATGGGGTGTTGTGAATTTCAAGGGCTACAGTATCATGAATAATGGCAATATGTATCATTT
AATAGTTGATCACATTTTCATCCTTTAAGTCTAGATGTTCTCTACTACAGTTATACAACA
CAAAATTCTAGCCCCAGACATTTAAACAAAATGGTAATAGGTATTCTGCTTGTCTACTGC
TGACCTGTTCTTGTGTTATGATAGTGACATAAGCAAGTAATTTTAAGTAGATATTTCTTG
GATTACTAGTTTGGTTTAAGTGGATCATAAAGGAAATACTTTATACTAAAATAAACCCCA
AGTCAGGGAAGAAGAAAAGTTTACTAAAAGGAAATGGGTGCATTTTCATTAAGGCTCCGT
TTTCCAAAGTGTCTTCTGTAAGTTGATCCAAAAGTCAATTTAGGAGAGACATGTTCTTTT
TCTCTTGGAGAGACTCACAATGAATTTCAAAAGCATAGAGAAAGTAGAAGATACTATGTG
TTGTAGTTTAGTGTCTCCCACCAACTTTGGCAAGTTATGTAATGTCTCCTTCCTCAATTT
ACCCAAATGTAAATGGGGATGATAATTACAGTATCTGCTTTATAAAGCTGTTCTGAGGTT
AAATGAGAAAATCCATATAAAAAGTCTAGCACTGTACCTGACACTTACTATATGATCATG
ACTGATAATGCTGGTACTAATAATAGAAAAACCTCTTTAGCTTTGTGAAACCCTATGTTT
CTTAGACTTATTTGGCCACAAGAACATCTGTAAACTCTCACAGAATTAGAGTTGTGGTGA
ATTTACTTTGATAAATTCTGCTTTTATATTATGAAACATGATGTTTCTATGTTTCATGTT
TAATAAGATGTATTTTATCTTATATATTGTATGTGAAGACACTTTTTAAATGTTTCAAAA
TATTTTTTTATCACACTTTATTTTCAAATCATTATTGATTAGTTGGTATCATGGTAAACC
CATTTTACCTCTGAAAAATCTAGGGCTCCCATTTGTATTGCCATGCAGGGGCAAAGCCAG
AACCCTGCACACAGCATTTCTTTTCTCTTCACAGTTTTTCCCCCGGGCAGGGTTGTTTCT
CAAGGTCAAGCAGAGTCCATTGTATTTTTTTTTAATTTTCCAGTCTACCCAGCATAGACC
TAGGGATAGAATAGACACTTAATACACATTGGCAGAAATGAAAATGAGTTAAGTGAAGGT
TTGTTAGGGCTCTTTAATCAGATTCTCCCCATCTCTAGCTAGTTTTAGAAGATTACAGCA
GGCTGCATAATTGTTTAGGACAGTGTCCTAGAAGCATAGGAATTTCCAAACTCTGGGCAT
GTATTTGTATGATTAATATCTGTTCAGATGTTAAAAGATGGCACCCATTGACCCAACTTA
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGG
GAAGGGATAGTAATTCTCAAAGACATTGATCTCACCTCCTTTCTGTTGTCTTATCTATTT
TAAGAGATATATTTTGGTGGTAGTGAGATAGAGATGGTCCTTGGGATGTGGTAACTAAAG
TCATGTGAGCTGTTAATATATGTCTGCCGTTGTGACATAGCTGTACAGACTGATTCAAGG
AATATTTGTTTGTTTGGGACAGGACTTTATCAACTCATTAGAGTTAGAGAACATGATTTA
GCTCATGAACATAGAAACTCTGAGGGGCAGTTATATAAAATGAAAAAATACACAAATTGT
TTCCAGATTAAATGTTATATGATAGACAAAATATTTCCAAACATGGGATTCTTGAGAGGA
AAACAATAAAAGGGTTCTTGGTGAAAATATTGGGAAGTATTTAGAAAACTATCAGAAAAC
TTTCACTTCCCCTTTCCCCAGCCTACCTGAAGGTGCCAAACCAGAGCAGTAGGTATGCTC
CCACCTTCACCAGTGACTCCATCAGTGACCCTTCTCCTTTAAATTTTTCCCTGAAATGTA
TCTTGTAAATTAAGAATGGTTTTTAAGTGATTTTGTTTTCGACCCAAAGGCTAGGGTGAT
TGCTTGATTTTAACATGAAATTTCCAATCAAATGAAGAGTATTTTCCTTGTACCCAAGAT
CATATTTTAAACTAGCAAACAACACATTATCTTAATGCAAAATTAAATGTATGTGTATGA
CTAGATTGTATTACAGTATTATATGATAAGCAAGGATATTTATATTTTCAGAAAATCGAT
GAGTGTCAAGTAAAATTAATTATGTATGTATGTTTCCTTCTCTCTCTCTCTCAGCATCTC
AAACCATTATAGGTTTGTTTCATACAGTAAGGTATATAATATTGATTAGAAGCTAAAGAA
TTAACCTGAGCTTGTTATTTTTCTACACACCTTTCCACCTCTGCTTCCCTGTACACCCTC
TAACCCCCACCATATTCCTACAGCTTCACACTTGCTCATATCCATTATGGCAATGATGGA
TTATTGGCATCCAACCAACATGACAGGGTGTCACAGGTCGCTGAGCAGAGATTTTCAGAC
TCTGTTTCCACCTGCATTAACTATTATTGAAATAGTTTATTGAGATTGAAGTATTGATCA
TTTTCTGCTAACCTTGGCTTAAGGGAAGGAAGAGGAAGCAGTGGTGTTTTTGAAAGACAC
TAAATTTCACTTAGAAAAATCTCATTTATTTAGTCTTTTCTTCTTCCTATTTTATAGCCC
CTATTGTTTTATTGCTTGGAAAAGGGTATCTTGGCTTTATTTTTATGACAGTATAATTAT
ACTTCAGAAATGTACTTGATTACAATGGGTAACAAAATTGTTCTAGTATATTGGTTTGGC
CAATATTGCTATACAAACAACTTTTCAGTCAATTGAGTCTGGTAAAAAATCAATACATTA
TGGTAATAGTTCAAGTAAGAATTTGCTGAATCTAAGTGTTTTAATACCATCTCCTTTCAG
GGAAAAAATAGTTTTGCAATGCCAGGACATCTTTCTCATATTTTATTTTAATAAAAATGC
TTTTTTATGAAGAAATTTAAAATCCTCAGCAGAAGTGGTTGTGAACAGGTAAACATTAGC
ACACTTCTTTCTTATAGGGTAGAGGAGACCTAGTTTCCACGTGAAATCTATTTCTCTGAC
TGTAGTTGAAAGGTATAGCAATGGGCTTTGACTTCCTTTGCAATGTGTCACATTTGGATT
CATGTGTCTCGTTCTGGGTGCTGATTTTACCAAGAGACATGGACAGTTGAAAGAGCACCC
AAAGGAGTATGAGAAGAATAATGAGGGGCCCTGGTAATTGTATCTGGCCCATCATTCTTC
ATTCATTTGTTAAAGCAGCCACGTTTTGAGTGTGTGCTGTGTGGAGGGCATTATGCTCAA
TGTTGGGGACAGCATGGCCCTCATCAGACCTATGTCCAGATGGATGAGAAACTCTGTCCC
CAGGTAAGTATGGGAAACTTCAGTCTGGGCCACATGTCTGTATGTGTGGTATACAGGCCT
TGGTTCTGAGGAGGGAGCTATGCTTTGAGGATGGAGCTGTTCCTTCCTTGGGAAGAATCG
GGAAAGGTCTCATAGAGAAACTGATACTTGAGTTGAGAAGTGGTTGAAAGAATTGGCTAA
CTTTTATCTGAAGAAGAGAGAATTAAAGGGCTCCATGACAGCTGTCTTTAAAGAAAAAAT
CTGAAGGGCTGTCTGTAGACAGAGGAACAGGTTTCCTTGGTGTTCTGAAACCTTGACCAT
CACTGACAGAGTTGGCTTTTGATTAGAGTGAGGTATTTTTCCTACTACTGTTTTCCCCGT
TGGGTTGTCATCTCTGGAGGAGAGTCTGTGTCTGGTGGAAATCCCCACAGTGCACAGTTC
CTTACCTATTGTAGGTGTTTAGTGAGTATTTCAGGAATTAACCTGCAGAGGCAGATTCTT
CACAACCTAAGAATGGACACAAAGTTCTGGCTGTTGCTGGGTAACCCTGGGAGGTGAACT
TGCCTGCCTCAAACAGAACAATATAGCTATTGTTCAGAACCACTAAGAAAAGAATTCCCA
CTCAGACTTAGAGATGAGATGACTACAAAAGTTTGTTCCAAGTCTAAAGTGCCAGAACTA
AATTCAGCATTCAGCTACCATAAAAATCTCCTATCAGGTTTTGTTTGATTTTGTTCTTTT
AAATTTTGTCATATTGTATGTTCATTTATTCACTGAACAAATACTTATTGATGCACACTA
TGTGCCAAAGATTATTCTAAGCATGTGTGATCCAATAGTGAACAAGACAAATGAGCTCCC
TGCACTCCTGGAGCTTACACTAGTGGGACAAACCGACAATAGTCAAGGAAATACATATTG
AAGGAAGATGATGTCAGACATTGCAAGTGCTATAAAGAATGTAAAATAGGTGCTCTAGGA
AGGCTTATCTGAGTGGATGATGTTTAAGCTGAGACTTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAG
CATATGATCCCCTGGAAATTATATCTTTGATTTTTTTTTTCTTCACCATGATTTTTTGAG
TGTATTTGTGTGTGTATTAAAATAATCTTTGGAATATTTTTCGTATTTTTTTGGCTTGCT
GGTCTTTGTAAGCGCATTCATTTTCCTCCTCCCACACAGAATCCCTCCCACTCCCTTTCT
CCTCCCATTTATCTTGTTTTAAAAAGATGTGATATATTTAAGACTCATCTTCTTAAATAG
ACTGGGGTTAGCACTTTCTCTTGACTAATCTTAAGGGATTCTATAAAACAAAATGTTGCT
TAATTTTATAACAAGGATTTTCTAATACAATTTATATGTTTTTAGAAGTCACCAAAGTCA
TCTCAAAAAAGAATGTGGTGGAATTGGTTTTAGAATCCAAACACTTCCCTTCTGTTATCT
AAAACTCCATGTTATGCCATGTATAAGGAAGTCATTCAAATTCCTTCATCTTATTAGGTT
TAAAGATGTCTGCCCAGTTGGTGTAAGGTGTGATGCTTGTTTGAGTGCGTTCCGTTTTTA
TGTTAAAGGAAAAGGTCTCTCTTGGTTCATTTTGACCCTAGTCATGATATGCCTGTTTTG
TGAAGGCTGTTATGCACAAAAGTGCACAAAATGAAGATAAACTGCCTCTCTCCAGTCTGA
CAAAAGCCATTCCTTTGCAGAATGGTTGCTGCAGTGAAAGTAAATAAATGAATGGACAGC
AATCACAGCCTAGTTGATGAAACTGTTCAATTAAAGCACAGGCATTTACATGGTGTAATT
TCCCTAAATTGCCAATGAGCCCCTTTAGACACAACCAGTGTTCAAATTGATTTCAGCATT
GATTTTGGCTGAAGCTGATAAATTTCTGCTTGTTAGTTAAAGTAATTTTGCAGAAGACTT
TGTACTGCAGTATTGAAGTGTTCATTTAGCTGATGGTTAAAAGAGGAGTTATTTACAGAG
GCCTCTACTGTTGTTCTGAGATGGGACAATTCCCCAATCATCTTTTACTTTTAATTTTTT
AGGCTTCAGTATACCAATCAATAGGTGATTGAAACTGATTAAAACTTATCCAACCAGCTG
CCTATGGCAGTTTAATTAGAAGCTGGATAATTCTTAAATTAAAGTTGTCTTATTCTCATT
GTATAGCTATCTTCTAGAAGAGTAAAAGGACTAACAGTGCTGAAAACTTCAAGTTTGACT
TTGCTAAGGTATCTTGCAAATGTTAAATCATGCAATTGCTGTTCCTAAGGCAACTTAAAA
ATGTACTCTGAGGCTTTTGTCTTTAAGAGATTAGAAGTAATAATATTCTTACTTGGCAGC
CAAGGAATTTTTTTTCCAGAAAAGTGGATAACCTGTAGTTAATTATATATGTGAAAGAAT
GGCTGTTTATGATATATCTCTGATTTCACAAGCAAGATGAATGTTTGAGCTTATTATTTT
CTAACACTGCAGTGTAGGATGAAGCTAGCCATCATGATGTCCCGTCATCTTCTGTGTAAA
ATCTTAAGCTTTGAATTTATATCTTTTATTCTGTTTTGAAGTCTTGATTAAAATAAATCT
CCATTGAAGGAGAACCAGATATTCTCTTGAACTACATGTTGACTTTTCAGCAGTATTCTG
GGCAGGATTATAGAAGAGAGATTTTTGCTTTTTTTTTTTTTTACAGAGAAGTTTCCCCAT
ACTCATTTTACCTAGTGTAGGACAATTTCTTGAGTTTTTAATGGAAACGGGTTAATATTT
TCCGTCAGAAGGGACATATTACATCTGGTACTACAGGGAAGAACAGGGAATAAATGGACT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTTTTTTTCTGTGGATGGTTATTTT
AGTATGTGACAGTGTTCCTTAAAATTCCAAAGCTTCACCATTAGTCCTAAATATTGGTCA
TACCTACCCCCAAAGAAACCTGCCAAGCAAACAAATCTCTAAAAAGATCAAGCAATAAAA
TATATTGCATAAATTGAACCACAGTTAGTTTACATTTGGTTACTGAAAACATGTCATTGA
ATTAATCTCACATGATAAAGTTTTTGTTTTGTTTGTGTGTATGCACACATATATACTCAT
ATGCATTTATGCATTTGACTTTTATAAATAAAAAAATGTCCTACTTAAGATTTGTTCAGC
CTTATCATCTTTTGGTATAATGCAATATAATCAGTGTTCTGGTTCATTCTAAATAGGAGT
CTTACAGTGTATGATCCCTCATCAGTATCTTCTCCTAGTGGTGTAATTTCTCAATATCTA
CCATCTCCTTTTTTTGTTTGTTTTAGTGGTTTTCTTTTGAGCCCAGACTATAAAATCTAA
AATGAAAAACTTCCAAGTTGGAAAAAGACTTCCATTTTGTTATTCCAAATTTATATAAAA
TTAGAGTTTGTTTTTTTGTTTTGTTTTGTTTTTGATCAATAAATAAAATGTCATATAAGG
AGTAGGGAAATAGCATCTGTAAGTATGGAAACCTATGATCCTACATCAGATTGGCTTTAA
TGGATGCCCATATATTTGGTTTTGATAAGAAAGCAGATTTAATAATTGAATCTGACTATG
AGCAACTCTTAACATTCCATGTTAATGAGAACTAAGAGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGTCTCCACATCATTGATATAATTTCTTCAATTGCTAGAGTCACAACAGAAT
AAAATATGGATTAGAGCGGACCTACTTGTATTCTACTATAGAACAATGATTTTTGATGTG
TCGTCTTCAAATGTGGTTTTACACAGAGTTTCAGTGACAGGATACATCCTACAACTTTCA
TTGTACATCTTATTCCTGGATTACATCATCATGAATTAATATTTTAGAATAAATTCTGTA
ATTGTCATTAATATTATTATATTATATTATGTGTATGGGGAAGGGGAGAATGTTAAAAGC
ATTACTTTGCCAAGTGTTAACATTTACATAATTTTTGTAACCTTTGTTCTAGTGTTTCTT
CATTTTTAAATAAACTTGGAGCCTAAAAACATGCAGGTGGCTCTTTCTTGACTTTTGAGA
GGCTTTGGAAATAAATACAAAGAAAATATGTGCAAACCTAAATGATTTTCGCCTAGAAAA
AAATGGGCATGTTTTTAGAGGAGTGAGGTAAGCTTCATGGAAAAATTCTTACCCAGCAAT
TAGGGTGGAGAACTTGGAACTAAAGAAAACAAATGACTCAAGATATCAAAGTGAGCATTG
CTAGCCACGATATCAATTTCAAGAAGAGCTATTCACCTTTTGACTAGCCCAGCAATCGGC
TGGAACCTACCTACATGATTCACCCTCCCTCTTTTACCCTGGGAATGCCCTCTTTCAGCA
AAGCCCAAATACAATTGTATGTTTCCCTAAACATTGTGAATATTCGCAAGTTGAACACCA
GAGAAGCTATTTTCCTTCTGGTTAGCTTCCTCCTCATGCGTCCGATTTGTAAACTGCAAA
TGGTGATATTTTTTCCTCAGAAGCACTGTCTTCTGCTCTGCTCTCAGGGTTTCTTTCTCT
TTTCATGGTCCCATTTCCTGTTTGCTTTCGGGCCACTGTACCCTGCCATCCACAGGCCAA
CAGCTCCGCAGGCTTATCTCCTAACCATATCCCATGGACCCTGCTTAACTCAGGGGAACT
AATACATGCTAAGTTCTTGATCTGTGGTCTCTGAACCAAGAGCATCAGTATCACCTGGGA
ACTTGGGAGAAGGCAAATTTGGGGGCCCTACCCTTGAAGAATTGGAAACTCTGAGCATGG
GCGCCAGCAATCTTTGTTTCGGTAAAGTGCTCCAGGTTTTTCTCATGCTTACCATAGTAC
TGTCAATGATATTAAGTGAATGTTTATGTTTTAATAGGGGAAAATAACTTCATGCAAAGA
AATGCACTTTTAATAGTGGAATTTCAGTTTAACAACAACAAAGGGAAATTATTCTAGAGT
CTCTCAGATTACACCTCTAAGTAATTCCACCTGTGCATAACATGGGTGATGATTTGAGTC
CAAATAAATAATTTGAAGTTGCAAATAAATCATATGGTAGGCAAGTAAGGGTGTATATAG
TTACAGAGAATGAGGATGGAAAAGATTTATTTTCAGTTTGTTAAAAATGATGTAGGGAAG
AGACTAGAATGAAATTTGCCACTTTATTGCAAACATGGGCAAGCTTTATTTTTTCCTATT
CTTTTTTGCATTTGACCTTGAATAATTATGAGACTGGCTACAAAGCCGATAAAAATTAAA
GGTCATCTTTCTACAGAGGAATTTTTATGCAGTAGCTTTAATGTTGACCTTAAATTGGTC
TCGATTCCAGACTGCATCCTGTTATTAACTTTCTTTGTGGTTTTATGTAAATGAATTAAT
TTCACCCCTTGATTTCTCCTTCAGTTGTAGATATTTTCAATCTATGGGTATAGATGGGAA
TGGAGAATGTTGATGAAAACTACTGAGAAATGTTTTTATAATAACTTACTCTTTCTAAGA
TACGATCACGAATAGCCATGTGCACATTATTCTGATGTATCTAAAACATGTTTTCTCTTT
TGTGTTTTTATGCAGATACTTCTTATTAACAGAAGTTAGGCTATCTAGGCAGCCCTGAGA
TTGCATGAATTATTCTATACAAGCTCTCATTGCAGTCAAGAGTATAGGCAATATTTTCAG
TCCTGGGTGTGTATTGTACTGGTTATTAAGAACGAAATGCAATGCCAATGGCTGATTGTT
TTGTGGGAACCAATGCCCTCTCCCTTTTTGTGAGAATGGTGTGGTGGCACACAGTAGGCT
TATGAATTGCATAATTTAATACTTTATTAAAATAAAAGCCCAAATAAAGAGAAGGGATGT
AGTTAATCTTTAGTTAAGAATGTGAGTGACATTTGGCTCTGGGAAGACACGTTGAAGGGA
GAAGAAAAAAGATGACCCTCAAATATTTCACATTGACTCTGCAGAGTTCAATTTGACACT
GATTTGATTGCACCCCCCCGCCCCCCACTTCTAAAAGGGTCTTTGGAATTAAAAGGCAGC
TTGAAGAGTAGGAAGAATGAGAAAACACCAAGTTTCCCAGAAGTTGGCAAGATGTTGACT
AGGACCCTGCGATTGCCTGTAATGTCTCAGATGGAGTTCTAATCCAGCAACTTCACTAGG
GCACTTAGAGCAGCTGAACAAATCTAACTTTATGTCTGATCTATCTCACGGCACAATCAT
TCTTCTTTTATTGCATTTAACATTTTCCATCAAATTCTCTCAAAGCACCAAGTAAATATT
TATTAATCTTCCCAACCTCTGATAAAAATGAGACATACAAAAAAAGTATTTTAGTCATCT
CTGGTTGGTGGATGGGTGTGCTAGGAGGGAATTTAATGACCTCCTGCACTTCAAGCCCTC
AGTTCTAACTACTCTACAGTGCTATCTTATGATAACATAGGCAGTGTGCGATAGGAGAGA
GAATCTGACTTCAAAGTCAGAAAGATCTGGTTCTCCATCTCAGACCAACCACTTAATTAA
CCTTGTAGCATTGGGCAAATTAACCTTCCTTAACATCAGTTTCTTCATCTGTGAAATGGG
CCTAGAATTAGTAGCTTAATGGAAACATTTAAAAATGCTGTGCTCGCTGGCAAGCCCTCA
ACAACTTAAGTAAAAGTTATGATAATTCTTTCATCTTTCATTTTATGCATTATGTTAGGT
GAAGAGGAAATGCCCACAAATTCTGTCCTGGGGCATGGGACATTTACTGCTTTCAGTAGA
ATTTCTCAGTTGTGTCTAGGTTGTAGTCTTGAATCCACTTTTGTAACTCCTATGACAGGG
CATCACAATGAAAAAAAAAGTTAATTTTTATCTAGGATATATATATTTCTTTTTCTGTGG
TCAAGCTCTTAGCCAGATCTTTCCCAAGATTCCTTTGAAAGTCCTGAAAGAATTCATTTA
CGGGAAACGGACTTATCCCAGTGGTTAGGGTGTCCGTCTACCACATGGGAGGTCCACGGT
TCAAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGCGCAGTGCTGATGCGCGC
AAGGAGTGCCCTGCCATGCAGGGGTGTCCCCGCGTAGGGGAGCCCCACGCGCAGGGAGTA
CACCCGTAAGGAGAGCCACCCAGCGCGAAAGAAAGTGCAGCCTGCTCAGGAATGGCGCCG
CCCACACTTCCCCTGCCGCTGATGACAACAGAAGCGGACAAAGAAACAAGACGCAGCAAA
TAGACACAGAGAACAGACAACCGGGGGAGGGGGGGGAATTAAATAAATAAATAAGTCTTT
AAAAAAAAATTCATTTAGTATTTACAATTGATTGCCTCATTTTTTCCCCCAAATTAAAAA
AAAAACTTTTTTAAGGTTAAGCAACATTTAGAATTAAGCTCTGTTTATACAGCTTATTGA
AAAGAAAAACAAGCCAACAGACAACTCCTGCTGTGTGCGGCACTCTCCCAGTGTCACTCC
ATCCATCCCTGGACCAGGGGCTCACTTCCTGTAGTCTCCTTTGCTGGGACCCCTGGGATC
TGGCCACTGCCTAGCCCTCTCTTGCTCTCTTCTGATCCCTACCCTGCCTTGTCCATTCCA
GCTGCTTCCCATTCATTTCCTGGCTTCATAGCTGCAGAGGGCTTGGGAATTCTTTCTGAG
CCAGGCAGTGATCAGCATTCCTACCAGCTGTCAGTTTTCCTGCCAAATGGGAGTCTTCCT
CTTGCAGCACACCCCCACCTGTCTGCAGCTGTATGGCTTCTGGACGTGTCCATGGCTGCC
AGAGCTCAGAACATGTGTGACATGACCTGAGCCAAAATCCTGCATAGGGCTGTAGGAGAC
TCCACCAACCCCATACCTCACTGGGAGTGATGGAAGCTCGCCTGCCCAGCTCCCATCCCA
ATCTATGAAGAAGCATCATCTAAGCAGATTTCTATACATTCCTGTCCTGCCCTCTTCCCA
TATTCCCCAAAGAGAGCACTAAGGAAGGGCAGCAGACTTTGGGACCAGCTAACCAGGGTT
AAATCATGGAAAACACAAAAGGTCCAGACAAGAAATAGGGGCCAAGATTAGCTTCAGGTG
ACTGACAACAAACAAGACTGGCTGAACATTCACCCCTGGGGATAAGTGAAGAGGCCATAG
CCTGTTGGAATTTTTTTGTACCTCTGTAGGCATTTTCATTTTGCACAGTGCCTGAAGTTC
TAGTTCCCGGCCCAACATCCTCTTTCCAGTAAAAGCTGGGCGTGGTGCAGCATTTTCCAA
TGTGTTCCGTGGAACACAAGTCCCCTGAGAAGCTCCTTGAGGAAAGGTTTCCATGGTTGA
ATAACATTTTGCAAAGCTGCACACTGTAGCTTGCTCAAGAAGACTTACTGAGCGCATTAC
TATATTAGAGGCTCTTGGAAGTTCTGCTTTACCCCGAAGCTGCTAAAGTTATGGAGCACA
GAACACTTTTGTCAAGTAACACCTAATAACAACTAGTAAAATTAATGTTCAGTGGCCATG
CTGTTCCTTAAAGCCGCCAAGTACACATACCCACCTCAGGGCCTTTGTCTTGCTGCTCCT
TTTGCTGGAACGCTCTTTCCACATGACTTACTGCCTCACCAGGTCTCTGCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTACTTATTTTTTTAAAAT
ATCTATTGTGTTTTCTGCAGCTGCTTTTATTTTATTTATTTTTTTAAATTTTTTTTTAAA
TTTTTTTATTTTTTATGGACTTTGTAATAATATTACATTAAAAATATATATGTGAGGTCC
CATTCAACCCCACCCCCCCCACCCCCCCCTCTCCCCCCCCCCAACAACACTCGTTCCCAT
CATCATGACACATCCATTGGATTTGGTAAGTACATCTTTGGGCACCTCTGCACCTCATAT
ACATTGGTTCACATCATGGCCCATACTCTCCTCTATTCCATCATGTAGGCCCTGTGAGGA
TTTACAATGTCCGGTGAAGCACCATCCAGGGCAGCTCCATGTCCCGAAGACGCCTCCACC
TCTCATCTCTTCCTGCCTTTCCCCATACCCTTTGTCCATTATGTCCACTTTTCCCAATCC
AATGCCACCTCTTCTATGTGGACACTGGATTGGTTGTGTCCATTGCACCTTTATGTCAAG
AGGAGGCTCAGATTCCACCTGGATGCTGGATGCAATCCTCCCATTTTCAGTTGTAATCAC
TCTAGGCTCCATGGTGTGGTGGTTGTCCTTCTTCACCTCCATCTTAGCTGAGTGTGGTAA
GTCCAATAAATCAGATTGTAGGTGCTGGAGTCTGTTGAGGCTCAGGATCTGGCTATCACA
TTGTCAGTCCAGAGATTCAAATCCCCTAAATATATCTTAAACCCCAACATTAACTGCACC
TCCAGCACATTTCTGCAGCTGCTTTTTAAAAAAAATAATTTTTATTAGACAGGTAGTGAA
CTTACAAAACAATCATGCACGTGTGTGGAATTCCCATAGAAAACCGCTCCACCAACACAC
TACATTGTTGTGGAATATTTGTTACAGATTATGAGATAATATCATACTATTATCACTAAC
TGTGGTCTATAGCATACATTTGGTATATTTTTTCTATATACCCCTATTAACACAGTACAT
CTTTGGCATTGATGCAAGAATATTACAGCCCTGTTGTTATGTATAGCCCATAGATTACAT
TAATTGTGGTTTTCCCATGCTTCTCCACATTCTTACCACCTTGCAATAGTAATGTACATT
TATTCTAGTTCGTAGAAGGACATTCTTGCTTTTATACTATTAACCACAATTCTCATCCAC
CTCTGGATTCACTATGTTAATCAGACCCTAGATAATTCTCTAGATTTCTTTCAATTGATG
TTTACATCCTTAGACTACCCTGTCCAGTCGCAATCACATTTATAAATCTGTTGTGTAAGT
TCTACTCACTATAATGTGTTATCAACTTTATCCATTTCCACAATTTTACAGTCAAGTTAA
TTAAAACATCTACATATATTAAGCAACAGAACTCCTTTCAGTCCAATTCTTATTTCCTAA
TAACCTATACTCTAGGTTTTAACTCCATGTATTTATTCTTCTTATTTTGTTCATATTAGT
GATACCATGCAATATTTGCCATTTTGTGTTTGGCTTACTTCACTTAACATAATGTCTTCC
AGGTTCATCCTTGTTATCATATGTGTCCCAATTTCATTTCTTCTTACAGCAGCATAGTAT
TGCATCATATGTACATATTTTGTTTATTCATTCATTAGTTGATGGACACTTAGCTTGTTT
CCATTTTTTGGCATTGTGAATAATGATGCTATGAACATCAGTGTGCAGATGTCTGTTTGC
ATTGCAGTTTTCAGTTTCTTCAGGATATATTTCTAGTAGAGGAATTGCTGGGTCATACTA
CAGTTCTTTATTTAGCTTCCTGAGGACTGACGAAATTGTTCTCCCAGATAGGGCTGCACC
ATTATACAAGTCGCACCAACAGATGAAGGAGTGTTCCTATTTCTCCATATCCTCTCCAGC
AACTTACTGTTTTCTGTATATTTAGTAATGACTATTATGTGCAGCAGAGATGATATCTCA
TTGTCATTTAGATTCCCATTTCCCTTATAACTAGTGATATGGAACATTTTTTTATGTGCT
TTTGCCTGTTTGTATTTCCCCTTTGGAGAAATGTCTATTTAAGTCTTTTGCCCATTTTTT
AATTGGGATGACTTGCTCTTTTATTGTTGTGTTGTATGATCTCATTATATAGAATGGAAA
TCCAACTCTTATCGGATATGTGATGTAGCAGTTTGATATTATTTATGAACTCCAAAAGTA
TATTGGATTATATTTGTAAGCTGGTCTGTCCCTCTGGATATATTAGATTATATTGGATTC
AGAGGTTTACTTGATTAAATAATGATTAAGGCATACATTGGGCCACGTCAGTAGGATGTT
GTGTCTCCGCCCCCTTGGTGGAGATAAGGCAAAGGACCAAGTTGGGAATTTTTAAGCTGG
AGCTGGAGAAGTGAACATACAGGAGAAGCACACAGGAATAGAGATGACTCCTTAGACACA
GCAGAAGCCCCAGGGAGAGAGACAGAGCCTAATAGTCTATATCTGGCCTTTTGGAGAGAG
CACACAGCTGAGCCCGGAGAGAAATGGAGCCCCAGGAAGAGAGGATCCCAAGAAGCCTGA
ACTCTTAGCAGACATCAGCAGCCATCTTGCCCTAACACATGGCAATAGCCTATGGTGACG
GAAGTAACTTATGCTTTATGGCCTGGTAACTGTAAGCTTCTACAAGCAAATAAATATCCT
TTACCAAGGCCAACAGATTTCTGGTATGGTGCATCAGCACCCCTTTGGCTGACTAAAACA
TGTGATTCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAGGCTTCCCAAAGAGTATTTTCTCTGTTAAGAATG
TCCCAAAGCAACAATGACACGATGCCTTGAAATAAAAAGTTATAATTTTCTATTGTCTAG
CCCAGAACAAGAGTACTCTGCGAACCATCCCATAACCAGTGGTGACTTATAAACAATCAA
AGTGGGTAATAATAATACTAGCTAACATTTATATAGCACTTACCATGTGCTAAGCACCAA
GTAATTTGCATTAACACATTTAATCCTCATTCTACCCCCATTTTACAGGTGAGGATATCA
GGCACAGAGAGGATAAAAAAAATTGGCAAAGTTCATGCAAGAATGCATGTGGCAGAGCCT
AGATTCAAACAAGGCAATGGCTCCAGAATGATTATTTTAATGTAATGTTTCTTCCTTCTA
CTAAAAGGAACAATGACATTGGTTGCTAAAAGATGCTTTGCAATATCTCTGGCCATTATA
GTTATAATTTTTTAATTCAGAGAAATTGGTGAGCTAGGGCCTTTTAAAGGCGTTAGCCAA
GGGACACTTGGAAGCTAAGTGAATTGCACCATAGAACAAACACGTTTTTTTCCTACATCA
GTTACCGACTATTTTATATGAGAGAAATAGTACGAAACATATTGCTCTTTATTGTCTTGT
GACTGGCATTCAATTTTGACTCAAAAGATTTTTTAAATTACAGTATTAAGCTTATATACT
AGAGGTGGTATGTTCATCCTTAGAAATTTAAAATATACTTTTTTCCTTTCAAGGAAGTGG
GAATTTTGTTCATACTTGATGTTACAATCATAAAAGCCATTTTCAAATTAAAAATTTCCT
TCATCTTTATTTTTTGAAATCTTTATAAGTACCAGAGCATATTGGCTGAAGGGATGGTCA
TCTGATCCCATGGCTTGCTTTTCTAAGCCTCAGATTCGCGTCTATGTTTTAGTCTGCTAA
AGATTCTGGAGGTAATATACCAGTAATGGGCTGGATTTTAACAATGGGAATTTATTAGAT
TAAAAGCTTACAGTTTCAAGACTGAGAAAAATGTCCAAATCCAGTCATCATCAAGCAATG
CTTTCTCCACAGTAAGATAAAGTGTAAGAAGTGCGTAGCACAGGGCCTGGTCTATAGTAA
GATCTTATTAAATGATAATTACTACTACTGTGTTTAAATTTTCTGTCTGTATTGTAGGTC
TAGATAATTTAACAGTGAAATTTATGGCATAAAACTATTTTATTTTTAATGATATTTTTA
TCGCTTCCCTCTTCTTAGGTCATATTCTGTTAAGAGAATGAAATAAATATTAGTTTTACT
GTACATGATACTTTATTAATTATGCATTTAAAAAATAAAGTTTGGAAAGACAAATTTGGT
CTTTTTCCAATGGTCCTGTTATAAAAGGGCTATTAAAATAATGCATAAGAGAATAATATT
CATTCATTATTAATACCTGGTAGCAGTGATTACATCAGCTCAGTCTGGTCATTGATCAGC
CCTCAGAAACCTCACTTCAACAAGATCTCAAGAGCAGACACAGCAAAGGAAGGCAAAGAG
CATGCTCTGCTGTGTCTCAGATCTGCTCATCAGTGGTTCCTCCTCCTGTATCTCAGTTCT
TCTTCTCCCCTAGCCCATTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCT
GCCATAGTCCCATGCTGTGAGTTCGTGACAGTACAGCAGATAGAACTCAGGTTTTGTGAC
CACCATCCTCTTTTAATAATTCTTACTGCCTCTTCACATCTGAATCAAGCTCTGTATGTT
CACCACCTTCCCATCCAGACTTGCCCCATAGTATATTCTCCTGTTTACTGACCATTTTAT
GCTAAAATTGTGTTACTATTTTCTCTACTAGTTAGCCATTTTTGATCCCTTTCTCTTCCT
TGCTCTCTGTTTTGGTTTGCCAAAGGGCTGCTGATGAAAAGTACCAGAAATGTATTGACT
TTTGTAAAGGGTATTTATTTGGGGGTCATATCTCACAGTTGCAAGGCTGTGAAAAGTTCA
ACTCAAGGTACCAAAGTCAGCTACTGTTGATTCTGGTGTTGCTGCCACATGATGAAGCAA
GATGGCCACCAATCTATGTGGAGGTCTCTGCCTTCTGTTCCAGAATCTACTACCTCTTGG
AGCTCAGCTTCGAGCAACCAGACATAGGGTTTTCTCTTTCTTGGCCTCCTATTTCAGTCT
GGGCTATTCTGCTCTCTTCCCAACTTCAACTATCAGGCATATAGCAGAGCTGGTCTCCTT
TTGACTTACTCCATGGGTCAGTCCTCTTCGGGGCTTTGTGCTCAGGCAATCCTCTCTCAC
ATACTGCAGAAACAAATATGCCTTATTTCCTCTGTCTGAGTGAGTCCATTTATATCAGAC
CCAGCAAGGGGGCAGGGACTCAACATGAACCATGTGCCACTGACGTCGTCCAGTCAAATG
GGTCTCACACCCAAGGGAATGGATTAGTTTAGTTTAAAACATGATATCTTGCTTTTCGGG
ATTCACAAAATTCAATTTGTCACACTCTCCATAACAATTCACTTTCCAAATTTTATTTAA
TCTCTCCATAAAATCTCTTATATTCATCCTTTACTTTCCATTATGATGGTTTTCTCTATA
TCAGGCCTAAATTATGTATGAATTGGATTATTACAATAGCCTACTAATTGCTCTTCCTGA
CTCCAGTCTCCTTCCAATTCTTATTTACTCTTTAGATCATTGGCATATTCATCTTACTGA
AACATTCTAAAGCATTCACTCCCTTTTGGTAAAATGGAAGAAGGGCGCTCAGTATGACTA
AGCAGTACTTTTTTTTTTTTTTTTAATAAGAGGGATGAATTGCTATTTCAAAGTTGTTAG
TAGTTTCTATTGCCAGTGTTGGAATTTTCAAGTTTCCTTGGAGCAGATAGCATATTAACC
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATGGGAAAAGATACC
AGCAAAAACTAATTAAAAGAAAACTGTTCTGGTTATAATAATATCAGATAACACATAATA
CTTTAAGGCAAAAAAGTATTATTAAGGATGAAAAGGATTACTACATGATGATAGAAGAAA
AAGAGACTCTGAATATATAACACTCCTAAACTTGTATGTAACTAATAACATAATTTAAAA
ATACATAAAGCAAAATTGATAAAATAACAAGGAAAAATTGATAAATCCACAATCAGAATG
GGAGACTGTCTTTCCATAAACAATCGAGCAAGCAGACCAAAATTAGTAAGAATATAGACA
ATTTTGACATCACAATTAACAGGCTGGTTATATAATCCGGTGTAGAATTATATACCAATT
ATAGTTCCAAAGCAAGTCTTAATAAATATCTAAAAATCTAATGTAATCACTTTTTCTGAC
TATAATGGAATTACTTTAGAAACCATTAACAATAAATTAACCCCCACTCATTCATTTGGG
AATCAAAAAATATATTTTTTATATATAATACATCATGAAGGAAATAATATTTATAACCAA
ACAATAAAGAAATATAGTACATTAAAATTTGTGAGATGCAGCCAAAGTCATACTTAAAGG
ATAGTTTTACATACATTGGTATATAACTGGAAATGCATAGACTTAGCAGCTAACTCAAGA
AGTTAAATAAAAAGGGAGTAAACCCAGAGAAAGTGGAAGGAAGGAAATATTGCAGAACAT
ACATTAATGAAATAGAAATTCAGGAAACAGTTCCACAAAACTAAAAGCTGGTTCCTTTGG
AAATTGATCAAGTATAAAAGGGAGAAAACACAGATAACAAAATCAGGAATAAAAAGAACA
CAGTTCTAGATAGATTTCAAAAATAACAGGACAGTACAATGAATAACTTTATGACAATAA
ATTTGAAAACCTACAAAATGAATATATTCCTGTTCTTTCAGTCTGTTTTAGTGGGTGAAA
CCCTTAAACCACTTAGCTATCCTGAAAACTTCCTAGCTTCCTGACATTTAATACATGCTT
ACTGTATGCCAGGTACTCTCCTCAGTGCTTTTTCCTGTATTATCTCATTGAATCCTCACA
ATTCTATGAGGTAGGGACTGTTTTCCCCATTCTGAAGTTGAGACAACTGAGATGTGACGG
GGTTTACTAACAGTCCTGATTATTCCGGTTAAGAAGCAGCAGAATTGAGATCAGAACCCA
GGCAGTGACTTCAGAGGCCACACCCTTTACTCTTCTGCCTTCCATAAATAGGTTGGAAGT
GACTGTAGAATGCGTCTTTGCTGGAGAGATTTATAGGTGATGGTCCTTAGTCTGATTTAA
ATATGTTAGCATCATTGTAAGTTTTGAATTACATTGTTCCCTGCCCTAGAAAGCAGTTAA
GAGAATGTAAGTTCCAGTCTTTTTTCTTTCTTTCTTTTTTTTTTTTTGATATTTTAACAG
ATAGTTACATTTTATTTTCCTTCTTTAAGAGAAAAACACTTTAATAGACATAACTTTGAA
GATATTAGTTTCCATCAGAGAAACTTTAGAAGACTCACATTGTTTTCCATCTATTATCAA
ATACAATGAAGTCACGCTTTTATTTCATACAGCATTAAAAAGCCCTTTTTTAATATTCTG
TAGTTAGCCTCATAGTTTCCTCTGAGAAGTAAAGATTTTGTTGCTGCTGTGATGATTCAC
AGTTCCAGCCTTGACTTTTCCACTGACTGTGTGAGTTTATTTAGCCTGGTTTGGGTGTTT
CAGCTGTTAAAGGAAGAAATTAAACTAGACATTTTTCTGTATTCTGACTAGCTCAATAAA
TTCTCTTATTCTGTACTCTACCATGATTAAAGGTGATAGCAACTTTATTGTCCAGTCATC
TAGAACCTACTATTCCTAATGAATAAAGAGGGTACGAATGTATTTATACTAAGTGTCCTC
TTTTGCTGTATTTGTTATTTTAATTGTTCCAAAATTTATGTCTGACTACTGGCTCTTGCC
ATCCTCAAGTATATATGTTGTGTGCTTAATTTTAAGGGGGGGACTTTTCCTATATGGCCT
GTGCTGGTCACAAATAAAATAAACCTCACACAGGCTAGGCACTAAAAATATTTCATAATA
ATGCTTTCTCCATTCACTCATTGAAATAGGTAATTACTGTGGCAACAACTAATTTGAAGT
GTTAGCTATTAATTAAAACACTGCAGAGGTGTGTAAGTTGTCTTTTGGTGTAACCAGAGC
CTCCATTCAAACTTCATTAATCACTTTCCAGTTACTGTGTAGTGGGATGGTCAGGACAAC
TGAGATGTAGTAGTCCTTCACAGTAAACAAATTCCTTTTCTCCAGGCAAAATGCCATTTG
CCAAAGTTAAGGGACACATTGGTCTCATATGCCTGGCTTTGCCTTTGTCATCCACTTCTT
GATGATTAAATGTTAAATTGGTACTGTCATTGCACTGTAAAGCAAACACATATCTCTCTA
TTGCTCGAAATCGAACTCAAACTTTCCACGGATGAATTAGCATGCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
AGATTTATTTTTTATTTATTTCTCCCCCCGCCCCCTCCCCCATGTTGTCTGCTCTGTGTC
CATTCACTGTGTGTTCTTCTGTGACCACTTCTATCCTTATCAGCAGCACCGGGAATCTGT
GTTTCTTTTTGTTGCGTCATCTTGTTGTGTCAGCTCTCCGTGTGTGTGGCGCCATTCTTG
GGCAGGCTGCACCCAAGTAGAAATTTGAAACCAGTAAAAATATTTTGCAGCTACTTGCTG
GACAGTTTTGGGTGGAGGTTCCTGAGAAGCTTACTTCCGTTCCCCCATATCTTCCTTATC
CCACTCCCATCTTAACACTAGCTGGGTGACAGGAAGAACAATCTGATTTTGGTTAATGTG
AAAAATCCTCTGTGGGACAAGATTTTTATTCTTCTAAATTAATTTGCTTCTTTATAATTT
TGTGGGTTTCTAAGAACAGTGCTTGTTTATGTTGTGTAGTTTGTTTTGAAACTTTTATAT
AAACCAAATTATTTCTGGACAATGATCAGAATGGGCATTTACTGTAGTATGTATGTAAAA
GGCCACAGAAGATCTTGATAAGAAGTGATGGTATTTTATTTCTGCAGACCCAATCTGTAT
TTCTTTCTCATAAATGAATGTTTTCATATTCTTTGATTAAATTTGTAATTATTTCAATGT
ATCTGATCATAAGAACTTGTCTCTTTTCTGAAGCTTTTTAAACTACTGAGTGATGCTGGC
TTTAGGGAAAGATGAGCCACATGCATGTTTATAATTCTGTGGTTTCTCATATGAAATTAT
ATCTTAAGCCATGGCTCATTACTCAGGTTTTGAGATTATTTTGATGAAATGTAAGGATAT
AATTTATCTGCATATGTAACTGAAAGAAACAAAAGCAAATTCTATTTTTATGGCTGTGTA
CAGTGCTTAGTATAGGGCTATAGAGGACCCCTGCACACAAAAAGGTGGCATTACCTCAGA
ATGCTATTGTAAGTTAATCTATAATGAAGCACTTTGTAAACCATTAAGCATAATAGAAAT
GTAACTTACTATTGTTATTAGTGATATTTGAAAGTGCCATGTATTCCATTGCTATAGAAA
AGTTTGGATTTACAAAGTTTAGATTACATACGGCCTTAACCATGTTTTAAGTTGTTTAGA
ATTTTGTGATTTTGTTGTTTCTTTTCTTCTCACAGAGCATATCATGTCCCGAGTGGAAAA
ATATTAGCTGTAAAGGTAAGTGTTAAATACATTTTATGAAATTGCTGAATCTTACTGTTA
TCTCTTCCTCCTGTTAGCTTGAGTCACAGGTATGTCAAAAAGGAGGTGAATGAGTTTAAG
GTTTAGGTGATAGGTAGAAGCTATGGCTCTGTTGTTACGTAAAGGCACCTAAACATGTTT
TAAGTATGCCTTAAAGTGGTGAGTTATTTACTCCTTACATTGTAAATTTTCTCATCATTA
TTGACCTACACTCCTTCTGTGTTCTCTGTTGAGTGGCATCACTGGCTCCCTGTCACACAC
TCAAAACCTTAGTAGTCTTTCATTCCTTTTTCTTCTTTACCCACTACATACTTTAAGTAT
CCCTTTGTCATTTTCTATCTATTCTTATCCCCACTGCCACTGCCTTAGATCAGGTCACTT
TACCTCCTACCTGGACTATTGAAATAGCTTCCTCACTATACCTTCAATCTTTTTCTTCTC
CTATGCACCTTTTATGCTGCAACCAGAGTTGAGAAGTCAGATCACAGGTCCGGCCTACTC
TCTCTGTCCCCCTCTCTTCAGTCCCCAGTCATGTACAATATAAAGCCAAAGATGTCTGCC
TTGCTTCTGACCCTTTATGGTCTCCTGAAATGCTTAAACAACCACAATCATCAATAGAGT
CAAACTGTACATAGCTGAGGGTTGGTCTCAGCAATTGCCTAAGGTACTCCTCACTTGTTT
CCATCCTTCTCATAATCCATACCCCATTTCCACCAAACTCCAAGATTCTAGACTTTCCAT
ATCACTTTGGATTTAATCTCTTATGCTGGTTTTTGATACTTGATTTTACCATTGTTTTAG
TTATTCATTTATTTTTAAAATGTACTTTTTAATTTTTTTGAAAAGATACTTAGATTATAT
AAATGTCACATAAAAAATATAGGGGATTCCCATAAGCCCCATTCCCTATCCCTCCCATAT
TTTTCCACATTAATATCCTTCATTAGTGTGATACATTTGTTTCAATTGATGAATACATTT
TGGAGCATTGCCACTAAGTGTGGATTATAGTTTACATTGTAATTTACATTCTCTCCCGTA
CATTTTTGTAAGTTTTTACAGGATATATAATGGCACGTATCTATTATTGCACTCGAGTGT
CTGCGCGGTGAGCCGAATGACCACAAGGCGAGCCAAGTGCCCATGTGGGTGCCTGCATGG
CAAGCCAAGTGCCTTTGTGAGTGCTCACATGGTGAACCAGTGTCCATGTGGCCAGCCAGT
GCCCGCACAGTGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCC
GTTCCACCCCACCCCCCCCCACCCCCCAGTATCATCTTCCTCTCTTGTCACCCCTCTGAT
CCAGAAGCTTATTTTTGTCCCTTGTCAGATGTGTTGGTCAGCTTTTGAAGTATTCTTTCA
GTAAATAGGAGCTACTACTTACTGATCATTTATACTGTCCTAAGCTCTTCACACACATTT
TCCTCATCTAATCCTGTTAACTTTTTTGCAGTAGTTATCATTTTAATCACGATTTTACAG
GTGGAGAAGTTGAGGCACAGGGAAGTTAAATATCTTGCCCAAGGTCCCAAAGCAAATAAG
TAGTGGAGCCAGGAATTGAACCAGGCAACCTCACTTCCAACTCCCTTCTTTTAACCTCTC
TCCTATATTGCTGCTCACTACCCTCAGATTTGGCTTCTAAAGCATAGTCTGGTCATATCT
CTTTCCATCTCAATGGTTTTCATTGGCTCCACATTACTTCCCAAATAAACTAAAAACTTT
ATAGAATGGAACTCATTCTTTTTTTCAGTTGAACTCATTTGCCTTATCTGAATCCAGGTA
CTTTCTCACTGCAACACTTAGCTTCATTTATCTCTCTAATTAGAATACCTTCAGCCATGT
CTCTGCCTATCAAAATCCTTAATATTCTTCAAGGGTCAGCTCAAAATGCTCCTCCTCCAT
TGAACTTACCTGGGTAAATCCTGTCACAATATTGTTTCCCTCTCTCTTTTTCTCTTTTTT
TCACACTCACACTATCTTACCCTGTGTCTTAGGTTGCCAAAGTGCTACCAATGCAAAGTA
CTAGAAATAGGTTGGCTTTTATAATGGGTAAAAGCTTTCAGTTCTGAAGCTGTGAAACGT
CCAAATCAAAACACCTTCAGAGATGCTTTCTCACCAAGTCAGATATTGGTGATCCTGGGG
TCTTGCCATATGGCAGATCAAGATGGTGACCAATCTCTGCTGAGGTCCTTGTCTTCCCCT
CGGGGCTTACTATCTCATGGAGCCCAGTTGTGGGTGACCAGGTATAAGGCTTGTCTCTTT
CTGGGCCTCTCTCAGTATCAGCTACTCTGCTTTCTTTCTAAGTTCAGCTGTGGGCTATCA
GGCATATGGCTCATCTTTTCAGCTTTGAGCTTTTCCATGAGCCTAGCCTCTTAGGGGGCT
TCCTCACAAGGCTGGGTCAAAATGGCGGCTTCCTTTTTCTGTGTCTCTCAGTTTATTTAA
AGTGCCAGTAAGAGGGCAAAGACCCAACATGAGTCACACCTCACTGATGTAATCCAATCA
GAAGGGCTCCACACCCCACAGGAATGGATTAGTTCAAGAACATTATTATTTTTTGTTTTG
GGGATTCATAAAAGAACTTCAAACTGTCTTACTCTGTCATTTGAATATCTCTAGAATTCT
GTGTGTCTCTTACCATATGCTGCCTTTTATTTCATTATTAGTATACATGTTCATCTATTG
AAACCTTTTTGTAAGTGTGGGGAACGTATTATCCTCTTGTTTTACTCATTGATTTGTACA
TATTCTTATATATAGGGCCTAATACAGAGCACTAAATATTACGACTTGACTAGATACTCA
ACATATAATTTGTTGAATGAATGCATAAATTTTTTGTCTTTCATTTATTCTTTATGTCAT
TCATTCATCTTTTGAAGTAACATCTTGAAAGCAAGTTCAGCTCATATACAAAATATCCCA
TAGTGTTCTTTGTATGGACCATTGATCTCACCCAGAATATTTCTTAGCCTTTTTTATATT
AAAGGGTGAAATGAAAGGTTAAGAGTTAGAAGCACATTACGTCTTTTCCTGACCCTCCCC
TGACTTTTGTGTGACTTCAAGCATGTCACTTGAACCTCCCTGTGACCTCAGCTGTGAAAC
CAGGCTGCCTGGTGTCACAGCGGGATTGTGAAGAGCAGCAAATCACAGTTCTTGTCCAAA
CAGAATCACCTGCAGGGTTTGATGCCTGTATAGAATGATGAGTGAAATTTAATTTTCCAA
GTCAAGTGACCAGTTGGAACCACACTTTCAATGTCTGTTGGAACAATTAGATGAGAGTCC
TCAAAAAGCTTTACTTTCCTCTTTCCTACTCAAAATATTTCTAATTTTTTATATTTTCTA
AATGTCCTTTTAAAAAAATGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTGGAAAATATGTTCATTTAAGATATTGTCTTTAAAGCAAATTGAATTTGGGGGAG
AATAAAGTACCTTGAATTTTATACCACTGAATTTAGAAAAAAAATTTGCCTCAAAAAGAG
CATTTTGAAAATGATGCCAATCACATTGTAAAGATAATTATTTATAATGACTATATGTAA
CTCATATAAAGTATTTCTAACTACTTTTTATTTTGGGGTGGTGGTGATATAGGTAGGCAA
GACAATTGCAAATAAGTAGAACAGAAACAAATAATACTGTTAGCCATCTTGCAAATAGAA
CCATTTTATGCTATTAATGTATTCTATAAAATCTTTCGAATAGAAATGCTTGGAGGATTT
AATAGATTTCTCAGTATTGTTATTTTTTAATTGGGAAAAAGTCCATCTAACAGGAAAATT
CTTAGCTGTATATAGCATGTGCTGATTATCATTCTTTGACTGCTTTGGGTTTCTACTCCC
TTTAAACTAGCATTTAAATGGACCATTTGATTAATCATTTGTATACTGACTGTAATCCTC
CCAAATTTCCTTTCTGAGTTGTACATACTGTAAAAGACAATTATGTCGCCGCAGATTAAA
TAAGTGAATTAAAACAGAATAGCGGCTTAATTTGACCTGTGATTTTGCTCCCTTTCCCTT
TAGTGGAGCGTATGCCACTCTAGCAAATAAATGAAGTCATCCATGACAGCTTGTGATGAA
TTGCCGTATTTATACTGTATATTTTAATAGCCTCACACTAATTTAAATTGAGCACAGAGT
AAATTATAATTCAGTCACTTGACTGCTTATATTTAACTTGACAACTCATCCTTATTTGTC
CTGGAGGTGTAGTGGAGAACAGTGGAAATGCACTCAGGTATTTCAGTTTTTCACTTAACC
CTTTCTCCATGAAATGCTTCATACTCAAGTTCTCTCCAGGTTGAACAATTTAGTTCTTCC
TAAGGAGGAAAAAAAATAATGAAGACTCATTAGTCTGTAAGTTTCCTTTTTCTTTTTAAT
TTCCTTAAAAAGAAATTTATTATTTGCCATACTTTTCTCTGTTGCCTTCAAATAAAGAAT
TGGACTTGCTTATTTTCAGCAGTTTTAAAGCTCACTCGCAAGAATGCCCAGGGGAAGGAG
AATTAACCTTCCATCTATATTGCCAAGTCCCCTAGAAAACAGAAGAGCATTTCAGCAGAA
TTATTTTAAGGTAGATTATGTTTTCCCTCTCAAGTTCTCAGAAATACCTTTATTCACTTT
TCCTCCATTATGGAGTTTCACTCTGAACAATAGCAAATACTAAAAACAATCAAGACCTGT
TTGAGTATAGTGGTTTGACTCTACAATACAATATTATCTGCTACATTTTAGGTCAACATA
GCACTGTTTATATATTTTGGTGTTTATGTCTTTGGTTTTAAATTCAGTTGTGAAAAATCA
AGTAATCCATTTCCTTCCCAACATCTTCTTTGAAGGATTATGATAGAAGGGAGCACTTTA
GTAAAATTCTGTACCGCTTAATGGGTATTGATGTGAATAAGATCTTGGGGGTTCTGGGGG
TGGGGAGGTGGGGGGTAGAAAATGCACAACACTCAGTCTTCCCATGAGGAGGTCACAAGC
ACTCTGTTCTCTCGAGGCTTCTGTCTTTTGGAGAGGAGACGTGAATGCTAAGACCAGAAT
GTGATAAGGAGAGGTACAAAGAGGCAGAGCTAGAGATGAATTCTGATGGAGGGCTCTGGG
GTAGGCTTTGTTTAAAAGAGCTGGTGACATTCAACTGTGTCCTAAAAAACAGAAATTTTT
TTTATAATCAGTGATTGTGGAGTAGAAAGACAAAGCATACCCCACATGGTGTATGTGAAA
CAGTAAAAGTTATCTAATTTCACATGAGCATTGGGTTTATAGTAGGAAGTAGTGGGAGAG
TTAGAAAAACAAGTTGGAGCTAGATTGTGGAAGAATTCTAGAATTTAAACTTTATTCTAG
ATGTGGAAACCCAATTAAGGTTCTTGGTCAGTAGAATGATATATTCATAACTGGGAGTTT
TGGGTTATTCCGAGGAGTTGGCTAGCCACGTATAATAATGTTATTTCTAAATAGTAACCT
GGAGATGCAATATATATTAGCAGTCATACTAAGCAGTGAATAAATGACATTTTGCAATGT
TAAATAAATGATTCTCAACCTTACTGTGGATGAAAGTCATCTAGGGAACTTTAAGAAAAT
GCTAAGATGTGGGACCAACGCCGGAGATTCTGATTCTGTTGTTCTGGGGTCAGGCTTTTA
CGTCGAGATTTTTTTTAAGTGCCCAGGTAATTTTAATGTGAAGCCAGGCTTAAAAACCTC
TGCTTTTAGATAAATAATACCTGTATTCCTTTTATCATAGATTTTTCCAGGTGAAAGATT
CCCTGTGTTTGACGTAGTAGTGTGAATAGTTGTAATATTTATGGTAGAGAGTTGAAACAA
TGCTAGATAAATTTATTTTATTGCTAAGTTTTACACATAAACAAAAATGTTAGTGAATAT
TGGTGGTAAGTGGAGAAATGATTAAATTTTTCTCTGCAGTTTTATATTACATTTACAATT
TAGTTTAGTGAAAGCCTTTGTAAATAATTTTAAACTCTTGATAGAAACTGGCTATGCCAT
TTTTCTCCCTCACCTTCTCCTCCCCCAAATGTCAGTACTATAAAATGTGTGATTGAGAAG
TATCCCATTCTTTCTTTGCTCTATCAGCTATTTGAAATGAATAATTTTAGGGTTATTTTT
CTCCAGTATAATTGTATTTATTCAGATATAGCATAAAATGTAATTCAGTGTTGGGTGGTG
TATAATTACACTGTCATCGTACTCCTGAATGTTAAGTTTTTAATGTAGAAATGTTAGAGT
CAGAAATGTCTGCTACAAACCTTAAAAATTGTCTTCCAACTTTTAAAATTCTCATCACTG
TCTTTTTAAAATAAAAACAGGTGTCCTTGAATTGACCTCACTGAAGTGCTAGGTAAAATT
TTGAACACTTGATAGTTGTCTTTCTCAAAGAATAAGTTTCTGAAATAAACTAGAATTTAC
TCTAAGTTTATAAATAAAGCATTTTACTTCCTTCATTATGCGTCTGATACATAGCTTAAG
AAAAAGCAAATTGTCAGAATGTGCTAGAAAGCACACAGGTCGGGGAGTCAGGGGAGAGGC
TCTACCATCAAAAGGCTGCGTGGCTCCTCTAAACCTTAGATTCCTCCTCTAAAAAAGAGG
AGTTCAGTTAAATGATTTTTGAGGTTTTTACTTCAAATTCTAACATTTTATAACAATATT
AGTGAGGAATATATTACATAATTGAAAGATATAAAAAATCATATATTTTAAAAACTGTTT
TCTAATGTCTCTTATAACTAAAAACCCCACTTTAAATGTTATTTTTTCTCATCTTTCTCC
CTGCTTATCATAAGCTGGTGTCTAAATCACAAGACAGTTCTCTTTTAATTGTTTGAGGGT
CATTCCTATCTTCCTTTTCTGAAAATAATCAGTGTGGCCAAAATAGGGTGTATAAATTAA
GGATGTTAAAACTTAACTGACTTTTAAAGCCATTAATGCTGACCTCTGAGACCTGGCTCT
TTCCTTGGCCCCATCAATCACTTCTATACTACCTCCGCCAATACAAAGGGTTAGACAGAT
GTGAATACAGTTTATATTGCTGAGATTATGGTGATGGGGAGGAGAAAGAGGGATGAATAG
AGGAAAGACTTCAGTTTTTGTTTCATAGTGAGTATAGCTATATTAAATTTGAAGGAGAAT
AAATGTTTGAATATTTATGCCTTTCTATATTTAGGTCATACTACTAGATATTACACTGGA
ACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGGTAATTTTTTCTTGGAA
AAATTTATTTCTACTTGCAAACTATGTTTATATTATTGGCTTCCAGGTTTTTAAATCTTT
TTGTCTTATTTTTATTACAGTGTGATTCTTCATATATCATAGGATTTTATGGTGCATTTT
TTGTAGAAAACAGGATTTCGATATGTACAGAATTCATGGATGGTGAGTTTTCCATTTTCC
AGCTTTTTAAAATTGATTTTTGGAGTAGAGTGCTTTAAAACCTGGTTTTCCACTAGATGT
CAAGTAGAATTGAAAATAAGTAAAATATACTAATAATTACCTCTTTTATACTCAATAACC
ATCTTAGTTTTAGGAGTTACTGATGTTAAATATTTGTAGCTGAGCTATAATTTCAAGAAT
GTAGTTTCATTTTACTTTTATTGAAAATTTAAATAGAACAGATTAAATGCTAGTCTAATC
AGTTGTTTGATATTTGATTCTTCTGTACAATCTGTCTTCACTTGCAAAACAGATGTTCTG
TTCTTTTAATGTTTCAATAGTAAAAACAGATTTTCTTTTAAAGAAATCTATTAACCCAAT
GTCCTGTGTCTTTTAGAGTGAAATCAGTTCTTAATTGCAAGATAAGAAATCGTTTTTCAA
CACAGCTGTTTAGCAAAGATGTGTTTAGTTTTCTTTGGACTTTATCCCTTTCATTTCATC
TGTATTTCTTGTTGCTGTCTATTTGTGGTTCTTTCTTGAGCTGAATGTTGTGGCAAAATG
CAGATTTCATTTTTGAAAGACAGTTTTCCTGCATATAGAATTCTTGGTTAGCAGAGTTTT
GCTTTAGCCCTTTAAATATGTCATCCCACTGCCCTCTTGCCTTTATGGTTTCTGATGCAA
TATTGGCATTTAATCTTATTGAGGCTCCCTTGTGTGTGACATGTTGCTTCTCTCTTGGAG
CTTTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACACCCTGCT
CATTTTGTTTTTACTCACTGTCTGCACATTGTTTGCTCATTGTCTGCTTGTTTTTGCTCA
ATGTCTGCTTGTTGTCTGCTTGTTGTTTGGCTTCTTTAGGAGGCACTGGGAACTGAACCT
GGGATCTCCCATGTGGGAGGTGGGCACTCAAGTCCTTGAGCCATATCTGCTCCCACTCTG
AGATTTTTTGTTTGTTTGTTTTAAAGATTTACCTAACCACAGGGCCAAATCCACTTCTCA
TGTCTTGTACTTCTTTAATCATTTTCTGACTAGACATCCTATCTATTATTGAGAGTAGTG
TGTTAAAGTCTCCTATTAATGTAGAATCGCCAGTTTCTCCCTTCAAATCTGTCAGTATTT
GCTTCATATATTTTGGGGCTCTGCTCTTAGGTGCATATATATTTACAATTGTTACATCTC
CCTGTGGAATTGTCCCCCTCGTCAGTATGTATTGACCATGTTGGTCCCTCATAAGTGTTT
TTTATTTAATGTTTATTTTATCCAATATTAATATAGCTATCCCAGCTTTCTTTTGGTTAT
TTCTCACATGATATATTTTTTTCCAGCCTTTCACCCTCAACTTACTTGTACCTTTCACTT
TAATGTATGTCTCTTGCAGACAGCATGTAGTTGGTTCATGTTTTTTTATCCATTCTGTAG
TCTCTGAGTTTGACTGGAGAGTTTAATCCATTTATATTTAAGATCAACACTGATAATACA
GGATTTTCATCTGCCATTTGCTATTTAGCCTTTATAAATCTTATGCCTTTTTTGTCCCTC
ACTTTTGTTAAAGCCTACTTTTATGTTTATTTGCTTTTTTGTGTTTCTTCTTATTTGGTG
CCTTCTCATTTCTGCCTGAATATACTTTTCATTTCTTTTTCTTGTGGTTACCTTGAGTTG
AAAATTTAATATCCTAAATATAGACCAGTTATATTTGGTTTGCTACCAACTTAACTTAAA
ATGCCTGCACATATACATTTCATATACCTCTCTGTCCCCCTACCAATTTTTTTGGTACTT
CTTACCACTTGTACTTTGGTATGTTGTATGTCTAGAATCCTAGATTTATCATTTTTTTAT
GCATTTGCATTTTAGCACCTATAGAAAGTAAGAAGTGGAGTTATATACCTAACAATACAA
TACAATAATACTGTCATTTATAATTACCTAAAAGGTTACCTTTAGCGAAGGTCTTTATTT
CTTTTTTTTAAATTTTATTTATTTATTTTTTTAAAGATACTTAGATTATACAAATGTCAC
ATAGAAAGTGTAGGGAGTTCCCATATGCCCCATTCCCCACACCTCCCACATTTTCCCACA
TTAAGAACGTCCTTCATTAGTGAGGTATATTCATTGCAGTTGATGAACACATTTTTGAAC
ATTGCTGCTAAGCATAGATTAAAGTTTACATTGTAGTTTACACTCTCTTCCACACAATTC
TGTAGGTTATGATAAGATTTATAATGGCCTGTATCTGTCATCTTTATTTCTTTATGTTGC
TGTGAACTACTGTCTAGGGTCCTTTTATTTAAAGGGAATCTTAAGAACTCCCTTTACCAT
TGCTTATAAGACAGGTCTAGTGGTGATAAACTCCCTCAGCTTTTGTTTATCTGAGAAATC
TTAATCTCGCCTTCATTTTTTAGAGTGAGTCTCACCAGATATAAAATTCTTAGCTGGCAG
TTGTTTTCCTTCAGCTCTTTTAAGTATTTCAACCCACTGCTCCATAGTTTCTGTTGAGAA
AAAGGTACTCTATCTAATTAGGACTCCTTTGTATAGAACACGTTGCTTTTCTCTTGCAGC
TTTCAGAACTCTCTCCTTGTCCTTCCATTTCCTCCTGTAACCAGTATATGGCAGGGTATG
TTTTTCTTCATGTTTGGTTTTCTCTGAGCTTCTTGGATGTGTTCATCTTTTGCTAGTTTG
GGGAGGTTCTCTGTCATTATTTCTTTGACTGTTCCTTCTGCACCTTTCTCTTCTCCTTCT
AGGACTCCCATAACATGTTAATCAATGTGTTTGATGGTGTCCATAGCTGTCTTAGCCTAT
TTTCACCTTTATTTATTTATTTTTTCAAAAGATTTATTTATTTATTTTAATTTCCCCCCC
TCCCCTGGTTGTCTGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTG
TTGTCGTCAGCGGCAGGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCTCTTTCTT
TTCATGCTGGGCGGCTTCTCCTTACGGGGTGCACTCCTTGCGCGTGGGGCTCCCCCACGC
GGGGGACACCCCTGCGTGGCAGGGCACTCCTTGCGCGCATCAGCACTGCGCATGGCCAGC
TCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTCCCATATGGTAGACGGAC
GCCCTAACCACTGGGCCAAAGTCCGTTTCCCTATTTTCACCTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCCTCTTCCTTTGGA
TGGACCATCATTTCCTGCCTCTTTATCTTGTACTCTTGTTGCACACTGTACGTTTTAGTA
TTTTAAAATGTTAACTGTGGGTTTTACTCCCTGGGATGTCTGTTTCTTAATTTTGTAACC
AGCTGGTGATAAGACAGACTTTTTCCTCACACTCTTCCGTGGATGCTGTACAGTGTTATT
CTGTCCCCTGGAGTTTCAAAATAGGTGTTTCAGACCGTTCCTGCCTGTTTAATAGTTGTT
TTTGTGGAAGGATTGAAACTTCCTATTCTGCATTCTTCTCCAGAAGTCTCCTCTCAATTA
CATTTTTAATAGTTCAAGTTTATATCTGAAAATATTAACTTTGCAGCCATATTTAATTCT
GTTTGAGACCCCCTTACTCTCTTCCTTTGAGCTACTCTTCCAGCCTTTTCTCCTGCTGCT
GCTGGACAGGTTGCCTTTACTCCACTAAAATTTCCCCTTTCTTAAGTTTTGTATTCCAGT
TTTCACTTCCTCTATTTCCCAAAGCAACTATGTAAATTTAATTATTCTCCCAAGATCTTG
CCCACCATTTTCTCCTCCAGAGATAATATAGACTGTCAACTATGAACTTTCCTAATTCTT
TGCTTTTCCATTTATAACTTGGCCCAATTGCACTCACCTCTCAGATGGCAAGTTACTTAA
AGCCAGTGCCTCCACATGTGTCCACTTTGTGGATTTTCCTCTTTCAGTGATCCTTTTTCA
GACCATCACTCTCTCTGTAGTACTGCTCTCTAATTATCATTACTCCTCTTCCTTTCCCAT
TATAGCCAAACTTCTGGCAACTTTTTCCCCAACCCTAATGCCGTTCTCTTAGTCTAGGTT
CTCATTGTCTATTTTATTTTTATCTCAGATTTGTCATTTATTTCCAAATATTAATGAACA
CCTTCTTTCAGACACTGTTCTAAACCTGGGGCTACAATAGTGAACAAGACTAAGTCCCTG
TCCTCTCAGGGCCCACATTCTAGAAAGGGACACAGACAAGAAACACAAAATACCTCTGAA
AGAGGGATAAGTGGTAGTTAAAACATAAAGCAGGGTAGATCATGACTAGCAGGCAAGAAG
TTTCCTGATAGGATGGTCAGGGGTGGCATTTTTGAGGAAGGGACATTTTAGCAGGGACCT
TGCTGTCAAGGAGACACTCAGAAAAGATCATGGGTAAGATCTTTGAGGCAGAGGGAGGAT
GAAGTATAAATGCTCTGAAGTGGAATAAAACTTAGTATAATCAAGGCCCCACAAGATGGC
CAGTGTGACTAGCAAGTAACTATGAGAGGACCTGAACTAGATTGCATTACATTAAGAAGT
TTTGGGGAAACGGACTTGGCTCAGTGGTTAGGGCATCCGTCTTCCATATGGGAGGTCCAC
GGTTCTAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGTGCAGAGCTGATGCA
CGCAAGGAGTGCCATGCCACACAGGGGCGTCCCCCGCATAGGGGAGCCCCATGTGCAAGG
AGTGTGCCCCACAAAGAGAGCCGCCCAGCACGAAAGAAAATGCAGCCTGCCCAAGAATGG
CACCGCCCACATGGAGAGCTGACACAAGAAGATGACCATTGAGAGCTGACACAAGAAGAT
GACTCAACCAAAAGAGACACAGATTCCCGGGCCGCAGACAAAGAAACAAGACGCAGCAAA
TAGACGCAGAGAAGAGGCAACCAGGGTGTGGGGGGAGAGAAATAAATAAATAAATAAATA
AAATCTTTAAAAAAAGAGAAGTTTTGGTTTCATTCTGAATTTAATAGGAAACGTTAGAAG
GTTTTAAGTAGGGGAGTGATGGGATGTGTCTCCTCCTAAAGTCAAAACTGAATCCTTTCA
GAAACACCCATATAGAGGATTTCAGAATATATGCATAAATTTGGATTTTAATCATGGGAA
TAAATTGTTTCCCCAAAATCCTATGTTGCGGAGAAAGGGCTTTCTTTCTTCCTTTTTTTT
TTCTTAGCTACCAGAGGCTAAGAGAGGCTCTTCTGAAATTTTAGCTTATAGCTCCAGATT
GTAATTTTGTGAGTAATAATAATGATGATAGTCTTTTTTTTTTCTTTTTGAGGTACCGAG
GACCAGGAATTGAACCTGGGACCTCATGTGTGGGAAGCCAACGTTCAACCATTGGGCCAC
ATTAGCTTCTCTGAGTTAGTTTTATATTTTTTCATTTGTTTTGCTTGTTGTTTGTTTTTG
TTTTTTCAGGAGGCACTGGAAACTGAATCTGGGACCCTCCTTGTGGGAGGCGGGAGCTTA
ACCTTTTGAGATACATTTGCTTCTGATGATGGTCATATTAAAGAAAATGTTGTGTCTCAT
ATGTCAGTAATGTGGCTTCTCAATCCTTTACATATTTGTGTTTCTCCTACATGGGACCCT
ATTTTATATTTTAGAGCCCATATTAGGGTAAGAATGGGCCTTATCCCTTGGATCCTTTTG
GCTTAGTTATATGAAGATGTCAACCCTTAATTCATCAACAGAAATGTAGTTGTTCAGAAA
TAGAAATGGATTTTTGCTAAACTGTTACTACTCTTCCTCCAGCTTCCCATGCAATGAAAT
TACTGACTAGGGAACATAGAGAAGTAACAGGTTACAGAGAGCAAACAAGTGACCTTGCAG
TTATGAGCAGAAAGTTCAAACCAGCTGAGCCACAGATCTTTATTTATTTATTTATTTTTA
AAGATTTATTTTGTATTTATTAGGTTATTGGACTGATCTTTAATGTCACTCTGCACTAAT
ATTTGATGAGTCTAATTGCCTTGTTTGGATAGACTTGTAAAATAGAAATGATACTAAAAC
TGAAAGAGTAAAAATTAAACCAAGAACTTCCCTTTAGCATTTTTATGTTGATAAGAATTA
GTGAATCATACAGAGAGATCTCTTCAGGATCAGTAGATAGTCTTGATTCCAAGTGGCTCT
GCTGCATCTTCTTTTTTCTGTTGTTTTTTTGTTTTTGTTTTTGTTTTTCCTCTGACAGTT
ATCTCTAATGATCACGTCAAGGTCAGGATGACTCTGCGAATATACAGAGTCCAATATGGA
AAGATTTCCTCATTTGGATGGCTGCTGAGGAGAGTAGGATATAATTGAGATTAAAGGGAT
ATTTACAGAAACTAGTGAACTACCTATAAATGGGATTCTTCTTTGACTTGTTCCAGAGAT
AAGTTGGTAACATAATCTTTGGCTTATTGGTCTAGCTTGTTGAAACCTTTGTTCTTTGAC
TAATTAAACCCTGATTTTTATCTTATGTAAAAACAAATCTCTTAAGATTTTTTACTGGTA
TATTTGGATAAGTTTGTACCTCCCAGTCTTGAGCCATTAAAGCAATTTAGTTCATAAGGA
ATTGGCCTGGTAAGCTGCATTTGTCATTCTTCCAAATACCAAAGTGTAAAGCTTGATCTT
GAGACTGTTCATCCTTGCAATTGCTAATTCATCTGAAAGATCAATGAGAACATAAAATGC
TTTTCTGCTGTATATTTACTTTTATTGCAACTCTAATAAAAATACGATTTTAGTAAATAA
GGATGGTTCAGTTCATTGCAGAAATCTCTTTTTTCCTTTTCATTATCTTCCCAGTAGCAC
CCAGAGCCAAATGAGGTTTTAGTAACATTATGATTGCAAGTAAAAGTTACCTAAAAGAGT
CACCATTTTCCTCACATGCTTTAAACAGCTTAAATATGTAGCCAGTTGTCATATATATAC
ATAATAAAGATACATACATATATATGTATATATATATGTGTGTAGGTATGTGTATATATA
TATATGCAGCTTTTTTTTGCAGGGAAACATTTAATTTTTTCTCTGGTGTTGAGCTTTAGA
AATACTTGACATATAAAAAATTCTTACTGGAAAAATAGACAATTGCATTTCAAAAGAATT
GCACACTCCATGTTACTATCTTACGAGCCATACTTATGTCATCTGATAATAATGTGATAA
AAATATTAACTTTGAGCCTCTAATAGAAAAACATTATTTCTCAAAGAACCTGAATAATTC
CTTTATAGAACATTAAGTGTATACCTCAATTTGGCTAGTAAAAGAAGATCATTGTATATT
ATTGAAATATTTTTCATATAATCATATTATTCTGAGTAAAGTAGTGATTCCTTGCATATC
TTCCTGAAATTTTTATACCACTTAAATAAAATTAAAAATTTTAAAAGTATACTCAAATTT
ATGCTTCCAAGTGACTATTGGTCCCTTCAAAATAAGTCACGTAGAAAGGTGTTGCTACAA
ATGGTTTTCGGTCCCCGTTTTTGAAACTGCTTTCAGAACTACTATACCTATATGGTGAAA
TTCACGGTGAGTTTTACTTATTCACTTATTCATCCAGCCAATATTTATTGAACATCTGTT
TGCTAGTTTGTGCTCGTTGCTAGATTCATAAAAATTAAATAGAAGAAGCAAACAAAAAAA
TGACTCCCTCATAATGTTGGCTTTTGGAAATTGTAAAAAATCTTTTAAAGCTGAATTTGG
TAAAGGGTAGTAAAGGATGGTAAAAGGATGCTAGGGAGTACCATTTTAGAGAAAAATGAG
ATATGATATAAAATAAAGAGATTAGTTTTCTCTGTTTACCTCGTAAGATGGTTTCCAAAG
TGGTCTCAAAGAAAAAAAAACTAAGGTAGCATCATTGGAATAGATTGATTACTTGCCTTG
GTACCTAATTTAAAGGGTAGCTTGTTCATTTAGGTAAATACTAACATTGCTGTTTTTACT
TTATTAGTTTTTATTTTCATTTTTTGCCTTATATCTACCAGATTTTGTTTGGTTAATGTG
CAGATTCTAAGATAGGGCCCTGTTTACATTTGAGAAAACTATTACACATGGCAGAGACAT
AAATGTAACTGTTACATTGATCTTATAGTTTTTTGTATGTATTTAAGTTTACATATAAAG
TGCAAAATCTTAGCCTACCCTTGACTAAAACTCTTTAGTTTTACATATGTACTGGGGAAT
AAATTATAAGTATACTTCATCTGGAATTATGAGAAATAAACATATTAAGCTGTAAAAAGT
TCATATGTGCTTCTCAAGATTAAACTATCTCCTATTCTTTACAGTAAAAACCAGTTTTAT
CCTACACATCCATGATGCAGGAAAAAAGAAGAGAAAAAATATTTTCATAATAAGTGCCCA
GGGGAGGAGCACTGTACTTTTCTAATAGTTTCATTTGTAGTAACACAACATGACAAAATA
TTTCTTTCTCTCTGCAGGGGGATCTTTGGATGTATATAGAGAAATTCCAGAGCATGTCCT
TGGAAGAATTGCAGTAGCAGTGAGTATATAGCGTTAACCTAATATAATTTGGGTGATTTG
ATCTTCCTAGTAAGGCCTTATTCTCTTTATACTCTCAGGATTTTTTCTCTTTTTCTGTAG
TCCCTATTGGCTACCAGAGCAGAGCCTTCTTAATTCTCTTCTGTTCTTATCATTTTGTCC
TTTCTTCTTTTCAGAGACCAACCCACATTAATGACACAGTCATACGACATCTTTCAGCTT
ACGGATTGGTTCTGTGACTTATTCCACTTTGTTTTATGTGTTTGCAAGGACCTTAGTGCT
CTTGTTGACCAGTAAAATTTCCAAGTTCTTCCAAAAAAAAAATCTTTTTTTGGACATTTT
GTAATTATATACATAAGATTAACGAATGCTTTCAAGTCAAAGTTATAAAAATAAAACAGT
TGATGAGAAAATATTACTTTGATAGTAAAGATTTTTGCAGTCTTTTATGTCATTGGTTTT
TAATTTTTCACCAGCTACTTTTTAAAATACTTTTTTATTTTTAAACAATATTTTAGATGA
CATAAATGTTACATAAAAAATTTAGGGGGGAAATGGACTTGGCCCAGTGGTTAGGGCATC
CGTCTACCACATGGGAGGTCCGCGGTTCAAACTCCGGGCCTCCTTGACCCGTGTGGAGCT
GGCCCATGCGCAGTGCTGATGTGCGCAAGGAGTGCCGTGCCACGCAGGGGTGTCCCCTGC
GTAGGGGAGCCCCACGCGCAAGGAGTGCGCCCTGTAAGGAGAAGCCACCCAGCACGAAAG
AAAGTGTAGCCTGCCCAGGAATGGCACCGCCCACACTTCCCATGCCGCTGACAACAGAAG
CGGACAAAGAAACAAGACGCAGCAAATAGACACAGAGAACAGACAACCGGGGGAGGAGGA
GAATTAAATAAATAAATAAATCTTTAAAAATATATATATATATAGGAGAGTCCCATATGT
CCCACTCCTTACCTCTCCCATACTTTCCCACATTAATAGCATCTTCATTAGTGTGGTACA
TTTGTTATAATTGATGAATACATTTTGGGGCATTGCCACTAAGTGTAGATTATAGTTTAT
ATTACAGTTTGCACTCTGTCCCACAAGTTATATAATTGATGACAAAATATATAATAGTTT
GTATCCATCATTGCGGTGTCATTCAGGAAAATTCCAGTGTCCCGAAAATGCCCCCATATT
ATACCTGTTTCCCCTCTCCCTCCCCTCAGAACCTCCAGTGGCTACTGCCTTCACATCAGT
GATAAAAGTTCTTCCATTGCTAGAATAACAAGTTTATAGTAGAATAACAGTAAGTCTACT
CTAGTCAATTGTTCATTCCCCAATCCTGAGGATGCTGGGATGGTGATAACCTACTCTGCC
TCTAATTGAGAGGGGGCTTAGATCCCATGGGGCTGATGGATGGGACTAACTTGTTTGCAG
TTGTAGACTCTCTCTGTTCCTTGGGATGGGTATTGTCCATCATCATCTTCTTGTTAGTTG
TCCTGGGTGAGTCCAATGAACTGGAGAGTAGGTGTTGCAACTCTGTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGGCTGAGTGGAGTAAGTCCAATAAATCAA
AGTGTAGGAGCTGAAGTCTGTTGAGGCTCTGGGCCTGGGTGTCATATTATCAGTCCAGAG
ATTCAAATCCCCTACATATATCTTAAACCCAGCACCGACTACAATTCCAATAAAGTAGCA
TGCAAGTCTTGTGAAAAGTGATCCCCTCTGAGTCCAATTCCATCACGCAGAAACACCAGG
TCCAAAGAAGGACTATCTGTCATGGCAGTGAACCCTTTCTGCCATGACCATAGAACCCGT
GGGTCTCTTTATCCCTCAAAAGAACCAATACCTGGGGTTGTATCTACCTTATCTGTCTCT
TAGACTCTGTTCAGTTGTACATAGGGGTATTCCTTCTGACAACCTCCAGACTCTTTTTTA
GAGACTCACAGCCTTATAATCTCATTTCTCCTTTCCATTTCCCCCTTACATTAGGTCAAA
CAGCTTCCCGAAGTCATGTTATTATATGTAGACAGGTATATTCTGCTGTTCCGCATTGAA
TCTTTAATTCAAGGTCATTTTATAGTTGCTTCTTCAGCTGGTATGTGGTAGTGATCCCTC
GGTGCCAGGGAGGCGCTTTTTTAAACTAAGGTTTGTTTGCTTGTTTCTGGAATATGTCCA
GTTTCTACAGCTTTGGTGGCTCATCAGGTCATAGTAATGAAAATTACCTGTGGCCAGAGT
AGAAAAAATGCTTTTGATAAGTTTTCTCTTCTTATGCCTCTTTTTAAAAACTCTGCTGGC
ATCTGTACTTGTGTAGTGCCTCCAAAATTCATTCTTCTCTAATCCTGAGTAGGCTGTATT
TGGATAATCCCGTTGCTTTTGATAGGCACCAGACTGACACATGGCTAATGCCTAACAGCA
GGAGAACCACATTCAATTGCTTTAGATTCTTTTACATCTAGGCATCTCTCTCTCCCCAAA
TAACTTTCTTTTCCAGATTCTAATAATCTGTCAATACAAGGCAGGTCCAAAGATCCAAGA
TCTGTTATAGGATGGACTCCTGTCAGCCTCTATGATATGTTGTTCAATTTTTCACTTATA
GGATGTATGGCAAGAGAATATTTTTCTCCTTACAAGAAATCCATATAAACTGATTTCAGC
CTCCTAACTTACACAATGATCCCCCCCCCCCCCGCAATTTCCTTTCGAATCTAGTCTCCA
ATAAAGAGGAATGCCATTCTACTTTTCCCTGCCATTTAACACATTTTATTTTTTCTCTTT
TTCTGAAGCAGTGACACTGTGTACTATATTTTAAGTGCTAATGTTGATTGAAGTTGTCCC
TGAAAAGATGTGTACTTGACATGTCAAGGAATGAATGATTGACAGCAGATAAAAGCACTT
TAAGTGTCAAGGTTTTGTCAAGTCATTGTTGTAAAACCTAGCCTACTGAATACCAGAAAT
ACCCTCTAGCTTTCAGTAGACCAATTTCTAGCTAGCTCCCTTGCACACTGATACTTCGAT
GCCTCTAAAAGGAAACTATAATCTATTTTGACAAAAATAGAAGAATATTTTCTTTTTTGA
GCCTCTAACAAAATTTATAATTTAACAAGAATCATGTCAGTATTTGCTTTACTTTTTTCT
GCCTGGCAATCTGAATATGATGGATTGCCTTCCCATTTGTGTTTTCTGACTATTCATTTT
CTGTGGAACCAGTTCTTAGTGGTAAGCTATCTTTAGTGGTTTAATGGGAGGTTTTTAATA
TTCATGTAAGTTGAGTATTAACCCTGCTTCCAGATCTTAGAAGATGAATTATTTCCATGC
TAAATTGTTCACCATTGCTGTTCTTTTTTCCACAAGCATTTAAAGAAATATTTGTGTCCT
TTTTCTTTCTGTGATAAAATTATTATTTATATTTTGATGTTTTGTTTTTTACTGTCTTAT
ATCTGAGACATATTTGTTTTAGTGGAATGGCAAATATTCCAAACTCTGGAAGAAAACATT
TGCAGTAAAAATTTATTCTGTTCTCTTAGAATAGACCAAACATATAGTAGAATTGATCAT
ACCATGTTAGCAAGTCTGTCAGGAGTATATTCTACTCTGCCCAGCATTAATTGATAAAGA
TTTTGTCTTCTAGATCTTTAGTGAGATATTTGAAAATTGGTTTTCTTTCTCTGTATTTCC
TTTTTTTAACTTTTGCTCTTAGTCTTCCTCAGTCAATTAAAATCCTTGCTTACATAGCCC
TCAACCCTATTTTCTTCATTTTCAAGATAGGTAAACCACTCTGTTCTTTATTGCCATGGT
AGGTTTTCTTGTTCTTATAGTCCTTACTTATTTAAAATTTTCTATAAATCTGTGTACTTT
CAAATTCTTATTGTAAATATTGAGCAATAGTAATTTGTTCATTATATCTGGTACCTAATT
ATGGATACTTGGCCCTGAAATTTTTTTAAGTTCACATGTGCATACAGAATCCATGGTTGT
AAATAAAACATCTGCATCTACTTTAACAAAAATCTATATAAAGATTTTTTAAAGTTTTCA
TGGCAACCACTGGTTACATTTCCTACATAGAAGGTAGCATTTGTAACCTGTGTACTTAAG
GTTTTGGAAATATCTTTTTTCAGTGTCTCATCATTGTTCTTTACTCAAGCTATTAAGTGA
AAAATACAAATCTAAGTCATATGTTTGTACTTTCTCTTTTTATTTTCTTTAGCTGTCTTT
TCAATATTGTCTGCACTATTCCTCCATATGCTTTGCTTCAGCCAGACTATCTTGTATTGA
TCATCATGACATGTTTTATTCTTTCCTTCTAATGCCTTTAAAATAATTTTTTGGAACTTT
TTGTTTTGAAATTATTTTAAACTTAAAGAAAAGTGAGAATTTCTACAAATGCTTCACCCA
GATTCCCCAATTGTGAAAACTTTACCACGTTTGCTTAAAAAAAAATTATAAATATATTTT
AAAAATAATAATATGTTGCAGACACCATGGTCCTTTACACCTAAATACATAAGGTGTATA
TTTCCTAAGAACAAGGACCTTCTCTTATATAATCACTATTTAATGGTCAAAATCAGGAAA
TTAACATTGATACAATACTGTATTAGCTAATCAACTTGATATTATTTAGTCGATTTAAAA
GACTTTATTCAAATTTTGCCAATTGCCCAGTAATACCCTGTATAGACAAAAAGAAAAAAA
TTCAGGTCCAGCATCCAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCATTCTCCTTTAATCCATCACAAATGTCTCCATATTTCTTTTCTTTCATGAACTTGAT
ATTTTTTGATGAGTACTCTGTCCCACACTTTGACTACATATTTTACCTTGGCCTAAAGTA
TTCTTCCTTTTTCCTCACTTAATTCAGTTACTCAAGGCCCACCACCTTGGTGTAAAGCCT
TTCCTGCCTAGTAGTGGGATAAAGCAGTATCTATTTTACCCAGTTCCTTCTTGGAATTTG
CTGCCTTATTTCATTAGTTAACTTTTAAGAAATATCTCTCAGTGATCTAAAATGTCCTGA
TTTTTAAAAATTAAATACAGACATGTAGAAAATAAAAATTGAAAGTCTTTGTGCCTCTTT
CCTTTTCCTTTCCTCCCCTGCCCCACGTCACCACTAAGAATTTAGCATAATTCCAGGTCA
TTTTATATGCACATACACATATATTTTTCATTTGGTTATATACCCTACCTTTAGAACACT
GTAAACTCATTAAAGGAAGAACCTGTGGCTTATACATTTGGCATCTCCACAGAACCTGGC
ACAGAAATGGGAGATGCTTAATAAATGCTCATTGGTTGACTTGAGTTTTTTGCTGTTGTT
TTAATTTTATTGTAGTAACATATATATAACATAAATTTTGCCATTGTAAACATTTTTACT
GTTTTATAGGACTAGGTTTGATATGATTATTTGTTCTTAATGTGGAAAATTCCCTATAAA
AAACAAAATTGCATTGTTTTCTCTTTCCTAAATTTAGGTGGTTAAAGGCCTTACCTATTT
GTGGAGTTTAAAGATTTTGCATAGAGGTAGGTGCTGGGCTTATAAACTTTGACTTAATTT
TTGAAGGGTGGGAGCATTTCTCTAGATACCTTGATTTTTAAAGAGCATAAATGGTGATAT
TTAAGCCAGTGATATATTTGGTAGTCAAAATGATAGTTGCCTTATAAATGTTATTTTTCT
TGTTGTTTTTTCCCCCCCTCAGCTACTGTCATTGAGATTATGAACCTGGTATAATAGTGT
TTTTCTGAGTCATATTTAGCAAACCTGTAAAAAGATGTTTCATAGTATTTGAAAATGACA
GACTTTCATTTTTCTTATGTAACTCTAGTTAATACAAGCCTGTCATCTTCTATACAATTC
CATCCCTTCCTTTCATTAACATTTCAGGTATCATACACCAATTCTTAAGAGATTGCTCTA
TATACCTTCAACATGGAACTTTAAGGAATTGGTGAAAGCGTCAGAGATCTCCTGGTTATT
AAGAGAACAGATGAGAGAATAATTAGATAACTGTTGAGTATTGTAAAAGGTACCTCCCTT
TGTTTTTTTAATGTTCCCAAAATGTCTGAGTTCATTTGGAGCAAATTATTAAGTAAGAAA
CAGACTATAACAAAGCAACTTCAGGGCCTAATGTTACTAACAGTACTGTGTCATTTTGTA
CATCTGGTCATCCTAGCTTTATGCACAGTGGGGAATGCAACAGCATACACAGTAAATGTG
ATTAAAGGAAAGCTTGTGTTTTTAAAAAAACAATAGCACAAAACTAAGGTATAAGCTAAG
AGAAATGTAAAAAACAACTGATGTCTTCAATTGTATTATCACTTCTGCCACTAAGGGTTG
TTTTTTGTTGTGGTGGTTTTGATATCCTAGGGTGTCCAAATTTCTCCTTAACTCCTCCAT
CCTCTTTTGAAGAGGGTATCTAGATTTCGAAGGTATTTATGCTGATTAAATGAAATCTCT
CTTTAAAGCCACTTCATTCTACTTCTAGAGTAAAAGTGATACAAAATATAGATGTAAGAA
GAGCAGGCTGAGTTGTGACTGTATTACTTGTATTACTTTCCCTGGGAAAGAATGTAAACA
TGCATGATGATTGAAAGAAGTATTTTCACCACTAAGATTAAGAGAGAATGGTATTTAATA
GATGACTTATATTGCCTCATTCCCTGTACTCTCACCTCTCCCGTACCCACCAACCCATAA
AGTGGTTATAGGAATCAACACAGTTGATTTTTGTCATGTTTTATGGAAACTATCCATTTG
ACAAAAGAGCCAAAGAAAAACATCAATTCTCAATAGCAAAGCTCTCATTAACAGTACCTT
GCCATAGAAATGCTAGTGTTGTTATTAAAGTGAGCCTTAGCATCAACCTTTACCGTAGGC
ATACAGCTTAATTCTGTCTTATAATGAATTCTCTCCAGCTATAACTTTCTATTAAGAATT
TTAGTAATGCAGAGAAATATAGTGGATGGAGAAATAATTTTACTTATTTGTCAGTCATCT
TTGTTTTTCTTCTTTAAAATCAGAAGTAATGCTGATAAGTAGATACTACTTTAGTATTCC
CTGTATTTAATTATTTGGTTTTATTTTTACTCTGCGTTAGGAAGAAATAACCGAGTTGTT
CTTTTGAAATGGGATCCTGATTGACATGTTTCAAATGAATTTTATCTAGATCTAAAAATA
AAGTCTAAGATATTTGTCAAATTCCCAGTACAACCACCTTAGGATCATTATGAGCAAATA
TGGTTGATTAGAGCCTTGCAGAGGCTGATGGGCTTTCTTCCCAACTGTGGATGTAACTTA
AGCTAAGAAAGTGTTCTTTGATCAGTGATAGATGAGGACATTAGTGGTTTGACTGATACA
GAACATGGAGATTTCAAAAGGGATTCCAGGGCCCGTTCTTCTTTCAGTCTGTGCAAGCCA
GTCCAATTTCCACAGAGAGTAACCCATTTTAACTTACCACTAGGTATAGGAAGAAGGTAC
CTGTGAGGGGCTGAGTGGAGACACTTTGGTAATGGGCCAACAAACCTTCTCAAGGATTTT
CAGTTTTAAATAAGTAACAGTGGATGAATGTGCATCTGTTTCTCTGTGGAGGGAAAGACT
GATAAATTACAGTGCCCATGAATAGATTTTCTCCTGTAGTTATCAGTTCTCAACTATAGA
AATAAATATGCTGTGGTAATACTCCTCATTACATATATTTATGTTTAGTTTTTTAGTTCC
TTGGCTATTCACAGAAATATTTACTTTCTGGATTTAAAAGCATGAGTTTTATTGAACTGT
GGAAAAAGCCAAGTGTCTCTGGAGACTTTTGTAAAGCGTTGTAATAAGAAATTTACTCTA
GATTGAGTAGTTATTAACTTAATATTTTAGAGGTTTTGTCCATATTTAATAACTTACATT
CCATAAAATAAGATTAAAGATGGCTTTTATTTACCAAAAAGCTATTTAATTTTCTCCTTG
ATTAAAAAATTGTAGCTTTTTAGATCAGTTCAATCAGGCAATTAAAGATCAGAGCTTTTA
AGTTCAGCTAAGGCAATTAAATAGATAATATACTTGTTTAGACACTTTTGCTGTATAAGC
TCATGGCTGTACCTTCTTAAAAGCACATATACTCATTTTTGCCTTCTCTAAATGAATGAT
GATGGGAATTCTATTTGAATATGTGTCACATTGTCAAATCAAAGGCAGGAATCATTCTAC
AAAACAGGGACTGTACAGGTGCTCTGAGCAAACTAGGCATATGATAGTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCATTAAATTTATTTT
GCTTATTCTACGATAAGAGTTGAAATGGTATATGTGAAAGTACTTTGTAAACTCTTAAAT
GTTAATGCAGGTATGCTTTTATTATATAACATATAATATATAGTAACTATGAGTTAATCA
CTTTATCCAATTAATAAGAATATCCTACTTTCAGATCAAGCCAGAGAGAGGGTTTATTTT
ATTTTGTATTACTAGGTCAAAATTATGAAAATCTTTTCTCTCTAAACCAAACATGAGGAC
ATAATTCTTAAAATATTTGAAACTTTCATCAAGATTAACTACTTAAAGAATAAATTCTCT
TTATTAAAAGACATATTGTGAGCCCTATAAGTATGGAATCTACTGACTTGGGTAAAAACA
AAGAAAATGAAAAGTGACAAAGTCTGTTAGGCCAGATCCAGCATTACAGCAAGCATTGCA
TCTTAACTTCAAAACATACATCGCCACTAATGAGGTGAGAGCCCTGCATATTAATAAACT
ATACCTCTAGTCATAGCCATCATTACCCACATCAAACATAAATACAAGATTAACACCTAA
GCCATTTCTTTGGAAGCTGTGAGAATGCCCTAGCAGTAAATGCTCTGTCTTTCCCTGGGG
ATAAAAAAAATAGAAATGGAAGGGTAATGAGAATAGAACTTAGAGTGAAAAAATAAAATT
GGAAATCAAGTTGACTCAGCCTTACACATATGCAGAAGTTTTTGGCAAAAAGAAACTAGA
TATTTGGTGAGCCGGACATTTTTTTTTTTCTGTACATATGAACCTAGTTAGTTTCACTTA
TTTTTCTCTAAAAGGAAAGTGGTTTTTTTTTTTTCCTGTGTTTTTTTCCTTTTTCTTTTT
TTTTTTTTCTTAATTTTTAAAAAATATTTCTGCAGAAATTCTGTCACTAATTGCTGTTAA
GATGGATTTGTATTTAGGGAAACTCAGTCTTGTATTTTCAGGAGACATGTTCAAAATTTA
ATTTTCAACCCCTAGATTTACTTTTTATAAATCTGGCCTCTCACAGACCTTCCAGTGTGT
GCTACCTTAAATGCCATGTCTGGCATTGTTAGTTCATTCATTTAGGAACTATTTATTTTA
TACCTACTATGTACCGCTGTTCTAAGTGCTTGTAATACATCAGTGTACAAAAAAAAGATT
ACTACACTGAAATGGAGATTACATTCTAGCAGGGGTGGGGTTAGAAAACAGACCGTAAAC
AATAAACACAGTAGGTAAGTAAATAGACTGTGTTTGACAGTGATTAGTAATATGGAGAGA
AGAAAAAGTAGATTGAGCTCAGCTGAAACAAAAGGTAGGTTACAGTGTTAATTAGGTAGC
CCTCGTAGAGACTATCAGTTTGGAGTAAAGGCATAAAGGAAGAGAGGGACTAGTCAAGTA
GCTAAGAGGGAGCTGTTAGAGCAGAAGCCACAAGGGGAATGTGCCTGGAGTGTTCACAGA
ATAGCAAGGCGGCCAGTGGGGCTGGTGTTAGCTGAGGCCAAGTGGGTGAGGGGGAGAGTG
GTGGAAAGGAAGGCAGTATAAAGACTTTGCCTTTTCCCTCAGAGAGGGTGAGGGAATCAC
AGCAAGGTTTTAGCAGAGAAATGACATGATCTAACTTGTATATTAAAAAGCTAACTATGG
CTGCTGAGTTGAGAAAAGATTGTGTGGGGATAAGAGTAGATTAGGGGGAAGCGAACTTGG
CCCAGTGGTTAGGGCGTCCACGTACCACATGGGAGGTCCACGGTTCAAACCCCGGGCCTC
CTTGACCTGTGTGGAGCTGGCCCATGCACAGTGCTGATGCGCAGCAAGGAGTGCCCTGCC
ACACAGGAGTGTCCCCCACCCGACGCGCAAGGAGTGCACCCAGTAAGGAGAGCCACCCGG
AGCAAAAGAAAGTGCAGCCTGCCCAAGAATGGTGCCGTACACACAGAGACCTGACACAAC
AAGATGACGCAACAAAAAGAAACACAGATTCCCGGTGCCGCTGGTAAGGATAGAAGCGGT
CACAGAAGAACACAGCGAATGGACACAGAGAGTAGAGGGGGGAAGGAGAGAGAACTAAAA
AAAAAAAAAAATCTATAAAAAAAGAAGAGTAGATTAGGGACACCCATTAGGAAGCTATTG
AGTTATAGAAGCTCAGATCAGGGAGAAAGTCTTGAAGGTGGAGAGAAGTGGTCAGATTCT
GGGTTTGTTTTAAATGTAGAGTCAATAGACTGTCCTGATGAATTATTTGTGGGGCTTAAG
AGAAAGAGAAGAGTCAAGGTTATTTAAACTTTAAATAGTAGTTCAGTATGTTAAAAAGAG
AAATGCTTCCTGCTACTTTTTTTTTTTTTCCTGTTAAAAGAGAGTATTGCACAACTGTTA
AAATTGACCAAAAAAGGAAGAAAAACCTGATAATATCCAGAACTGGCTATTGATGGAAAA
GATATCAGTGGTTATCAAGATAATCAAGTGATTGAAGCATTGAATAAAAAGGTGTTTCCC
TAATGTCTAAACATGTGGAATAACTTTTCATTTGCTCATTGGGCATTTGTGTATCTTCTC
TGAAGAAATGTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTTCTTTAGGAGGCACTGGGAACTGAACCCTACCACATGGGAAGTTAGGCTGGTGC
CCAACTGCTTGAGCCATGTCTTCTTCCCAAGTTTTAAATTTTGATTAAGCCCAAATTATT
TATTTTTTGTTTGGTTGCTTGTGCTTTAGGTGTCATGTCTAAGAATCCATAGGCCTAATT
GATGCCTTATGACCCTTCTTGGTCATGTCTCCTGGTGCACAAAAAAAGAGTTCCTCAAAT
GCATACCTAGGAGTGGAAATGCTTAATCATATGGTATGTAAATATTCAGCCCTCAAGTTA
AATTGATAAATTATCCCATTTATAGTGTATGTTTCCCTTGCTCGTCCACCTTGAGGTCTC
CCTCTAGAGCAGGGGTTCTTAACCTTTTTTGTTCCATGGACCCCTTTACCAGTCAGGTGA
AATGAATCCTACTGTAATTTATTTATTGGATTCATAATTGAAGAAATGCTAGTTTCCAGT
TAGAGGTCAGAGAGAATAAAGATAATAAGTAGGTTTTTTCATTTCAAGCTCATGGGTCCG
CTAAAGTCTTTCCACAGATCCCTTGGGGGTCCCTGGACCCCTGGTTAAGAACCCCTGCTC
TAGAGCCCCTTATTGGTAGGGCCAAAGAGGGAGCCAGCTGGCCAAGCAACTCTGAAATCA
CAAAGCAGAATTTAGAGGGGTAGACTTAGAGATGAGAGGCAGAGCAATGAGTGTAAAAAT
GTGATCACTATGTAGATGGAATGGAATAAAAAACAACTAGGCCAGTGTGGCTGAAAGTCA
CGAGTTTAAAACCTCTGCAAAGTAGCCTTATTTCCTACCAGTCTCTATTTTGTGCCTTCT
CCAGTGATGGTGCTCTTTCTACTTATAAACCTTCATTTATCATCTCTCAGTTACAACTCT
GACCCCTACCATACTTTGCTCCTTTCCCATTGTTGAAGGCCCATTTCAAATGCTCCTTCT
TTCATGAGTTTTCAGTGATCATTACAGTTGGAGGCAATAAGAATATCCCTCCCTTGGGTT
CCACAGCTCCATAGCTGCCCTTTCTCTGGACATCAGGCACTGTTCACTCAGCATCATTGT
TTTGGTCTATGACTCAACTCATTTTTTTTTTTTTTTTTTTTTTTGAGTTTAAGAACTATA
ATGCAACAGTATAGAAATAGAGAAAATAATCACATGTTTTGGCATAACTTTTATCATTTT
TGGGGTTTGTCTGCATATTTTAATATATGTTGTGCATATGTTATGCTGTATCTGAATTGT
TTTTGCCTTTATTAGGTCAACAGACTGTTTTTCCACATTGCTTCATCGTCTTCATCACAA
TTTTTTATGGTTGCACACTGTTCTATTGCATATTAGTTAATAGTCTTTATAACCAAAAAG
GGAACTTTGGGCAGAGGATATTAGGGCATCTCACAGAAGCCAAGGATTCATGTGTGGCCC
TGTCTTGGAGCCCCTGGAATAGGGATACAAATGTCGTGAGGTTTATTTTGTGCCTAGTGT
CTGCTTCATTCTTTCCTCTTTCCCTCAGCAGCTTGGCTTCCTGCACTTTTCCTGTTCACA
AAACAGAAAACACCCACTGATCATTCCCAGGCCTTACACATGTCAATCCAGGTATCCAGA
GACTGGTCCCTCTTTCTCAGGAGCAGGCTCATCTTTTGTTTGTTTGTTTGCTTTCATTTC
TGTTTCTCTAATTACTAGTGAGATTTCACATCTATTCTTATTAACTATTTTAGGTTTACT
TCTTTGAATTGCTTATTAATATCTTTTGGCCATTTTTTTTTCTCTTGGGTTTCTAATAAA
TGTTACTGTTTAATGAGTACTTATCATGTCCTAGACACTGTAGTAAATAAATTACTTTTA
TGTCATCCTTAAAATAACCCCAGGAGACAGAAATTATTACTCCCATTGTATATACAAAAA
AACCGAGACTCAAGAAATTTTTATTAATTTGTCAAAGACTGTATTGCTAGCAAGTAATAG
GGCTGAAGTTTAATCTTGCATCTGTGACTCCAAAGCCTGTTATTACGATATTAATTGGAA
TTTGAAGATCTTCTGTAATTCAGAAATTTTTTGGTGGTTATGGTTTCTGGACCAACAAGA
ATGTGCGAGTAAATAGTTTGATTTCCTCTTGATTGAAAACACAGGAGAGAAACACCTGCA
TCTAAATGAAACTATAAATTCTACAGCACACAGTCAGAGGAGGAGACACTAATGATTCCC
AAATCCACTACTTTAGCACTGATCTCTATTTCTCTTGAGATTCAGAGCTTTATTTCAAAT
ACCCTAAAAGAAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCAAAC
CCTTTTCCCCCCTTCCACAGGAATGATCTTTTTACTGTGTTCATATTATATTTGCTGCAG
CTGATGTACAGATTTTGAAACAATAGCTTTCAAACGTGGTTCCAGTATGGTTTACTTTAT
GGTTTATATTTTAGACTGTACAATTTTCTAAATTTTTAGTTACATTATGGTTTGCATTTT
AGCCTATGGACTTTTATACATTTTTGGTGAAATTTGACATGTTCTATATCCATCATTGCA
CTATCTTGTGGAATACTTCCATTACCCCCCAGTTACCCTGTTTCCAGCTATTCTATTCCT
CTCTCCCCCTCCCCTCAGGGCCCTCAGTGACAACCAAGCTTCACTGCTTGAAGGACCAGA
TTCATAGATACTTGCAACAATGCTGAGTGCTTGACACACTAGACTGTCCTCCCCCATTGG
GAGCCACCAATTCTCTCGAGACACAATTCCCTCTATATGAGAACATCAGGCCTCCCCAGG
ATGTGGGTGCACCTTCCTATTCAGTGTAGGGGTCTCCACCCAATGATATAACACACTATG
AAAGATGAGCACTCACACCCTCCCCTAGAAGCCTGCCCCTGTGCCAGATGCCCCCCCTTA
AGCACCTTAAGCAGGTAACCTTTCCTTATTATATTTTCGAAAGATTTTTCTCAACATTAT
AGTTTCAACAACATACCCAACAATCTCCCATGTTCATCTGTTATCCCCAACCCTCCCCCC
AATTCCTTGGGCCATCTGACCCATCCTCCCAACCCTAGCCCGCCTCAAACCTGCAAAGCC
CCAACCCAATAGTATCCCTATGCCCCCGTCTTATCCCTTCCCTGTACAAATACTTACCTT
CACTTTATCATAGATTTCACCCATGTAGGGATCATCTCACAAACTTCCTCTCCCTGCCCC
CAAGATCCTGTAAGCCTATCACCCGGTCTCTAGCTCTCTGAGAATGCTTGGTTTGCTTAT
TTCATATCAAAGAGGTCATGTAGCATTTGTCCTTCAATGTCTGGCTTGCTTCATTCAACA
TAGGGTCGTCAAGATTCATCCATGTTATCCGATGTATTAGTACTGTATTCCTTCTTATAG
GAATACAGGTATATAGGTATTCCATTGTATGCATATACCACATTTTTGTTCATCCATTCA
TCTGTTGATGGACATTTTGGGTTGATTCCAACTTTTGGGCAATAGTGAATAATGTCGCTA
TGAACATTGGTGTGCATATATCAGTTTTGTGTCCTTGTTTTTCAATTCTTCTGGGTATAT
ACCCCAGCAGTGGAAATTGCTGGGTCATATGGCAAATCCTGTATCTAGATTTTTTGAGAA
ACTGCCAAACTGTCCTCCAGAATGGCTGGGATCATCTGCATTCCCACCAGTAGTGGATGA
GTATTCCCATTCCTCCACATCCTCTCTAGCATTAGTAGTCTTCTGTTTTTTTCATAGCCG
CCAATCTTATGGGAGTAAGATGGAATCTCATTGTAGTTTTGATATGCATTTCCCTAACAG
CTAGGGATTTGGAACATTTTTTATGGGCTTTTTAGCCATTTGTATTTCTTCTTTGGAGAA
GTGTCTGTTTAAATCTCTTGCCCATTTTTTAAATGGGTTGTTTATCTTTTTATTTTCAAG
ATATAAGAGTTCTTTATATATGCAGGATAATAGTCTCCTATCAGATATATGGTTACCAAT
ATTTACTCCCATTGGGTAGGCTGTCTTTTCACTTTCTTGACAAATTCCTTTGAGGTGAAA
AAGGCTTTAATTTTGAGGAAGTCCCATTTATCTATTTATTTGTTTGCTGCTCGTGCTTTT
GGTGAGAAGTTTATGAAACCATTTCCTATTACATGGTCCCTGTAGGTGCTTCCCTACATT
GCTTTCTAAGGTCTTTATGGTCTTGGCTCTTATAGTTAGGTCTTTGATCCATCTTGAGTT
GATTTTTGTATAAGGCATGATTTAGTAATCCTCTTTCATTCTTTTACATATGGATATCCA
GTTCTCCAGGCACCAAGTGAGTGGGTTTGGTGACCTTGTCGAATATCATATGACTGTATA
TATGAATATCTATATCAGAACTTTCAATTTGGTTCCATTGCTCAGTGTGTCTATCCTTGT
GCCAATACCATGCCATTTTCTCTACTGTAGCTTTGTAGTATGTTTTGAAGTCTCGGTAGG
GTGATTCTCTCTCATATCATTTTTCTTTTTCAATATGTCTTTGGGCTATTTCAGGACCTC
TTTCCTTTCCCAAATAAATTTCAGAGTTAGTTTTTCTAGTTCATTAAAAAAATGCTGTGT
GGATTTTTATTGGGATTGCATTGAATCTGTAGATGAGTTTTGGTAGGATAGACATCTTAA
TAATATTTAATCTTCCTATCCATGAACAGGGAATATTCCTCCATTTATTTAGGTCTTCTT
TGATTTCCTTGAACAGTTTTGTGTAGTTTTCTGTGTATAAGTCTTTTACATCTTTGGTTA
AATTTATTCCTAGGTATTTGATTTTTTAATTTACTATTGTAAATGGTATTTATTTCTTGA
TTTCCTCCTCAAATTGCTCATTATCGGTGTACAGAAATATTACTGATTTTTGTGCATTGA
TCTTATACCCTGCGACTTTACTGAACTCATTTATAAGTTCTAGAAGCTTTGTTGTAGACT
TCTCAGGGCTTTCTATGTATAGGATCATGTCATCTGCAAATAGTGGAATTTTGACTTCTT
CGTTTCCTATTTGGATTCCTTTTGTATCTGGGTCTTGCCTCAGTGCTTAAGCAAGTACTT
CTAACACAATGTTAAATAGAAGGGGTAAGAGTGGGCATCCTTGTCTTATTCCTGATATTA
GAGGGGAAGATTTTGGGATTTCACCATTGTAAATGATGTTAGCTGTTGTTTTTCATATAT
ACCCTTTATTATGTTCAGAAAATTTCCTTCTATTCCTATCTTTTGCAGTGTTTTTATCAA
GAAAGGATGTTGTATTTTGTCAAATCCTTTTTCTGCATCTATAGATATGATCATGTGATT
TTTTCCCTTTGATCTGTTTGTGTGATGTTTTACATTAATTGATTTTCTTATGTTGAACCA
TCCTTGCATACCAGGAATGAAACCCACTTGGTCGTGGTGTATAATTTGTTTAATGTATTG
TTGAATACCATTAGCAAGTATTTTGTTGAGGATTTTTGCATCTAGGTTCATTAGAGAGAT
TGGACTGTAATTTTCCTTTCTTGTGGTGTCTTTGGCTTTGGTAATAGGGTAATGTTGGCA
TCGTAAAATGAATTAGGCAGTGTTCCTTCTATTTCCATTTTTTGGAAGAGTTTAAGCAAA
ATTGGTGTTATTTCTTTCTGGAATGTTTGGTAGAATTCACCTATGAAACCATCTGGCCCA
GGGCTCTTCTTAGTTGGGAGGTTTTTTATGACTGACTCTATATCTTTACTTGTGATTGGT
TTGTTGAAATTTCTGCAGTGTTTGCCTCACGTATTTGGAGGCACCCTTGTTAGAAGCATA
AATATTTATGATTGGTCTTTCTTCTTGAAAGATTATCGCTTTCACTAATATGTAGTGTCC
ATCTTTGTCTCTCTCAAGTGTTTTGCATTTAAAGTCTATTTTGTCTGATATTAGTATAGC
TACACCTGCCCTTTTTTGTTTGCCTATAAGATTGTTTTCCAGCCATTCACTTTCAATCTC
CTTGAATCCCTGAGTCTAAGATGAGTTTTTTGTAGACAACATAGAGATGGGTCATATTTC
CTCATCCGATCTTCCAATCTGTGTCTCTTAACAGGTGAGTTTAATCCATTAACATTTAGT
GTTATTCCTTTCAAGGAATTATTTATATTAGCCATATTTTCTTTAGATTTGTGTTTGTCT
TATGTTGATTTTTTTTCTCACTTTGTAGTTTTAGTTGTTCTTACACTCTCCTCCAACTCT
GTCTCTCCTGTTTTTTTCTTTCCTCCTGCAGAACTCCCTTTAGTATTTCTTGAAGGGCAG
GTTTCTTGTTGGCATACTCTCTTAGTCTGTTTATCTGTGAATATTTTGAACTCACCATCA
TTTTTGAATGCTAGCTTTACGGGATAGAGTATTCTTGGTTGGAAATTCTTTTCTTTTAGT
ACCTTGACTATGTCATACCACTACCCTTCTTGCCTCCATGGTTTCAGATGAGAGATCAGC
ACTTAATCTTATGGAGCCTGCCTTGACAAGTATATGTCTTGGGTAGACCTGTTGGAATTT
ATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCTATAATATGTATGTTTGTACGTTTTGTGTTGTCATTCAGGTCCCTAAGTCCCTGC
TGGATTTTTCCTATCTTTTTATTGATTAATTCTACTATCTGTTTGATTTCAGATGTACTG
TCTTCTGCATCACTAATTCTTTCCTCTGCCTCTTCAAATCTTCTGTTTTTTTCTGAGAGT
GTATTTTTGATTTCTTGGATTGTGTTATTGATCCCCATCATATTTGTTATTTTTTGTACA
TGATCACAATTTCTTCTGTATGCTCTCCAGGTGTTTTCTTAATATGCTTAATCTCTTCCT
TCACTTCATTGAATTGGTCCATGATACATGTTTTGAGAGCTTTAATTACTTGTTTGATGT
TCCACTTCTCTTCCTGATTTTTAGTTTGTTCATTGGATTGGGCCATGCTTTCCTGAATAT
TGGTGTGGTCTGTAGGTTTTTGTTGTTGTCTGGTCATCATTTTATCTTGTTGGGTTTATT
CTGTTGATTATCTTCTTATTCTAGTCTTGGGGTTTAATTAGTTGTTGTTTTTTTGTGTGT
GTTAAGTCTTCTCTTTGTCACTTTGTTCTTCTTATTCTATTTCCTTGTTGTTGGCTAAGT
TCCCTTGAAGGAAAATATTAGGTCCAGAGAAAGCAAAAGGGGTAAAAAAGAAAAATATGA
TAGTAGTATTGATAATGAATCTTAGCAGAAGAACCACGTGAGATCTAGGAGAATGGATAT
AAAACTCATGGAAGCTGTGTATAGTTATAACCTTAAAAAAGTAGAGTACCTATAATGAGA
TATTAAACTGAATATGGGGAGGAATATACTATGAATTAAAAGGTTAGTGTGGTCAGGAGA
GAGAGAAAAAAGAGAGGACAATAATAAAGAGTGAATAAATTATATAAAAGATTAGAGGTA
TTAGATATAAAAAGGACGGCAGACTTGGCCCAGTGGTTAGGGTGTCCGTCTACCACATGG
GAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCTGTGTGGAAGTGACCCACGCGCAGT
GCTGATGCGCGCAAGGAGTGCCGTGTCACGCAGGGGTGTCCCCAGCGTAGGGGAGCCCCA
TGCGCAAGGAGTGTGCCCCGTAAGGAGAGCCACCCAGTGTGAAAGAAAGTGCAGCCTGCC
CAGGAATGGCACCGCACACACGGAGAGCTGACACAACAAGATGACGCAACAAAAAAAAAG
AAACACAGATTCCCGTGCTGCTGACAACAACAGAAGCAAAGAAGATGCAGCAAATAGACA
CAGAGAACAGACAGCTGGGGTGGGGTGTGGGGAGGAGAGAGAAATAAATAAATCTTTTTT
AAAAAAGAAGATATAAAAGTCAGTAATATTGGGGGCTAAATAGAGGTGTAATGTAAGAGA
AACAATAAATGATGGAGGAGAGAATGATGTAAAGGAAAGGGGATAGCATTGGCAGCCAAA
ATTAGTACACACAGAAAAGAGAAAATTGAGGATGAGGAAGCACAGCAAATAAGAATGTTG
CCTGCAGCACTAATATAAAAAAAAGGAAAAAGAAGGAAAAAAAAGCAGAGTAAGAAAAAG
AAGGGGAAAAAGAAGAAGAAGAAGAAGAAAAGGCAGTGGTAGGGATAAAGATGAAGCAAA
AAACAAGAACACAAACCAACAAGAAGACCAGACAAGGTCTCAGGCAAAGAATCCTCTTTG
CAATTGAATAAACTTCTTAGGAGTCTGACCTTCCCCCTTTCTCCCTTCCTCACTTCCTTC
TCTCCCAAGGCAGCAGGAGGGCTGCATGAGGGCTCCTGTAGGAAATTCAATTGGGTCCCT
GGTGAACCAACTCACCTGAGCAAATAATGACTCTTAATTTCTTGAGACAGCACTCACACC
CTGCCAGGAACCCTAAATATGCTTTTGGAATCCTGTAAAGCACATGCTACTGTCCCTCTC
CCTTAGGTGTGGTACAAGGAGGCTAGTTAATTTTCTGACTCCACCTTCTCCCAGACAAAG
TTTCCTATCCCAGGATGTTTAGGTAAATTGGGCTCTCTCACCAGATTTGCCTCTCCTCTC
TTCCTAGACTCTCCCCAAGTCAGCTGATATGCTCCTCCATACTCAATAAAAGAGTTAGTC
CGCGATGGGAGTGGTAGGGCAATGCCAGATTTCGGGGAGTGTTGGGCTCGGGAAACAGAG
GCCCGGAAGAATGTGGACTCTGGGTATGTAGGTCTGTGAAATGTGGGCTGCGGGGGTTCA
GGGGACACAGGCTTGGGGTTCACGCGTTTGGGAAACACAGGGCTTGGAAATTCCACCCCA
CAACCGGCATTTCTCAGTGAACGCTGCGGCTCTTAGCCCTAGAGGGGGAGGGATTTACCT
CCCCATGGCTTCTGAGTTCAGTATTAGAAACCCACAGTTCTACCTTGAGCAAACACCAAT
TCTTCTGCAATTTCGCCAGATCGATGTCCAGACATCTCCTGCCCTGCATGTTCCCAAAAC
AGCCTGCTCCGGTAGGACTCCATCACCACCTGTATATATTTTTCATATATTTTCTTTCTC
CTTACCATGGGCCTAAAATATAACAAACCTAAATCTATATGACAATCACATCTGATTTGA
TACCAACCTAGCTTCAATAGCATATACATGCACTGTTTGAACCTATTCATCTTCCCACCT
TTCTTGGTGTGCTTTTTACAGTTTTTATTTTTTATATATACTGTATGCCCCAAACCATGG
ATTTATCATTACTTTTTATGTATTTTTGCATTACTGTTAGAAGTAAAAAATGATATTACA
TACCAAAAAATACAAAACAGTAATACTACTAGTATTTATAATTACCCATTTGGTTACCTT
TACCGGAGGTCTTTATTTCTTTATACCACTTTGATTCACTGTCTGGTGTCCTTTCCTTTC
AGTCTGAAGACCTTCCTTTTAGCATTGCTTGTAGGACATGTCTAGTGGTGACTAACTCCC
TCAGCTTTTGTTATCTGGGAATGTTTTAAATTCTCCCTCATTTTTAAAAGGCATTCTCAC
TGGATACAAAATTCTTAGTTGACAATTGTTTTTGTTGGCACTTTAAATATTTTTATTCCA
CTACCTTCTTGCCTCCATTGTTACTGATGAGAAAGGTGGCACTTAATCGTATTGAGACTC
CCTCGTACATAGTATTGTTCTAGAATGACTCTATCAGCTTTCAAAACCTCTCCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGTTGCACAC
TGTATTTTTTAATAGTTTTAAGTGTTGACTCTGCGAGTTTAGTCCTTGATTTGTCTTTTC
CTTAAGTTTGTATTCAACTAGAAATATGATAGAGATTTCTTTTGAGTATCAGGAGCTATC
AAAAAAAAAAAAAAACCCAACACTACAAACCTTTCACAGTCTTTGCAAATTGGCTTTGCA
ATAATTGGGGCTCTCCCTCAAAGTTTAGCCCTGCTATCAAAAAGATCAGCCAGAGGCAAA
TGGGAAGTATGGGGTTGTCTGAAAATAAAAGAGACTGAAGTGTAAAGCAGTAATTGAGAA
AAAAGCAATGTGACTCAGCTAAGGAAATGGTTGCTTTCTAAACCAGACTTGATATAATCT
AATCAAAAGACATCTTTATGGGAAAAGGGTTTTAAAAGTATAAAGTACACTGAACATAAA
GTATAATTAATAAAAAATTGTAAGAATAACCTGTAGAAGCACAACCTCGATGGAACACAT
GAACATTCTTCCTCCTTTTTCTTTTTTTTTAACTTTTTACTTTGAAATAGTTGTAGATCC
ACAGGAAATTGCCCCACCTCCCTCCCCAAAATGCACAAGGAGATCCATGCAAAGGTAACT
TTTTAAGGATGGAATTTGGAAGAAAATTGAAGGCTGAAAATCCAAAATTATAATCTTTAA
AAGTCCTATAGGGATATTGTACTATATTCCAGAATTATTATATTTATTAAATGAGAGAAG
AGGAATGAGATGAGAGAAACAAAACCTTTCAATTCTTAGTAAAGAAATTCTTATGTCAAT
AAGGTAATGTTAAAAGATACTTAGTATATGTAAAAGTTGGCATTTGCAGCAAAACTAAAT
TAGGAAATATTTACTGGATAATGTGTTGAGTTTTTTTGTTTTTGTTTTTTAAGGAAAAGA
ATTGTTGGAAAGAATTTCTATCAATAGAAAGGTTACCTGATTAATTTTAAGTAACTTATG
AATAGAATTTGCATTTAACTTTTAAAACCTTTTTTGCAGAGATTTGCAATTTGGCCCTTA
CCTTCGCTTGTAATGAGTTTTTAAATAGTCTAAGCCATTATTTTGCTTTCTGCACAGTTT
TTTTCTTATACTGATTAATACCCTCCTACACAGGTGTGTCAGTGGTTTCCTGTCTGTGGA
CATGTAAGAATTGGAGGCAGAGGTGGACTTGGAGGAGTCTGGAGCCAGCTTGCTCCCCAC
AGGCCCAAGATCATCCTTTCCCATATAGAAAATACTAAAAAAAAAAAAAAAAGGAGCTGA
TTAGTATTTGAGTAATCCAAGCCAATTTAAAAGGAAACATCACTAGTTAACTTTAGGTTA
CAGCCATATAAGATGAGAAAATTGAGATATGGGGGCTTCCTTACCTGAGCTTTGTAACTG
CTTAGTCAGATATGTCTGGAAGGGGAGCATTTATGTTAGACATGTGCCAGGACACCTTGG
CTCTTGTTTAAAATCCTTTAAATATTGACTTTTAAACCTAAATAATAGGAAACAGATGTA
GCTCAAGTGGGTGAGCACCTGCCCCCCATGTTCGAGATCCTGGATTCAATCACTAGTACC
TCCTAAGGAATAATAATAATAATGATAATAATTGCATGCCAGTGCTGTAAGAGATCATAA
AAACTTAACATTTGTGTTTTGCACACACAGGAAAAAAAAGACTTAGCACATTAACTGAGG
TAAACAAAACTGGTTTAATGACTCTGGTTTGTTGATTTTTCTTCCACTCTGACTATCCAT
AAAAATGAACTTCTCTTCTAAAAAATGTCTTTAGAAATGGCCTACATTGGCCATTCATTC
TTTTTGCCTTGAGAAATTGCTGGGGATTTCTGTGTTTGTGGTAATGATTTTTTTTTTCAA
GGTTTTTTAAATTTCTCTTCCCCTTTCCCCCTGTTGTCTGCTCTCTTGTGTCCATTCGCT
GTGCATTCTTCAATGTCTGCTTGCATTCTTAGCAGCACCAGGAATCTGTGTCTCTTTTTG
TTACATCATCTTGCTGCATGTACCAGCTGTACGTGTGTGTGGCACCACTCCTGGGTGGAC
TGCACTTTTTCACGTGGGACAGCTCTCCTTGTGGGGTGCACTCCTTGTGCATGGGGCTCC
CCTACGCGGGGGACACCCCCTGCATGGCATGGCACTCCTTGTGTGGCAGCACTGTGCGTG
GGCCAGCTCACCACGTGGGCCAGGCTGCCCTAGGTTTGAACCCTGGACCTCCTGTATGAT
AGCAGATTGTTAGTTGAGCCACATCTGCTTGCCTGTCGTAATGATTTTTTAAGGATTTTC
AAAAGACAAGAAACCTATATATTGTCCCCTCTACGCAGTAAAATAAAGCAAACAATCCAA
TTAGAAAATGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGTGTTTTGATTC
ACCATGGAAGTCAGAGCATTCTTTTGCTATTGGAGGATTATGTTCCTTCTGGATTGGTAC
AATAATAATAATTACAATTAATATTATCACTTACTGAGTGCCTTCTATTTGTGTGTATAT
ATTTAATCCTCATGATAATCTTGTAAAGATTATTGTATCCCAATTTTAGATAAGGAAACT
AAGGCTCAAAGAGACTAATTAATTTGCTCAGTAATAGGAAAGGCAAGAAGTGGTTGGTGT
CCTAATGGAAGAACTCTAGTTTTAGGGTCAGATCTAAGTTTAGCATCTTCCTCTTAATTC
AACTCAGCTGTGACCTTAGGTCGGTTTCCTAACCTCCTTGAGGTCCTAACAGGATACCTG
GCATATAACGGTTACTATAGTTGAAACAATTGCTTCTCAAGAAAAAGCAAGAGGAAGTAG
TTAGAACCTTCCTCCAACTTCCCTCGATCTACATCTCCTATGGAGAAAGCAAACCTGTGA
GAAATGGAAGGAGCCTTAAATAAACACCTAGCCCAGTTTCCTTATGAATTTCCCAAGATC
AACCAACAATTCAGTGCCAAAGCTGGGATAATAATCCAGCCCATTAGTTCAGATGAAATT
CATCTCATAAATATAATGCAGTTGTTTACGTTTTGGGAGTTAGGGTTGGAGCCTCTAATT
GTATGGCCTTGGCCAAGTAACATCATTAATTTGAAGCCTCAATTTCCTCATCTATAAAAT
GCAGTTACCTACCTCAAGGGTTATAATGATAATTAAATGAGATAATAATGTATATAAAGC
ACTTAGCCCAGTGCTTGCATGTAGCAGTTGTCCAATAAATGTTATCTCCTATAAATTTTA
CTATTTCTTTAAAACAATTTATCAGAATTGGTCTTCTGGCTGGACATGCTGCCCCAAGTC
AAATCTACAATCAAAATGTATCTTACAATTTATTTATACATTTAATGTAGTGTTTCTTCT
TTTTTCTTTTCTTTTTTCTTTTTTTCCTGTTTCACTGAAAAGCTTTTACAGGCAGGTAGG
AGTCGTATAATCAGTGCTATCTTAGACTTGGAGGAAGAGGTTGTTCCTCCAAGGCTGGGC
CATAATATGGATCTCTCCTGACTCCCAGGAACTCATTCCACACTCCCAGGTGCCTCCCAC
ATACCAGCCTGAATATGTTCATGTTACAACTAGGAATCAAAGAGCCACCCTTTTAAAAGG
AAACTTCTTTTACTTATTGTGAAAAGATCGAGGGAAAAGAGAATTGAAAACCCCAGGCCT
TTTGCCCTTGGTATCATTAGCCTTATTAAAGCTACATATCTCCAGTCTTTATCATACATG
AAAGAGGAAAGCCATGTATGTTTGTTTTCTCCATTCTGAACTCATTCATGAGACTCTGTA
GACAATAACTGCCATTTAGGATGGCTAATTATGCTGCTTAATTTTATTTAAGGCTCTTGC
AAGAATATTTGGATGACCTACCCTTTATTATGTGATGGAACCATTAGAATAACTTTTATA
TTGCATTGTGGTTTTCTCTTAAGTGCATTCCTGTTGTGCACAGATGAATTTGTAATGCAG
AATGTCAACATAGATGATATTTAATTGTACCTGCTGGTCTCATTCATTAGAATGTAGTCC
CCGAGAAATAACTAGATAGATATATTGGTTGTTGTCTTTTCATAAGACAATTAAACATAA
TGAAAGAGGGTTGCTGAAGCACCCTGGCACCGTGCTAGGAGAGGTTACTGGGAGTGGAGA
CCTGCTGATTCTTCCTTGGGCTCCTGGTAAACTTAGAGTGTCTTCCTGGCATTCAAGCAA
AACAATGTAATTGCTTCATAGAAGGAAAAAGTTGAAGAGAAGTTTATTTCTGCTTCCATT
ATCATCTTAGAACACAGCCACATGCCATATTTTAAAACTGAATTTTTATTCCCCTGACAT
GCTATTTCAGGCCTATTTCTAAGAGTATTCAGTGAGGCTTACCTGTGAAAGTACAGAGCA
AATTAAATGTTTTAAGTATAAAACAAAACAGAGGCCAAAAGGGATCAGAAATAGGAGATA
TCGCCACCTGATGTGAGCAGATCACAGCAAAAAAATTTTTTTTTAATTTTTTTTTCAAAT
TACTTGGTTTTCCTTTTCTAACTAGAGAAGTGAGTGTGCATAAAGTCATGATTTTCTTTG
GAACTAACCTTTCCAGGAAAATATCATATAGGTCCCTATTCAAAGCACATTGGGCCACTC
CAACTGTAGTTTTGTGAAAGAGCTTTTATTTATCTATTTTTAACAGTCCCCTCGGCACCA
AGCCAAATCCTGACTGAGGGAAATCTACTCTAACCCCCGATTGTGTTGGGGGCATAGGCT
GGGCAGTGGGCGGAGGAGCCTTTTGTGAAGAACTGTAGAGAGCACTGCTCTTGAAGGTTC
TGGCCTTTATTAAGCAAGCTTCAGCTTGATACTGTGTATGTGGATTGTTAAGTGGCTAAC
TGATGCAGCATGTGTAAAGATACAGTTTCCTGCATGAGGTGGTTATAGGTAGTAGCATGG
GTTGTCTCAACATGATACCAATTTCCACAGTCAATTTGGTCAATGCAGTGGGGAAAAAAA
AAAAATCAGTCTAGCCGTTACTGGAAGTTATTGAAGTAACTATAGTTTGTTAACTGAATT
TTTCATGTCTGAACTGGGTGTTTTCACATTTTGTAGGCATATCCTTAGTCATTTTGGGAA
ATAATCTTAAATACACTAAAGTGACATTGAAAATTTTAACTTTCTTTAAATATTTGTAAA
TCACTATTATTCAGGCCTTCTAGTGCATATCAGTTTTGAGGGGATGTAACTATTTTAGCA
TTAATTGTTGTTTCATACTTTGTTGGAGTAGAAAAGTGACCATGGTGACCACCAAAGCAT
TTGCTGAACTATGAAGTTAATGATAAGCCACGTTGGTTTGAGGCTGATTTTTTTTAAACA
GTGTTATTGATATATAACTTACCATAAAACTCACCCATTTTAAGTGGACAATTCAGAGAT
TTTTAGTAAATTCATAGAATTATGCATCCATTGCCATAATTCCAATTTTAAAAACATTTT
CTCCAAAGAATCCTCATGCTCATTTTCAATAAATCCCTGCTTGCAAGCCCAGCCCCCACA
CAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGTTCATGCTAGGATCTTGGATTAAGTCCAGAGGGCATTTTCCATTTCCATGACATC
ACTTTGCTTCTCCTAAGAGGATCTGACTAACAGGAATCAATTCTGACTCCTTTAAAAGCC
TATCTGTATAAAATGACAATTTTTTGTCTAAAATGAAATAAGGTAAGGAATGTCTGATAT
TAAGATTGGGACAGAAAGAAAAGAAAAAAAGATTGAGTCACTTTACATTGTACCTTTAAT
CTCACTTTCTCCAGCGTGATCTTGACTTTTTGGCCAAGATAGATAGAAACAAAAATTCAA
ATTAGGGAACACTAAACATGATATTTCATACTTAGTACAAAGGCAGTTAAAGTTACTTTG
GTTTTTCACTAAACTTTAGTGACTACTAAAGGCTTATGCATTGCATTAGCAGAAGTTTAT
TCCTCTTTAGTTTTGTGAAAAGGACCTGTAATTCTGGACTTCTACACACCTCATGGGTGT
TTTCTTTGAGAAAATGTCTCTGTTAAAATCAATGTCCTACTATTCATTTAAGCTCCCCTG
CCTTCAATAAAACTAATTGATAAACTCTAATAATTAATGACCTGATTAAACCAAAATGAC
TTGCATCTGCCCTCGTGATTGCCATTTATAATCAGTCATTTTAATGACTCATCTTTTCTG
CGCTTTGCTTACAGAAGAAAGGCTATAATGTTTTTAAGTGAGCTGAATGAAAAGCATTCA
ATTGCTGTTTGTTTTACATAACTTGAGATTGCATTAAAATAAGCATTGATATAACTACCT
CCTTAAAAGTAATCTTTCTGCCTAATCTGTTGTGCTATTGTCTATTGCTTGGAGTGAAGT
TGAAATCAACCACAACAAGCAAACAAATAAAAATCAAGTGGAGTTATAGAATTGACATGT
TTTAAACGAAATCTTAAAGGGGTAAGATCAGTGGGTATAAACTAGAATTGTTGCTATCTC
AGATATAAAATGGAATATTTTATCTGAGAATAGTGAAACTTAAATCAAGGAAGTATCATC
ATTCCAGCATTGAAATAGAACCCATTTGCTTCTAATTCTGCCACATGACTTCAGATTTAA
CCTAAATAAATGAAGTCCTAATATTATTTACATCTCATCTAATTCCCAAAAGGATTGAGG
TAGCTTACAATATAAGATCAAAGCAATCATGAAAACCAGAAGAAGAGTTTAAAAATAAAG
AGATTGTTCACAAGGGATCACTGTGATGGGACTTGTCCTCTACCAAAATAACTAGAAAAC
TGGTCAAAATATGTGAAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAT
AGCTAGAATATTAGTCACCAGAGATAGATGTGTAAAGAATGAAACTGAGTTTAATCTGGG
CAAAATCGCAAAAATTGTTTGGAAATGAATAGAAATGGTGAAAGCACAATCATAGGATTT
GTAATTAGTAGCACTAACATATGGGTATGATAGTAGGGTCTTTTGTTTTGGTTTTTGAGT
AATGAAAATGCTGTAATATTGATTGCCATGATAGATGTGCAATTTGGTGATTATACCAAA
TGCCATTGAGTGTACATTTTAAATTATATGATTTATAAACAAAAAAAAAATTAAGGTGAG
CTGGGGAAAAATACACCAAATATAAAATATGGAGATTAGTAGTAATACTTTGATGATGCT
CTTTCATAATTTGTTACAAATAATTCACAACAATGCCAAGCATTGGTGGTGGGATGATAT
ATGGGAGCCCTATATGATATTATAAATGTGGTTTTTTTTGTAAGTTCACAACTTTAATTA
TATACTTTTTATTTATTTATTTATTTATTTATTTATTAAGTATATCATGTATAAATGATA
TACTTCAATAAATTTTTTTAAAAATGTAAAAAGAAAAAGGGAAGCTAACGTTAGAGTGGA
GAAACTTAGCACGCATAACCTTTACCAAATGATTAAGGTGAACATAATTAGTCAACACCA
GTCATATTGATATCATGTAACCCCTGATATGATGTGATAAGAAGGGCACTTTACCTCTGT
GGAATTCTTCTCCAAATTCTGTTAACCCCTGTCTAGCCATGAGAAAAACCATGAGACGAA
CCAACCCAAATTGGGGGGCATTCTATAAAATATCTGACCAATATACACAAAACTGCAAAG
AAACTGAAAATGTCACAGATCAGAGGAGACCCAAGAGACATGATGACTAAATGCAAAGTG
TTATTTAGATGAGATCATGAAGCAGAAAAAGGACATGAGTGGAAAATGGTGAGCTAAAGT
CTGGAGTTTAGTTAGTAATAATTTAATATGTAATACGGCTTCTTCGTTTTGGCAAATTTA
ACATGGCAGTGAATGCAAGATATTAACATTAAGGGAAGCTGGGTGGAGGGTATATAGGAA
TTCTGTATTATCTTTGCAACATTTCTGTAAATCTAAATTTTTCCAAAATAAAAACGATTA
TTAAAAAAACAGGAGCAGACCAAGATCAGAAACTAGAAGACAAAGTATGAGTAGGTTGCC
AAAACAAGGACTGTAGAGCAAAAATGAAATCAGGGATAGATAGAATCATACTGGGTTCAC
AAAACTGTATGCATACATGTCTAAAAAGGGTGAACTTTACTGTATGTAAATTATACCTCA
GGAAACAAGACTTAAAAAAAAAAAGTCATTCTCTTACATGTCAGCAGCAGTATTGGAGAA
GCTGTACTTTAGAAAGGTATTTACTCTATCCAAAAGACAAGTCTTTGTTTTTATATAACT
TGTTTTTATTTGAAAAGTTGTGTACTTACAGAAAAATCATGCAAAAAAAGAGTTCCCATA
ATACTGACCCTATTATTAATTCTTTGCATTAGTGTAGTACATTTGTTACTATTGATGAAA
GATGATTATTATAACTGTACTTTAACTATAGTCCATAGTTTACATTAGGGCTCACTATTT
GTGTGTTATAGCCCTATGGTTTTGTTTTGTTCTATATTTTGAAATTTTTTATTCCAGTAA
CATATATACAGCCTAAAATTTCCACGTTTTAACCACATTCAAATATACAATTGAGTATGT
CATTCATATTCACAGTTTTGCTGTTATTACCACCATCTATTACTAAAACCTTTCTGTCAC
CCCAAACAGAAATTCTACACCATTTAAGCATTAACTCCCCATTCTCCATCCCTACCCTGG
TCCCTGATAACCTGTATTCTAGTTTTTCATTCTATGAATTTGCTTATTCTAATTATTTCA
TATCAGTGAGCTCATATCTGTCTTTTTGTTTCTGGCTTATTTCACTCAGCATGTCTTCAG
ATTTCCTCCATTGTCACATGTTTCATTCCTTTTTACTGCCAAATAATATTCCCTTGTATG
TATAGACAACATTTTGTTTATCCATTCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTCTGGGTCAGGGTCACCTAG
GAGAGGGAAAAGGACAATGGAAATTCATGGGGAATGGTTGAACATTTAATGTTCATTTAA
ATATGCATTTAACCACCTTTCACCCCACGTGCCCTAAATTCACAAGGAAGGACACAAGCT
GGACCTGGGCTCCATCTGCCCCACTCCCCCCTCCCCAATAGGTTTAACAGCCAAGATGGC
GACACCTCCGAAGAATATGAGTTCACGGAAAATAATAAAATATCTGAGGATTGTCATCTT
TATATATAAAAAGGGTGATATGAAATCATAGCAGACAAAAGTAAATTAAAGGATGGGACA
GAACAAGAATGTAAAATAAGTATATAATTATGATTCTCAAAGAGATAAGGGAGGATATTG
GTGACATGAAGTGGAAATGTGCAGTTATAGAAAGAGACGATTGGAAATACCAAGTATGAA
GTAAAGAACCCAATAGATGGGATGAATAGCAGACTGGATGCAGCTAAGGAGCAAACAGGT
GAATGGAAAGACCGGGTTGATGTTAAAATGTATCAGAAGAATGGGAAGCAGACTTGGCCC
AATGGATAGAGTGTCCGCCTACCATGGGAGGACCACAATTCAAACCCCGGGCCTCCTTGA
CCCCTGTGGAGCTGGCCCACGCACAGTGCTCATGCATGCAAGGAGTGCCCTGCCATGCAG
GGGTGCCCCCCATGTAGGGGAGCCCCATGCATAGGGGAGCCCCATGCGCAAAGAGTGCAC
CCCATAAAGAGAGCCACCCAGTGCGAAAGAAAGTACGACCTACAAGATGACGCAGCAAAA
AGAAACAGATTCCCGTGCCGCTGACAACAATAGAAGCAGACAAAAGAGAACACACAGCAA
ATGGATACAGAGAACAGACAACTGGGTGGGGGGTGGGGGAGAGAAATAAATAAAAAATAA
ACCTTAAAAAAAAAGTCAAGGGAAAACTGTCAACCCATAATTCTATTCCCAGTAAATATA
TCTTTCATAAATAACAACAAAATGAAGACTTTTTCAGACAGACAAAGCTGAGAAGATTCC
TTGCCAATAGACCAGCATTGTAAGAAAAGTTAAAGCAAGTTATTTAAGCAGAAGGAAAAT
GGAGGGTTGGATTTCCAGGAAGGATTGAAACCACCAAAAATAGTAAATATTTGAATAAGT
ATAAAAGACTTTGTTCTCACTGTTTCTCACTGTTAAATTTCTTTTAAAAGTATTTAAGGC
AAAAATAATGATAGTGTATTGTGGGATTTATAACAGGTAGAGGTAAAATGTTTGATGATA
GCAGAAAGGGTGGAAGGAAGAAAATTTAAATATACTGTTGTAAGTTTTTTACTTTTTAAA
TAAAATGCCCGAATATTATTTGTAATAAGTTGAAGAATCATTTTCTAAATCCTAGAGCAG
TTATAAATAATAATAACAATAAAACAAGGAGTATAACTTCAAACAGGGATTGGCAAATTT
CAGCCCATGGGCCAAATTTGGCCTACCAACTGTTTTAGTAAACAAGATTGTATTGGCACA
CAGCCATGTCCATGCATTTACATATTGTCTGTGGCTGCTTTTGTACTATAGAGGTAGAGT
TGAATAGTTGCAACAAAGACCATATGGTCTTCAAAGCCTAAAATATTTCCTGTATGGCCC
TTTAAAAAAAAGGTGTGTCAAACCCTGGCTTAGAAGCCAATAGTAGAGATAAAATGGAAA
TCTAAAAATAGCTCAGTTAATCCAAAAGAAGGCAGGAAAAGATGAAAAAGAAGAACAAAG
TACAGATGGGACAAATAGCAAGATGGTAAATTTGAACCCAGCCATATAAATAGTTACATT
AATTGTAAATGGTCTAAACACTCCAATTAAAAGCCAAATAGGCTTGTTTAAAAAGCAAGA
CCCAACTGTATACTGTCTGCAAGATACCTACTTTAAATATAATGATAGATACACTATCCA
AACACTAGTCATCAAATTGTTCAAAGCAAAAAGTATAACGACATATTATGGTATATAATG
TATGTAGAAAAAGAAAAAACTAATCTATAATAACAGAAACTAATCAGTGGTTACGAGAAG
CTGGGGGTCAGGCTAGGTTTGGCTGTAAAGGAGCACAAGGCAACTTTAGTGTGATTGAAA
TGTTCAGTACTTGATTGTGGTGGTGATTACATGGATATATTCATTTATCAAACTAATCAA
ACTATACATTCAGATTGACTGCAATAAAACTGATATAAAAAAGTAAAGTTGATTTATAAA
AGTAAAGAGAAACAAGAAGACATTTCTCTTGAGAGATTCTGAACTATCTAGTAGTTAAGT
AGTGGGTTTTGTCAGTTTTTCTAAATTTCTGGGCCTATAGTCTAGGCGATCAATTTGCCA
AATATTTAAAAACTGTCCCAAAGTTTCTGGTTCAGTAGATATGGGGTGAAACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCTCCTTCCCAGGCAGAATTCAT
GCTTTTCCACCGTTAGTATGTTGCCGTCTTTTACTAGAGACATCATTCACTCCCCATTTG
CTCAACAAATATTTATCAAATGTCTCCAGTTTGTACCAGGCACCATTCTAGATGCTTGGG
ATATAGTTATGAACAGAACAGATTAAGACTCTGTGTTCATGAACCTTCTCATCAAGAGAG
GAAGACCAAGAATAGACAGATTTACACACTCAGATATAGTATATCAGTGGTGCTAAGTGT
TAAGGAGAACATTGAAGCAGGGAAAGAGAGAAAGGGAGTGTCTGGGTTGGGAAAGGTATT
GCTGTTTCATCGTGGGTGGTTGAGGAAGTCATCTCTTATAAAAGTAACATATGAGCAGAA
ACCTTAAAGAAATGAAGGAGTAAGCCATATGTATGAGCAGAACATCCCAGGGATATGGAA
CTATAGAACAGGAGCACGCCTGCCAAGGAGGCTAGTGGGAGAAGAGAGTGGGCAGGGAGA
GGAATGGTGAAGATGAGAGCTCACAGGTAATGGGGGCCTCCATTAGGAGGACTTGTTTTT
CCACTAAGTTGGGAAGCCTTTGCAGGTTTTAGGCAGAGAAGTGTCAGTAGAACATGATAA
ATAACTACTAGTAGACAGTGTCATATGCTTAGTTCCAAACAAATGGGACAAGCAGCAAAT
GCTATAGCAATTTAAAGGAAGTGGTGACTTTCATGACCTGCACAGTTGGGGAAGCAGGAG
GTAGAGTACGTGAGGCTGAGTAGGATTCACTAGTCAGAAAATATCGAAGAAGAGGGCAGG
AAGGGAGAGGAAACATGCCACATGAGCAGAGACTTAATGATGGGATTTTTTTTTTTAACA
GTGATTGAAACAGTCTAGTTAGAATACAAAAATTGGTTTGAGGATGACAGAAAGTCTACT
ACTTTCATGCTCAAAAAATACTGAAAACTAAGCTGAGAAGTGAATATGCAAAAGTCAAAT
AACAGACTTACATTTAAGTTAAAAGAAGATGCTGTTGTTGGAGAACCGAAAAATGCAGTA
AAGTTCTTATATATACACCTAATCTTTTAGAATATAGTCTGACAGTTTTGTTGTTTTGTT
CTTTTTCTCTTGAGCCACTTAAGTCAAATGTGTGTCTGATTGAAGCTAAAAATTTCCTGC
TTTTAGAAAATACCTCCTGATTTCTAGACAGCAGCTCCTTCTTCCAGGAGCTCAAAATAT
TTGTTCATTAGCTGTCTCCATCTGATATAGTGGCTTAAGGATGGTTTAAGGGCACTGGTA
TATAAAAGAGCAGATTGTCCAAAAGAAAAATATTCAAAACTTGAGAACTGAATTTGTAGA
AATAAGATAAGGCCAGGCTATGAAGAGTCTAACATTTCTTTCAGCTCAGCAAACATTTAT
TGAGTGTCAACTATGGGCTGTCTGTGATGTATTATGCTGAATACCCCTGATGGAGGCGGG
GAATATTTTACTTCATCCTTAAGGAGTGAAATGATGTAGTGAAAGTGGTATATTTAAGGT
TTAACATGATGATAGTATAAGAAATATATTGAAATTGGAGGAAATGAGTCAGAGAGACCA
GCTGGTGAGAGAGCTTAAACCTGCCTTACAAATACCAACTTGTATACAAAGAGAGAGTGC
CCCCACCCCATCCCAAAGAAGGGGTATAGTGTATGCTAACTGAAGGGCATGCTACAGAGA
CCTGTTCTATAGCTAACCCCACATCACTGAAAAAAAAATCCTCAACATAAAATAATGCTA
TATGCTTGTGGTTTTTCATTCATGTATTCATTCTTTCAGTCAACAGATATTTATTCAAAA
CACTTAGTGTATGCCAGACATATTGTGAGGGCTGGGAGTAATGTAGACAATAAAGAAGAC
AAAGTTATTGCCTTCACAGAGTTTACATTCTAGTGTCACTCATTCAGGCAACACTAATGT
ATGCACCCAGCACATTGCCAAGCACATTAATGTATAATAAGTGGTGCTCAATAATTGTTG
GTTATTGAGAGTGAACTTGGAGTTTGAATTGAGTGCCTACTCTCAGCAAGATACTTTGTT
GAGTACTCTTTTGCAGGGTAGAGATTCAGGGCAAAATTAACTCATTAAATTTTTTTTTTC
ACTGTTACATGAGAAATTATGAATCTCTTGTCCAGTTTTGGGGGTAGTTACAGTTGTAAA
CATAATCAGTTGTCTGTTCTAGACAACTTTTGCCACTGATGAAGAAGTGTGGAAGCAGGT
GCTGCTGTGCATCATCAAAAGTATTGCGCTCTTGTCCTGCTTGGATGGTTTGTGTGGGCT
CCCTGAATTCCTGAAAAGGCTCATTGTTGTCACTGACGATGCTTCACAGAAACCCTTTGT
GTCATTATTTAGCGACTGACTGCTTTGGGAAAGGCTATATCAATTCTTTTGTTAACAATA
ACAGCAGTCAAAAATGGTGTAAGGGAGTCAAAAATGATGAAAGGGAAGAGAAGGATAAAT
AAAACAGACTGAATAGGCATGCATGCACACAAACACACCACATCTTTTAGCTAAATTTCT
GGGTGATTTATCTAAAGTAATATTTGTCAGGTAAAACGCAGGAAATAGTAAAACTGCATT
CATTTTCTCATCTCTTTCAGATATAACCTCTTACCAGTAACATATGCTACTTTTTTTCGG
CTTCCCTTTGGTGTTACTGCTTCTTGGGGAAGAAGGGGGTGTAGTTTGACATTTGCACGT
TAAGAGTAAAGCTAATCCTTTTTGTGCAAGTTATTTGCAAGAAGATTATATTTTCTTATC
TTCCTAGTTTTCCTCAAAGGGGAGCGTAGAATGATGGGTATATTTACTGTTTTCAAAGCC
AAGATTTGATTTGACTTTCACTTGAGATAAACGCTTGCTTTTGTAGAAATCAAATATGGT
TGCAAGCAGAGGAATTAGGACCTTAAATTTTGCTTCCGGATAAAATGCTTTGCATTAAAT
TTGTGATTAGAATTTCTGGCTGAACAGATGATGTCATTTCTGCAATATGGTATAAAGTGT
GTGTGTGCTTTTTTTTATAACAAGCACTATAGAAACCAAATTAGTTACATGGACTTTCTT
CCGGTCTCTTTTTAGATGTGAAACCTTCTAATATGCTAGTAAACACAAGAGGACAGGTCA
AGCTGTGTGATTTTGGAGTTAGCACTCAGGTAGGTCTCTTTTTGCCTCCCAGTCTGTTCT
CCTTTCTGCAACAACCACTTTTTATTTTCCATCTACTCTCTGGATTGAAAAATCACCTAG
CCGCCAGATAAACAGAACCTCTGCATCTTCTCCTCGGCTGGGAGTGTGTTATTCATTTTT
AATCTCTGAGTGAGTTTCCTTCATCAGAATATGATTGTTCATTGTTTAATGGCAGTAAAA
ACTGCTGATATTGTAATTACTACTTACGAATGGCAAACTTCATTGATATGCAGCTTTGAT
ATGAAAACGTTTTGGCCAGACAAAAGGGAGGGCAAAGAGGGAGCTGTGCCTGGGGAGCCC
AACTGGCCCACAATAAAAATTAATATTGGGAGCAACAATGGTGGAGGGCCATTACAATGT
GCAGCACAAATTTTAATTAATTTCCATTTTGGGCCTCCCCTGAGAACCCTGGTGATAGTG
ACCCATGAGCGTGCTGTGATGTTGATTTGAATTGCAGCCACCTTTACTCCCAGCCAAACA
CGAAGACCAAAGCGAAGGTCATCGTTGTATTATGAGTTGTCAAAGTCTGTTATCCCTCCA
GCGTATTTAGTGTTCATTTCATTCTTGCAATGCATGGAGCTTCATTCACATCTTGAGCCT
TCTAACTAAAAAATGAATGTGTTCAAATTCTACTTCAAATTGACTTTTTATATCAGGCGG
GTTTGGGGTACTAAAGCAATAAGCATCCTGCTTAAGTGAATTGTTTTAAGGTTATCTGCT
ATAAACTGTAATGCTGTGTTTGTTTAAATTGGAAATCACATTCAAAAGAAAAGAGAGATT
TAATCATTTTTAATGCCTTTGTAGATAAATTTGTTCCCTTTTACATAATTTTTAGTTGAT
TTATAGGAATGATGATTGTAGGTTAAATGAGGAATAATTGCCCATTTTATTTCCACATTA
TCTTTATATTGTTCTAACAGACTGTTTTGTCTCATAGCTGGTGAATTCTATAGCCAAGAC
GTATGTTGGAACAAATGCTTATATGGCGGTAAGTAAACTTATGCAAAAATAACATTTAAA
CCAACATCTTTATCTTTATGTACTTGGTAATGTATAATTCTTGAATTAATTCCACCACTT
TAGCCTAACAGATCATAAATTACAGAGTCAATCCAGTCACGATCCAATTTTTAAATCTTT
CTTAAAAGACATTAGCGCTTATACAGGAGCTACCAACTTAATCTGATTTTGTTTACTTTA
ACTGGGTTGTTTCAAGTGTGAAATCACTGAGTTTTGAAGTTTAATCCTACAGAAAAATTG
CATTTTTATAGCATATTGGCTACATTGCCACATTGCTATTTAATTAATCCTCAATTATAC
CAAAATATCAGTCTGTAAGATTGGTTTTCTCCAGGAATACAAAAATGCTCTTTCACCAGA
TCAAAATTAGATTATCGATGTAACCAAATCTTCCTTATGGATCTCTGAATGTAAGGGCTT
AGCAGGCAATTTTCTTTAGAACTTGTACTTCTATATTTTATTTAGTTGTTGGACTCATGC
CTATTATACCTTAGTTGCACTGTAATAAATTTACCAAGAAGAAAAATTAGAAGCACAGAA
CTGTTTCAGTAACCAGTGTGGACTTGGTTTTCACACACTCCCCTTTTTTTTTCTACGTTT
TGAGTAAGAGAAGTTAACTTGTGTCTATAAAAATGCTTTTGTTTATTTCCAAAATCACTT
CAAGAGTCGGGGACAGAAAGGAGGAGGCAAGCAGGAAGCTTATCTAGTATCATTTTGGAG
TGTAGTTTTTTTTTTGTTTTGATATCTTAAGGTTAATTTTCTTAATAAGGGCTCTAGCTG
TATTTAGATAGTCCTTTTCTCTTCCATCTATTTTTATAAAGCATGAAGTTAAAGATGTTA
GTATGAATGAAACCCTGGATTTTTTTCACAGTGTTCTTTGTTCCTATATTATCTGATAAA
AAGATGTTAATATGGATGGAACTCTGGATCTCAGAACAATACTAAGCATTTTATTTTCAT
TTGGATATCAGAATAATTGATAATCTTGCATTGTTTTTTAAGGAAAATTAATTCTTTCCC
CTTTTTCTAAATAAGGTGGAAAAAAATGAATTAATCTCTGAGATTGTATTTGTCCCTATA
AAAGTAGTCCCCTCTTACTGACGCTAACCAGGTTAGAGATTGGTGAGCCACCTTATTGTT
AACAAAGCCCTGCTGAATGTTGTATTTTCAGTCTTTGAAAGATTATAAAGCACCGTGAAT
TTAAAAAAAAAAAAAAAACTATACCTGAAACAATTTCTCAGCTACACATCATGTCCTCAG
TAGCTTTAAATTACTCTATTGTGTGTGATCTATGTATCTTAAAAATAAATAAATAAATTG
TTCTAATAATTAAATTGCATTATGTTTGAATGCACAAACCCAGATTACAGTTGTCTTCCC
CAGGTGTACATTAAAGAAATTACTCTTTTTTCTTTCTGTTTATGGATGAATGTGATGCAT
CTATATGTTAATTGAAAATGTGAGGATTAAAATTAAGAAACATTAGCTCACAATGGCAGA
GCTAAAATTGCTTTGCTTCTTGGGTGAGTGAATTCCAGTCATCAGCTTTGTAGTTCAAGG
TGTAAAAAGTTTAAGATACCTACGAAGCAACAAGTGACAGCCTGATGGTGAGAACAAGAG
CTTCTGTTTGAATTCAGCAGACTCTCATTGGCCAGTTGCTTGCCTGTATGATGAGAGATC
AAAGATTGAGGGGGGAAAGGGAATACGAAAATAACATTTATGATTATGTAACAGATATTA
GTCCCTGCTTTCTAGCAGCTTAAAATCTTGTAAGATGGAGAAGGTCTGGACTTACTTTTT
TTTTCTTCTTTAAAGTATGACCGATACCACATTTCAGCTGGTCTAGTTTGTAACTTCGAG
TTCTACATAAGGCTCTATGGCAGGGGTCAGCAAACTACAGCTCTCAGGCCAAACTTAACT
TATGGCCTATTTTTGTAAATAAAGTGGTCTTGGAATATGGTCATACCCATTTGTTTACAT
CTACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGATTCCCAGTGC
CTCCTAGGGAAAAAAACAAACAACAAGCAAAACGAATGAATAAGCCAACTCAGCGGAGCG
GATGCGGCTCGTGGCTGAGGTACCTGGTACCTCAAAAAATAAATAAATAAAAGATAATTA
GGAAAAAGACAGGGAGACTCCTGAAGGTTCTAAGTCTTTTTTTTTTTTTTTTAAATAAGG
GACACGTTAAGTAATAGCACTCATAGAAGACTTGAAAAGTCATCTAATTTAACCTCCTTA
TTGACAAAATGAGGTATGACTGAGACAAGGATGCACTGCTTTTTAAGGGCAGATAATTAG
ATTTAATCCAAAGCAATAAAAAAAGATTCAGCACATTTTAAAAAGACTTCGTTTAGAAGG
AAGGGGTCCAGAAAGGCTTTGGGGCTTATATTTAATTAAAATCTTTTGTCAGATATTCTA
ACTACTTAAAGTTTTACTCTATTTTTAAAGATAGAAGCCCCTAAAACTTTAACCCACTAT
TCAGTAATTGTGGTTTGTTAGAATTTTCAAAAACTCAATCTAAGTTTGATGTCTTCTTTA
TGAATAACAAGTTTTAGAATAAAAGCCAATCTTACAAAATACCTGTTACATGTCCTTTGG
AGTCAGAGAGTCAGTCTAAGGGATTATATTTATCACTTAAATGTTTTTATCCATCTGTAC
TATTCCTGTCCTTGGAAATTGTCTTTACCCTGAGTAAAGGCCATTTGGGTTGCATGATCC
ATCTCAACTGGTCATGCTCATGGCAGTGTTGGTGATGGAACTGGTGATGATTAGAAAGAA
GCTAACATTTACTGTGCATTCCTATGTGCCACATGCTGGACCAAGCATGTTACATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCTTTCATTAGTGTGGTACATTTGTATAATTGATGAACA
CACGTTGAAGCACTGCTACTAACCATGGGCTATAGCTTACGTTATAGTTTACACTCTGCC
CCATGCAATTTTATAGGTTATGACAAAATGTATAATGACATGTATCCATCATTGCAATGT
CATGCAGGACAGTTCCAATGTCCCAAAAATGCTGTGCCATTTTCATCTTTATTTTGTTCA
GTTGGTTGAATAAATTTGCAACACTCAAACATTTGAGGTGATAGTTGTTAAAAACAGCGC
CAGCATTTGATCGAGTTTCATCTCAACTATATTATACATGGACATTTTAGATGCTTATCA
TAGGTCTTTTATTGGGTGAAAGTAAATATATGAGATAAATGTGTGACATTTAAGAGTAAT
GTTGTCTCTGAAAAACTTTTAAAACTTAGTTGACAAAATTTTGGGTCAACTGGAAAAAAA
AATCATGACTTCTGAAATCTCTGAATGCCTTGGTTCTCAGTAATACCATTCTTTATAAAA
TTTATTTCTTATTAAAATATGTAGTTTTTAAGACATTTTTTCTAAGTATTATGTAATTTT
TTTAGAGTGGGTAGAAAGGAGTGTAGCTTCTAAGTTACCACATAGCCAACATGTTGGTTT
TTTTTTAAGATTTATTTTTTATTTATTTCTATCCCCTTCCCACCGCCCCCTCCAGTTGTC
TGCTCTCTGTGTCCGTTCACTGTGTGTTCTTCTGTGACTGCTTCTATCCTTATCAGTGGC
ACCAGGAATCTGTATTTCTTTCTGTTGTGTCATCTTGTATCAGCTCTCCGTGTGTGCAGT
GCCATTCTTGGGCAGGCTGCATTTTCTTTCGTGCTGGGTGGCTCTCCTTCCAGGGCACAC
TCCTTGTGCATGGGGCTCCCCTATGCGGGGGACACCCCTACGTGGCAGGGCACTCCTTGC
ATGCATCAGCACTGCGCATGGGCCAGCTCCACAGAGGTCAAGGAGGCCCAGGGTTTGAAC
CGCGGACCTCCCATGTGGTAGGCAGACACCCTATCCTTTGGGCCAAGTCTGCTTCTCACC
AACATGTATTTTTGTCTCTTCTTTATTATCTTAGTAGTAGTTTTATGCTATGTATGTACC
ATAACCAAGCTATTGCTTATGAGAAAAATGTAATATAATGAATGCATTTAAAGCCATTGT
TACAAGTTTATAATGTATTATCTATCTTGTTTTATGTGTATTTTATATAACATTGAAAAA
TAATTTTTTCTTGATTGAGAAAGGATACAAAATGCAAAATCCACAGTTTTGGTAACTTAA
AATTGCAGTTGTTTTGAAGTTATAAATAAATAATTTTAATTTTAATATTTTTTTCATTTA
AAAAAGATATAATTAGGATGCCAGCTTTTAGTTTCTAATAGTAGCAGATAAGATCATTTA
GATCAACTCTTCTGCTGAAAAATGCTATTTAAAGTATTTCTAAAACTATTTCAAATGAAC
CAAAGAGTTAAAAAAAGTCAATGGGGAACTCCCAGGACAATTTTTAGATGAAATCCACAA
CAAAGAGGAAAGCAGAATGTCTGCGCACCAAAGCTCCTAATCTCTGAGGGTATTTGCCTA
TGCCACTCTTAGGATAGAGGGGTGGAAGTCAAGCTCCAGAGCCTGCTTATCGTGCTAAGA
CCCTAGAGGGCTCACTCTCAGTCTAAGGGCAAACCACATCTAAAGCTGTTACCTCTCCTC
CAATCTCAGGGAGCTGAAGAGAGAAGCAGAAGGAAAGGAAGAAGTTGTGGCCATAGACTA
GCTTAGGAAGATTTGCTTCCTGATTAAATGTACATGGCCTGAGTCTGCAAGGAACTTCAT
ACTGAGAACTTAGTTTTTGAAGTGGAGCTGGCTATTAGCACCCCTAGGTGTGTGGCAGAA
ATAAACAGAAAACCTCCTTTGAAGTAAAGGTCTCAGAGAACCTCTCTAGAAATTTTTTCA
AGAGTGAAAGCTAGCAAATAGTCAAAGGAAACCAGTACATGAGGAAACAAAGCAACATGA
AGGAGAACCATCAGAACAACAAGCAGTAGAAACAGATGCATATACAATTAAGATCCCAGA
TTTTTAAACAGCTATGCTTGTTGTATTTAAAGAAATATGTGACAAACTAAAAAATATCTT
AAGTAGACAGGAAATTATAAAAGTCATATAGTAGATTTGAAGAAGTCCTAAACAAAACTT
CTAGAAATGAAAGATATATCAACTAAAATTAAAAACTCATTGTATTCAGCAGCAAATTGG
ACAAAGCAGAAGGGAGAATTAGTGACCTAGAAGATAGATCTAAATAAGAGCAATCTGACT
TGAGCCCTTATTAAGCCAGTATGCTCTACTACCTACCCTGGGATCTTGCTGACTTTAAAA
CAAAAAAATTCCCCTGGTTTGTGATACATACTTTGATTGCATGCCAGCTGAAAAAGTATT
TGTGCATACTTAATAAATTTTCTGAGTAGTTCCTAAACAGATACTCCTTTTTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCTGCTTCCTCATTTTGTTTTAGAGGAGAGAGGACAGGGCAGACCAT
GTTTCCTTTAAATGTGAGCATTGCTTTGAACTGTGCAGCCTCAGGCCGTGCAGGCCTGGC
TCTATGAATTCAGAATGTAGTGGGGTTAATCTTATGCCTTAAGTCGGATTTAGGGCCTGG
GTACATTTCCCAGTCTCTGTCTACCTTGTATGCGCTTCAGGATAGACCCATGGAGCTTGT
TACCTACTTTTGCTAATCATTCTTGTTCAAGCACTGCATCACAACAGTAATCTCTTCTGT
TAGCATATTGTAAGAATAATTTCTGCAATGAGAAATTGTCACAATCTTATCCTCAAGGTG
TTCTTTTATGTGAACATTATCACTTTTCCTATTTTTTTTTTAAAGATTTATTTATTTATT
TATTTCTCTCTCCTTCCTCCCTGCCCCCAGTTGTCTGCTCTCTGTGTCCATTTGCTGTGT
GTTCTTCAGTGTCTGCTTGTATTCTTGTCAGCCGCACCAGGAATCTGTCATTTTGTTGCA
TCATCTTGCTGCATCAGCTCTCCCTGTGTGCGGCGCCACTCCTGGGCAGGCTGGACTTTA
TTTCACTGTGCGACTCACCTTATGGGGTGCACTCCTTGCATGTGGGGCTCCCCTAGGTGG
GGGACACCCCATGTGGCATAACACTCCTTGCTGCACAGCAGCACTGTGTGTGGCCAGCTC
CAAACGGGTCAAGGAGGTCCTGGGTTTGAACCACGGACCTCCCATGTGGTAGGCGGACAC
TCTATCCATTGAGCCAAGGTCACTTCCCTCCTATATTTCCTTTTTTAACTTAATTAATTT
TTCTTAACTTTATTTTCAGCTTGCAGTTTTGTATTTGTTTTGGATGTTCAGTGGGCAAAT
GGAATGATGTTTTATGTATGTCGATCTGTGAAATGTTTTATATGGGGCTTACTCTTGGGA
TTTTTTTGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCGTATTCTATCCCTTCAGTCAGCTACACATCGTAAGGCG
GACAAGCTATAGACCAGGGATGGTTCTAGGTATGTAATGAATGAAGCACTTAACTTGCCT
ATAGGGAGAAACAGTCTAGAAAACAGATGATTATAACACAGTGTGACAGGTAAAAAATTA
GAGACATGAACAAAATTTTAATGAAGTACAGAGGCAGGAATTCTTAATTCTGCCTGAGAA
GGGGACCATTTCACAAAAAGGTGGCCCTTGAGATCTGTAAGGCATACATGCGTGTAGGGG
AAGACCAGGAATACATAAAAGGCCATTGCCGCTCCAGGGAACAAGGAAAAGTTTAGTGAT
TGGAACTGAGTGTACCAAAGAATCATCCAGAGAAATTTTTTTTTTTTTTTTTTTTTAGTG
AAGATCCCCAGACCTGCCTCTAGAGATTCTGACCCTGGAGATTCATTTGTAATAGGCACT
TCACGCATTTCTGTGATGGGTAGTCCAAAGACCACATTTCAAGAAATATTGACCAGGTTG
AATCTAGTGCTTGGGCCTTCTGACTTGGAATTCTGGGGGCATTTTGACACACTGGAAAGA
ACCCTAGTTTTGCAGTCAGACATACTTCAATTTGAGTTCTGGCTCTGCCATTGGACAACT
TAATGCTAATACAAGGTTTAAACTTGGGGGAGGTCACTTAACCTTGCTTGCTAAGCCTCA
GGTTTTTGGTTTCCTTTTAATTTAAAAAAAAAATTCTTTTGTGTAATCATTTATACATCA
CAAAAATTTCCCATTTAACTCGTCTTCACTGGATACATTTCAATGGATTCAATACATTTG
TCAGTAATTGGTACTGGCCTTCACCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTAAATTAAATTCTCCTTCACTTCCCACCACCCCCCCATTT
GTCTGCTCTCTGTGTCCATTTGCTGTTGTGTTCTTCTGAGTCTGCTTGCATTATCCAGCA
GCACTGGGAAACTGTGTCTTTTTTATTGCTACATCTTGCTGTGTTAGCTCTCCATATGTG
CGGTGCCACTCCTGGGTGGCCTATGCTTTTTTCACGCCAGGTAGCTCTCCTTGCAGGGCG
CACTCCTTGTGCATAGGGCACCCCTATGGAGGGGTGCCCCTACGTGGCATGGCACTCCTT
GCGTGCAGCAGCACTGTGCATGCGCCAGCTTACCACACAGGTCAGGAGGCCCTGGAGATT
GAACCTCAGCCCCTCCATATGGTAGACAGACGCTCTATCAGTTGAGCCACGTACACTTCC
CTGTATCTGACTTATTTCACTCAATATATTTTCAGTGTTCATCTGTATTATAACATATAT
CAAAACTTCATTTCTTTTCATAACTTAGTAGTATTTCATTGCATGTATACACCACACTTT
GTTTATTCATTCATCTATTGGTGGACACTTGAATTGCTTCTACCTTTTGACTATAGTGAG
TAATGCTGCAATGAACATTAGTGTACAAATATCTGAGTCCCTCTTTTCAATTCTTTTAGA
TATATATACCAAGAAATGGAATTGCTGGTCACATGGTAATTCTGACTGGCCACATAGTAA
CTTAACTTTCTGAGGAATCACCAAACTATTTTCCACAGCAGCTGCACCATTTTATATTCC
CACCAACAATGTACAAAGGTTCCTATTTCTCCAGATCCTCTTAAGCCTCAGCTTTTACAT
CTGTAAAATGTGGACAATTATGCCTACCTTTTTAAGATTATTATCTTAAAATAATTGACC
CGTGGGAAGAGTTATTCCTGGTAGGAAAGGAGTTTTGCAAGCTAAAAAAATAAATAAAGG
AATTAAGGTAATATATCCTGCTATCTCAAGTCAGGGCTTTATTTAATTTTATGGAAAGTG
GTCTGGACAGAAGACACCAAATACATTAATGTGGCCCAGACTCTTAGAGGCCCCCATGGA
AGCTCCTGAAGGATGGTGGATATTGTGGGTGCTGGGAAATTCCAAGGATGTGAAAAGAAT
AGACTGCCATCCTGAGGGCTAAGAGAGATGTAGATATGAGCTTAACTCTGCTATGCCCAT
CTTTGTAACTTTGAGCAACCATTCTACCTCCCTGAGGCCTCAGTTTCTCGTATTCATTCA
GGTATATGTTCATTCAAAAAACTTCTATGTGGTACCCTACTGAATGCCAAATCCTGGAGA
GAGGAGAGAGAGACACCAGGCAACATCCACCTCAGTATAAAATTATTCCTGTTGAAGCAG
AGAGCATACGTGTAGTGGCTTTCTAGACCAGGTGTTTGCTACACATCTTGAATGGAAGAC
TATAGTCCCAGATGGGCCTTTCAAACTGCCCTCAGTTTATGTCAAAAGAAATTCTGATAG
GGAAGCGGACTTGGCCCAATGGATAGGGCGTCTGCCTACCACATGGGAGGTCCGCAGTTC
AAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGCGCAGTGCTGATGTGCACAA
GGAGAGCTGTGCCACACAGGGGTGTCCCCCGCATAGGGGAGCCCCATGCTCAGGGATTGC
GCCCCTAAGGAGAGCCGCCCAGAGCAAAGGAAAGTGCAGCCTACCCAGGAATGGTGCCAC
ACACACGGAGAGCACACACAACAAGATGATGCAACAAAAAGAAACACAGATTCCCATGCC
ACTGACAATAACAGAAGTGGACAAAGAAGAACACGCAGCAAATGGACACAGAGCACAGAC
AACCTGGGGGAAAGGGAGGAGAAATAAATAAAATAAATCTTTGGAGAAAAAAAAAAAAGC
TTTACAAGTAAATAAACATATTCATGAGCCATTATATGGTTCAGCTCTTTCAAATATATG
CATACACTTTAGAATGTAAATGCCAAATATTTACTGAGATACACAGAAATTGTGGTATGA
ATTGAATTAGTTAGAGAGTCCCAACCAGGAAAACAGAAACTACTCTAAGTATTGAAAATA
GAAAGAATATAGTTCAGGGATTGGTTATTAAGGGGATAAAAATGAGAAAACAAAGACAGT
GAAGCAACCCAGAGTTTAGCAATAACAGAAAGCTGCTTCCATCCCTAGGCTAGAAATACA
AATATTCGAGCCCAGTGGCCAGTAAGATTAAAGAATTAAATTCTGATATCCTAGAGAAAG
AGAGAAAAATCAATATGTTATGCCTAAAAAAAAGAGCTAGGCATTAAGAACACACTATTT
AAAAATATAGAGGGAAATACCAAAAGAAAGCCCTGAAAAATAGTCACTTCTGTGAAGGCA
AGGGAAAGTACAGGGGGTTAATTTTATTTTTTAAGAAAAAAATCTTATATTTACCTATTA
AAAATGTATTAGTTGATAAAAATTAAATTTAAAAGAGAAGTCTTTAGCAAACTTGATTTT
TATTTCCTTGAATAGGGTTTCTTTTCATGCAAATGTGTTTCTTTTTTCCACTTAGGTATG
TTGATGATGTGATTAGCCGCATTGACAGGATGTTTCCTGAAATGTCGATCCACTTATCTA
GACCCAATGGAACATCAGCAATGCTTCTGGTAAGATCTCCTTGACTTATTTGTAAGGAGG
TATGGAAGGAAATTGACCTCAAGATTAACTCTCTGATCCCGTGTTATAGGATCTATAAAA
TGAAAATTAAATTACAGTTTGATAGTTAATAGCATATTTCTTTTTACTTGCATTCTGGAG
GCTAGAAAGTTTGCATGTTGAAACTTTATATTTGAACCAATTGCAGACCCCATCTAAGAG
CTAACCAGAGCCGTAAGTTAGTTCATATAACAAACCTCTTGAACACGATCTTGGTGAATC
TGTTTTATATTGTCCCAAAGAGATACAATAGTAATGTCCAATTATTGGATCCTGCTAAAG
AGAACATCCCCTTAAAAAGGAACCACGTTCTGTGGAAAACAATTATAAAATCCATTATGT
ATTTGTAAAAAGCTTTCTGAGACCTCATCATTGATGACTTGTGTTTCTAGTTCTGTTATT
TCTGATCTTGGTTTGCTCTGAGCAAGCTGGTCATATAATCTGCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAATTCTTGCATCAGAGGCAACTTTGTTGAGAATTCAGTAGTACTAT
ATATAATACACACACACACATACATACGGTGTAAAATTGTTTTGCTATCTGTAAGCTGCC
TATGCGAATGTTAGTGGCTCCCTGCCTTAGCTGAGCTCATGTGATATTTCCTGGAGCGCC
GTAAAGCAACTCATGGACTCCCTCCTATTTTTTCACAGCCTGAAAGAATTTCAGGGGCGC
AGTATGGTATCCATTATCATGTCTGGAGCTTAGGCATCTCTCTCATGCAGGTATGTTGTT
TTTTAATAAACACTTATATGCATATCTGTACTGATATGCTCTATCAGGAAAAATTAAAAT
TTTGACAAAAATTAAACTTCTATTATGTTTAGTAAACATAGTGTTTGACTCTAGATCCTT
ATTTTTGATATCCTTGCATAGCTTGTAAACAAGCTCTGAAGATTATTCTGAAGTGCTTAT
TAAAATTACAGATTTCTAGATCCCATTCAAGACCAATTAAATCCAGATCTTTAAGAATCT
GCATTGTTAATATGTTCCCTGGATGATCCTTATGCACATAAATCTGGAAAACCTGTGTAA
GAATGCATAAAAAGCTTCTTCCAAAGGTGATTACTCTAAAGGGTTCAGTTCCCGGTAAAT
AAATAAATTAGTAAATAAACGGTACAGCCTGCTCATTTGGACGTCCGACTTCCATATGTT
TGCCTTAATAACAAAAAAGCCACCTCATTTCAATACTCATATCGCTTGTGTGCGAGTGTG
TGGTGATGGTTGGGTCTGGGGCAGGGGGGCTGTAGGGCTTATGTGTTTAGCACAGTTTTA
ATGTTTTCACTATTTTATAGCTGTATTTAGAATGGACTTTATCTTAGTGTACCAGATGTG
GCCCCACTAGAACTCTGCTAAATTTTCTATAAAATGACCGTTGATTTATAAGGAAATGTA
TAAGATCTATATTATATTAGAAGGACATCTGACTCAATTTGAATTAGTAGTATAGTTTGG
CTACTCATCAATGCCTCCAAGAATTGTTTCTAACGCATTGATTCAGATAAAGGAGGACTT
TTTAAAAAGTAGAAAGTATTCCTTTTTATATTTATTTAAATTTATCTCGTTTACTTTTGA
AAGTACTTTTTAAATGTAAGCTCATGGATAGGTAGAGTTAAACTCATCTTTTTTAGGTTA
AATACTTTTTTCTATGGCTTTTGTAATGCATGAATGCAACTATATTTGTCAGAAAATATC
CTCAGACTCAATTCACCTGAATTATAGAAAGCTAAAGATATCATGTTCAATGTTTATTAA
ACCATATTCTTCTGATTCTTCATAAAAGAGAATCTAAGAGGAAATAGAGTATGTATGCAT
CAGTAGAGAGGTCAGTAATGCTGCAGGACTGATGCTCAGAATCGAGTCCCCCAACAAAAT
CCTGAAGACTGTTTTGGGGGAAACTAGTGGTTTTGGTTTGTGGGCATCAAGCCTTGCTAT
TATCTAATTTCCCATTGTACTTTTTATTTTTTTATTTTTTAAAGATTTATTTATTTATTT
ATTTATTTATTTATTTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTGACTC
AATTTGAAATTAGTAGTATAGTTTGGCTACTCATCAATGCCTCCAAGAATTGTTTCTAAC
GCATTGATTCAGATAAAGGAGGACTTTTTAAAAAGTAGAAAAGTATTCCTTTTTATATTT
ATTTAAATTTATCTCGTTTACTTTTGAAAGTACTTTTTAAATGTAAGCTCATGGATAGGT
AGAGTTAAACTCATCTTTTTTAGGTTAAATACTTTTTTCTATGGCTTTTGTAATGCATGA
ATGCAACTATATTTGTCAGAAAATATCCTCAGACTCAATTCACCTGAATTATAGAAAGCT
AAAGATATCATGTTCAATGTTTATTAAACCATATTCTTCTGATTCTTCATAAAAGAGAAT
CTAAGAGGAAATAGAGTATGTATGCATCAGTAGAGAGGTCAGTAATGCTGCAGGACTGAT
GCTCAGAATCGAGTCCCCCAACAAAATCCTGAAGACTGTTTTGGGGGAAACTAGTGGTTT
TGGTTTGTGGGCATCAAGCCTTGCTATTATCTAATTTCCCATTGTACTTTTTATTTTTTT
ATTTTTTAAAGATTTATTTATTTATTTATTTATTTATTTATTTATTTCTCCTTCCCCGCC
CCCACCCCGGTTGTCTGTTCTCTGTGTCTATTCGCTGGGTGTTCTTCTTTGTCCGCTTCT
GTTGTTGTCAGCGGCACGGGAATCTGTGTTTCTTTTTGTTGCATCATCTTGGCGTGTCAG
CTCTCCGTGTGTGCAGCACCATTCCTGGGGAGGCTGCACTTCCTTTCATGCTGGGTGGCT
CTCCTTACGGGGCGCACTCCTTGCTCGTGGGGCTCCTCGAGGCGGGGGACACCTCTGTGT
GGCACGGCACTCCGTGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACATGGGTCAAGG
AGGCCCGGGGTTTGAACCGCAGACCTCCCATGTGGTAGACGGACGCCCTAACCACTGGGC
CAAGTCCGCCACCCCCCTTCGTACATTTTAAATCATCGTCATTGAGTATTTTTAAGAAAT
GACCAGAAATAGTGTAGAATAATTGAGATGTTACATGGTGTAAAGATAAGAATCCTTGAT
TGCAGTTCCAGCTTTGCTACTCATTCTTTGGATGGTTCTATGCAAGCCCCTCTCCTTTCT
GGGCATCAGTTTCTTTATCTGTAAAATAGACCAGATGATCTCTAAACAAACCCTTTCCAG
ATCTAACATTCTATGACTAAGTTTGCTGGTCTCTTTCCTTAGCTTTCACACGACTTTAGG
GTTTTTTGGCTTAGATGGTGACATGCCATAGCATGGCATAAAATACAGAGGGATAGCAAT
ACTGTAACAGCATAACTGCTAGATTTATGATTTAGAATACTTAAAAATGTTCAGGATTCA
TTCCTTCAACATTCATTCATTCATTTATTAAGCTCTTTCTATCCCCACTATGCAATCAGT
GAGGATAAAATAATAGAAGGACACTCAAGTCTTGACTCTCATGGAGTTAACATTTGGTGA
GGTTTGGGGCATGAAGGGAAAGACAGAAAACAAAAGGCTATTTATTATTTGTCAGGTGGT
AGTAAGTTCTGTGGAAAAAAATAAAGCAGGCTAAGGAGATGGAGAAATAATGGCATGGGG
GTGTCCTCTCTGATAAAGTAACATTTGAGCAGAAACTTGAATGATATGAATAGAGGAAGC
CATCTGGCAGTAGGAAGTAAAAAGGCACTAAGATGGAGTGTGTTTGGCATGTCTAAGGAA
AACAGAGACCAGTGTGACTAGAATGAAGTAAGAAAAAAAAAAAAAAAGGAAGAAATAAAG
TCAGAGAGGTAGCCAGGGGCCGGATCATATATGACCTTGGAAGCCATGATAAGGACTTTA
GATTTTACTCTAGAGAGAGAGAATGCAATCAGAAGGCTTTGAACAGAGGAAAGGCATTAT
TTGACTTACATTTTCAAAGGATCACTGAGTGCTCTATGGAGTACAGACTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGATGTAGGGGAAGAGAAATAAATAAATAATTTTTTTAACAATAGGGATGTT
GAGCACCTCTCTTTGTGTATGATAAAATGCTTTCAAAAGAGGATATGGGATTGCAGCCCA
TGTCCTGTGGAAGCTTATAATCCACCAAACAAGCAACAAGGTATGATCGAACAGAAGTGG
TAGACAAGTAAGTCACTAGAAAATAGAGTAAGGCCCCTGACGTGTTTATACCAAATTCAG
TTGGGGTCTAAGGTAAAGAAAAACACACGCTAGGGAAGGGGAATAGAGGTTTTGAGATGA
GAAATTGTGGGTAATGTTATAATGAAAATTAAAGAGAATTCCAAGCTTCTTTTTGTCTCA
GGGCAGATCTGATGGGAACATTACCTAAAGCGACTGACAGGGTGGCCCAAAAGATGAACT
TGAAGGCCGAGATTCTTTGTTTTCATCATAGTATGCTTGGAATAAATGTGATACATCCTG
TTTACAATCACTAGAGACAGAGAAAAATGAGAATCTCTATAGCATTTTAAGACTCCGAGG
AACAAATTATGTTCTGAAAGTCAGTATCTTCAAAGAAATAGTCAACATGTTTAAAAAGAA
TTCCTTCTCTTTTGTTTATCCTCACTTGTAAAATCAAGATTCCCTTTCCAGGTGTGGACT
CTGAAGAGTAGAACCAATCATTCATTCAACAATTATTACTTAAGTACTTGCCCTGTACTG
GGGCCCTTGATTGTGGGTCCCAGGAAACTAAAAATAGCCCACATCTGATAGAGAAAAAAG
AAACCTAAAGTTCAGATCAATGCAATAAAATCTTTAATTGAGATGTTTAGGAAGTGTACT
CTGGATCCCAGAGAGAGGGGAGGGGTGAGGTTTTACAATGGAGTTGGCGTTTGAATTGGG
TTGGTCTTCAGGGGAGTCTGCCACTGGGAGAAAGAGGGAGAAGAGGCAGAGTGCCTCTCC
ATCCTCCATCACACTCTGGTACCCTGTAAGCACTTCAGGGATGATCAGATGTCAAGTATG
CAAGTATTAGTGCAATTCCACCACCTGTTTATGCGTATACCTTTTTCAAACTATTTTGAA
TCAGGTTACCTGTGGTAAAGAAACAAACAGGTTAAAAATAGAGGAAACAGAGCAAAGGAA
TTTCTCTGAAATTATATAAGAATCAGAGACACAATGGAAACTAGAGTTTTCTATCCCTTC
TCCTTCTATCCCCTCTCCCAAGTCTATAAATTCTTGACTCATCATGGAGGCTTGGTGATG
CTAGAACCAGAAGATTGCTTTCATTGCTTTAAACTCCTAAAAGAGCAAGGCTCATTCTTG
CTTGCCTTCTGCTGCCCCTCCCTTGCTGCTTTGCTGCCACAGACCCATGGGCAGTCGTAA
CAAGCCCTCTCACTATACTCTTTCATAAAAGAGGATGCCACATACCACTAAAATGTGCCA
TTAAAAACAAAAACAAAAACACAGGTACATTTGTGCCTTTAGCAAAGAATCTTTAATATC
AGACTGTCTTTTATCCAGGGACAGAAACAGCCCCCATCTACTTCAGTTAAGCGTCTCCCT
TTTTGTGAGATTAAGTGGGTCCTTTCCAGGGTTTTGTCAGCTGCATGTAGTGTTTGGTGT
TGGAAGTGTTGGGCCTCAAAGCAGGGCCTTTATGGATAATCAGAGATGGCATGAAGAAAA
CTTCAACAGGAGAGTTAGGCAAACTCACATTTATTATGTCTGCAGAGGTAAAGAGCCAAG
GCCAGTCCAGAGTGACTCAGACCCAACTCCCTGTGGGGCAGTTTCACTCTTGTTTAAATA
CCCAAGTTACTACTTAGTATTTGCTTTGATTATGCATTAGTTTTCATGCATATGGATGAA
CACACATAGCTGGTTATATAATTGTGTGATTAATATGCTCAAGAAATCACGCTTGCACAT
ACATTGCATGATCAGGAAAGGAGCAGATAACTCCACCCCTGGGTGGGAATTTTACTATGT
TAATTAAGCAAGTTGAAGTGAAGACAGCAAGGGGTAGCTTCTACGCAGGTCCGGCCAACT
GGTTGAAGCTGGTTTTCCTATTTCATTGCTTCAACAGGATATTCTTGACCACAAAAGCAG
AATTTGGCCCAAAGAGAGGGTTGCATTTCATTACCTTCTGATTTACATACAATTCTTTTC
TTTGTATCCTAGCAACAGGGAGAAAAACAAGTTACTTTCAGGTATTCCATCATCCTACAT
CCATCAGAAGTAGTAGTAACGTAAAGATGGCAGGAAAAATGAAATTACTCAACTTGACCA
GACAATGGCGGTTTTACTAGATGGGAAGAATTTGGCTTATCTCTATGCTGTTTGTTTCTG
GTTTTCAACTTAGGTCTGTATATATGTCATAATTCCATTCCTGTGCGTGGGCGCCATGTG
GAATGCGGGAAAGAACCAAGTGAAATTGCAGTTCTTTCTTGGACCCTCATGACAGGAATC
AGAAAAACAAAAGTGATACCCACTAACAAGGGTATAAAACAGGAGAACTAGGACAAACTG
CAAGAATTAATCTTGCCCCAGGATATTTATTTGCCTCTCTGTGAAAATGAACACTGATTC
AGTAGACTTGGTGAATTCTAGGACCATTCACCCTGGTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGATAGTTTTGTTTAATCTTTAGGCATCTGGGGGTGGGGAATG
TACCTAAAACATTTTAGGACACAAATTCTTAATTTTCCAGGCAGTTCAGTACTTATCTCT
TCTCCCATAGAATAGCTCTGAGAAACTCCCTCTCTTGTTTTTCATTAATCAGTTAGTTCA
TATTCTTACTTCATTTTATTATAGTCACAACATAAATCTGTAGGTGAGAAGTAAACAATC
ATATCTGCAAAAGCTGGCTTTTAACTTGGCCTAAAAATAGTCAGCATGTATCCTCCTCTA
GGCTTGCATTTCTACTGCCCAGAATGATGCATCTACATTTAAAAACACACCAAGCCAGGC
CTAATGTTTTTATTCTCACTGAGTATGCTCTACAAATACATGTTCTGGTTTGTGATTCTA
TCTGGCAGGTTATTATAAACCTTATTAAGTTTGGTGGTGAATGATCTTCTGCAGGAGTCA
GAGTGAAAGCCCCATCTTTAGCACATGCATTTTGCTCTTTTCACTCCAGCCTTTGCTCTT
TCTGTCTTTGTTTGCCTCCTCTCTATGCCACTCTCTTGATTCTGAAGCGTAGAACAATCT
GGCTCCATGTGCTTGGTTAATTGGTGTGTCATCTGGTCCTCTGAGACCCCTCTTCACCAT
GATCACTGTTTTATTGAAGTGGTTTGAATGATGTGTTAAATGATGAAAGCAAGGGCCATA
GCTTAGAAAAATGGCTCAAGACAGGTGAAGAAGATATTCAGAGAGCCACATAAGGTCATT
ATCATCAAAGTAACACCATCTTCTGAAGTTTCTGATGGGCTCTCATGTTTTGACAAAGAT
TTTTGGTGTGAGTTTTAGAATTACCTTAAAAATAAATCTGTGGAATACTGTGTTGTTCTC
TGTACATCTCTTCCCCTCCCCAAGATACAATTTAAATACCCTTCCTTCATGATGCTAACT
CTGATCTCTCCGGCTTAAAGTAGTATCTTCCTCTCCTGGTCTTCGTCTGCATTCCTTATG
GCATGTACATTTTCTATTTTGTATTATAATAATAGTAAGTGTGTCATAATGCCTTGATGA
CAAGACTCAAATCTAATTATCTTATAATCTCCTACACTACCTAGCACAATTACACTGCCC
TGGTAGACACTCAAGAAATCTTCTTGGCCCAAATTTTCCATACTTTTATAATTGTTTTAA
AGCAGCTTCTGAATAGAGATCAGCACTTACATTTTGATAGAGGCTTGTTTCTATTGTCTC
GTAAATTTTCTTTGAACTAAACTAAATAGATCACAAATGCTTTGCATGTTAAGAACAGCT
TTCTCTTCTGCCAAGATATCAGACCCAGATTTTACCCTTTCTGGGCCCCAATTTCTTCAT
CTTTACAGGGGAGCTCTACTTCAGAGCTGCTGGACAAAGGTCATAATGAGAAAATTAAGC
AATAATCCCCTTTCCTTAAAAGGAATTATCTTTTGAAATATTTAAATTTGGTTAATAACG
TCTACCAGTTTGGCTAAATGTGACAACCGGAATGTATACTTTAGCTTCCACTCTCTTCTC
CAACTCCATTAAAATAATCATAAAGAGATTGTTTTAGAGGCTTAAAACTATAAAGACAAA
GTGGTAAAAGGAATAAAAGATAAAAACAACTGAATTTTGGAAGTGGGAAAACAGATGGAC
AATGGCAAATAGCAGAGTGGAGAGTTCCGAGTCTTGCACCGGAAGTAAAGAAAGCAAGAA
GCCACTTGATTTGCTGTAGAACACCCTAAAGGCTCAGGAATTGGTGGTACCAGGTGTTTG
GAACTAGGAGTAAAGGTGGGGCAAAGAGAGGAGGATTGTTTAAGTCTGAGAAGCAGTGAA
GCTGTTTTATCCACAGATCCACTCCACAACTCAGCATGGACAGTTGCCCCTCCACGCTAA
CATAAGACTGGGTGGAGAGTTTGTTGTTGTTGTTTTAAGAAAATAAAATAAGTGATACCT
GTTACAGTTGAAAGCTACATTTCATTACTGAGTACAGAGACATTAAGTGAAAGTTTTAGA
TTCTGAATGTTTGAGACTTCTCAGCCTTCTTACTCCCTCCCTGTTTCTAGGAGACTAGTA
ATCAAGTTTTCTATTTCCAGGCAGGAAATTTTAAAAGACTTTTCTCTAAGGAAATCTGAC
CAGAGACTAAGATTCAGACGTTGTAAGATCATGTTTTAGGAAAGGTCCTCAATCTACAAG
CCTCTACCCATGAGCACAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAGA
AAGAATAAAGGAAACAAAGGGGAGGAAATTATCAAAGAAAGTGTTTTAATTTTAAATTTT
AATTTTATAATGTGGGAGAAATATGTATATGTGGTTTGTGATTGTCTTCCCTTTAGTATT
TCTACAGCAAAAACAAAACAAAAAACCTAATTTTCCTAAATGATACATGGCAATGCTTTT
GTCCAGAGAAAGTGAGTTTTTGTTGAGAAATAATAAATTATTGAAATCTCTGTAGACAAA
CATCAATAGCAGAATTTTTCCCAAGTAAAATTTAGCATAAAAGTACAAATAGACTGAAAC
TACCTTGTCTTATAGAGATGTTAAAAGCTGTTAACACACCTCATTTTTGTCTTTCTCTTT
ATACATATCATTTAATGGATGCCAGATCAGACTCATTAGATGTCAAGAAAATAAAGTGTG
ATCTCCCACATTTATAAGCAAACACATAAAACATGTTGAGCTATGTGAAATCAAAATAAA
AGTACTGTGAAAGTGGCGTAGATCACCCAACCCAGAACCCTTGACAGAAGTTTCTAGAGA
AGTTTGATGGAGAGTGTTCTGGTTTCCTTGACTGCTCAAGCAAATGTCATACAATGGGTC
AGGTTAAACAATGGGAATTTATAAAGCTCCTGGTTTGAGGCTAAGAGAAAGTCCAAATCA
AGACATCATCAAGGCAATGCTTTCGTCCTGAAGACTGGTGTTCTGGGCCTGGCTGCTGGT
GATCCTTGGTCATTGGCTCCTCTGTCACATGGCGAGGCACATAGCAGCTTCTGCTAGCCT
CTCTGTTGTCTTCTGGGTTCCACTGAATTTCAGCTTCCTGCTTCCTGTGGCTTTGTTGCT
TTTTGTCTGAATTTCATTCCATTTATAAAGGACTTCAGTAATAGGATTAAGACCCAGCCT
GATTGAGGTGAGGGACACCTTAACTGGGGTGACCTCATTATAAGATCCTACTTACAATGG
GTTCACACCCATAGGAATGGATTAGATTTAAGAACATGTTTTTCTGGGGTATATATAGCT
CCACCACAGAGTGGAGCAGGTTGTTTTCTTTCTGTGATTTCATTCTCAGATTCAAGGGTT
GTCATCCTAATTTTGAATAGCTAAAGAGCTCAGACTTTGGGTTAACCAGATTTGGAGTCA
TGTGTTGGCACCACTGCATATAAGCAGTTGTGACTTTAGGAGGTCACTTTGCCAGGCCAG
GTACCATATCTTATCTGTGATATGGAGATAACATTTTGTCTTCATTCCTCAAATATTTAT
TGAATACCTGTTATGTGCCAAGCCCTGTTAAGTGCTAGTAAATAAAATAGGTATGTTCTC
TTTCCCTTTTGAGGCTACTGTATAATAAGGAAGACAGAAGATAATAATAACAAACACATT
TTTTGAAAGCATACACTTTTAACATTTTAGACTCTTTTCTAAACACTTTCATTTAACAAA
ACCCCATAAAGTAGATACTATTATTACCCCCATTTACACAGGTAAGGAAACTGAGGCAAG
GAGAGATTTTTTTTTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTCATCATCATGGGCACTCTGTCCTCCTCTGAAGACATTGA
AGAAAAGAGCACATCACCATTTTCTCACTCATTCTCACAGTTACTCCCCTTTCTGTAATT
CAGTCTTAACTCAATTTATTCCATTGTCAGTTTCTGGTCTAAAATTTTGTGTAACTTATT
GCAAAAAGAAGCTGTTAAAATGATCTTTGGTAGATGATGGATTGACTAGTCCAGTCCTTT
GCAAGGTTTGTGAAGGGATCCAGCTGTCTCAGATTACCATGCCTAAATGTGCATTTTCCA
AGGTTGTCAGTGATTGTAGTGCATGTGAAACTGGCAGACAAAGTGAAGTGTTTCCCACTG
AATGAAGCATTGTTGAGTTTGCTTTGTGCTCAAAGCTATCACGAACAAACATGAGATTGA
CAAAACAAGATGGAACAGGTGCTAGTAATCCCAGCTAAGCATTTTATTATTTTGATGGAT
TTCAGACTCTAAAGTTTTTCCAACACCACATGTCCATATGTGTATACAAACAAACACACA
CACAATTTGGGGTTTTAAGAAAACATTAAGTCAACAAAGGGTTGATATGAAGAATAAAAA
AATAATGAGAAAGCAAAGCAGGCATCTGACAACCTATCTTCAGATATTTGAAGGATTGTC
ACTGGAGAAGCAAGCTGCTACTTTATGACTTCAGCAAACTGAACCTTCTGAAGCTAAAAA
CAATACATATATATGTGGCTTTCTATTCAATATAAAGAAGAATTTTCTAATAGATCCCCA
CACCCTTCTCAACAGTGTGAACATATGCCTTTAGAGGTAAAATTGTCCCATCCCTGGGAG
TGTTTAAGTAGTGACCAAATGACCACCTATCTCAGATTTTTTTAGAAGAAATGCTTTGAA
TAGTAGAGACAGATATAAGGTTAGACAAAAGTCAGTCAATTATTCATTTAGTGGGAAGTG
GATTTGGCTCAACTGTGATGGAGCGTCCACTGACCACATGGGAGGTCCAGGGTTCAAACC
CAGAGCCTCTTGACCCATGTGGTGAGCTGGCCCATGTGCAGTGCTGATGCACACAAGAAG
TGCCTTGCCACGCAGGGGCATCCCCTTCATAGTGGCCCCACGTGCAAGGAGTGCACCCCG
TAAGGAGAGCCACTCCATGTGACAAAAGCCTAGCCTGCTTTCATGGTGTGTTAAAGCTGG
CCCACAGGCAGTGCTGATGTGCACAAGGAGTGCCGTGTCATACAGGGTGTACCCCACGTA
GGGGAGCCCCACACGCAAGGAGTGCACCCCGTAAGGAGAGCTGCCCTGCACCAAAAAAAA
AAAACATGCAGCCTACCCAGGAGTGGGGCCGTACACACGGAGAGCTGACGCAGCCAAGAT
GACGCAACAAGAGAGACACAGATTCTGGGTGCCGCTGACCAGGAATACAAAGTGGACACA
GAAGAACACACAGCGAAATGGACACAGCAGACAACTTGGGGGCGGGGGGGAGATGGGGTA
GGAAGGGAGATAAATAAATAAAAAATCTTAAAAAAAAAAACTGGCCTTATTGCAATTGTA
GCAGTCAAATTTCTCCTTTTTTTTATACAGTTTTGCTTTTTATATTTAAGAATTCTTTCC
ATATTCCTAGGCAATAAAAATATTCTTCCATATTTTCTTCCTAAGCTTTATGGTTTTGTC
TTTTTTCATGAAAATACATTATTTCTGTTAACATGTACTGTTTAAATAAATAAATAAATA
TTTAAATTTTTCTCAGTTTTAATTTCTAATGCAGTAAATATTGAGACATAACCCACATAA
ACAAAACTTCTATGGAGTCCTCAATAATTTTTAAGACTGTAAAGGGATCCTGAAACCAAA
AATTTTGAGAACCACTACCCTAGAGAAACTCTTGCATTGTGCTAGAGATAAGTACAAGAA
TTTTCTTAGCAACATTGTTCTTAATTACCCAAAACTGAAAAAAGTCACTCATAAACAGTA
GAATGGATAAATTTTGAATATTCCTACAATGGAACAGTATACAGCAGCGAAAGTAAACAA
TGCATGTTATGACAACATGGAAACTATACCCAATAACATGGATGACTCCAACATAATATT
GGGCAAAAGAAGCAAGTCACAAAAGAATATAGTGTGGGTTCATTTATATAAGTTCTATAA
CAGGCAAAATGAAACCATGTATTTAAGAGATGTTTACATAGTAGAATGTATGTTAGTTGG
TAAAGTGCAGAAAAGCAATGCAATCATTGTCATAAAAGTCAGAATAAAGGTATGACAGGT
TGAAGCTTTTGTGGACCCCAGAAAATCCTGCTTTAAAGCTAATCCATTCCTGTGAGGGTA
AACCTACTGTAGATGGGATCTTTTGATTAGATTCAGTTAAGGGACTTCCTTTTGATTACA
TCACACCAGGAGGGCGTGACCCAGGGTGGGTCTTAATCTTCTTACTGGAGTCCTTTATAA
ATGGGAATAAAAAGCTGCAGACACAGACAAGGGCTACAGAAACAAAGTGGAACCCAAAAA
GCTGAGAGAGAAGGCCCTGGGGGCCAACGAAGCCCCATTAGCCAGTCTCCGAGGCCTGGA
GGAGAGAGGAAAGACAAGGTGATTCCGGCTTTTGTCTGGTTGCCCACACCTGCAGCTAGG
GGATAAAGTGAGCCTGGAGGAGGAGGTGGAGACTGGCAGACACCTGCATTGTACACTGCC
ATGTGCCGCATCACCTATAGTTGTAGCTCGGAATAAAAGCATCTCCAATGATGCTTTAAT
TTGGACACATTTACAGCCTCAGAACTGTAAGCTTTTGACCTAATAAATCCAGTTGTGAAA
ACCATTCCATTTCTGGTATATTGCTTTGGCAGCATTTAGCAAACTAAAGCAAAAAGTTTA
CATCTTATCCTGAAAGAGAGAGCAATGATTGTGCTCCTAGGGTACCAGCAATGGTCCACA
TCTGGATCATAGTATTGGTTATGTGAGTACTCACTATATAATTATTCTTTAAACTGTACC
TATGTTTTATGCTCTTTTCCAAATGTACAGCATATGACTCATTTAAACTTCTATAAGGCA
TTATATTCTTTGAAGGAATTTCACACCCATTAAAAAAAATTTTAATCTTACAACTACCCC
TTGTGGTACCTATGAAAAATCTGTCTATATTAGTCAAGATCCACCAGAAAAGAAATGGTG
CTTTATTTGTATACATTTGGTAATTTTTAAAAAAATTTCTCTGCCTCCCCGCTCACAGTT
GTCTGCTCTCTGTGTCCATTCGCTGTGTGTTCTGTGACCACTTCTATCCATATCAGAATC
TGTGATTTTTTTTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACATGG
GAAACAGCAGTAGACTGTGATAAAGGTGACTCAGGGGAGGGAGAAACACATAGCAGATGT
CTTTTAGGGAATAATAAGACACCTGTCGTCCTGCTGTCTCATTGTGTCAAGCTACAGGAA
TGAAGATGTTTTCATCCTGTGCTTTTCCAAAACAGGGCCTTTCCAAAACAATTCAGTGTG
ATGACTACGTAAGTGCATTTTAATGTTTGCTAATGAATTTCTTGGTTTTGGAAAACAATA
TACTTCTTCTTTTGAAATTTATTCTCTTCATTCCCTCATGTTGCTTTTGTTGGTCAAGGA
GAAGTCCATCCTAGTGAAGCTGTAAGGGTTCTTTCTAACCAGGGAAGCACCATCAAAAGT
GATATTCCAGTGACCACTTGGGGATTGCAGGGATTGTGCTCGGAAAGTGTGTAAGTGACT
CTGCATTTTAGATTTCCATTGCCTTTCTGGGGCCCATTAAATTGATCAGTAAGTGGTAAG
TGATGAGGCTGGGAGGCAGAGGCATGGTAAAGAAAGAATTGAAGAAATGAGAATGAGTCA
GCCAAGGTAGAAGTTTCATTTGTAAGGGATGGTGGCTTTTCTACTTTCCTAGTGATTTGA
AGGTGGTTATCACTGCTTTATCCCTTTCATTTTCCCTTTCATTTCTGGAATTTTAGAAAC
CACCTGCTCTATCTAACTAAGTGCTATGGAATGAAGAATTTTGTCAAAAAATTTGTAACA
AAGAGTAGAGGTTGGAAATTCATGGTGTGTAAATATACTCCATTATAATATGAGGGAAGG
AAACTTCAGTAGCTTGATCATTTTAGTCAGTAGGGGGTTGAGGGAAGCAGATGTGGCTCA
AGTGAATACAGCTTCCACCTACCAAATGGGAGGACATGGGTTTGATCCCTGGGGATTCCT
GGTGAAAAAGAAGAGAAGGTGTGCCCCCCTGGTGAGCCAGTGCCCCGCACAAGTGAGTCA
CGCAGCAAGATTATGACACATCAAAAGAGAGACAAGGGGAGAGTCAAGGTGAAGCACAGC
AGAGACCAGGAAGTGAGGTGGTGCAATTGACCGGGAGCCTCTCTCCCTGTCAGAGGTATC
CAGAATCGAATCCTGGTGAATGCTAGAGGAGAGGAAATGGGAAGAGAAGACAACACTGAC
AGCAAAAACAGCAGGGCAAGAGGAGGGGATGGGAGGGAAATAAATAAATAAATCTTAAAA
AAAAAAATGGGTAGAGGTGCTTTGCTAAGAGGGGGAAGGAGAACCAATGTCAAACATAAG
TGCTGTGCTAAAAATATTCATTGGGAAAATTAACACAGCATTTTATTTAGAACTTTTAAT
GTTTTATATAAAAGGAAAAACTAATAGGGGGAATTCAGTCCATTCTTTAGTTGGTGGGGA
AAGATATATTTGGATAGGAGAGCTTTTCACACCTACCAGATCATTTAGGTTAAGTGGCAT
GGCTGCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTGGGCAGGCTGCACTTCCTTTCAC
GCTGGGCGGCTCTCCTTACTGGGCTCACTTCTTGCGCATGGGGCTCCCCTATGCAGGGGA
CACCCCTGCATGGCAGGACACTCCTTGCGCACATCAGCACTGCACACGGGCCAGCTCCAC
ACGGGTCAGGGAGACCCGGGCTTTGAACCGCGGACCTCTCATGTGGTAGACGGACGCCCT
AACCACTGGGCCAAGTCCGCCACCAAAATAAATCTTTAAAAAAAAGAAATCCTCTTGAAG
ATCCTACAGACCATGTTACATTCTTTGGTGCTGAACTGGATCATAATAACCCTTAACAAA
ATATAGTCTTTATTTTTTAAATTATTTTATTACATACATTATGTTGTATTTAGAGACTAG
AAGATTTTTAACTAGAAGAGACCTTAGAAGTTGTTAAACCAGACCCTTCCTCCTACCATT
GAAGAAGCTGGGTGCAGAAAAGGGAAGGAATATAACCACAGTTATAGCATGCAGCTAGTA
CTGTGCAGAAGAGTGCTAAGATCGAGGACTTCCCATGTGCAGCCTAGTGCTCTTTGCTCT
CTTCTGAACTGTTGACATCCTCTTGCTAATGTCATTCTAACAAGAAGGGTGAAAACATTA
CAATGTTTAACCCGTATGTAACACTTAACGAAGCCATTTGAAATTCATTATCTCATTTAA
ACTTCCCACCATGATGGGAAATAACTGAAAACTCAGGACTTCTAGGCATCAAGATTGTAC
CACCTTAGAGCATCAGAGTTACCACTTTGCAAATCAAGAAACTGAGATCCAGAGAAATTA
AAGAACTTTTCCAAAAAGGTTAAGTGACCAGACCAGACATCAGGAGTCAAGTGTCCTGAC
TCATGGTTTAAAGTCTGCTTTTTCCATTATGCTATAGAATAGAAGTAGATCAAGTAGTTT
GAAGAAAAAAGATGAATGATAAATGTAAATGAGCTAAAAATTAGATAAAGGAGAAGATAG
GTTTATTGCGACTCTCCTTGTCAGTCAAGACTGCCTTTCATAGGATTGCAACTGGACTAT
CCCTGAAGCTGGTTTAGTATTACTGTGTTTTAAAATGTATAGTCAGCTGTTTTTCAGAAA
TCAAGGCATAATTTATTTTTAAAAAGAAACTCAAAAATTAGCCTAATCTCCAACATGTCT
ACTATAATGGGAAATGGCTAGGTGAGAATTCCATCTAACCAATAAACTTTTATCCATTGC
TAACCTATGTTGGTAAAAAGGATACAAACCTTGCCCTTAGAAGCTCCTTGATTAGTGAGG
AGGAAGATAAATTAAAAGTGCAAAGGAAGCACATAGAACTGGGCAGATGAGAGGCAGAGC
TGGTAAGGATAGCATTTCAGTTAATCCTCAATGTATAAGAAACTACCCAAAACTAGGGGC
TTAAAATAACCATTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
AAGCAGGGCTTGACTGTTCCTTATAGTCCTGACCAGGAGTCTCTCATTAGGTTGCAGCCA
GGTGGCTTGTTAAGGGAAGATCCAAGATGACTTCACCCATATATATGGAGCCTTCGTGGA
GATGGCTAAGATGCTTGGACCCCTCCCTCTCTCTTTCCATGTGGCTAGTTTGAGCTTTTA
TTGTGGCTGGTGTTATAAGCTGTAAAGTCAAGCTGCAGATTGCTTAAGGCCCAATCTCAG
AAGTTCCATAGGATAGCTCCAGCCACATTCTATTGATCACAACAATAGGCTCTTGATGAG
GGAGTAACTAGGTCACATTGCAAAAGAACTTGTGGGATGGGAGATTCTATTGAGGCCATC
TCTGGAAACCTAGAAAGCTTCCTGCAAGTGATAGTGTCTAAACTGAGTTTTGATGGATGG
GTTGGATTTAGAGGACAGTGTTCCAGCAGGAGCAACAGAAAGTGTGAGAATAATCAGCAT
CGAATGTTTTCAGCAATAGACAGGAAAAGAAATTGTTCTCACCTGATTATGACTTCCTTG
ACTTTGAATGTCTAGAAATAGAACTGTAGATTAAGTTGCCTTTAACCAACTAAATCCCAG
CATTGTTTTCTCAGATATCCACAACTGCATGATGCCAGAGAGGGATGTAGAAATGGAGGC
CTCCAGAGGAATAGGTCTCTAGAAACTGTTGTCAAGATTAAAGCTGTACGTTGTCAGATG
ACACAAGTCCAGCATTACACAAACATAATTAAAAGAATTTTATTTCTTAATTCTTCTTAT
GAGGATTCAAATGATTATTGAAGTTAAGCACATGAGATTGGGTTTTGGCATTTTGAGGCA
ATTAACTTTTCCCTTCTTGCAATCCTCTAGTCTTTAATAGAAGATAAACCATCTAAATTA
GCCATAATGCTTAAGTATGTGAAGATGGTAGCAACTGATCATTTTACACCATGATGTGTA
ATTAAGAGGTTTTGTCAGTGAAGACTGTCAACCCCTAGCCCTGAAATGTGTGTGTACTAT
GTTCATTAAAGTACTCTAGCATAGAAACAACCAAGCCATGTACCAACAGGTTGACCAGGC
TGTAGGAGATAACACGATCAGGGGATTTATCATAATCAATGAATATTTATTGTCAATCCA
CTACAAAACACTATTTCTGGTGTCACGGAGAACATATAAAAGTTTTGGTCTAGACTTTGC
CCTTAAACAAGATGAAAGTTTGCTTGGCTGTAGAAAATCAAAAATATATAAAACGCTAGG
AGCTGTCACAAGTAGGATATGATCTTCTCAATGAATGGTATGTACAGGGAATGGTATGAA
TTTTATCCAAAAAGTTATGGGTGGAGTCCTCTGGGACTAATTTTTGGAAAAGGAGAAGGA
AGAACAGGAGGAATAATTTGAGCCAAGTTGTGAAAGTGTAAGTAGTTTGGAGTTCCATAT
ACCATCTTTTGCAATATCTCCAGACAGGAAAACTGCACTCAATATTGCATCTTGAACTGT
TTAGAAATATTTTAAGAACATTCATCTTTTTATCAGAAAACTTAAATGGTAGTTTTCATC
CCATCATGACTAAACTTTATCTCCTTTTAATTCCGTCTCACTGAAGTTTCTCTTAATGCA
CAGAATATCATCAAAAGAGACCATTGCAGTTATTATATTTTTAAGTGCTTTTTAGAGATT
TAGTTACATACTCATCGCTCTGAGTAGAGCTCCTGATGAAAATCTACATGGAACAATTAC
AATGTCTTCAAGGCTACAAGATTGGGTCTCTTTGAATGGAGGTTTTGTATTTTTTGTTTT
TGGTCTTTTTTTTCCCAGGAATTAGCTGCCTCAAATTTACTATGATCTAGATAAATTATA
TATTGCTTTTAAACTACAGTATTCAACCAAAAAATTTTCCATTCAGAGTTTTTGTTATAA
TATAGTCTAGTCAGACAGATTGATACATACACATTTTTAAGGAAAAGAAGAAAATAATGC
AAGTTTGAAACAGATAATGGGAGAGTGAGGAGAATTTTGTGTTCTGGGACAGCAGCATTA
GGAAGACCAGGCAAAGTTTAAAGATTCAAAACAATAAATAGCATATAGCATCTAATACTT
TTTATCATCCTTACCCAGCTATCAGAATGAAGAAAGACAGTGTCCAGCTGTAGCAGTAGG
TTGATAGCAGGAGAATTAGAAGTAAAGGTACTAGTGCCTGAGGGGTGGGTCATGAATTAA
TAATTGCTATGTGGCGGATGAGCCCCGTCAGAAGAGCTGAAAATGAGGAAGTTGCCTTGC
AGAGCGCTATCAATCACTCAGTGACCATAACTTCCAGTAATTAGTGTATTTTATGGGCCT
TTGCTTCAGTGGCTCGGAAGCACATATGCTCCAGTCACAGCTAAACTTTGCCAGAGTAAT
ATTCCAGGATGATTTATCCTCTTGCTGCACTGGGATATAACCCTATATTAGGTGAAGATT
GTGAACTAAGCTGCAATAAAGTGTAAGTTTAGGTACAGTTTGCCCAGGTTGAGACCTCAA
TGTATCATACTTTCCAGCATTCATGGTTAGGCTACAGCAAGCAATCATTTTTAACAGTGA
AACAAATAAAGCAATTAAAGGACCAGCATTAGTATATTGTACTTGTGAATTACTGTTGCC
CTCTCCCCATTTAAATGTCCACTGTAATAAGCCCATTTCTAATTAAAAAAAGCACACTCT
ATTAGAAACATTTATTTGTAATGCTGTCTTTTCTCCATTAGTATTACTAATCTGTGGGAT
AGAGTGTAAGACCTCCAGAATGGTAGAAAAGTGTTACTGCTTGATTTATTTCTTTGCACT
ACTGTGATTGGGCTCCTTAAGTTAAAATAAATTTACTTTGTGTTGGTGGACTCTGGTGAA
GATGAGTCGTTCTTTTCTAAATATTGGCACATGTTAAGGAGCCCTCCTGGATGGGAATGT
CACACTTAGGCTCTTTCTACACAGAGAAAACATGTTGTTTGTGAGCTCTCAGGAGCACTT
GGCCCTTTTTGTACAGAAATAATTAGTTATTTGCCATGGTTCACCCACTGTACTAAAAGT
CTCTGGAGCCTTTGCAGACAGGGTCTTTTGCTATTGCCAAAACATCTGTACAGCCCAGAG
TTCCTTGTAATTTAACAAGCTTTGCCACCAACTTAGAGTGTGACCTTGGGCAAATTAATT
AAGCTTCTGGAGCCTCCATTGAGCCATAATTCTGTTTGTGTTAAAGAAATTCTTAGAGCT
AGTAAGAAAATGCTATATGAAAATAAGTATAAATTGAATAGGAAAAAAAGGTATATTCAT
GGTTCCACTGTATTCTTTGTAAATAAACATATCTAAACCACTCTTAATGATGGTATCCTT
GACTTTTCTTAAATAGACATCTTTGATAAATTCATTTTACCAAGCATAGATGAAAAGGTG
TACACAGTTTCATGTTTTCATTGCATTTATTATCCCATCTTTAATTTGCAATGTCTTACA
ATAGCATACAAGTTAAACAATAATAGTAAAACAAACTAATTGTCTTTAATTAAAGTGAAT
TAGATTTTGACTTTAATATATTTGATATAGTGAGAACTGATCATGTGGAGGGTCCCAAAG
GTTATTAGGGCATATTTCTGTTGGGCCTGATGGTGTTAGGTAATAACCCTCTTCCTCATA
GTTCTAGACATGAACAAATATGTCACTTCATCAGTCTCTGTTACTCGCACTTATGCCCCT
CTGCAGGGGTTGCAGATTCCACAAGTTATCAGCTAATGGCGTTATACATTAAAAATTGAA
GCTTTCCTCACTCCAAGGCTTTTCAAGGCTTTGTTCTTAAGCCCTAGACACTTTAGAGTG
CAGCTGCAAACTATAGGCAGAAGATTAAATTAATTTGTAACTCTTTTTTTTTTTGGTCCT
GCATTTACTAAATCCTCCACATTTAATTGAAACCCTACTTCAAGACGCTTTGTGTTTCTC
TGTTCTTTGTTGTCAGTTTAACCTCGGAAGCACTTTAACACTGGTAAATTGCTGTTATAT
CCTTTGGATTTTTTTTAAACCATTCAGTAAGAGGATAGTGAAATTGATACACGGAAGAAA
AGTAAAAATCTTAGGGTAGATTTTGAAGTATTTAATATTTATTATGGTTCTTCACCAGCA
TAGTTAACAGGTGATTTAAAACTCTCTAGGACTGTGTAAATTGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCTGCAGGCCATTTCAGAGACGATTATATACTCTCTTTTGTAAGTTTCCTA
ATTTATAATACCTTGACAATAAAAAACTGGGGAAATGCAAGTAGATTAATAGACCAGTAG
GGGTAAAAGATACAGAATGGCCCCAGGTTCTTCTGTCTCCAAAATACTCCCTCAGTGAAT
GTGTGCTTCTGCTTCCCCATAAGGCTTCCTTGTTTATTTTGACTTTTGACAACCTCCTTG
TGAACTTGTTCTTCATGCAGCGGTATCTGCTATGAGCCCTATTCCTTTTTCACCTTGTCC
TAATGTAACTTGATAAAAGGGTTCTAGTTCCTGGCTATAAATTTCCTTCTGCTTTGCTAC
AAGACAAAGAGTGTGGAACATAAGCACTCAGGCTACATGAAACCCAGAAGGACAGGCATG
TGCATTGAAGGCAGTCCCTCTCCAGAGGCCTTAAAATGACTGCATTCGGTACCAGCCTAA
TAGTGTCACTACCTGTTTTCGTTGGTGCAGATTTGGGATCCTTGGCCTGCTGCAGTGGCA
GTGTTGCCTACTGGTCAGAGACAAGGAACCATTCTCTGTCCTCTAACTCCAAGAAGGTCA
GACCTGCAAGATGTTTTAGAAGCAGTCCTCTCAGGTAGAACTGAAGTTCTATACAATGTC
AGGAGAATACACAGAAAGCAAAGGCAATTCCAGAATGATGAATTCACAAGTTCAAGCACT
GCCACCTGTCCCAAAGCAGACTAGGTACAGAGAGGTCCCCAGCAGTTTGGCCTAACACTG
AATTTTCTCTCTGTTCTCCCTCATGGTATCCTACAAAGTAAGTGAATGACATCAACCATC
CTTATTTACCTTGTACCAGTTGTGACAGTGTGGGCCAAGTAAATAAGTGTGCCTTCCCAA
GTCAGCTATAATGTGGCCTCGCCATTGGAGAATGATAATAACTTGAGAATTTGAGGGTTT
ATGTTGAAGTGGGAAGAATTCACATTTTTCACTTTATCCCTTTCCCCCCCTCCCCCTTTT
AAGCCTTCCATTTATCATTGCCTAATCCTTATAAGCCTCAAGAGTCAATGGCTGTTGACA
CCTGCTCACAAGTATAGATTGTGACCATATGTGGCCAAGTTTCTTCTGCTGGTAAGCCAC
ATGGACAGAATTCTTCCATACTGACATATTCAAACATGCACCCTAGTAAACACCTGGAAA
ACACCTGGAAAAGGACTTGAGATAGAATGTTGTGATGTTTTCTAGTAGTTATTAAACTGC
TAGCCTTTTTAGGTGAGAGACCTTCCTCTTAGTGGTTTTCTAGTAGATGAGTGTGATGAG
AGATAGCAGCTTTTGGTGAGCCATTACTGCCTTGATAGACCTCCCAAATCAATTGACCAG
AAACTTACCGTATTTCTAAAATGTAAGGCAGACTTACAGCCTGTATTGGATGGAAGCAGG
TGAGGTGGTAGATTACAGAACTAAATTTTTCCCCTTCCTAATTAGTAAGTACATAGACAA
CAAACATAACACAAAACTATGAAAGAGAGTTTGGTTAAAGTCCTCACTCTCTTTTCCTTC
ACCCTTATTGTGATGGTTTTCCTATTTATATGTGGAGGGATTAACAAAATAAATGAAATA
ATAGTTATAACTTTATATCTTGGAAATCAGTGAACTCTGTATACAAGCTAGAAGGTAATG
AAAATTACCAGGTTTACCAAAACATATATAACATGCACATGTACACAGAGAGAGACACAT
ATACATCCAAATGAATGATGGCACTTCCAAAGTAGTCACCTTACAAGGTCATGTGGTTTA
TTTCTTTTAAATTATTGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTTTTGACTGTGTCTGTTGTATTAGTAAATGTGGTCTTT
TTACTTTATATCCATTTTATTTCTGGTTGAATCATTTTGTTTTTACAAGTGAGAATCCTA
AGACCTAAATTAAGTGATTGGTCCAGAAACACATAGCAGTTCACAAATCAAGCTAAACAA
GAAGCTCTCAAGATTCATTTTCCCAATTTCAAGCTTATACTCACAATTCTGACTTCATAT
TCTTGAAATGGCCTTTTTCTCACTAGTCATCAATCTTTTCATCGTAGTAACAAATGGATG
AAAATAGTGGCAAAATTTTCAACTTCATAATATTGTCCATGTGACGATCGTGAAACGCTT
CATGTGTGCTTATAACTGAAAACTGTACAGTGCTGTGGGCTAGGAACAATTAGGTGTTCC
CATTTTATAAGTGGAAAAATCCATAGTCACCTGTAATTTTACATCTCTGTCTAGAAAAAA
CTGTTGCACACACCTAAGTAATACCCAGAGAGCTGATAATATTCCTAAGAGAAACCATGT
AAGGGTAATTTTTAGTTGTTTTGTTTTATCAAGGATACAACGTTGTCCATTGAAAATGTG
CGTTCTAAATACAGCTTCTTAATGTAATTACAGCAATAATTGTGTTCAAGCATTTGAGGT
TGTGAGCCTTTTTAAATTCACTGGATAAAATTCTGAAATTTAGTATTGTCTGTCTTAAGG
AGATCTGCCCTGCATGCTGATCTATAACTAGACAAATATTATTTCCTATCACAGCTTGCT
CCTGGGAGGTTTCCATATCCTCACGTAAGATTGTTCATTACTGCCGTTTGTCACTGTGAC
ATTCATTCCTATGTATGAAGGTACGGGGAGCAATTGTGAACATTTGAGCCACATACAAAT
AAATCTGTCCCGTTAAATTGCAAAGTGATATCTTAAAGGAGTCATTTAGAAGTCTCTATT
GATTTTTTATTTTTTTTCAACTCCAGATTTTTTTCCCTCTTTGTTAAAGGTTGAAAGTGA
TTATCATGTTCTTCCTTTGTGTGACATTGGGGATGATTTTCCTTATCCTGGCCCAGCACC
ATGTGCTCATATTGAGGTTGGAGGAGAGGCACGTCCATTTCTTGATAACAGTCTTTGAGC
TTTTAGATTAAATTTAAATTATTTGAATTAAAGGATTAAGATGAGGAATAAAAAAAAAAA
TCTAGTCTAGGTTATTATTTTTGCTAAGCAAATAAAATGGGCCCCTAATTTTATGAGTGT
GATTTTGCACATTTTCTTGTTAAAAATTTTCCTATCTCCTATCCCCATTTCTAAGAAAAC
AAACTGTCCATTTTACTAGCATTGCTGACTGTGATCTTTACAATTTCTTTAAAAATTTTA
TTATAGAAGGGTTCTAGCCCTTAAAAATGTATTTAGTGGTTTGAAAAGGATTCCCTAGTA
GGAGGTTGGCGGGATGTGTGAAATGTCTAGGGAGATGAAAAATGAATGGTTTGACTGTTT
TCCTCTGGTTGTTGCCTACTGTTTTTCTGGCATCTTGGTCTGTACAGGCCCGAGTGCCTA
GAGGCATGTCTGATTTAAAGGTGGTGTTGGTCTCTGCTCTTTAAGCATCTATTAACTTGC
TATTATTATGCAAATAACTGTTGTATTACACATACTAATTTATGCATGGTTAGATTATGC
AGATGCATCACAAACATGGTTATTGAATAATAGGATTGGGTTTATTCTACCATCTTTATA
AACTGTTTTAAGCAAATTCTCATGGCTGGCACCCATGTGGACTTTTAAAGACCCTTCAGT
CCCTGAAATGTCTCTTTTGTATCCTTTTTCTTTTACAGTTAAAGCATCTGATGAGTGGAA
GAGAAATTGTCCAAGTTCTTAGGTTCAAGAGTGTTAGTCTGCTTTGCAAATTAATAGATT
TCTTTGTGTAAACATAATCTTTTCCTTAAAGAGAAAATCTAAAATAGGATAACTTGGCAT
GCATGCTAGCATTTGGTGAGGTTTTAGTGTACATTGCCTTGCTATTTAGCTCTAGGTAGC
CCGTCAAGTTGAAAATCACATTTTCAGGATTTGTACCTAATTAGAATATTTATCTTGGTA
AGCCCCTTGTTCTGTCAGTAATTTTTAAGCAGTTCATTGTTTGGCCAATTTATGTAAACC
CTTCATATTTTGAAAATCAACAGTGGAGCCCTTATAATAGATCTCTCAAGTCTTAGTAGA
AAACTTGTAAACCAACTAATAAAAATGCTAGAGTTTGAGAATGTAGCCATATCCTTGAGA
CTCCTAATCTATGGAGTAATTAATCAGTGAGACTTGGTGAATGATGTATCTGAGAAACAG
ATTGTCATTGCATTTGACAAATGAAGCGTTTGAAGGCTACAGTCACATTTGGGAAAAGGC
TATACACCTTTGCAATGTTGTTTTTCTGAATGTCTAAGTATACATTTACTTGATCAGTCA
GGTGGAAGTTGGAAAATTCTAATGTACTGAACTCCCTAGTTAGCACTAACCTTTATGCCC
AAGTTGGGGGTGGGGCAGGGGCAGCAAGACGGGGAACTGTTTTCCTTGAATCCTGAAAGA
TGTTGTCACCTAATTGGGATTTTTATTTCAAATAGAAGCAGCTTTGATGCCAACAGACCT
GTTTCCTAGATCTTTAAACAAGCACTTGTGTGTTTCATTGCTTGAATCATAATTTTTGGT
GGGTTTGGCATTTCTTTTACAAGCTTTCTTCTAAAGACTGAGGGATTGGGATAGGATATA
TTACTATATAAATGCCTTTCTTACCTTTCCCTCATGTGCGAAAAAGCTTTTTTTTTTTTA
ATGTATTTTTATAGTATCACAAAAGACTGGATTATTAAATAACACCCTCTCTTTAGCCAT
GTTATCTCATCTGAACTCCCAACCACTCTTTCAGGTAAGCCTTCTCTCATTGAACAAACA
GGATGGCTAATTTGCTCACTGTTGATCTGCAACTGGTTTGGTTCCATTGAGATCCCAAGT
GGGGTAGACAAGAGTGAGTCATAGACTCTTAGGGTTGAAATGGATCTCAGACATCATTGA
CTCAAACCTCTCTACAATATCCCTTAAATGTGAACCTCCACACTCTGCTTAAACACCTTC
ATTGACAGGAAACTCACTACTTTCCAAAGCAACCATGGACTCAGAGCAGTGTTCTGTTCA
CTCAGCTGTGGATGGCTCCATCATAATTCTCACACACTGATCTGGTCCTTAAGCACATGA
AAGCCTTTCACGTATCCTTTAGAACACATAGATTTGAATCCCTACTGTGTCCAGGACTGG
GGACAGTACCAGGATATTATTGCTCAAAAATCAAATCAGAGCACCAGATGGGAGCTCTCT
TTTCACTAGTGGCAAGTTGAGAAAAGTGGCCTATTGAAAAGAGCTCTGGACCAGGAGCCA
GAGGATTAGAATTAGAACCCAGTTTTCCTACAAACTCTCTGGTCACCTCAGACCTTAATT
CTTACTTTGTGATTCCTCAAGGCATCGTTTTCCTCTTGTCTAAAATGAGGATCCTGATAT
CTTCCTTTCCTATCTGATTAGAGGAGATGTGCAGATCTAATGAAATTATGGCTGTGAAAC
CACTTGGAAAAGTACAGAGGACTGCTCTGCTGGCCCTAATGTTGGGCTGCAGCACAAATC
AGGATTTCTGTCAACAGCAGGGGAACCTTTGCAAAAGAACCTCAGCCACTTGCCAGCTTC
AACTGGAGCAAGGTATAAAAGGAGCAGAGAGGAAAACCAGGAGGAGAGTCCAGCTTCAAG
GCTCGTTCTTCACCTAGCCCAGCATCAGTGCTGCTGACAGCATCATTAGCAGTGCCTCTT
CCTTCCAGTGACAGAGCATATATCGGGTGGGGACACAGATTGAGGGAGGAGTGTTGAAAA
GATATTAAGGAGAGTCAGTGGCCTGGGACCAACATAAAGGTTAAAGGGCTTGGTTTTTGT
TGAGATAATCATTCTGCATGGATTTCATTGTTTTGTGAGTTGGGTTAGCACTATCTATTT
GGTTTCCTCTAGCCATAGGGTGCACAGTCTCATTGGCATGCAGTTTAGGATGTACAGGGG
GAAAAAAAAAAAAAAGGTCAGGCACCACTGTACTAATGCACAGTCTGATTATTAGGGCTT
ATAATAGGAAGAAAACAATGTCTTGGATTCATCTAGCACTTTTACCATATAACACTCCCA
AGCACTTTCATTTCTGTTACCTGACTCAGCTTTACATGCTGTCTGTGTGGACTTTTATAT
CCAGTCTCCAGGTGAGCAGACTGAGGCTCAGAGAGGTAGAGCACCTTGCATTAGGGAGAA
ATGGGTCCACTTAGGTGTAGGATTTGTATACCAAAATAGCTGGCTCTGTGTATTCTTAAT
TTGGTTGGCTGTTTGTACCACTGTTCACCTTCCCTTTCAGCCCCACCATCCCCTTCTCCT
AGTTTGCCTTCTCTGCCCTGGGGAAACCTCTTGTGTAGATGAGATACGCTGAGCATCAGA
GGGTTGTACCAATGTAGATGATGACAAGATCATTCCCGAGAGCCCTTCTGCTTTTCTTAC
CCTGTGTTTAGCAGAGTGGCAGGAGGATCCCTAGGGTCCCAGAGCTCTCATTGACCCCAA
TGCCATTAAATTCTGGGTGCCTGCAAAGCATTATCTAAATGGGATAATGAAAACTTGCAT
TTTTTAACATCTTGCAAGCAGATAGTGTGTCAATTTCTTGAACACTTTAGCTTTAATAGT
AATCTGAAAAGATGTGCAGGTCTGGGCAAGGACTGGAGTAGTGAACAGTTAATCATGTAG
ATCCAAATTCAGTTGACTTAAAAAACATGATGGTGGGCAATGGCTTGTTTAATGACACCG
TAATTTAGGAAAAATGAAAAGGATTGCCTGCTAAAAATCATCAGCCTTCATTTAAACTTT
ACAACAGTACACTGCATTAGGATGCTAGTAAATCCATTAAGAAGACTTCTAGAGGATGTG
CGAGTTCTGGCATTTGGAAATTTGGTAAACAAGATCCACAGGAAAGTGAAGATAATTCAG
ATACAAATGTATTTAAAATACTTTTGCATCTATAAAAATGTTTTTCTTTTGGCTACAATT
CCTGATGTTGGTTAATAAATTACATCAAAATGACCTGAAGTTAAAAACAGGAAAAAAATC
TGAGCAAATAGTGCCCCTGGTATTGTAAAGCTTTGAATGTTTTCACACCCCATTAATTTA
TTACTTCTCTTTCTTCATCTTTAAATTTCTTAAAAAAAAAAAAAAATTTCGACTCCCCGC
TGCTGCAGTGATTTTCATCTTGTTGTTAATTTTCCCTGCTCCATATGGAGCTCCAGACAT
TTCACCTGGAGGCTGTACTAGATTTTGCTGTAGTGATCGTACTTCCGGAGGCCAAAACTG
TCATTTAGGGTTCCTGGTGCATCTGTCTGCGCCAGGCTTTTCGCTGGCTTGGGAGAGTGT
GAATAACAAATTGGATGCACCTGAGATTTGGATGATTAGTGTGTTTTGTGAATCTCCACG
ACTTGTAAGCAGATAGCTCTGGGGGGGGGGGATGTCTAAACAGTGACTATGGGTGAATCT
GTACTCACACCTTACATTTGGGGCTTTGCTAGGGAAGTGCAAACATCCTAGGCAGTCTGA
ATGCAGAGAGAGTAACAAATATTTCATCCTGCCTTGTCATTGATTAGAAAAGAGCCTTTA
ATTTCATTTCACCCCATGTTGTGATTAATTTGCATTCTTTGTCAGAAGTTAATGGAGTTT
TTTATGGTTCACTCTGAAATCCTTGAAGACATCAGACTTGATCTGATGTTTATACAACCG
CCAGCGGAATTTTTTCGTTTGATTGATGGCAAGCTTGATGTTATTCCAAACGGCTTTTTA
AGCTGTTTTTAAGAATTATTTGAATAAAATGCAAGCAAGATATTGTTGTAACGATCAAGA
TTATCTGTTAAAAATCTGTTTCAAATAAACAAGATGATAAGTAGTAAAAAGAATAAAAAA
GATAAGAGAAATAGTGAACAGTGATGTTATTTGTTAAAAATACATAAGAATGGCATTTAA
GTAAATTATTGCGACATATAGATAAGGTTGCTTTTATTTTTTAAAAATTATCATCATTTG
GCCAAATGAAATAATCAAAGCTAAGGTAAAAAGAAATCTGGATCCTTTAGGCTTAAAACC
CTTACTATCAATTGGTAATTCTCATTTATTCTGCCAGTTTTTGTCACCAAATTATGAAAT
AGAGATCTACTATTCTTAACTCAAGGAGACAGGGCTGTCAGGCCTGTTAGCTAAACAAAA
TGATGACATATTACTTGTCTCAATAAAGAGACATTCTTAAATCCCAATACAAGTCAGACT
ATAAGTGGATAATAGAGGATTGTAAGTGAAAGACATGCATTCTAAATAGTTATTAAGACT
GGTGTTTTTCACAGGATAGTACAGAACTGAAAATATCCTGTTTATAAAAGCAAAATACCC
CAGTTTGTGGGTAAGAGAAATGTGTGTTCACCCCCATGCTGCTGTATATCAGAGTATGAG
AGGAGCTGTAGGTAGTGTTTGCTTCAGAACCCCCTGCTATAACTAAGGAAATATGTTTTG
CAAATGCTTTTTGATTGCTAATACATTTGTTTGATTTGAGCTCTTTGCCTTGCTTCAGCA
GATTCTTGCTTCACTGTGATTTGCTGCTAGTGAAACTTACTCCTAGTTCAAAAGGCTACT
TATCTGAGCACTTTCATTTAAAACAGATTTATTTGTTGTATCTGAAAGTTTGCTGAACAA
TTAGATACTTCTAATTGAAGTTACTGCTGTCTGATCCTTGTATTAACCTGATCTAAGGTT
CTTTTTATTATATGTAATCCATATTATTGACCAAATTTGCCCCATTTTCATTTAAATGTA
AGCAGCTTGTCAAGAAGAAAATATTTTGTTTAACTTGGCATGAAACCTGCTGTTTTAACA
TGTTGGGTTTTTTTTTCAATTGACAGACTGTCTTTTAAACATTCATTTATTTCTAGTAAT
AAATTGTGCTCTGGATAAAGCATTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CAGGATACCCCACGTAAGGGTGTCCCCCGTGCAAGGAATGGCCCTGCGTGAAACTGTAGC
CCACCCAGAAGTGGTGCCACACATACAGAGAGCTGACGCAGCAAGATGACAACAAAAATA
GACACAGATCCCCAGTGCCTCCTGATGAGAACACAGGCAGACACAGAAGAACACACAGCA
AATGGACACAGAGAGCAGACAACGGACAAGGGGGGCAGGGGAATAAATAAATAAATCTTT
AAAAAAAAAAAAAAAAGAAAAGTAAATTACTTGTTAATACCTCAGTTGAGGTATATATAA
TTAGTCAGCTAGGTTGGTGATTCCTATCTTTTTTTAACCACTAACCCCATGTTGCAGTAC
CTTTTAAATTACTTTATGACATATATCTCTGTTCAATTCAGCATATATTTGTCATTGACC
ACCTACTCTGTGCCTGCCACTGTGCTAAGCATAGGGAGTACAGAAATGTAACAGATGTGG
TTTTTACTGTAAAAGAACCCAGTCCAATGGGAAGAAAAACAAAAACGGAAAAGGCAGTTG
ATATAAAAGGAAACCTGCAGATGGGACACTCTAGCTTCAAGAGGAAGAGGGAGTGGTCAG
CTTATTGTAAGAAGCCTCAGGTTTCAAAGTAGATAATCCTTGAGATGAGACTCTAAGGCT
CCATGGAGACTAAGAATGTTCCAGCCATTCTAGTGAAAAGGAGCATCATACGGTAGAAAG
TACAGGTCTAAAATAATATATTGTATTGGTGCCCTTCCAGTAGTTTAATTCAATAGAGTA
CTATTATTGTTACTTTCATTTCCCTAACAGTTTTGACTGTCTCCAGGTAACATTTAAAAT
AACACCAGAAGATAGGGAAGTAAGTAGAAGAAAGCGAAGAATTGGTAGAGGAGAACGGTG
GTGTATCAGGATGGAGATGGTGAGTTTAGCAGAGAACAGATAATGAATTTGGGTTTGAGA
ATTTCTTAAATCCCTTTTGAATGACTGGGAGCCCATCTGAAATTGGGAAATATTGCACTT
ACAATCTCTCTGCCCTGACATTGGTTGCCATGTATCTCTTAGAAGTTTCCTGCTGCTCTC
TCTTGGCACATCATAGGACTTTTTCCAGACTGCTGTTGGGGGAATTTTAATGATCAAATA
AGCTAACGCCTAAGAGAACACTTTGAAAAATATAAGTTGGTAAACAGAGCAAGGTAATAT
TTGTATTAGTTATATTCTCTGAAAGCAGTTTACGGGATTTACTATACAACTCTGAAAATA
TATGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACATACAGCTCCCAAACCAC
CACAACTCCCATCCACTCAAGTGCTGCCTCCACGTGGTATGTCTGCAGAGATGGAAATTA
TATCCCAGATGCTCAGTGCTTGCCAGGTAATTGCTGAATGGGTAATGGATCCCTGGGGAG
AAAGTGGTCCTCAACAACCATAGTAGCAGCAAACCGTCAACGTTTATTGTATCCAGTGTT
TTACTTAGCACCATTCAATGTAGAAAACTTGGGTAGATTTGGGTTTTGGGCCTCATTGGC
ATCCAAGTTAAAAAGGGAACAGACCTGCCCAAACTTTATGGGAACACACATTACTTTTTT
TCTTTCTTTCTTTCCTTTTTTTTTAAGGAGGTACTGGGAATTGAACCCAGGACCTTGTAC
ATGGGAGGCAGGCACTCAGCCACTGAGTTACATCTGCTCCCCCATACATTACTTTTTAGA
TGTCTAACAGTTCTATATTAATGCCTGAGGGAATTGGAAATTCTTCCTCAACTAAAATGT
TAATGATGCTAAGATCCCAACCCACCTTGGTGCCCATAAAACAGACATGCTAAGTTCATT
GAAAAGTCAATGAGTTGCCTGAAAGGAGCAAAGAGCTGATTCAGTCTAAGTCTGGAGAGT
ACCCAGGATATGCTAGGTGGAAAGAGGGTCCCAGAGAATGTTAGGAGCTAAATATGAAAA
TACCTGTTTATGTGCAGAGCCAACTGCTTGTCTCCAAGGAATCTTGGGAAACTGAGGCAG
CCAGTTAGAACCATCTGAGGACCTATTATGCTGTATACTCTAAAGGTCTACAGATGGTAA
CCACCATGGGTAGAAGGGAAGAAAAGCTAGCGAATGGAATAGAGAAGGAGCTATTGGCAT
AAGCCAAGAGGGGGAAGACCAAAAGAATGTAACGTAGCTTGTCTTATTTTGTTTTCCATT
GAGAAACAGGTTGTAGAGAGCACCATTTTGGGCAGGAGGAGACCTTGAGTCTAGGCTTAG
TTTTAATTTGGCAAAATATAGGAAACAAAAGAAAGTTTCCAGCCAAAGGCCTCCCTGGAG
TACCTGAGCTTGAGGTGACAGCAATACATCTGGTCCTTGCTCTTTGGACAGCTCTATGCT
TCCTTGTAGCCAGGCAACTGGAAATGCCCGGTGATTCAGGGCAGGGGATACTGGGAGGTA
ACAAGTGACACACCCCATAAGTGTCACTTTAAATTACTGTCAGTATATGGTTTTTCACAC
ACACACACATAAAGCTGACCTGAGCAGCTTCCTTTCTCCTTTCCACACCTTCAACACCTT
TTTTATCACCATTTCTCTCTGGAGTACTCCCTTGGAGTTTATTGAAACCTTATTTTATTT
ATATCAAGATATGAGAGGTGTGAAGTAAGACTCTGAAACAGAAGTTGAACTTTGTTCAAT
TCATTCTAAATCCATGGCTTCTTTTCTTTAAATCTACTTTGATTTTCATTTACAGTCAAG
CCCAGTAGTAAGGCACATGTTACCATGGTTGTATGTGACTGTTATTTCAAGATTCTTTCC
TTCCTAATTCTATCTTAACTGTATCTTGATTGCATTTTCAGTTTATCTCAAAGTGCATCA
GGCCAACAACATTGTAAAGTATATCATGTTTTTTAAAAATCCAATAATTATGTGGGGCAT
TAGCCCACAAAACTAACCTTCCTTGCAATGCCTATAAATATCACCTAGGGAGAAAAAGGT
GATCTTAGAAATCTACAGAATCCTGAGACAAAAAAGCAAAATTCCAGCAAATTACATTTT
ATCCAAATATTAAGTGACATTTAGAGAAGAGTGCAAGCCCTATGTTCTTAGCTCTGCCAC
TACATTTCAGGGACCTAAATAGGATGCTTCATTTCTGTGGACCAACAATTGTCTCATCCA
TCTTTTGGATCCTAAGGTCTAGTACAGTGCCTAGCTCAGAGTGTAAGTACTTAACCTACA
TGAAATCAGTGAATTAATTATTTAGTCCAGCTTATCTTTTTTTATATGTTGCAAAGCAAG
TTTTGGAGTCAGGAGAAACTAAGAATCAACACACATCTTAAGACCTTAATTTTTGTCCCA
TTTCCTATCTAATATATCCCTTAGCCCCACTTTACCCCAACCGGCATTAATGTCTGAAAG
TTAAAACTTCCGAGGAAATGTATTAATTGTCTTCAGACATTTCAGGTTTCTCATGTAAGA
GAGAACATGGATTTGCCCTGTCAGGAGGGTAGAACTGAGTCGAGGTGAAAGGGACAGTCA
TCACTAGACACGTTCAGGCAGAAGCCAGGTCAGGAGGGATGTAATGAAGAAGGATTCAGG
GATCAAATGGGATGGGGAGCTACATTGGATTAAGTAACCTTTAAGATCCTTTCAGACCAG
TCTCTAAAAGTGAATGATTCTACTCAATATTGAGCAGACACCAAATAAATAAAAGGCTGA
TACAGTTTCTGTCTGTTGAGAGAAGTTCCATTTCATCAGAATTGTCCAGATTCTGTAATT
GGTTTAATCATCTACTCCTGTTAACTCTCAAATACTATGTCAATATGAAACACATAAGAA
ATAAAAGAGTACAAGAAAGAAGTAATTCTTTTTCAGCCCAGCATATATATATGTCTGTTT
CCTCACAATTCAGCCAGCCATGTGATATGACCATCAAAAATGTGAATTCACTCTTAGTTT
CCATGGATAGAAGTATAATGTCCAGAGGAAGGTGATTTAAACCAGTCAGTCCAAAGTTTG
TGTTCAGGTGTGAGTGTCCTATTTTTTTTAAGGAAAGGACACATATGGAAACACTCAGAG
AAAGGTGACTGCAGTGGTAAAGAATGCGAAATCATGCCTGTGTCATTCAGGTTCAGGTAA
CAGAAAACCTAATTTAAACTAGCTTTAAACATAAGGGGAATTTATCAGATCACCTGTTTT
AAATGCCTTGTATTGCTGGTTTTAGGTAGCACTTGATCCAGCAAGTCACTTTGACTCTAT
TCTCTGTAGGCTTCTCTCTTCACAGACTGAGAATGACTACTGGGGTTTCTGGGGCAATGT
GCTTCCCAGGTTCGAGGGGAAGAGTGAGTCTCATTTTCCTCACAGATAGCCAGAGGTCCT
GTCTTCAGTTTGACTGGAGCATTTTCAATACCTGAGCCCAGGGCATTTAGATGATGTTGA
TTAGTTTGGGACTGAACTCCCCTAGAGTGGGAGGGGGGTCATTTTCCCATGAAGCACATG
GGCTATTTGGAGGTAGGGGAATGCTGTTGGAATGTTGGTACTAAGAGAGGTGGAAGGATA
GAAGGCAAGAAAATAGCATCTCATCATAAAGAAGAAAATAGTGTTTCTTCAGGAAAGAAC
ACATTGTGAAGACATGACAGCTGTCTTCAAATATGTAAAGAACTGGCATTGAAATTATTC
TCTACAGTGTCAGACCAGGGGCTCAGGGCAGAGGATACTGGGAGCCAGTAAGTGACACAC
CCAGCAAATGTCACATTAAGTTACTATCAGTATATGATTTCTCCCAAACATACACACACA
GCCGACTTGAGCAGGTTCCTTATTATAGAAAGAAAGATTTGGACTCAAAATAAGAACTTT
CTAACAATTTAAACCATTAAGTATAGAATCATTAAAAGTGTTTTAGCAAACACAGAATAC
CTGTTTGTCAGGAATATTATAAAGGAAATTTCTACATTGGGCAAGGAATTGAACTAGTTA
ATCTCCAAGATCATTCTACATTCTATGGCATGTAGAGGGTTTAAACTAACAGAGATGGAA
ACTAAATGGTAGCTCAGGAAAAAAAAACCTTTCAGACACTTCAACACATTAAAGACTTTG
GCCTGGGAAGCATATGTGGCTCAAGCAGTTGGACACCTGCCTACCACATGGGAGGTCCTG
GATTCATTTCCTGGTGCCTCCTAGGGAGGACAAGCAAGACAGCAAGCTGATGCCACAGGC
TGGCATGGAGAGCTCACAAAATGAGATGATGCAACAAAGAGACACAACAGGAAAAAAGAC
ACAATGGTAGACTCAATAAGCAGGAGCAGAGTGGCTCAAGCTACTGGGCACCTCCCTCTC
ACATGGGAGGTCCCAGTGCCTCCTAAAAAGAAGACTAGCACACAGTGAACAGACACAGCA
GACAGCAAGTGCAAAACAAAAGGGAGGGTGAGAATAAATAAATAAAATAAATCTTAAAAA
AAGACTAAAACTTTGGTCCTACCCCCTTCAAGATGGAGAAGTGAAATGCTTCAGGACTCT
GTCCCAACACACAAGCTTTGAAAAGCCAGCAAATACAGGCATTAACATCTTTCTTAAAAT
CTCCAGAACACAATTAAGGGGCTACAGTAACAGGGCAAGTGCTGAATCAACTTAAAAGCT
ATAGGATTTTTGGCACCCTAGCTGCTCCCTTCCCCATCCCTCAGCAAGTTCAGCGATGTG
TCCCAAGGCAGGTTCCTGGTCCCAGGTCCAAAAGGAAAAGAGTAACCCTCTTGCACATAC
TGGCTAGAAGTGTGTATGTCTGCTCAGTCTGTCTTGTGATGGCGTGAGAGAGACTTGGCC
TGAGTGTAGAAGGCAGCTCACAGAACTCTCCTACAGAAAACTGGGAGAGCTGACAAGTTG
TGCTGCCTGAGGCAAGAGATTGCTGGCTTTAGACTATACAGTGTAGCAACTGGGGCTGTG
AAGAAATGGTTTCCTAAGGAAGAGTGGACATTCCTGTGATGGAAATGAAGGAATTCCTAG
GGCCAAATATGCATGCTCAAGACAAGCTGCATGTGCAGAAAGAACTAGGGAGGCCTGTAT
GCTTTGGTCTGGAGCTGTTCTCTTAACCCATTGAATTGATAAGCCATGAAGGGGAGCTCA
TTTGCACAGGTCAGTCTGCAAAGACTGGGTAAAGTGTTTTATTTTTTTCCTTGTTGATTT
TTTTATTAGCCCCTGGCATTGAAGGCAAGTTCTATCATAACACTAGCTGGTACAAGCTTA
AGGGAATAGATGGACACCTCAGAAATCTAAATTCTAGCAATAACACATTAACGTATCAAA
ATGTCAAGAGTTTCAACCAAAGTTTACAAGACATACAAAGAAACAGGGAAGTGATGGTCC
AGGCAAAGGAGAAGATTAAAACATTAGAAACCATCAGTGAAGAGGATAAGACCTGGGACA
GCCCAAACAAAGACTTTTAAAACATGGACCTACTCAACTGACGGAGTGTCCACCTACCAT
ACGGGAGGTCCAGGATTCAATCCCCAGGTGAGCTGGCCTACGCACAGTGCTGCCGCATGC
ATGGAGTGCTGTGCCACGCAAGGGGTGCTCCCTGCGTAGGGGTGCCCCACGCACAAGGAG
TGTGCCCCATGTGAAAAACACAGCCTACCCAGGAGTGGCGCTGCACACATGGAGAGCTGA
TGCAGCAAAATGACACAACAAAGAGAGACACAGATTCCTGGTGCCGCCTGACAAGAATGC
AGGCAGACAGAAGAACACACAGAGAATGGACACAGAGAGCAGACACTGGGAGTGGGGAGG
AAGGGGAGAGAAATAAAATAAATCTTACCAAAAAAAAAAAAAAGCCCTAAATTTGCTCAA
AGAGCTAAAGGAAAAATTGGACAAATAATTAAAGGAAATCAGGAAAATGATAGATGAACA
CAAAGAATATCAATAAAGAGAAATTCTGAAAAGGAATCAAATAGAACTGAAGACCACAGT
AACAGAAATTTAAAATTCCCTAGAAGGTTTCAACAGCAGATTGGAGGTAGCAGAAGAAAG
AATCAGTGAATCTGAAGATCAGACTATTGAAATCTTCTAGTCAGAGGAAAGAATTAAGAA
AAGTGAACAGAACCTGAGGAACCTGTAGGACACCATCAAGCATACCAATGTGTGTGTTGT
GGGAGTCCCAGAAGGAGAAGAAAGAGAAAAAGGGACAGAAAGAACTTTCAAAGAAGTAAT
AGCTGAAAACTTGCCAAAATAACAAAGACATGAATAGTGTCCCAAGGTGCTCAACAAACA
CCAAACAAGATAAACCCAAATAGACTCAAACCTTGCTATGTTCTAATCAAACTGTCAAAT
GCCAAAGATAAAGAGAGAATCTGAAAGCCATAAGAGAGAAGTAACATTACATACAAGGGA
GCTTTAGTAAAATTAAGTGCCGATTTCTCATCAGAAACCCTGAAGGCAAGAAGGCAGTAG
GATGACATACATAAAGTGCTAAAAAAAAAAAAAAAAAAATGCCAACCAAAAATTCTGTAT
CTGGCAAAACTGTCTTTCAAAAATGAGGAAGTGATTAAGACATTCCAAGATAAACAAAAC
TGAGGGATATCATCACCACTAGATCAGCACTACAAGAAATATTAAAGGGAGCTTGTCAGG
TTGAAAGGAAAGGACAGTAGATAATTCACGGAAGCCACACAAAGAAATAAAGATCTCTAA
TAAGGATGATGACATGGGTAAATAGTAATGCCACTTCTACTGTATTTTCAGTTTGTAACT
CCGCTTTTTACTTCTTTCAGGATCTCAAGGCAAATAAATAAGATGTATGATAAATCGATG
GTTTTGTAATGTGTAAATATGTAATTTATGACAAGAGCTACATTAAGGTGGGGAGACAGA
GGAGTGTAGGAACATACTTTTTATGTATGCTGTTGAAGTTAAGTTGGTATCAAAGCAAGT
GAAGTTGTTACAGATTTAGGATGTTAAATTTAAGCTCCATGGTAACCTCAAAGAAATATA
GAGAATATTCAGACTCACAAAGAGAAATAAAGTACAGGTCACCCATGATAGGGGCTAAGG
GCAATGTTAAATTTCTTGAACTTGATTACCACATTAAGGTGATTACATAAATAATTATCT
TGTTTGTAGGAAATGTACATGTAAGTATTGTGTGTTCAAGGATATGATGTGTGCAGCCTG
CTCTCAAATGTTCAGAAAATAGATAGAGGGAGATGGGGAGGAGAGGGAGAAAGAGAGAGA
AAGTGAGAGGGAAAAGAGGGAGGGAGAAAGGGAAGGAAAGGAAGGAAGAAAGGAAGTGGC
AAAATGTTCAAACTGGTGGATCTGGGTTTCTGGTGGGGTGGGGCATGTTGGAGTTCTCTC
TCTGGGGTTTGTATTACTTTTGCAAATGTCTGGTAAATTTGAAATTACTTCAAGATAAAA
AGTTAAATCTTTTGCTACGGTAGATTTATTTGATCATAAAGAGTAGAGTGGTCCACAGGC
CTTTCAAAAAAAAAAAAAAGCAATACCTTTTACACACACACACTGATATTCTGTAACAAG
ATTCTAAAATAAGGTCACCTTTTTTGGAGCAAAGAAAGAAGATAAGTTTGATTCAAATAA
ATGTCTAAAATCTTCTGTGAAAAGGAAGATGCTTTATGGACTCTTGGCCCAGACCTTGTA
CCGTTGGGGGAAAGGTTAATTTTCTGATTCACATTGATCATTTGAATTGTGGCTCTAAGC
CCCTGCTTTTCTTACAAAATTCAGGTCTAAAAATGAAAACTTATATCTTCCCAGAGGGTG
ATTTACTGTGGCTCCTATGCACCTATCTGGGGGGGCATGAACTATGTCAATTTTAAATAC
ACAAAGGATAAAAGACTATAGACTGACAATCAGGTCTTTTTTTTCTTGCTCACCCACTGG
CAGACCAATCAAATGAATAATGTTGCACAGTACCTTGGTGCTCCAGCTGTTGTATTTTGT
GTGAAAATGCATTGTCCTTGATATTCAGGAAGCAGTGAGAGTCAAGTGATCTAATTTATG
GTTGTGATGGTTTTCCGTCGGTCCCATCTGAGCTGTGTCCTCTTCCAGCAACCTTAGAGT
CTTTCTGTCCCACCCAGCTGTTTGTTAAATTCAGGAAACCCTGGTTTTAGCTTTTCAAAA
CTGGTCACTCCCTAATGTAGTACCCCAGCCAGAATATGAGATATGGAGCAGAGGGAATGT
GCCAGTGAATGGAGTTTAGAACATGGGGGTCATAGTGACTTTTTTATACCCTATTGAGTA
GGTTTCTGCTAAATCCTCATAACTTATTTTGTTTTAGGCCCTATACAAAAAATGCTAATA
GATTCATGATAAGAATCTATGATAAGAGCTTGAAAATGTACAGAGGTTGATGAGCAGGGG
AGATAGGGTGACAGGTGAATTACATGTGTTCATTTTGGATTAATATAGATAATATATATT
ATTCATTAATTTTGTCTCTATAATGCATTCAGTATCTAAAAATTATCAGTTAACCAAAAT
TCCCACTTAGAGTTAACCAGCATAAATTTTTTTCTATCCCTTTTTTTTTTTAAGATTTAT
TTTATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTGTGTTCT
CTGTGTCTGCTGTCTCTCTTTAGGAAGCACCATGGAACCAAACCCAGTACCTCCCATGTG
AAGAAGGTGTGCTCAATCACAGAGCCACCTCAGCTCCGTGGTTTGCCATATCTCTCATTG
TCTTTCCTCTTTGAGTCTCTTTTGTTGTATCATCTTGTTGATCAGCTTGCTGTACCTGCC
CGCTGTGCCAGCTTACCTTCTCCAGGAGGCATCAAAAACTGAACCTGGGACATCCCATGT
GGTAGGCAGAAGCCCAATCTCTTGAGTCACATCCACTTCCCTCTATCCATTTTTAAAAAG
TCTGTTTGGAAGCCCTTGCTTTAAGTTAGTAGTACTAGGCAATGTGTATTCAGTTTGTGG
TCATGTGGAAGGAATTTTTTTCCCTTCAGTTGACAATTTAAGATGGGCCACTTTGTTTTT
ACAAATCATAACTTTGGATTGGAGGTTATGTGTCCTTAAGTTTTAGCACCCATCATAGTG
CCAGACAACATTTAGGTTGAATGCTGGTACCCGTTCTCCCTAGGATAGGAAAAATATTCA
CAGCACCTGAATGGGAAACTGTGCCTTCAAAGAATCTTTCGGGTCCTCTATCTCATTCCT
TCATTTCGTCAGCAAAAGCCCTGAACCCCAATGAAGGGAGGGGGTTCCTGAGGCCATGGA
GATCTGACCCCAAAGCTCATGCATTTTCCTGACACTGGACAGCCTTCTGAGCCAGGACTC
AGTTCTAGCCTACATTCTTTCTACAACCTTGGGCATTTCTCTCCTCTGAGCTTCAATTTC
CCTAACAGCAAAATGATTGCATCAAACTAGATCATCTCTGAGGTCTCTTTCATATCAAAA
TTCAAAAATTCTTTAGATCACAATTTTTAATTGAAAATATGAAGGTTTCTGTTTACCATA
GTCCCTGTTTCTATTTAGCCAAGATTATAACTTAATGCATCTGATTTGAAACACAAGCCT
TGCAGAATGGCTACAGTTCCTAAAATTTGGAGTTTAAAAAAGAATAAAAAATTTAACATT
GAAAGCTATAATATATGATACCAGTAGTACAACAAATGAAAATGATACTTTTAAAAAATT
TCAACTTACATTACTTAATCTTATATTTCTTGTTTCTATTTAAGAGAAAATAACACAGCT
TGAAAAGCAGTAAATATGTAAAGGGAAAATTTGTCAACTGATATTGGAAGATCTGACCTA
GGTCACACATAAATCTCTCAGACAAGAGCTGCAGGCAAGCCATAATTTCAGAGCATAAAA
GAGAAAATGAAAGTGATAGCTGATATCCTTTCTAAGTTACATAGGTGGATTCATTTTAGA
TTTCTGATTGTGCTTCTGAATATAATATGAAAGGGCTGGTAGCAAGTTTTATTTTACCAC
TATATGTTAAAAGTACCTCTCCAGAGGCGGAAGCATAAAGTGAGACTCCAAAGTTTCTTA
CCACCAGAGTGATTGACTAAGTAGTTGAAGCCCCCCAAGCAAACTTTGCATTGATAATTA
CCTTTCCAGCATGATTTTCCAAAGCCATGTTGTAAGTGGAGGAGGAGCTTTTCTAATTGC
CAACTGTTATGGTCCTTGCAAGGAAATATATGAGAAGTGATACTACAATAACACCCTAGA
CCGAACTGATACTTAAGCCTGTTATGCAGTCATTTAAATACATAATGGTATCTCACATCA
GAATGAGGCATAAGCCTGTTAGTGTGCCTTTAAGTATTGGATCTAAGGACTGGCAAAAGA
GAAAAAGCAATGCCCAGAAGAGGGAAAAGGTTCAGCTAATTAGTATATCAAAATTCTACT
ACGTTCTAGAGTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTAGAGTTCCCATATACCTCCTCCCATACCTGGTTTTCCCTATTATTAACAT
TTTGCTTTACTGTGGTACCTTTGCTATAATTAATGAACTGTTATGTTATAATTGTATTAT
TAATTGTAGTCCATAGTTTACATTAGGTTTCATTCTTTCTGTTGTACGGCTCTATGTTCT
TTTGTAAGTGTGTGTTTTGTGTGTATTGGGGTAATATATATATTCAACCTAAAACTTACC
ATTTTAACCACTTCGAAATATACAATTCAGTGGTGTTAATTGCATTCACAGTGTTGTACT
GCCATTACCATCGTCCATTACCAAAACTTTTCCATCACCCCAAATAGAATCCCTCTACCA
ATTAAGCATTCCCCACTCCCCCTCATGCCTGCCCCTGTATTCTAATCTTAGGAATCAGTT
TTTAATTCATAGATGTGTTTTAGAATATTGTGATTGTCTAAAATATGACAACCAGAAAAG
TGGGTTATTACTCTAAGTATATACATGTTTCAAGCATATTACAGCTGAAAAGTAATTCCC
TTCTAACATCTGTAGGTACTCAGTAGGATAATTAACAAATCCCTGATTTATCCTTCTGTT
TATTTATTCCTTTTATAGTAAAAAAGTGAATTTATTTGGGAAACGGACTTGGCCCAGTGG
TTAGGGCGTCCGTCTACCACATGGGAGGTCCGTGGTTCAAACCCCGGGCCTCCTTGACCC
ATGTGCAGCTGGCCCATGCGCAGTGCTGATGCGCGCAAGGAGTGCCATGCTACGCAGGGG
TGTCCCCCATGTAGGGGAGCCCCACGCGCAAGGAGTGCACCCCATAAGGAGAGCCGCCCA
GCGCGAAAGAAAGTGCAGCCTGCCCAGGAATGGCACCACCCACACTTCCCATGCCGCTGA
CGACAACAAAAGCGGACAAAGAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTAGTGGCACTGGGAATCTGT
GTCTCTTTGTTGTGTCATCTTTCCTTCATCAGCTCTCCGTGTATGCTGCACCACTCCTGG
GCAGGCTGTACTTTTTTCATGCAGGGCGCCTCTCCATGGGGGTGCACTCCTTGCGCGTGG
GGCTCCCTTATGCAGGGAACACCCCTATGTGGCATGGCACTCCTTGTGCACATCAGCACT
GGGTGTGGGCCAGCTTGCCACACAGGTCAGGAAGCCCTAGGTTTGAACCCTGGACCTCCC
ATATGGTAGGTGATGCTCTATCAGTTGAGCCAAATCTGCTTCCCTGTGCAGGTTGTCTTT
TTACATTCATGATAAAGTCCTTTGCTTCACAGGAGTTTATACTTTTTATAAAGTCCTGTT
TTAGTTTGCCAAAGGACTATCAATGCAAAGTACCAGAAATGAGTTGGTTTTTATAAAGGG
AATTTATTTGGGGTAAAAGTTTACAGTTCTATGGCTATAAAGTATCCAAATTAAGGCACC
ATCAGAAGTGCTTTCTCACCAGTCAGCTGCCACACAGTTGAAGCAAGATGGCTACCAATC
TCTACTGAGGGTTAAGCTCCGCTGAGGGCAACCAGGCATGGGGCTTCTCTCTTTTTGAGT
TGTTCCATGGGCCCAGCCACTTGGGGCTTCATGCTTAAGTCCTCTCTCTTACATGGCAGG
ATCAAACATGGCGGGTTCCTTTTCCTGTGCCTTTCTGTAATATCTCTTTCTGTGTATCAT
TTATATCAGACCCAGCAAGAGGGCAGACTCAAACTGAGGCACGCCTCACTGATAAAGGCC
AATCAAAAGCCTAAAGTAATTTTATCAAGTAATGTAATCAAAAGTAATTTTATCAAGTAA
TCTAATCAAAAGGCCCTCAACCAAATTTGATGCAATTAAATGGTATCATACCCACAGGAA
TAGATTTGCCCAAAAACACAATCTTTCTCTTTTGGGGATTAATAAAATAATCTCAAACTG
CCACAGGTCCCTTTTATCTTTTTTTATCTTTTTGCTCATGGTTTTGGTGTAAGGTCCAAG
AAACCATTGCCTAACAAGATCCTAAAGATACTTCTGTGCTATCTCCATGTTTTGTAGGAG
CACACCGAGTTGCCTGCCTCATGTAGGGCAAGTTCTCAAACGGTAAGCTTGTGACATGTG
TCCAGGTTCAGTCGCTCAGGTCAGCACCAGACAGATGGACCAGGGACCCTTGCCATATGA
TCCTATCAGTTCTGCCAGTTTCTTCTGGTTTTTCAATGACACTGTGAGGGGAAGGAACCC
TGGAGCTTCTCACTCCATTATATTGCTCCCTCTCATTTTTTATGTGAGGTATAGTCATTT
TAAGTGTTCCATTCATTGAGTTTTCTCTTAACATAAGAAATGGGTCACTTCTATTACTCC
AGAAGGTTCCCTCATCCGTATGTCCCTTTCTAATCAAATCCCCTTCTTTCCCACTAGGAT
AACCACTTTCTGATTTCTATCACCCTAGATGAGTTTTGCTTATTCTTAGACTTTACATAA
ATGGAGCCATACCATATATATTGCCTGGTTTCTTTCACTCAGCATATTTCTGGATTCATT
CATGTTGTTGGTTGTGTCAGTAGCTCATTCAATTTATTGCTCAGTAGCACTCCTTTGTGA
GAATATAGCATGATTTGTTTATCTATTCTCCTATTGATGGACTTTTCATTTCTAGCTATT
ATGAATACAGCTGTTATAAGAATTCTTTTTTTCAAAAAAAAGATTTATTTATTTCTCTCC
CCTTTACCCACCCCTGCCCCCCCGGTTATCTGTTCTCTGTGTCTACTTGCTGAGTCTTCT
TCTTTGTCTGCTTCTGTTGTTGTCAGCGGCACAGGAATCTGCGTTTCTTTTTTTGTTGCA
TCATCTTGTTGTGTCAGCTCTCCATGTGGGCGGCGCCATTCCTGGGCAGGCTGCACTTTC
TTCTGCGCTGGGTGGCTCTCCTTATGGGGCGCACTCCTTGTGTGTGGGCTCCCCTATGCA
GGGGACACCCCTGCGTGGCATGGCACTCCTTGCACACATCAGCACTGCACATGGGCCAGC
TCCACACAGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTCCCATGTTGTAGAAGGAT
GCCCGAACCACTGGGCCAAGTCCGCCGCCTATAAGCATTCTTGTTCAAAGTGTTTTGTGG
ACATGTTTTCATTTCTTTTGGATATATAACTAGGAGTAGAATTGCTGGTTCTTATGGCAA
CTATATTTTTAACATTTTGAGGAACTGTCAAACAGTTTTTCAAAGTGATTTTGCCATTTT
ACCCTCCCACTACCCATTTTTTAGTCTGACAGGTATAGCATCTTAGAATTGAAGGCAAAC
TAGTCTAATTTATTACTCAATGTTGGAATATTTTAAAGTTTTCTTACCTCCTTTTGCTGC
CCTCTCACCTTTTTCCAAACCATTTTGTAATCACCCCTTGCTTCATCCTTTAAATTTTGT
CCCTCATTTTTTCTTTTACTATTTTTATTTTATCACTTTTATAAGCCAGTAGTTTTCAAA
ACTTAAAATCCATGTAGATTAGGCTGCAGTTGTAGTTCTCTTGACACATGGATATTCCCC
AACACATGTTAATTCAATAATGAAATGAATGTAGATCTAATATTTGAAATGGCTCAAATT
TGACTTGGAGAATATGAGAACCAGAGTTTTTAGGAAAAAAAATAAAGCACCATGCTGAAG
TAGATCAAGAAGGGAGAACCTAAGAGGTAAGGACTCAACATAGAAACCCATCTCTAACTT
TTGCTGTAACATTTAGTAAATTATCTGATTTGTCTGGGCCTTGATCTTGAGTATATTAGA
ATTAGCACTTTTATAATGTTCTGTATTGCATTCTTCATTTCTTCTTTTGTGTAAGCAAGT
CTTTTCTCACAATCCAGATTACAAACTATTAATACTTGGAAGTTTGGGCTTTCAAAACAT
CTTAACCTGAGTGTAATCTTGAAGAAAATCAGGTAAACTCAAATGACGGACATTCTATAA
AATAATTGCTCTGTATTCTAAAAAAATATTGTTAGGGGCAGTCATAGTTTTAAGGAACTT
GTTTGCAGATTAAAGAGATTCAAAAGGTATCACACCTAAATTCAATGCATGATCTAAGAT
TGGATTCTGGTCTGAGAAAATTAAATACCTTTAAAGGATATTATTAGGGGCAATTAATGA
AATTCACAAGTGCAACATTTTTTAGAGAATAGTATTGTACTGATGTTAAATTTCCTGTTT
TGATAATTTTCCTGTGACTATATGAGAATGTCCTTTACTCAGCAAATATTCGGAAGTGCT
TAGGAGTCTCCTAAAATATGATGTCTCCAATTTACTCTAAAAATTTTCCCAAAAAAGCCA
TATATATACATACTATAAAACAAGAGAAAGAAAATAATAAAAGAGCATTGGGCAAATTGT
AAATAATTAATGATTCTGAGTAAAGGGTATGTAGGAATTCCTTTTACCATTCTTACAAAA
TTTCTTCTAAATTTTAAGTTACATCAAATTTTAAATTTACAAAAATATGTTTTTAAAAAA
TTTCAAACAAAGAAATATTAATCTGAGGGCTGTGGTAACAGGTTATTATACATTTCAGGT
AATTGCCACAGAGTTTTCTTTCAAGTGTTTGAATTATTTTCAAATCAAAATAAGAATCTC
TGGAGAATTTCAGAAATGTGTAACACTAAGTTCTATTGGAAACAATCAACTATTTTTCTC
TATGTGCTCTTCAGGTATTGCATGAGTAAAAGTCATTCTGTCAGGTATTGGTTCTTCTGA
GGGCTACAGAGACCCACAGGTTCTATGGTCATGGCAGATGGAGTTCAGTGCCATGTCCAT
TGGCCCTACTTTGCAGTTGTGTTCCTGAGTGTGATGAAGTTGGACTCAGATATGATCTTT
GTTCACAAGCCTCTCCTGTTACTTTTCCCAGACCTGTGGTTGGCGCTGGGATTAGTGTGT
ACTCAGGGGACCTGAATCTCTGGACTGTCCATGTCATAGCCAGGCCCTGAGCCTCAACAG
ACTTGCAACTCCTACACTCTGGTTTATTAGACTTAAATCACTCAGCTAACATGGAGGTGA
AGAAGGTCAATCACCACACCAGGGAGCCAAGAGTGCCTACAACTGAAAGCAGGAGAATCA
CATCCATCATCCATGTGGAATTTAAGCCCCTTCTTGATATAGATGTGGAGTGGACATGGG
TCCACAGGATGAAGGAATAGAATATGGATTAGAGTGGACTTACTGATATTCTATTCATGA
ACTATTGTGATTAGTAATCAAAGAAAATGTAACATTGATGTGGAGAAAGTAGCCATGGTA
GCGGCTGAGGGTAGGGAGTGGGAAGAAGAGATGTGATGTGGGGGCATTTTCAGGACTTGG
AGTTGTCCTGGGTGATGCTGCAGGGACAGTTACCAGACATTGTATGTTCTCCCATGGCCC
ACTGGGTGGACTGGGGGAGAGTGTAAACTGTAATGTGGACCATTGACCATGAGGTACAGC
AGTGCTCAGAGATGTATTCACCAAGTGCAATGAATGTCCCATGATGATGGAGGAGGTTGT
TGTTATGGGAGGAGTGGGGTGAGGGGAGTGGAGGGTATATGGGGACCTCATATTTTTTGA
CTGTAACATTAAAAAAAGTAAAAAAAGAAAAAAAAAGTCATTCTGTCAAAAGTGATTGTT
TACAATGACCCCTTTTGCAAAACAGAGATATTAATATTCCAATTTCCTAAATGGAAAAAA
AAAAAGTAGGCAAAGAGTAAAGGCTGAAAGAAACACAATAAACTCAAAATAATTTCAAAT
GACTTGGCATCATTTAAAAAAATGTGTTTATTAATTTTGAAAGCATCCTATACATGAAGC
CTGAGTGATATCAGGATTGTTTAGGGAGAAGACAGTGGGTATTTATTTTCTTATTAATAA
ATTATTTTATTAATTTTTAATAATTTAATTAATTTATAAATATTAATAAATTAGAAACCA
CAAGTTGCTTCCATCTTTTCAGTTTCTTCATTTATCAGTTTCTAAATTACCTTTTCCATT
CTACATCAGATTCCACCAATGTTTACTGAGCACCTACTAGATGCCATGAAGATACAAAAG
AGAACTGGGACATGGTTCTTTGTGGCAGAGATGGCAGAGACTGCTAGTTGTCTACTCATT
ATCCTTTTTTTAAAAAAAGTTTTATTTTATTTCTCTCCCCTTCTCCCCATTGTCTGCTCT
CTGTGTCCATTCCCTGTGTGTTCTTCTGTGTCTGCTTGCATTCTTGTCTTGTGGCACCAG
GAAACTGTGTCACTTTTTTTGTTGTGTCATCTTGCTGTGTCAGCTCTCCGTGTGTGCAGC
GCCACTCCTGTGCAGGGTGGCTCTCCTTACAGGGTGCACTCTTTGCGCATGGGGTACCTT
TACACGGGGGACACCCCTATGTGGCACGGCACTCCTTTCACGTGGCAGCACTGCGTATGG
GCCAGCTCACCACAAGGGTCAGGAGGCCCTGGGTATTGAAACCTGGACCCTAGATATGGT
AAGCGGATGCTCTATCAGTTGAGCCACAACTGCTCCTTTCAGTATCCATTTCTTTCTTGG
AAATGGAACACCTCTTTATGTTGTGTAATTCAGTACGCTTTGCTACACAAAATGTCCAGC
CTTCCTTGCAGATGTGGTAGCATGAGACATAAACTAAAGACGTAGAGTAATGTTTCTGGA
AAAGTTCTTGAAAATTTGCCTGGGAAGCCTATTGTTTCTCCTTAACCATTTCCTCCTTTT
TGCCTGGAACATGGATGTAATGGCTGGACTTCTAGCAGCCATCTTGTAAACACAAGGACA
AGGTTCACACCCTGGAGTTGGCAGAGGGAAGAGATGAAAAAAGCTAGGTCCTTGGTGTCA
TCTTTGAGTTGCAATATCTGCCTTTCTCTGGGCTCCTTTATGTGAGGGACAATCAAATCC
TATCTTTTATAAGCCTTCATTAATTTGGATCTCTATAACTAGCAGCAGAATGCAGTTCCT
AAATTTAAAAGTCCCTGATTTCAAGGATTAGTTGAGGAGAGAAAACTAATGTACACAAAA
TAATGAGAGAACACTTTTTGGTAGCATATAATTAAGAGAAAGTGCAGGTGGAAGGATTAC
AAGTTAGAATCAGTTACTCCTGTGGTGGAGTCCTCAGATCAGCAATGCATTGTGTATGAC
CTTAGACAAATCATATAACCTTTCTGAATCATGGTTTCCTGTTTTATAAAATGAAGATGA
TAATAACTACCTTGTGTAATTGTTATGAGGAAGAGCATTAATGGGCCAGGCACATAGTAG
GTATGTAGTAAATGATATTAATTATTCATAAACTCTACAAATTGACAGAAGGAAGAAATC
TATATGGGTTTAAATGGTCAAAAAAGCCTTTCAGAATTTATGTCAGGATTCTCCAGGGAA
ACAGAATTGACAGATTACATATACAGATATATAATGAAAATACTATGAGATTTATTATAA
GAATTGTCTCACATGACCATGGGGATGGGCAAGTCTGAATTCTATAGGGCAGGCTGCAAA
CTGGGAACTCTGATAAAGATTTCTGATGAATTCCCCAGGAGAAGGTGGCTGGCTGAAGTA
AAGATGTGAATTCCTTCTTCTGACTGCTGAAATCATCACTTCTTCTAAGGATTGGATGAA
TCTTCTCTCATTGTTGAAGGCAATCTCCTCAGTTGACAGCAGACATAATCAGTCCAAGAT
GCAATCAACTTACTGATGATTTTAATCCACGAAATATCCTCACAGTAACAATTAGGCCAG
TGCTTCCTTGACCAAACAACTAGACACCATTACCTAGCCCAACTGACACATGAACTTAAC
TATCACATAGAAGAAGCTGGATTTAGTTGGCAGGGAAGGATGAAATGTTTCTAGATGGAT
AAAGGAGAAAGGTATTGCACATTGGTAAAAGCAAAGGCAAGTGAACCTGCCCTGACCAAG
AGGGTGGAGTGAAATCCTGGAGGCTCCATCTGCCCAAAGAAGCTTTGAACAATCAGCAAG
CACTGGCAGAAACATATTTTTTTAATGTCCAGAAAACAGTTAAAAGTTTGCAGTGACAGG
GTAAGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGC
AAGCATAAATAGTACAGTTTTAAGTTGTCTCACATCACGCTTTTAACCTACAGAATAGGT
CAAGGTGGAGACCTTCTCTAAGATCTCAGTTCATGAGGAAATTTCCTCTCCTCAATTCAT
TTGGTTCACACAACTCATATTACTGGGGACAGTGTCTCAGACCATCCCTGAATTCACTTT
GAAACATCCCTAGAATGTTTGCAGCATGTTTTCCTCAGAGAATGTGGTAAAATATACCCC
ACCCCCAGTTGTTGGAAATTTGTGAAAAATATTCTCTTTGATGTCAAAAATGGCTTTCTC
GGGAAGCAGATGTGGCTCAAGTGGGCTCCCGTCTACCATATGGGAGGTCCAGGGTTCAAT
TCCCGGGGCCTCCTGATGAAGACAAGCTGGCCTGCACGGAGAGCTGGCCCTAATGGAGAA
CTGGCCCATGCAGAGTGCTGGCCCAAACAGAGAGCTGGCCTGCACAGCAAGCTGGCCCGA
GCAGAGAGCTGGCGCAGCAAGATGACGCAACAAAAAGAGACAGAGGGGAGATAATAAGAG
ATGTAGCAGACCAGGGAGCTGAGGTGGCACAAGAGATTGAGCACCTCTCTCCCACTCTAG
AAGGTCCCAGGATTGGTTCCTGGTGCCACCTAAAGAGAAGACAAGAGAAAAAAAAAAGAG
AGAGAGAAGAAGCAGACACAGAAGAACACACAGTAAATAGACAAAGAAAGCAGACAGTGA
GGGCAAAACAATGGGGGGGGGGGGGCGCCGGGGGGGCGGCGAAATAAATAAATATTTTAA
AAAATGGATTTCTCATTCTTAGTTCACGTATGTCAAGTAACTCTCCTGTTGAAGTAGATA
TATCTTACTAAGAATGGGGGAGATTGTAGAGGTATGTCTTGTTCATGAATGGTAAAAGTA
ATTATTAGGCACTTTATGCATCCAGCATTCTTGTAGGAAATCTGTTTAATTTATTTAGAC
TCTTGAAGATAATTATTGCATGTTTCCTGTACTTAACAAAGTGGTATTTCATCTTGAATG
TGCAGATCAAAGATTTCTTCAGAAAACCAAGGCTGTGTCTATTACTTTGAAATAGATATA
GTAACATTGAAAAAGTTAGTTAAGCAATAATTGGAAGTAGTCATTTTGTATATAAACAGG
AAATAAATTATTTTTGTAGTCACTCATAAATATTCATTGTAAGGATATAAATGAAGAAAA
GTTGAATTAATTGAATAGAGGTAAGTAAGTAAAGTATGGACACTGCCAGGTATCAGGACC
TGTATCAAATACAAGAGAGAGTGGATGTAGGTCAAATGTTTGAGCACCTGCTTTCCATGT
AAGAGCTCCTGGGTTCAATCCCTGGTACCTCCTCAAAAACAATAGCAAAACAAACAAAAA
ACCCCAACTTTCATTGGGGAGTGGATGTAGCTCCCAGGTACAAGGTCCTGGGCTACATCC
CCGGTACCTCCTAAACAAAAAAATTACGTATCAAAGTTGTGTAAGAGAGAGCCTCAGCTC
TTAAACTAAGGCTATAGTCATTTTAGTTTCCTGGCTACTTAAAAACATACTGTAAAATGG
ATTGGCTTAAACAATGGGAATTTATTGGATCATGGTTTGGGGGCCAAGAGAAGTCCAAAA
ATAAGGAAAGCCAGGTAATGCTTTCTCCCAGAGGGCAGTGGATTTCTGGGGCTGGCTCTG
GAAATCCTTCCTGCTCGGCTTTTCTGTCTCATGGGAATGCACATGGTGGCCGCTCCTAGT
TTCTGTCTCACTCTGACTATAAAGAACACCAGTACTCCAGATTAAAGCCCAGCATGATTC
AGTGGAGCCACAGCACAACTGAAGTAAGCCCTCGAAGAGGTCTATGTACAATGGGTTCCC
ATCCACCAGAATGCAAAGACCGAGACTATGTCCAAACTGGGGTGCACAGTTCAACCCACC
ACAAAACCACTTGCCAGATTTTGAGCAATGTATTTATAGCCTGAGAATCATCTGTCAAAT
GATTACCAGCTCTTTATTGCATTAAAAACTTTTGCTCATAAAAAAAAAAAAAAAAAGAAT
GTGGGAGAGTGGGGGAAATTATTCATGTGTGTTTGGAGGGGAAAAAAAAGTACCATAGGT
ACCTCATATCACAGGAGAAGTTACCTGTACTTTTCAAGATTTTTTTTCAAGGTTGTGTGA
CTTGATGCTAAAATCTGTAACCACTCTAGGGTGATAGTTAACAAATCTGCCTCTCTTTTT
TATGTAAAGCCTTATCACTCACTGAGCGAAGGAAAAAGTCTTAGCATTAATTCAGAATGG
CATTAAGTGTAAACTGTCAAAATAGACTAAAAGCCAGTCAACCTGGGACAAAATGATCAG
GGAGGGGGTGATGAAGAGCCATGTGCAGCAACGAGTGTGCACTATGTTCAGTTGAGCATG
GAAAGCTCATTTTAAAACACTCAAGCACTAGGTGGAAGGGTCTGCTGATCAGCCACATGA
ATGCAAAAGAAATACAAAAATACAATTTCTGCCCTTGAGAATCTTACAGTCTAGTTGAGA
AGAACTCACATGCCAAAATTGTTCATTTATAAACTTTACTATACCAAATATAAATCTAAT
GCACATTCACTTGTTTTTAAATAATGATATGAGCAAAGGTAGGTATAATGCAGGTGCTGG
AGGGAAAAGGCATTGCAGAAGCCCCACCACCACCATAGCCTGGCCTTAGAAATGCCTAGT
CCTCTGGGAGACTCAGTTTTCCCATCATGGAATAAAGACGTTCACCACTGCCAACCTTTA
AGGTGATTTGTGCGAATCAAATGAGAGCATGCCTGTAAAAGGACATTTTAAAGTACCGTC
AAAAAACATAGATGGGACCATTACTATTTTCCCTTTATTTTACCAGCCGGTTGGAGCTCA
TTTATCCATGAATACAACTGCCTAGTCAATAATAATGTTTGGTTTCTAAAAATATCCCTC
TTAAAAAAATTAGTACCTGGAACTCCATTTTCCTTGAGTTTTTAATAACTGTAGGCATTT
TTTTTTTTGCATTGAAGTGTTTCATACTTTAATTATTACTAAGTGGATGTTGTATTAATT
TGGTGTCATATTGTAGTAACTTTCTAAGATATGTGGTTTATCAGTGTTAAATGTGTGAGC
ACCCTGCCTTCAGAATGTTGCTCAGGAACAGACACTCCCACTAGACATTTATTCCCTGAA
AAACAGTGAAAAGCTTGCGTGAATTTGATTTTCCCAGCAATCATTGCTGCCCTGGAAACA
AGCTGAAGGAACTTTGGAAAAGGTGGAGCCTTCACCCCACTCCTGAGTTAGAGGCGAATA
CTTCAAGCACATAATTAAAGTTTTCTTCACAAAATAGGGGATTGTGAGCAGACACTGGCA
GGAATCCAAAATTCTAATTTCTGACTATGATTTAATTTCAATTTTAAATAAATCGGTTTT
TAATTTAAAAAGAGTGAGCTTCATAACATTAGCAATGATTGCAACATTAAGCCCAGTGTT
CACAATCTAGCAATATAAAACATTATTTATATCTGAATCGTAAACAGCCTTTTGAAATGG
ATTATGGTTTTTCTCCCTATTCTAATACAACCTGGAGGGTACTAAAAAGTGTTGTGTGAA
ATTAACATTCTGCTGACTTTCGCCTATAAATGAGAAGCGAGCTATTAACATTTGTGTATT
TTCATTATGTAAATTGTGTTAACACATGCCCACAAATTGCCACCAGCAATGCAATAATTT
TCTCTCAGTGATCATAATGTGTCCAAGTGAGTCATTTTGATTATGACATGCTAATTACAT
ATTGCCTTTTTTCAGATTCAGAAAAACCAGGGATCTTTAATGGTAAGCTTTATGAGTTCA
GAAAAAAATTCACTTTTCTTTTTCCTGATGGCTGCTTCCTTTGCATGCTTGAATGCCTTG
TTTTAAACTTAGCAAATTGCATTTTGAAGAAAATGCAAACCTTTAACTGCCTGTATTAGA
TTAGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGCATCAAT
GTTTTTATAGAGTTTGCTGTGTGATAATCTGCTATATTTTATGCATAATGATTTTTCTTT
CCACTCCACTGTAAAGATATTGCATAGAGGCTAATACTTTTTCCCCTCTTCTTTTCCATT
GCAGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGTGAGGCATCGTCTTATGTGCTT
TCACTCCTAAAGTCATTCCTAATGGTGTGGAAAGCTTATATTTTGTTTCCTAATGAAGCA
CAATGCCCAACATCCTTGGAGCAAGTTGTGTTGTATGGCTCTGAGCCACGTTACATGAAC
TGGCCTTGTCCTGAATCCCACTCTCCTGATTCTGCCAGAGAATCTGTGCAAAAACAAACT
GTCCTGTAGGCTGGTATGGAGGGGTAGCAGAGGCCCTAAAGATAAAACACAGTAATATTA
ATTGATCCTCTCCCTGGCCAGTTGGGGAAGGAGCAGGGAATTAAAATGCTATCATTTTTT
CCATAATAGATATTTAAAAGCATTCAGTGGGCAAGGGTCAGAGATGAACAGCAAACATAA
GCTAGATGAAGTTTTTCTCCCTTGCTTTATTTACCCAAAGCATATCAGGGTGATAAAAAT
GTTTGAAAACTCTAGATTTGGCTTTAATTTCCTAATTGGGCAGGCATTTTTCTCAGATTA
TGCTCCTAACTTCTTATACTTTTGACTAGTTTTTTCACATTTTAAGTCATCCTCTTTGAT
CATTCCTACCTATCAAGTTCCCAGTGTCCCTCTGCCTTCATGGAACTAATGTACCTGCAT
TTCTTTCTCAACCAGACTTTTCTACTTCTTATGACTTTACAGTCCTTTTTTCTGTAAATT
AGCAATCTTGTAGTACACCAGATTCTCAATTAAGAAACATTAACATCTTTTAAAAAGCTG
AGTTTTTCTGGGCTTGGTTTCGCCTACCAGCAAAGTTCATTTTTTAAACTTTAATTTTAC
AATTTTAAAACACTTCTAATTAGAGATGGAAGGCAATAAATGAATGAGATAGGAAAGTTT
GAAAGAAAAAAAACAAATCGTAATTCATAATTATTCCTCTCAATTAAACATCTGTATAAC
CAGTTATGAGATTTGGGAGAAAAAATAAAGATCCTCCTAGGAAAAAGACAAACGCGCACA
CATATCACAATAATAGTAAGAATGGGGCTCTAACATCCTTAATGGTTGCAGCCGTCAGTC
CATATATCCCCCGCAAGCCATAAACCATGTTGGTACAAAAATGAAGGCATCGTCCTGAAA
CAAATGGAGACTCCATTATCTCAAATATCAGACTGGCCTCCTGGATCTAATAGCTCATCA
ATATCTTCTGTCAACTTATATTCCAAAAACATCCTATCCCCATCAGAATCCTTTCAATTA
AACTGATTTTACTAAGGTTCTTCTCCATTTCTGCTTAGGGAAGTCCCCTGATAGGCATGG
CCTACCCAGGAAAATGCACTTCCTGCTGTGTTTCCTGGTTCTTGGTCTGCCAGGTGCCTG
GGCAGCAGAACATTCAGATACAATTATTCCTCATTGATGATATGTGTATTACCTGACAGC
TAACTTAAGATTTTTTGGACTAAATAGACATTTTCATTCCTTATTTAAAATGTGCATTTT
AAAGAAAGAAATGTTTCTTAAATGTATTTGCTCTTGGCAGCCTATTGACAGTGTGTAGCA
AATATCATTTAACCTTTTCTTGATGACTCAGGTCCATATTTTAAATATGGTACTGAAATA
AACCTTGATATTTTGATGCTCTCTAGGGTTATAAAATTGTGTGTGGCTAAATCGCCTTGG
TCTGATGCTCTGATGGATGATTTTCCTGTTTCACTCTTGTGATCACCTCAGTGCTTCATG
GTTACTACTCACTCTTGTCAGTAACTGCCTGCTAACCCAATGATATCTATCATCAGTCTT
TGCATTCCTGATAGTGACCCTAACAAAACTAGAAAGTGCAAATGAAATTAGATACCCAAG
TGGAATGTATATAGTCAAACATGACTTCATCTGGAAAGAGACATAGGGGCTTTTCTTTTC
TTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCTCCTAGAGA
CTGAGCCCATGGAGCAGCTCTTGAGAAGAGAAGTCCCTGAGAGGCTCAAAGAGCTGAGGT
TAAGAAAGAGAGACGCTCTATGCCTGGTTGGCCTCAGCTGAGCTCACACGTTGGCAGAGA
TCGGCAGTCATCTTGCTTCAACATGTGGCAGCTGGCTTTGGTGAGAAAGTGCCTTTTATG
GTGCCCAATTTGGATTTTCCATGGTCTTGGAATTATAAGTTTTTACCCCAAAATATGTTC
CCTTTATAAAAGCCAAACCATTTCTGGTACTTTGCATCAACAACCCTTGGCAAAATAAAA
TTGCCTGCCTGAATGATTTACTTTGTGTAGTTATTAACTTAATGTGCAGAATAACATTTT
TTCATACAGTTTTAAAATAAATAAGATGTTGATCAAATATTGAGGTAGCATCTCCCATAA
AGTACACCTATGTTTGTGGTATATGTATGATAAAATCGATAATTTAAGACATGTTAAAAA
TTTTAATTTCCTGATATTTCAGGGCTAATTTTAAAAAACCTACAAATATGCATGTATAGA
CTATTTAATAAATGAACATGATTACAGTATAATTTTCTCCAAAACAGCTCAGGTAAATAT
ATCAGTCTCTAAGTAAAGCCAAGAGTATGTCAGAGATATCACAATATAGTGGAATGTAAA
TCATTTTGAAGAAAGTGGAATTGAGTTAAATTTAAAATTTTACCTTTTCAAAACAATGTA
ACATCTGATAAGGTATTTAAATTTTAGCATTTTTCCTGTTAAATGGGAAAGAGTAATTCA
ATTGCAATTGTTATTATAATTGTTATAATCAAAATCCACTCCATATTCCTAGACCTCATG
TAAGCAGTGAGTGCCTGATGACAGTCTCAAGTGATATTTCAAATCCTATGATTGCAAATA
GTGTACCAATCTAGACTTTTGCTGAATCTGAGAGCAGCAGGTAATTTGCTCTTGTTTTAA
GCTACAGAGATAGTCTACTGCAGCAAGATTATAAACCATTTGGATAAATTACAAAACCAA
GAACCTTTTAATAACTAAACAAATTTTCCAAGGGACCAAGGGTTTTGCTCATTGGATCAA
AAAAAGGAACAATCCTTCTATTTCATTAAAATCAAAGTGATAGATTTTTGATATAGTGCC
TCTTGACTAGACCAAGATCTGGTCTGAAAAGGCAAAGTGAAAATGGCTGAGCTGGGTTAT
AATTACTTTGTAATGTCAATTTCCAAAACTGACTCACAAGTGGAACTTCTGTTATCATCA
ACCCAGGAGGGCCTTGTTCACTTATGCAAAATGCATTGTGCTTAAATGTCAGCTTCTGCA
AATGCCATTTGATGAATATACCAAGTTTAAGAGAGTGACTGAATCCAAGGGACTTAAATA
TCCAGTTGTCCATTTGGATTTGTAAATCATCACATAAGATGAATCATATCTAAGACCAGC
AGGACAAAGGCAAGATTGTGTTTGGTGACAACCTTGTTCCAATGTGGCATCTACATGGGA
CTAAATGGTTCCAGAATGGAACCAAATTCTGACTGAAAAAAGCATCCGATGTAATAACAT
TACTTGAATAATTTGATCTGAGTAGACATTAAGAAAAATGAATTTAATCATTTTCAAATT
AAGAAAAATTCATTATTTATAGATTTGTAGGAATGAAATTTCTATTCTTAATTAAAAGCA
TTATTTATATAACAAGGCTATTAATGTTTACTATAGGAAGCAGATGTGGCTCAAATAATA
AGGCCTCCATCTACCATATGGGAGTACCTCTCTGGGACCTCCTGGTGAAAAAGAAGAAGA
GAAAGTATGCTTGTGTGGTGAGCTCAGTGCCTGTGCAGTGAGCCAAGTGTCCCTGCAGTG
AGCTGAGTGCCCACGTGGCAAGCTGAGTGCCCATGTGAGTGCCCGTGTGGCGAGCCACTG
CCTGCATGGCAAGCCGAGTGCCCACATGAGTGCATGGTGAGCCAGTGCCTGCATGGCGAG
CCAGTACCTGCGCAGCATGCTGAGTGCCCACACAGCGAGCCAGTGCCCATGCAAATGAGT
CACGCAGCAAGATGATGATGCAACAAAAGAGAGACAAAGGGGAGAGTCAAGGTGAGGCAC
AGCAGAAACCAGGAACTGAGGTGGTGCAATTGACAGGGAACCTCTCTCCACATCAGAGGT
CCCCAGGATCGAATCCATGTGAATCCTAGAAGAGAAAGATGAGAAGACAAAAAGAGAAAT
AGATACAGAAGATCACACAGTGAATGGACAGCAAAAACAGTGGGGAGGGGGAGGGGATGG
AAAAAAAATAAATCTTAAAAAAACAAACAGCTACAAGATTTGCAAAATACCAAAATGCTT
TTGAAACATAAGTATAAACTTAATGGTCAATATTGTCTGCAGTTGGGCCAGATCTGCAGA
CAAGCATGAGCTTCCTTGTTCAGGTTTGCTAGCTGAGCAATTCTTGGATTTGCGGGTTGT
TCTTCCTTGCTTTAGAAAGATTTGGTCTTAGGAATTACATAGGACATGACTTTGCATAGA
CTATCTGGATGGCTCTAATGGAGAGTTTACCTCTTCTATTTATTCTAAGAAGCCTTCCTG
AAAAAGATGAGCATAGAGCAGGGCTTTGAGAGAGAACAATGGTATATTATATGTAGGGTA
TAGATACTGTACAGACAACTGGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATATTGATTTTATATCTTCAG
TGTTTGCCTGGCACCTGTACAACAAATGAGCTAAAGGAAGGCTTAAAGAGGATTCCTCCA
CTCCCCTCCCCCGCCCCCCATAAGTCCATCTGTCCATCTCTAGGAAATTCTGTGCATGTT
TCTGGTGAAGGATAAAACACTGGAGATGCCTCTTGATTTGTACATCTTTGCAGACCATTT
TGACAGGTCTCTTATTTACAGAGCTATAGTTGTAGTTCTGTCTGCTAAAGCAAATACCAT
GCAATGAGTTGGCTTAACAATTGGAATTTATTGGCTCATGATTTTGAGGCTAGGAGAAGT
CCAAAATTGTGGCATCAGAAAGGTGATGCTTTCTCCTTGAGGACTGTGGTGTTCTGGGAC
TGGCTGCTGGTGGTCCTTGGTTCTCGACTTTTCCATCACATGGCAATGCGCATGGGCAGC
ATCTTCTCCTTTCTCTTCCAGGTTCCATTGACTTCCAGCTTCCGGCTGCTCCCCTGTAGC
TTCTCTCTGTGTAGCCTCTTGTATAACACCTCCAGTAGTAATAGGATTAAGACCCATCCT
GATTCAAGTGGGCCACACCTTAACTGAAGTAACCTCATCAAAAGTTCTATTTACATGGAC
CATGGAATAGATTAAGATTGGGAACATGTTTTTCTGGGGTATATAACTCCATTCCACCAG
AGCCAGGCAAAACAGAGTTTGCTTTCTCAATTTTTTTAAACCAAATGCTTTTCCCCCCTC
TCTTTACCATATTTGGTTCTTCTTCTTCAAATTCCTTCTAATTCATATAAGTGAATTAGT
TGTACCATGACTGCTCTTTTGACTTTTGCTTTCCTAGACTCCAAATGTTTGGTGAAGTTT
AAATTGTGATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCGTCTTTCCTTTCTCCAATAAACACTTGAAAAGGGGT
AAGTCCTGGTGTTTGAGAGCCTGGACTTTGGAGTCAGGTCCTGATTTCAGCTCTGCCAAA
CTATTAGCTGTGTCATCCTGGACAAGTTACTTAGTTTCTTTATCTGTAAGATAAGCATAA
TAATACTTAGCTCATTTAGGAGATTTTAGGAATGAAAGAACTTAACATACTTGTAGCACA
ATCCTCTATAAATAGTGGCTACAACTTTTTAAATGGTATTTTTATTTATCCTATGTAATC
CCTAGAATTATCCTTTCCCTTTTGGCTCCCTGCTCTAGAAAATTCAACAGATCTACTCTT
AGTGAAAGTTCTGTGACTATGAGGATAAATCAGAATAAGTCCTGCCCTCAAGAAATTCAC
AGTGCAGCCTTGAAAAAGACATGTGTACAGGTAACTACGAAGATACTGATGGGCTGAAAA
TAAGCATTTTATTTGTACAACCCTACAGTGATCTTTCTGAGAAGTATTTAATTAAGGTCT
GAATTAACTAATACCCAGGCAGTGGCAAAGCTTATGGAAGCAAGTAGTAAAATGCCAAAA
ACAGCTCACATTTTCGTCTAAATGATTAATATTACTTCTGAAACTCCATGTAATCAGTAA
AATTCTGTAGTTTTTGAAAACAGTTTTCTGATGCAGCATAAGAGGTAGGCTTCTTTTACA
TTCATGTGAAAAAATATGCCGGGTTGTACCTTTGAAGCAATGTTAGAGAAATGTAGTTAA
TAGGAAGTGTTTCTGGTTGTTAATTAATTAGATGGCTTTAATCAAGAACTATTTTCTGAG
AAACTTCTTATTCCCAGCCTTGAGGCAGGCGCTAAGGAAACAAAGATGACTCTTCCCTTA
AGGAACTCATAATCTAATAGTACTTCATTCAACAAATGTTTCCTTATTGCCTACTGGGGA
TGTGATGGTGTACGAGGCACTGAAGCTTAGGCTAGCAGGAGGTTGACAGTTTAGATACAC
ATGTCTTTCCAGCTTCTTTGAGAAGTGTGTGATTGACACAGGGTTTTGGCAAGACCAAAT
GTGTGTGTGTATGCATATCCCCTCCCCTCCAGAACATTTTTTGATCCTAGAAACCAAGAG
TAGCTCTTGAAAGAATAGTTTTGTCTCTGGAACCAAAATGAACCTAGAAATCATTCTGGT
GTAGAATTGTGAAGTAGATAAAATTATATTCCATTTCCCTTGAGCCTGGCTCTTTCTGGT
TTCTAAATTCCTTTCCTCTCAACTCTATTTTGTTCTCCACAGGGCTACAAGAACACAGGG
CTACTAGAATGGTGGTTCTAAAATGTAAATCTGATTATATCTCTCCTCTGCTTAAAAACT
TTACTGGCTTCCCAAGCATGGTACACAAGACACTTTGTGATCTTATTCTGCCAAGCCTTC
CAGCCTCACTCTCCATAAGACCTATGTGTAGGGTTGCCAGGTTGAAAAAGTACAAATGCA
GCGTACCCCGTTAAATTTAAAATTTCAGATAAACAACAAATTTGATGTATAATTATGTTC
CAAGTATTGCATGAACCAGACTTACACTAAAACATGTTTCTTTTTATCTGAAATAGAAAT
ATAACTAGTCCTGTATTTTACCTGACAACCCTACCCAGACTGGACTGATTAATTTGTCCT
TCCCCGATCAGCATTCTTTACCCTTCTATGTGGTTGATAACCTCTCCACCCTGTGCCTTA
TCCACATGATAATCATCTGCTTATTCTTCAAAATCCAGCCACAGTATTCTGGAACTCTGC
AGGGTACGCTTGGTATCCATTGTGCCTGGGGATGAGCCTGGCCACCCGTGTGCCTTGTTT
CATATCTGGACTTCTGTTCCAGTTCCTGTTCTTTCCTTCTCTCTTCTCTCCTGGAACTGG
AGTTCTGCCCTGATTACTTGGCTGGAACCGACACAGGGTCTTTTGCCCTTTTCTACTCTC
TTCCTGGCACTGTGGGCTAGATCCTTTCTTCCAGCTGTTGGTTGGGCTCCTGATCTAAAC
CGGATGGATCATTGAAACCTGCTATAGATGCTCCCGCTTTCTTGTCTTGCCTACTACAAA
GGATGGACAAAAGACTCAAAGGAGATCAAGTTGGTTCATGGTTTGTAAAGTGCAAAGACT
CTATGATGGTAATTTAGTTTAGAGACCAATTTCAAGCTCTTTCCCTTGTACTGTACTTGA
AAGTCCCTCTCTAAAGTGTTCTGGATTCCCCTTGTTTCTGTTCATGCCTAGCAACGTATA
ACGCTGAAAATGATGTGGAAATTTACTAAGTGGCCTCAAGTTTGTTTTTTTTTACTGCAT
CCTGCCATACTGATTGTTACATTATGAGTGGATCCAGACCTGTGACTTTAAAAATTTTTA
TTTTAATCTTATGATCCAGGGCATACCTCTTCACAATTAAAATCAAAACCCCATGAACTC
TCTCCTACTCAAAATATGTGTAAGATGCTCTGATATTTTCTATTCTGTTATTTCTATTCC
ATTTCACTTCTTAAAAAATTGGCCAGCCCACCAAATTGATTTCATAGCCCACTAATAGGT
CACGACTTTCATTTTGCCAAACACTGATATGCACAATCCAATGAGATTTCCTAATTTGAC
TAAGTGACCAGGACAATTGTCAAATGTCTGCCTCATTTGGTGCTGTCTCCAATAGGAACT
ATTTTGCCCACAAAAGGAACTGAGGCCACCTGCTTGAGGTAAGTCACATTTCTCCCTGAT
GATAAGGTCAGCAAGCAGAGTGCTGCAGCCAGACTTTCTAAGCTCCCTGAGGTTAATATA
TATAATTCCTGGCAAGGCCATCTATAAAGAGGGAGAGCTGCAAAATGACCACAAACAGCA
ACTACATTCATCTACAAGAGAATGGATCATGTTTGGGGCAATTCTTTCTCAGGCCCTTTA
AATTACTCCTGAATGGGTTAAAGAGACTTTTAGGTTTCTGAGGTTTCACATTGATTTCAT
AGATAAGAAAGCATGAATGAAAACTTTCCCAGTCACTGCTATGATTTTTCTCCATTATCC
TTTTCCCTAATTGATAAGCAACTTAGTCCAATATTCAGATTTCACTCTAATAGCCTGCTT
GAAAGAGCTGGGCAACAGTAGATTCCAGGAAAAAATAAAAAGGAAAATATATGGAGGGAA
ACGGACTTGGCCCAGTGGTTAGGGCGTCGGTCTACCCACATGGGAGGTCCGCGGTTCAAA
CCCTGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGCGCAGTGCTGATGCGCGCAAGGA
GTGCCATGCCACGCAGGGGTGTCCCCCGCGTAGGGGAGCCCCACCCGCAAGTAGTGCGCC
CCGTAAGGAGAGCCGCCCAGCGTGAAAGAAAGAGCAGCCTGCCCAGGAATGGCGCCGCCC
ACACTTCCCGTGCCGCTGACGACAACAGAAGCGGACAAAGAAACAAGACCCAGCAAAAAG
ACACAGAGAACAGACAACCGGGGGAGAGGGGGAATTAAATAAACAAATAAATCTTAAAAA
TATATATATATGGAAAGGAAGTATGGTTCAAACAGAGTAGAAAGAAGAGAAATTATCTTA
AGAATTCTTATGATACAAGCCGCTAATCTAGTTGCTATAATTCTGAATTCCCCTACCCCA
CCCCTCATCCCCAAACACCTCTTCCCCTCAGTCTTTTTTCTTTTTGTTAGAGTTTTAATT
TTGTTTATTCTGTTGACCTTGAAAAGAGCAGTTTCCGCTCAATTGTGGACATAAAAGCCA
GTTTGAAGAGAGTTTAAAAGAGACTGAAAAAGAGTGAGCTACTGTAGACAACTGTTTGAC
TAAAAGAGATACAAAGGAAGGAGATGGTAACTGTTGAGGGGAATGGAGTCAAGAGGATGT
TTTTGTTTGTTTGTTTTTAAGATGGTTGAAATAACAGCATGTTTGCCTGATGATGGAAAT
GATCCAGGAGAGGAAAGAGTGTAGATAGTAGCCAGAAGGGAGAATTTGCCTGGTCTGGTG
GTTCTTGTGCCTGCAAGAGGGGTGGGGATCTTGTGCCACAAGGTGGAGGATTTTCGTAGG
AGCGCTGAGAGCGCATCCTTACTGAGAGGAGGGTGAGTGGGGTCGGAAGGTACACTTGTA
TGGGTACATGGGATGTGGTGCAGGGGAGCTCAGTAGAAATTCTTTTCTGATTCTTCAGTT
TTCTCAGCAAAGAAAGAAGCGAAGTCATCAGCTGAGAATGAAGGCAGGCAGAAGAGACGA
CTAAGTGTGAAACAGTCCTTTAAGAGAGTAGGAAAATAGAGGGCGTTAGCTGGGAAGGGC
CTACTACGGTTCCCAGTGACAAGTTTGAAGTGAGACCAGACATCATGGGGGTTGTGTGTG
TGCGTTTTCCGGCTATGATCAGATGCATGGGTGCAGAAACAGTGTAGGTGGAAGGAAAGT
TGGATTTAACCAGCATTACGATGTTGCCAATCAGTATGCCAGAATTAGAGGTGATCGTGG
GAATTTAGAGAGTGGTATATAGAGGGCCTCAAGCGGCAGTACAGTACTAAAGATGCTCCT
CCTCTTGTGGTTTTGTCATTTTCTGATATCACACTTTTAACGGTAGAGTAATTAAGGTGG
GGTTTTTTTGCTTTTGTTTTTGTTGTTTTCCTTTTTAGGGTACTGGGGCAGGGATTGAAC
CCTGTGTCTCATATGTGGGAAGCCAGCACTCTACCACTGAGCCACATGGGCTCCCCTGAG
TTGGTTTTATCATTTGTTTGCTTGTTGTTTGTGTTTTTATTTCTAGGAGGCACTGGGGAC
TGAATCCTGGACCTCCCATGTGGGAAGCAGGTGCTCAACTGCTTGAGCCACATCCAGTGC
CCAGTAAAAAGTGGTTTTAAATTACTTTCTCTTGTTTGTCTCTCTCTCTTTCTCTCTAAC
AATATATGTTTGTTTGTATATATTTGTATCATCTGGTCTGTTTCATCCTACTAGAATATA
AACTCTATGAGAACAAGGACCTTGTCAGTAATACTCATTGTTTTATATTCCCAGTATAAA
ACATTGACATTGTAAAAACCAAAAAATATTTGACAGAAGGATGATGAATGGTGAGGGCAT
GATTTTAAGACCATCACTGTCCCGGTCATACTCTTCTTGATTTGCCTCTGCCAGTTTTCT
CCTGACAGAAATACCTGCCAAGAGAAAGCAGATCCCTCCCCCAACATTAGAGCTGTTGCT
AAACTATCCAGTCCAGATCTACTACAAGGTCTTAATAAGGGTATAGGGAGGAGAGCTCAA
GACTTTTATTCCAGTGTTACTCAGGCACAAAATTTTTCAAAAGTGAGCCGAAGAGGTGCC
ATGAGGACACAATAGCTTTCTGTTTTGTCTTATTTAAAACAACTTTATTGAGGTTTAATT
TACATACCATAAAATTCACCCATTTTAAATATACACTTCATTGAATTTTAGTAAATTCAT
CCAATTATATAACCATCACCACAATTCAGTTTTAGAACACTTGCATTACTGCAAAAATTT
CCCTCTTGCCTGTTTGCAATCCACGTCTGTTCCCACCCTAGCCCAGGCAGCCACTGACCC
TTCTGTCTCTACAGTTTTGCCTTTTCTAGAATTTTCATATAAATGGAATCATACAATATA
TTGTCTTTTGTGTCTGGCTTCTTTCATTTAGTATAAAGTTTTTAAAGTTCATTCATATAA
TTTTGTGTATATATAGTGCCTTTATTTTCTTCTTGAAGAACATTCCATCACAAAGGTATA
CAACATTTTGTTTATCTATTCATCAGTTGATGGACATTTGAAATGTTTCCAGTTTGGGGT
TATTATGAATAACACTACTATGAATATTTGCATTCAAGTCTTTGTATAAACATATATTTT
TATTTTTCTTGGGGAAATACCTAGAGATTGAATTGCTGGGTCAAATGGTAAGTATGTTTA
GCTTTTACAAATCCGCCAAACAGTGATGGTTCCAGTTTTTCTACATCCTTGCCAACACTT
GATCAGTCTTTTTTTTCCTTTCTTTTAGCCATTCTAGTCAGTATGTAGCAGTATCGCATT
TTGGTTTTAATTTGCATTTGCCTGATGATTAGTGATGTTAGACATCCTTTACAGTGGGCT
TACTTTTTATTAATATATTTTCTTTAATGAAATGATCTTTCAATCATTCACTCATTTTTA
AATCGGGATCACTTGTCTTACTGTTCTGTAATAAGGGTTCTTTATATATTCTGGGTACAA
ATCATTTATCTGGTATATATTGTGCAATTATCTTTTCTCCAGTCTGTGCTTTGTCTTTTT
CGTCTTCTTAATGCTATCTTTTTTTTTTAAGATTTATTTATTGTATTTATTTTTCCCCTT
CCCCCACCCCAGTTGTCTGCTCTCTCTGTCTATTTCCTGCGTGTTCTTCTTTTTCCGCTT
CTGTTGTTGTCATCAGCACGGGAATCTGTGTTTCTTTTTGTTGCTTCATCTTGTTGTGTC
AGCTCTCCATATGAGCAGTGCCACTCCTGGGCAGGCTGCACTCTCCTTCGTGCTGGGCAG
CTCTCCTTATGGGGCGCACTCCTTGCACGTGGGGCTCCCCTATGCGGGGACATCCCTGCG
TGGCACAGCACTCCTTGCATGCATAGCACTGCTCATGGGCCAGCTCCACACCAGTCAAGG
AGGCCAGGGGTTTGAACTGTGGACCTCCCATGTGGTAGATGGATGCCCTAACCACTGGGC
CAAGTCTGCTTCCCCTTAATGCTGTCTTTTGAAAAGCAAACATTTTTAATTTTGATGAAG
TCTTTTTTTTTTTTTGGTCAATTTTGACTGTGATTGTTCATGCTTTTTGTGCCATAAGTA
AGAACTCTTTGCCTAATCCTTGCAAAATTTTTGTCCTATGTTTTCTTCAAGTTTTTGTGT
ATGGTATAAGATAAGGATCAAGTCCCAACTTTTTTTGCATGTGTTTATCCAATTATCCCA
GCCCTAATTGTTGAAAGGACTATCCTTTCCTCATTGAATAACTTGGCACCTTTCTAAAAA
GTCAATTGATCACATATCTGGACTTTATTCTCTCCACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACAATTGTATGCCAACAAAT
TAAACAACCTAGACAGTAGACAAATTTCTAAAAACACACTACCAATACTGACTCAGGAAG
AAATAGAGAAACGACTTATTACACATAAAGAGATTTTCAAAACTTCCCACAAAGAAAAAG
CACAAACAGGATGGCTTTATTGGTGAATTCTACCAAGCATTTAAAGAACAATTAACATAT
ATCCCTTTCAAACTCCCCCAAAAAGTAAGAGGAGGGAATGCTTCCTAACTCCTTCTGTGA
GGCCATATTCCCCTGATACCAAAGTCAGATGAAGACATCACAAGAAAAGAAAACTACAGA
CCAATATCCCTTATGAGTATAGGTGAAAAAATTCTCAAGAAATACCAGTAGGGAAGCAGA
CTTGGCCCAATGGATAAGGTGTCCACCTACCACATGGGAGGTCTGCTGTTCAGACCCCGG
GTCTCCTTGACCCGTGTGGAGCTGGCCCACGCGCAGTGCTCATGCACGCAAGGAGTGCCG
TGCCACACAAGGTGTCCCCCGTGTAGGGGAGCCCCACATGCAAGGAGTGCACCCTGTAAG
GAGAGCCGCCCAGCACAAAAGAAAGTGCAACCTGCCCAAGAATGGCACCGCACACACGGA
GAGCTGACACAAGATGATGCAACGAAAAGAAACGCAGATTCCCGGTGCTGCTGATAAGGA
TAGAAGTGGTCACAGAAGAACATACAATGAATGGACACAGAAAGCAGACAACGAGGGGGG
GATTGGAGGGGATTGGGGGGTAGGGGAGAGAAATAAAGAAAAAATAAATCTTTAAAAAAA
AAAAGAAATACTAGTAAAATGTATCTAGCCTGATAAAAAAGGATTATATAACACAAGCAA
ATGGGATTTATCACAGGAACACAAGGTTGGTTCTACATAAGAAAATTAATCAATGTAATA
CACCATGTTAATAGAATAAAGGCCAAAAACCACATGATCAATTCAATAGAAAGAAAAAAA
AAAGTTTTTTTAAATTCAACATCATTCATTTTAAAAACTGTCAATAAACTACGACTCCAG
AGAGAGCCAAAGTAGATACAACCCTAGATGCTTGTTCTCCTGAAGGCTATGGAGATCCAC
AGGGTATATGGTCATGGCAGATGGATTTGGAGTTCTGTGCCATGTCAGAGGGCCCTACTT
TGGAATTTGTGCTCCTGAGTGTGATGGAGCTGGACTCAGATGTGACCTTCCTACACATGC
TGCTTCTGTCACTTACTGAACCTGTGGTTGGCGCTGGGTTTGGTGTATACTCAGGAGACT
TGAATCTCTGGACTGGCCATGTGCCAGCTGGGCCCTGAGCATCAGCAGAGTTGCGACTCC
TACTCTCTGGTTCATTGGACTTACCCAGGTCAGCTAACAGGGAGGTGAAAATGGTCAAAC
ACCACACCAGGGAATCAAGAGTGCCAACAACTGCAAGCAGGAGAATTGTATCCATCATCC
ATGTGGAATCTAAGCCCCCTCTTGATCTAGATGTGGAGTGGACATCACCATCCCAGGGTC
CACAGAATGGAGGAATAAAATATGTAAAGAATAGTCTTTCAACAATTGGTGCTGGGACAA
CTGGATATCTATATGCAAGAGAATAAATTTATACCCATACCTCACACCAAAACAAAAATT
AACACTAAGTATCAAAGACCTAAACATAAGAGATAAAACTATAAAATTCTTGGAAAGAAT
CATAGATATAAATCTTCATGACCTTGGATTGTTTATTAGTTTCTTAGATATGACACCAAG
AACATAAGCAACAACAATTAAAAAAAGATAAATTGTACTTCACCAAAATTAAATACCTTT
ATTCATTAAAAGGACACCATCAAGTAAGCAAAAAAACCACCCAAAGAATGGAAGAAAATA
CTTGCAAATCATATATCCGATAGGGGCCTAAAATCCAGAATAAAGAACTCTTAAAATTCA
ATAATTAAAAAAACCAATCCAATTAAAAATGGGCAAAGAATTTGCATAGACCAAAGTAAA
TACTCAAATGACTGATAAACACATGAATTAGATGCTCAATATCATTAGTCATTGGGGAAA
TGCAAATGAAAACTATAATGGGATAACACTTCATACTCAATAGGATGACTATAATCAAAA
AGGCAAACTATACCAATTCTCAGGATGTGAAGAATTGGAATCTTCATACATTAATGATGG
GAATGTAAAATGTGCATCCATTGTGGGTGCAGTTCCTGAAAAAGTTATAGAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGGAGGTCCTTTTCAATTGGATAG
GATGGTTCCTCTGTAGAAGAAAAGAGAAAAAGTCAGACCATATTCCACTTGGTATAGGAC
TAACTTTGCTAGAAAAAAATCTGTATTTTAATTTATTTCAAGGATCATTTATTGGTCCTG
GACCTCTATCAGGTGCTGGAATAAATCCCTGTGTCTAATGACTTCATGATCTGGAGGAAG
ACTAGATCTGATGCAGTGTGATACGAACTATTGTATAGCTATGTAAACAGTGCTGTGCTG
AATTCCATCTAGAGCCAAGTTGGAAGAAGGTAGGTTTGAAGAGGTGGGAAGGTAACCAGA
CAACTTCAAAGAGGAGATGCATTTGAGCTGGGCCTTGGAAGACGTTTAGGCATACACAAA
GTGAAAAAGGGGAGGTCATTCCAACAGTGGGAGTAATACTAGTGTAGGTGTGAAAGTACA
AATGATTAGCCCGAAGTGAGGCTAGAAAAAAATGAAGATGGGAGTTTCAGATGCCATGCT
AAGAAGCTTAGAAATTACTATAAAAGGGGAGATACATAGAAGATTTGACATGTTGAGATC
TGTATTTTTTTTTTATTTCTCCTACCCTGCCCTCCCATTATTTGTGCTTGCTGTGTCTGT
TCATTATGTGCTCATCTTCTCTTTGGAGGCATCAGAACCAAACCTGGGACCTCCCATATG
AGAAGGTGGTGCCTAATTATTGAGCCACCTCTACTCCCTGCTTTGTGTCTCTCGTTATGT
TTTCCTCCTTGTGTCTCTTTGTTGTGTCAGCTTGCTGTGCCAGCCCATCACATCAGCTCA
CTTTCTTGCTTATCTTCTTTATGAGGCACCAGGAACTGAACCCAGGACCTCCCGTGTGGT
AGGCGGAGCTCGATCACTTGAGCCACATCTGCTTCCTGAGAGCTGTAGTTTTTAAAAGAT
ATTTCATGGAAGGTAGATAGAGGTAATAGGAGAAAAGAGGAAGAGCAAGATGCTTAGAAG
CTTTTTTATGTGTTTGTAAAGCAGTCTCCTTCCTCACTTTTCTCATCCTTTTCCCAGTCC
TCAGTTTTTTCATCTCCCTGTTCATGTGTCATGCTCTTCTAGAACAGAGATCTTAGCTGC
CTCTTGAGTCACTTGATTCCCATGGAAGTATCTAGCTGTGTGATTAACCATCCATCCTCT
TTTTCACTGAGCTGCCAGGGGAGGTGGAGAAACCGTTCAGCCCAGCTCTCCCTTTAAGTG
CCCTTTCCTTTTGGCACTGAACATATTTGCTGGCATTTCTAGAAAACATTAGGGGAACCA
TACATATGTGAAGAGTTAATGTGAGATCTTTTTTTAGTTGAGGTGTTTTGTGGGGTAGAC
GATTGTCCCCATTCATAAAGATACTTTTTAGTCCTGCTGTAATGATGTGAATATGACATC
CAGGCAGATAAGTAAATAGTGAAGACTCTCTTATATTCTCATTAAATCCTATGGTTAAAT
AGAATCATAAGAACTTGCAGAAGGCACAGACTTTTATGAACGGAATTTTGTAATGATGGG
TCCCTTTTTTTTTTTTGCCGGGAGAGTCTGTTCCCATCTTAAGCAAGCTTACTTTGCTCT
TCATTAGCATTGGAAGGCCCAAGGCAAGGTCAGGCCCCACAGCAAAGATTCCCCTTCCTT
CTCTCTTGCCCATAATTCAACTGCCTGCCTCCTTTCCATCATCCTTCCCTACTCCCACCA
TGGCATCCCTGTTAATCTCCTTTTTCCAGCTACAGACCTTATGAGAAAAGCCAGTGTCTT
CCCCACCCACCTCCTGTCAACACTAGAGCACAAAGGTCCCCTTCCTGAAGCCACGGCTCT
ACCTGTCTATTGGCCTGGAGCCCAGTCTGTGCTTTGTTATGGTGTTATGGTATAGGATGC
TGTGTGTTTTGAGTTTCATAAAAATTCCAAATGAACGCCAGGATAAACCACCTGTTTCTG
ATTGAAGGACTGCCCTACATGGCAACAGTCCCTTGTTTTTTTTGCTTATGACGTTTTGGT
TTTGTTTTGGTTTTTAGTGTGTGTGTGTATGTGTATTTGTTTTTTAACAGAGAACAGGAA
GAAAGAGGATAAGAGACAAGTTAAAGGTACACGTATATTTAATTTAAATACAGATGTGTC
TTGTATACATGAAAGTATTTCTAAAAGGCATTTGCAAATGAGATTGTGTCTTCTCATTGA
TACATTAGTTGATTTTCACATCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGACAAGTAAACAGTCATGTATAAACTGATCACTTTAAACTAAACTGCAGGTAATA
TAAGTGGTATGAGACTTGATGGCCTGAGCTCTCAGAGGACCACAGTAGCTATCATTTTAA
CCACTCACATAAATGTGTATTTACGATATGGTGTTTAATGATGTTTACAGCTATATAAAT
TGTATAATTAAAGTGTGGACAAGGTGCTGGAGAAGCACAGAGAAGAGGTTTCTGTGGAGA
AGATAAGAGTTGCCAGGGGAGGCTGTCCAGAGAAGACCCAAAGTGTGGGTGGCGTTAGCT
TCCAAGACACTTGAAGTTAATACTGTGTTTCTTGAGTGTTGCGAGATGAAGCGAGGGCCG
CATATAGAAGGATCTTTACACACCATACAAAAGAGCTTCTATTTTCCCCGAAGGCATTTG
GAGGTGCAGTGAAAGAGTTTTTTAAGCAGCGGATCAACATAGCCAAAAATTACTCTGGGA
GGGGTGTGGAAGATAGATTGAGAAGGTCAATTAGGAAGCAATAGTCCTGACCAGAGATTA
TGAGGGCCTAATTAGAACAGCCTTAGCATGTTTGAAGGGTATTTAGGAGATGGAATAAGA
TGGATTTGGTAAGTGATTTGACGTAGGGAAAGGAGGAGAGGAAGCACAGGCTTGGGCAGT
TGGGCGCCATCATGAGGTGGGGCACGCAGAAGGAGAGGCCCGTTCAGGGGAAAGGTGATT
AGCACTCTATTCGTAGGAGACTCACTGAGTGCCTCCCTCTAAACCATATTAATTCGTACT
CCAGACCCACTTATAAGAAGCTTAATGACTAGACTCTAAGTTCCTTAAGGGCTTTTCTTT
TCTGTCTTTCTAGTACTGCATATAATGTATAGTACTTCATATAATGTCTTTCTAGTACTA
ATATTTTGTCATAAATTATTTGTTGGGTGAAATTTATCCATAATTACAAGAACTTATTAC
TCATTTTACCAAGTCCTCAGGGGGAAAAAGAACAAAAAGTAATAGAAGATATATAATCAG
GAAGTCTCTGTTAATACTTAACTAATATATACGGTCTTTGATCATAATTCACAAATCTAG
CTTAACCTTTGTGATTTACAAAATGTTTCCCCATATTGCATTGTTTTCCCACAGTGCCCC
ATTTTACAGATTAGGAAACTGAGTGGCAGTCAAAGGCTAGTGCACCTTTCTACTTTACTA
TAGCTGACCTTGATGGAAGCAAAAAGTGACAGCTAAACATCATTTTGTCATTAAAAGAAG
AGATTTTTTTAAAAACCGTGTAAAAGAAGGCATAAGTTAAAAAGCATGTATATATGCCCC
AAGGGCATAGATATATTGCATTACAGTTAAGTTTTACTGTCTATAAGAATGACTCCAGGT
CTTTAGGAAAGCATTTTGTTCTGCATATTCTGTTTAAGTTGGCAGGAAGGAGCTTGACTC
CATTTAAAAAGATTTCTATTGAAACTATTAAAATACAAAATTTTTGGCTCTTAAACTTCT
GTCATCTTAATAAAACTCATGCACAATCACTTAATCCTGGACAGGTTAACTGAGGGCTAG
TTAACTGAAAAACTACTGAACTATGAAAAGAGCAAGTACTCCCCTGGTGGGGCATGAAAA
TGACTGTCTGGTAATATCTCCGTGGAGCTCCAAAAGTGGTATTAACCAACTCCAGAGGGA
ACACCATCCATTCATCTTTTTGCTTGAGGGATTTGCCGTAATTCTGACTTCTGAAGTTAG
CAAGAGGTAAACCTCTCCTGCTCCCAGCACCCTAAGGATGGCCTATACCTTTCACAACAC
AAAGCTGCAGGTAGTGAGGCAAAACTTGGCCTGAGCTCTCTGAGGACCTGTGCAGGACCA
GAGCTTCTGACCACAGTGACTAACACCCTAACCAATCACATGAATTGGGTATTTATGATG
TGGTATTTCATGATGTTTGCAACTTGTTGTATGAGTTAATGACTGAGATATTAGAAATTT
GGTAAGTTAATTCAAAATTAATATATGCATTAGTCCTGTCCTCCTGTAGTGTTAGGATAT
ATAATTGGGAGCCTGAAAACTGATATTCCTCCTTTATGAAAGACAATCTTTAGAAATCTA
ATACCTCCTTTGAAAAGTCTAGTATGTTTAAATCAATGCAGTTTGGCTGATTTGAAGATT
GAAAATAGGTTAGCATTAAGGCCATGATTCCTTTAGTAATTACTTTCTCTATTGGTAATA
ACTGTTTCTTTAGAAATGACATTAACATTCTACCAAAACACAGCAGTAATCCAAAAATTA
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GTGGGGCCAGTTTTGGCTGCTGTCATTTAACATGTGTTGCTCTATTGTGAAGTCTTATCC
AGCCGTAGGACAATGCTCATTTAATCCTCCATGATGGGACCTTCACGCCCTGAGCCCAAG
TTGGATGCCAGGGTCAGTTACCCGGCAGCTCAGGCTGGGGCACTGCTCTGCTTCACTGCC
GAGTTGCTGTAATCATTTTGTCTGCCGTTAATTTTCCCTAAACCAGGGAAAACGCGTATG
TGAGCCTTGCAAATGTTCTCAAATGAGATTTCAAACTGGTCGACTGGGGTGTTGCCTCCA
TTCCAGAATGGAGGCAGCTTTCCAGGGAGTGTAAGTTCCTTCCTTCCTCTTGAAAATGGA
AACGCCTGAGCCCACGAGATTCCTGATGTTCTGAGGTCCAGAGTAACAGATGGCATTATG
ATTTTCCAAATCCTGATGAACATTCTAACTGAACTTGTTCATTTCACAGTATGCAGTTCT
ATTTTTTTCACTTCCTCTCCCTTCCTCCCTCCCTGTCTCCCTCTCTTTGTTCCTCTCATA
TTAACTAACTTTAAACTGATGTGATACTTCCTTTAGATAGCTTTAAATTCCCTTCTCTCT
GTCATTTATTGTATGGGCCCAATTATAATACAACTTCATATATAATTCTCAGCCTTTGGA
TTGTAGCTGACACAGTCTTTGAATTTGTTTTAAAATGTGTAAGCAAATATTGCCAGCACT
CGTACACCATGTAGCTATTGGAAATTCTGTTTTTCTCCTTATCTGAAGCTTGCAGTGCAG
GTGGCAAATGGCAGTAATTATTTTAACTAACAGTCGAGTGAACATTCAGGAGGACATACA
CTGTGGTGATGTGGACTTTGGATTTACAGAGTTCTTGGAGTCTGACTTGATAGTGTTACG
GCTTGTTGATTTTTCAGGACACGAACCTGCCACATTCCTACACTTGAACAGTGTGTAGGT
GTGGTTAAAGTGTTTCGATGTAAACTCCTTTCCTGTAAAAAAAGGAATTATTCCTTTCAT
TTAGGAACCTCTTAACGCTTATTTTTCTCTCGTAGATTTTCTTCTTTCGTTTGTGTTTAA
TTCGTTTATGATCTGCTTTTTATCTAAGACTGCTTTTAATGAGCAGTTCTGCACTAGAAT
CTAGTAAAAAAAAAGTGTGGTGATATTAACATGGTAATTTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGATCAACATGGTAGCTGACTCTCTGGAGGAAAAATGTCT
ACAGTGTATGATCAACACTAATAGGGACAGTAAAACACAGTAGTATTGCTGAATAATACC
TTTAGATCAGCTGAGCAGAGCTTCCCACGAGGGTGAGCTCATTTAATGGTTCCTAAAACT
CAATCTCATGGATGTCAATGGTCATGCTTGATTATTTGCAGCAGCATTTTATGAAAAAGC
AATAGAAATGCATTGGGAGGCTACAGAGAAAGAGGACAAAAACGGGTTTTACTTTTACTT
TTGTAAATGAAATCCCTTTGGTATGAAACAAGTATGTTTTTTCCGTGCCACGTAAGTCAT
TGAAAAGGGAAGGTATGTATGGATGTTAATGTGTTTGTCTGTGAACTGTTTATTTAGACA
CCTCTGAATAATGCTATTCACTGTAGCTTATGACCAACAGGAGACCTGAGGCAAAAAGAA
AAAACAATGTGCATTGGCTTTGGAAAGGAAGCAGTTGCAAATACAGTGTAAAAGACTAAT
CCATTTTACAGTCTCCGCCCAACTATTTTTAAGGAATTTCACAAAACACCAGGATCTTTG
CCATATGATTAGAAAATCTCTTAAGCAAATATAAATCTTTTAGATAACAAAATAGGCAGA
CTAAATGAAGAATTCGTTTTGACATTTTAAAAAATATATTTATTTTTAAAAGATACATAG
ATTACACACAATAGTTGTTTTTTTAAAGATTTATTTTTCATTCATTTCTCTTCCCTTCCT
CCCCCCCCAACTGTCTACTGTCTGCATACATTCCCCGCACGCTCCCCCGTGACCGCCTCT
GTCCCTATCAGCAGCACTGGGAATCTGTGCTTCTCCCTGCTGCATCATCTTGCCGTGTCA
GCTCTCCGCGCTGGCGGCTCTCCCCATGGGGCGCACTCCCCGCGGGTGGCACAGCACCCC
CCGTGCATATCAGCACCACACATGGGCCAGCTCCACACAGGCCAAGGAGGCCCAGGGTTT
GAACCGCGGACCTCCCACATGGTAGGCGGATGCCCTAACCACTGGGCCAAGTCCGCCTCC
CCACACAAAATAGCTTTGACACTAATGACAAAGTTTTTTCCTCTCTTCTCTCATATCCCA
ATACTGAAGAATTTCAAAAACACATTTTAGGAAAAAAAATAGAAAAATATTCTTATAATC
TCAAATTTCAATTACTTAGAGATTCTTTTAGACCTATTCATTTGTGTTTTTTATAAGCCA
TTTGGTAATGGTGTTCACTTGGCTAGCAGCTGGTTTCTCCCTTGTGTTAAGGGTTTATCA
GTAAGGTGGGTATTTCAGTGGCTAAAATTTAGGCCTTTAGCCCCTGGTTCCAACCCTCTC
TGAGACAAGTAAAATGAGCTGCTACTGTCAGCCTAGACCCCATGAACAGAACTTCACACC
AAAATGCCTACACATGTCATTTGTCATGTCTGGCAACCCAGAGCATGGGGTGACCAGTGT
GGAAATTGAATCATCTTTCACTTTCTCTGCTCAAGGCCTGATGTAGAGTGAGATGAGTAA
AAGGAGGGCTCTCTGGTCTCCAGCTGGGGAATAGTCAAAGGCTTTCTATTTGATGATGCC
CATCTGCAAGCCTTCCTAAATTCAAAACTTCACTCCCACGCCAGCCCTGTCCGTCGTTAA
ACCCTTCAGATTAGGTCGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTT
GAAACTTACAGATGTTAAAATGAAGAGTATGACTCTTGATGTTGGTCAGACTCCAGCTGA
TTCGCTGATATTACTCACTGTTGTCTTGATGGCCTGATACTATTAAGTCTAGAAGTAGGC
TACAAAGCAAAGTTAGAAGGCTTTTCATATTTTATTTAACCTACAAGGCTGGTTTAATCT
AACCATAGCACAACTGATCTTAGAACTCAACAGTGCAGCCTACACCTTGAGATTTTTGAG
GAGTTGTCCTTCTATCTTCCTTGTTTTATTATCAATATGTAAAAACCTCAGTTTGAAGGA
ATGTCTTTTTTGCCCAAAGGGATACAGATTAAGATGTTCAAGCCCCCCATGCTTGTTCTC
TGGGAGTGAGGAGGGAAGAAAGTATAATAGAGCAAAGAAGGTGTATTACACTTTCTAGGC
ATTTATACTTTATTCCCCACCACTCTCCTTTGTGAACTCATAATTACAGGCAAACTGAAT
AGAACCCTCAGAACAGTCTGAGTGCCCAGCCTTGGCACTCTAGCTTGGCCATCTCCTCCA
CCTGGCAGGGCTGTTTATTAGGGCTATACATCTCATCCTTCTGAACAATACACACATTCT
TTGAGGATATGAATTTTAAAAAAGAGCAGCCATCCCACAATACCAGGCTCAAAAAGCCTT
GCATAAGGTAGGTGCTCAGAAAAATTGTTGAAAGAATAAATGAATAAATAAATAATAATT
GACACAATATTTTGTGTCTATGCACTATCAGTGACCAAATTAACCACCACATCATTATCA
GGTTCCACTGTCATCTTTAATTATGAATTAAAAGCAAAAATTAAGTCGTAAGGAATATTT
CTTGTAATTAAGGTCTCCTAATTTTTTTCCAGAGAGTCTTCTCTCTTATACAAAGCAGAG
CTCTGCTAAGCATCTGGGCCTCATCTGAGTTTTTAAAAATTTTTATTTTTAGGGAGCAAA
TATGGCTCAAGCAGTTGAATGCTCACCTCCCACATGGGAGGTCCCAGGTTCAGTTTCCAG
TGCCTCCTAAAGAGACAACAATGAGCAAGCAAACNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGCAGGAGTGCACCCCATAAGGAG
AGCCGCCCAGTCGCGAAAGAAAGTGCAGCCTGCCCAGGAATGGCACCACACACACGGAGA
GCTGACACAGCAAGATGACGCAACAAAAAGAGACACAGATTCCCGGTGCTGCTGATAAGA
ATAGAAGCAGTCACAGAAAAACACACAGCAAGTGGACAGAGAGAGCAGACAACTCGGGGG
GGGGGGGGGGGGAATAAAAAAATAAAATAAATCTTTAAAAAAAAAGAATATGCCTTTAAA
ATAAATATTTCCCTTTTAAGTCAAGTCATTTTGAAAGCATTTTTCTGGTTTATGTTTTAT
GTATTCAGAGTATCCATCTTAACCAACCTGCTCTTCAGGTCTCAGAATGTACTTACCAGC
AAACTTACTCTGTATGTGAACTAGCAGCAGCTGCAGTTGCAATTGGACCACCTTTCCCCT
CTCTTCTCCCCACCTCTTTTGAGTATACAGGTACACACACACATACACACATACTCAGAT
TTTCTGCTGCTTGCCTTTTTTTATGCCCTGAGCACCTTGCTGACAAGTGCTAATAACAAA
ATACCCAGAGAGAGTCCAGTTGAAGTTAGCACACATTAAACATTCTGAACTTGTCCTTTT
GCTCATAGATTGTGCATAATTAATAATTAAACAGTTTCAGTTGTAATGGGTTGACCTTCC
TGAACTGTTCATTATTCACAAGGCAAAGGCATCACTCAAACTTTTTTCCCATTGTCCTTT
GCTGTTCTCTAGCACGCTGCATGCTTTTGTTTCATTTGTTTAGCAAAAGGGGCTGACCAG
ATAGTTACTGAAACCTCTGAGACTTGGAGTCTGTCCTCCTTGATGACCAGAGTTGCTTAC
TGAAATGGTTTAATGGCATATGTTTTTATATAACAGTTGCCTGCTTGACAACAAGACCCA
GCTTTGTGGCCCTTTAGCAGGACTCTAAAGTTGATTTGGGGCTAAAATTTCAGGTTAAGG
CTTTGGTTAAGATTGTATTCCACAGTTTCATTCTGTACTTCTATGCTCAGAAGTTCAATA
AACACCACAGACACACATATGCACACACATGCACCCACCCAAAAAACCCTTAAGTGAAGT
ATGGCATCAGGTTCTTAAGGAGAGTGACTTTTATTAAAAATTTAGAGTCTGTTCCAGCCA
GTACTTAGAATTAATAGTGTAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGC
CCTAGGATATTTTGGCTAAGGAAATGGCAACTGCTCTACTAAATCCCTCAGAACCCCCTT
GGTATGGTTCTCAGTCTCCCTCTAACCCTCATGGTGACTTGGATGCTTTTCCCTCCCCTG
GTGTGCAGATTTACTATGCACCTCCCCTCCCCACAGATTTTAATTAGTTAATGAAATGTG
TAGTTCTTGGATTTTTTTTTAACATCCTTATCTAAACTAACTTCTAATTTAATTTGCTTT
AAAATAGAGAGAAAGTGTACTTTAAAACCCTCCAGTGGAGTGAAGATTGTTGGGTATATT
TATTTGCTTTCCTTTGGAATAGTAGCAGCCTGCCTACTTTTTGGAGTTGAAGGCTCACAG
AGGGCTCCTTAGCCCTTGTGTCTGTGTGTGGCATTCTGATCTCCCCACTAGTTAGTCTTC
TGTATCTCAGAAAATTCTCCTTTGAGGGATGCAAGAGACATGGGTTCCAAAAACTAAAAA
AAATATCTGGCATCATGCATAGGAGATTAGAATTTCTCTCTCATCTTTGATGAGTGAGTT
TTTCCCGTCACCAGTGAGATGAGAATCCACCCACTGTGGTTCTGCAAAGTCGAGTTGGGC
TGGCATTTTCAGAAGTGAAATAAATTATTCATGGATACCACCCAGTGTTCTTTAGTTTTA
TGTTATGAGGAATTTAACAGGCTTACAATATCAGGTCTTAAGTAAAATTAACTACCCATG
CAAAGATGTCACATTTTCTCTTTTTGTTTCTCATCCATGTTAAAATGACATCTTCATCTA
GTTGCCTAGTCTATAATTCATTAATTTGCTCTTAGTGTCATACTTTGAAATGAGGCCCAC
ATGAACATCACATTTTATCCTAGGATCTTTGTAGAAAGCCAGACCAGAATTTAAACCATC
TTGGTAAATATTCAGCCGCATTAGGACAGGAGACTTTTATTTTCCTAAATATTACATTTG
AAAGTGATTACTACTCACATAGTACTTCCAGTACTGCATTCTCCATACTTAAAAAAAAAA
AAAAAAAATCCAGAAAAGAATAACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAGTGGACTGTTTCCTCACTTCCCCCCA
TTTTAATGTCCTCTCTAGGTAATGCCTACATGTAATCCTTTAAATTTAGCAAGATTTAAT
TTCACTCACATTTTCCTTTGTTTTCCTTTTCTCCTAGAAATCTTTCTCTACTGATGAGAA
TGAAATTTTTAAGTTTAGAATGACTTAGCCTTCCCCTCTTTTAGATAAATTGGGTAAATT
CAAAGAGACAGGATATATAAAAACAATAAATAAATATTTTGTTCATATTCCTTTTTTTTT
TAACCTCTTTGGGATTTTTTTTTTTTTTTTTGGCTGCTTTGACCACCTCATTTCCTTTTG
ATTTAATTGTATTTTCCAACAGTTTCCAATTGTTTGAATTGGAAACAAAGCCTTAATAAG
AGTTCTAGTTAATTTTCTGTCTTGTAATTACCGATCTCATTTTTCTGATAATTGGCCACA
GCAATTATATGTATATTTACTAATCACATAGGAGGCTGTGCAATTGTATCTATCTGCCAC
CATTGATAATGACACGCATATTGCAGAGGTGCTTTTATCATCTTCTTTTTTCCACTACAT
CAAAGCTATTTTCTCGCGTTCTCAATAATGAATACATGCATGCATTTGACACAGTTGTGT
GCTAGAGAAATTGTTTGGCTCCCACCAAATGCTGCATGCTCTGAGTTTCTTGCCTGCAGC
GCTAGAAGGTTGTATGTAATGATATATTGCTCATCCAAATGGCCAAAGCACTCCAAAGCA
CAGTGAGATTAAAATAAGTCATTCCTTTGTTAATTTAAATAGGTGCATGTATCATACTTT
GCAGGGCACTTTGTGTAGGGATGTCAGGGAGGGGAAAGCCGCCGAAAGGTATTTTTAATA
GCAAATGAGAATAGATGAGAATGGAGTCATTTGCAGCTGCCTACTTTATGTGCCTCTCTT
GTTCCAACTGTAGGTCTAATGAGATGACTGTTAAAGTACTCTGCAGTGTAATTTCATTAC
ATCCTGAGCTGTTACACTATAAACACAGTGGAGCTCTCTGTCATTCTTGGAAAAACTCCT
AAATTCTTAAAGCCTTCCTTTGCAAACGTAATGGGGTTTGCTCCCTGTGTTATGTTGAGG
TTGTCGCTTATTGCTGTGTAGTTCTTTGCTCCTTTGAGTGACTTCCACCTTCCAGCCCAG
TTTCATTTGGTGGTTGATGTGAGAGTTTCTCGTTGTGTCCTTAATTCACTGGCTTTCATG
AATATGCTGGAAATGAATTTGCCTATATTGGCAATAGACTGAAATTTCTTTGCAGGAAAC
AACTCCGCCTATAAAAATACCTTTCTGTTAAAGTAAAAAAAAATCTGACCTACATGATTT
GGTTAAGGGCAAGTATTTGAGAGCATTTGAATATACTTGTAAATGTAAAAAATAAGGAAA
GTGTTATTAAATAGCAAATCCAGTCACACAAACAAAGGTCAACACAAGAATTTTTTTTTT
AGCTCTTTGTTAATTACAAGACCATTTGGTGTGTGGGCGGGAATAATCATTTAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAAAGCTATTTTT
CCTCCAAAAACGTTTCTTTTCCAAACCATACCATCTTGAAAAACAAAGCATACATTTTGG
TTAAATAACTGGAATCTTGACTGTTTTGAAGTTCATTAATAGTGTTAGAGCTATTATCCA
GAAATATATATTAATGTCTCTTGATCTGTCTTATGTGGAGTTCCTAAAAGCATTCAAAGG
CACTTCGTGGGACTGCCCATTTTGAAATGCAGAAATTGAAAAACGTGGGAGTCCTATGCC
TTCCCAGAGCACTTGGTTTGAGCACCGCCCGCTCAGGAGATGGATTTGTGGCAGGATGGC
TGTGCTTATCTCACTGTGTGGTCTGAAACCATCCTGGGGTTGGGGCCGGTTCTAGGCAGA
CAAAAGAAAAGCAGATAAGACTTTGCCTTTATCTATCCAAAAAATGAATCAGCTGTTATA
TAAAAGTTTTATGGAGACAGAGGGAGGAATAACCTGTGTTGAAATTTCCACAGATGTCAA
GCCGAAACGGAAATGATAGTGGGTAATAGCCTTGTTTTCCCAAGAGATACAGCTACTTTG
CAATGTCAGATTAGGACTGTTACCAACTCCACTGGCAAGACAGCTTGAATTACTTGCTAA
TGGATGCAGTATTTGAGAGGTGCATATGGTTATTTATAGGGAAGGCAAATGTCCTCGATG
TCATTAATGGTTCATAACTACGGTTCTTGTTTACCAAATGATCATTAAATCTATTTGAAA
AAATACTGTCAGCAAATGCAGAGATTATATGAAGGATTTACTTCTTGCTTGTTAGAGGTT
GCCTCATATAAAGAAAAAGCATCTGTGCAATTTAGCCCTTCCAAATGTTAGAAGTAGCAA
TCTCTTGTCATGACTTTATCCCACAGACACTCTCAAGTCAGAACAGACTTGTCAGGTACA
GCCAAGTAGGCAGTACCAGCAGTCACTCTGGCTCACAGTATGGGTGCTTCACCTAGTAGC
TAAGCATATTCTACAGCTACTAATTATACCTATTGCATGGAAAGGCCAGAAATATTTTGT
ATGAGCAATGTTGATTATTTAAGAAGCTTGAAAAAACTTAGCTTTCCCACAGCTATTTAA
TGAATTATCAACTTGCATCATAGCCAAAAAAAAAAAAAAGTCAAGGTAATATGTAATAAC
CCATTGGTAATTTCATAGCATTATCTAGATTCCTGACCTCTTTTATATATTACCTGTCAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATGATAGCACCTGTGCAAGTGATATAGCTAACATGAGTTGTTTTTGGGTTTT
TTCCCTCCTACAGCATGCGAAAACAGCCAAAAGAAAGGCCAGCACCTGAGGAATTGATGG
TAACTAATTTTTTTTTAATTTAATGTCAAACTCTTTCCCCTAGGGTCACAAATTAATGTA
GATTAGTCATTTGCTATTACAGCCTTTCAGAATTCAGAGGACTGGTAACAAAGAAGAGAG
TCAACATTTTAAGTTTTTAGAACAGTCCTACACGAAATTCTGAATATAGCATGGAGTCCT
CTTGGATTCATGTAAAATGAAATTAGTTTGGCTGCAAAAGATCAAGCTAATGTGAATCTT
TGGTCTTTCTTCAGACAGAGACAACTACAAGGCTGCTAGTGCTGTGTTCTCAGCTCCAAA
GCAGCTTTCTTTGATTGCAAATGACAGTTTTTAGTCAAGCAGGGAGAGGAACAGAGACTC
TCCCTAACAATTCCCAAATGGTCATTTATTTAGTGCAGATTGTTGATTTGACAATGCACA
AGCTGTTAGAATAACGTTAGGATTGAGCATTAGTAAATAATAATTATAGTCTACTCTTTC
TAATGTTTTGCATACCATTCCCTGTGTTTAGATTACTGCACTCATAACAAATCTTGATCA
GTTTTCTTTTACTTCTTTAAACAAGGTGTATTTTATCAATATCACTTGAGAAGTTTTCAT
CCTTTTTATTCTGTCCTAATAAACACCGTAAGTACCCAAACTTCTGTATAATACAGATTC
CATCCCTAAGTATAAAATAACAGTACATTTCCCTTTTTTATCATGACTGCTTTCCAGGAA
CCTACTTTTCTCCATCATGTTATCCCTGCAGCCAGGTCTCAGTTTTCAGGGTAATTTCAA
ATTAAACCTCACCCCTAAAACCTCTGTAATTTATAATGGTGCAGGTTTCATGTCTAAAAT
AAACTAGTGCTTTCTTTCTTTCGTTCTTTCTTTCTCTTTGATGGCTGGCAAATTCTTGCA
GTTAGTCACATTTGAGAAAACTTGGAACAGGTTCTAGAGATGGAGACCCATTTACCTTGT
ACATTATGATGCTATGGCTGGATAGCTCAGCTATTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 7164..7212, 32073..32140, 50985..51054, 55179..55219, 56212..56279, 62264..62278, 62280..62286, 62288..62298, 62300..62315, 69596..69660, 146855..146894, 154294..154362, 154460..154541, 163457..163518, 169177..169225, 236655..236728, 237697..237747, 273098..273169, 363075..363101, 363484..363516, 412758..412819, 415393..415438
1001..1135, 7164..7212, 32073..32140, 50985..51054, 55179..55219, 56212..56279, 62264..62278, 62280..62286, 62288..62298, 62300..62315, 69596..69660, 146855..146894, 154294..154362, 154460..154541, 163457..163518, 169177..169225, 236655..236728, 237697..237747, 273098..273169, 363075..363101, 363484..363516, 412758..412819, 415393..415438
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved