Dasypus_novemcinctus Locus ZCCHC8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ZCCHC8
Dasypus_novemcinctus
ZCCHC8
GeneScaffold_238
SNORA9
5370..5503
25041
GCTCCCATAACTGGTTCTCTATCTCACCCATTTATTCAACGAGTTCCTTAAGCCAGATT
CCTAGAAAACATACATAACTCATTTTCTCATTTCCCAAATCCAACCCATAGATGACGTCT
GTTGCTTTAATTTTCTTTTAAATATATTCTAAATACCTACTTCTCCACCATTAACATTGC
CCTAGTCCAAACTACAATTTAACTCTATACTACAAAAAATCTCTCCCACGAATACCCACC
AACACCTCCACTCGACCCAGCCCGGGGAACGAAATAGTTATTTTACTGTTTTGTTTCTTT
CACTAGACTGTTTCATGAGAGCAGAAGTTTATTTTGCTCACTCTTGTATCCTCGGGTCCT
AGAACAGTGTCTGACCCATTGGAGCTGCTAAATAAACGTTTTTGAACGAATGAGTGAACA
AGAGGAACTCGAGAAAGTTTCAACAGATAATCTAAAATAGTCTAATGATCTAACTAGTTT
TACACGAAAAGTGAAACAAACCCAATAAACTCAAGTAGCTTGTCTAAAATCACAAAGGTT
GTTTGTGGCAAAGTAGTTCTTTATTCCATTGTTGATGTTCAGCACGCCCACCAGAATCTA
TGTTAAACCATGCGGCGTGCTCTTCATTTTATAGATGCACAACAGAGGCGACCCGTATGG
TAGCAACACACTGATCTAGCCTGGCTTTCTTCACGTTTAAAAGGACCAATCCCGGTATGC
AATGCAAACAATGAGTTAGTAGCTTGGAAACCACGAGTCCCGGCATGCCATACGCGCGAG
CTGTCTCGGAAGAGGGTATGAGACGCCACTGCATTCTGGGAGTTGTAGTCCTCCGAAACG
GGCCCGCCCAACGCGCGTGCAGCTCGGGTGGCTCACGTTTGGAGAAACCCTTCAGGGTGG
CTTAACGCGGCCCGAACCTTTGCTAGCGGTACCGCCCTACAACTTCGCCCGGCACCCGGT
GGCCGGCTCGGTGTCTGCTCGAGTCTTTCCCACAGCCCAAAATGGCGGCGGAGGTGGATT
TTGGCGACCTAGAGCTGTTCGAGGCGTTTGATCACCCAGAAGAGTCGATTCCGAAGCCCG
TTCACACCCGCTTCAAGGACGACGACGGCGACGAGGAGGAAGAGAATGGAGTCGGTGACG
CGGAACTGCGGCAGCGGCTCCGGCAGTGTGAGGAAACCATTGAGCTACTCCGCGCCGAAA
ATATCCTTCCCGCTCGCTGGGCCCCGTCACACAGGCGTGTAGTCCCCGCTTTCCTCGGGG
GGAGGGGACCGGCGGAAATTCCACGAGGGCCAGAATTCCAAGTAATTCTCTTGCCCTGCA
GGCGGGCTGAGATCCCAGGGTTCATGTTGCGGAAGCTGCCCCCGGGCCTCAGCGCAGCCC
TCTCCCATTCCGGGAGCCCGTATTCTGGACTAGATCGCCCCGCTGGCCCCCCGGTTCGGT
TCTGATTTTTAGGGTTGTTTTAAACCTGTTTGTAACTGTTAGATTGTAGACAGTTCACTA
CTTCTCTTCCCCACCTTACGGTCATTATCCGACTTAATTTTGCAGGCAACTAACGTTGAT
GCGCTCTTGTTATAGTTGTGTATTCGGAATACTTGGACCTTAGGACAGATCTCTGTTTAA
CTTTTTAGTTTTAAATAACTTCAAACTTACAAGTTGCAGATATAATAAAAAACAATTCAG
AGACCTGCAATTAGACTGCCTACCCCGATAACCAAATTTACCAACTCGTAACATTTTGCC
ACATTTAGATCTGTTTTTAAGATGGGGCAAAAAGTTCGTGGTGCTGGACCCAGAGTCGAG
GGATATCAGAGTTCCGGGCATGCACAGAAAAATAGTTTGCGTGCTTAGAGCCCTTCCACT
TTGGACTAGTTTCGGTGGTGAATATGCATTGTAACGCTTTAGGAAACGCACCAAATAAAT
TACCGTTTTGCTTTAAAGTTAAATGATTACAGCTCTAGCAATATTTGCTAGTATGTTTAT
CTCCATCCTTAATTTTTGTTGTTTTTACTTTATGTACAGATAATTTCGGTTTAGGTAGTT
TCCTTTTTAAATTAAGAGCCCTCAAAATAAATTACCTCAAGGTTTTCAGAGCCTGATTTT
TCTTTCATATGCCTTTTTCTAAACATTTTATGAAAAATTTCAAAATACAAAAAAAAGATT
GTTCAGTGAACATCCAAAGATTCCCTCCTGGATTCTCAGCTGTTAACATTTTGCTGTACT
GTGTTTGCTTTATCACATGTCATGATACTTTTGACCTGGAAACATTTCTTAAGTGAATGG
GTAGTTGGTTGTTGGCAGTTTAACTTTTGACAGGGACACTGCTGTTTGTCTAACATTTTT
GGTCCAGTCTGTTAGTCTTTTGAACTATGACCATGTCTTAGAATATATGTTCAAAGGGTT
GAAAACTATTTTAATCAGGTTCAAATGCTTAGCCTTGCAACTAAATAGGAAATCAGTAAG
TGTTTTAGTCTAATGATATATTTGTGGGTCTTTTAATGGTCATAATATTCTAACACCAGA
TGTGACAGTAGTTGAATTCTATGAGCATTGTGGTTCTGTAAATTTTAATGAGGGTTTATA
TTCCTTGACAAGTAATAACATCAAGAACTTAAAAGAAAATTGAATATTCTGACTCGACCG
AGGTATGAGACCTTGAAATTATACCTACACCAGCATTGTCTGTGATTATGTATCCTGATA
TTTATGTTTAATCATAATTTCATTGTATAAAGAATGTTTACAGTGTTGTATCAATTGGAC
TGGTCTAGCAGTGTACATAAGTTGTTTTTTTTTTAAGTGATCAGAGTAATGATCCTTTAT
TTTGTGTGGATAAAATTGGGACAATTATAATTGTGATTGGCTTTTGAACTGATTTATTGG
GTGAAAACATTTGTGAAATGCAATACAGAAATTTTTTACTTAAGTTTCAGAATAGATAAG
TTGTCAACCTAGCTGTTTGCATACAACAAACATTTTGGGGAAGTTAGAAATAAAATTACA
GTATTACTCTAGGTGAAGGCTTATTTACACAATTAAAATGTGTACCCGAAGTTGTTAAAA
AATAGAAGAAACAACTCACTATGGAGAATTTTAGAAGAAAAAGTAGTGAGCTTTAGAAAA
AAAGAGGTAATAGATTTGTATTTAGATATCTGATCTAAGCAGATAAGGAGATTAAGTGCT
TCATCTTTTCATAAAAATTCATTTAACAGGTCACAAAAGCTAAAGTATTTGTTAAAGTAC
AAATTAATTATGTGGGACAAGATTTGGGGCATATCATGACAGTTTCACATGCACTTTTTT
GTCCCTAGTATCATCTTGAGTCACCATCTACATTGGTGACTCAAGGTTAAAATTTGAGAA
ATGCCTCCACTCTCTCTGTGAGCTCACTTAGTGGATCTAAATTCATTTTTGATTAGATAT
CAAATGTATTAACTATAACTAGAATTCCTCACAAAAGTCATAATTTTTATAGATTTAAGG
ATTTTTATTTAATAATAAGTTTTCTAAATGGAATTCATTTAAACGTGAACTATTTATTTA
AAAAGGAGTGAGTTCAAATGATTGCAACATTGTAGGGTTTGCCAATTTATAAGAAAATAA
CATTGTGAAAAAGGAATAAATTGTAATTTTTCTAAAATGAATAAGCTTTGTATTGCCAAA
CAGTTAAGGTATTCTACAGAGAACCAAGGAAAAATGAGAAATAATATTATTTAGATAAAA
CTTTTATCACAAGCTTCTTGGTTAAAAACTTGTTCTCTGAACTGTCATAATCAAAAGTTT
CTCTATTTCCCCCTCATAAACATTATGTATTTTTTATGATTTCTTTTTATTTTAATACAT
GTTTTTTATTAGAGAAATTGTGCGCTTACAAAACAATCATACATAATGTGTAGAATTCCC
ATACATTACCCCTCCACCAACACCTTACATTGTTGTGGAGCATTTGTACAGGTTATAAAA
GAACAACATCAGACTGTTACCACTAACTATGGTCCATAGCATATATTTGGTATCTTTTTT
CCATACATGTATTTTTAAAAGCTTTCAGGTATTGCAACAGGTCTGTCAACTTTCCCATAT
TTTAATTGTTTACTTCATGTTGTGAACAACTCCAAATGCTGATTTACTTCACCTGCTGTA
CAGGTGAGGCCTATGAGGCAGGTGAGAAGAGCTGGAATCAGGGATTTGAGCTGGTCTCAG
GTTACTGGAGCAATATACTGCAAGTTTACCATCTGAATTCTTGTTCTCTTTTTTCTTTCA
GTATTTGAAAATCAAATCCAGCAATAGTATAATTTTTACTTTTCTACTGTAGAATCTTGG
ATTTGAGACATTTAATGCCATGTGCATTGCCCTCAGAGACTCTATCCATTTATTTATAAA
ATGTTTCCATTTTGCTGTATACTTCCAAGCCATAATTCACTCCAGTTCTTTTTGAAATAG
TGCTTAGGTTCCTGTAACCTTCTGGTTTGTCAGAAACCAGTCATTAGGTAGAGAAACTCT
TTGAGAACTGAAAGATTATCTGCAGTTAATAATTTTTTTAAGCATTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACTTTAATTTCTCTAAGAGT
ATGTTTTAACTTCTGTTTTAGTGGAATATTGGTGAACAATACTAAGTTAGATGGACCTTT
ATTACAGATTCTGTTTATGAACAATGTTATTTCAAAGTAAGTAATTTTTCCTTTTCCTAA
ATATAATAAATTAATGTGTTTATGAAACAATGTCTACCATAAATATGCTGTTTTCATTCA
TACTTATATCATCTTTGTTCCTTTACTTAAAATGTTCCTGGAGTTAAAATTTATGGGGTA
ATGATTAAGCATAAGACATTGAGTCATTCAGACCTGAATTTGTATCTGGACTCCTTCTTT
CTACATATGTGAACCTGGACAAGTCACTGAACTTCTCTGCATATCAGTTTCCTCACTGGA
AGACAGGATACTAATAGTCACTACCTCTTAGGTGGCTAAATAAGCAACTGTAAGAGCTTA
ATAAATTGCCTGTAGTAGACATCACCTCCACCACCACCGCTGCTAATAATATTAACCATA
ACTTTCCCCAAATCAGGTAACTGAGTTCTCCATCTTGGTAGCTTCAAAGCTTACCCACCT
GATAAGTTTTTTAATAATTAAACTAGACCTTTGCAAGCCTTCGAGATGCTTGAGTCTGGG
GTGACTGGGTGCATTCCTGCATTGCTTGCCAGAGTGTTCTGAAATGGTTTGAGGCCTTGC
CCTGTCTCTTCCTCAGAACATAGCCATAGGCATTTCACAGTTTTTTGCCCTATTCTGAGT
CACTCATATTGTTATCTCCAAGGTGAAGGAGATGAAGAGTAGCATAGAGTCTTACCTGCT
TGCTGGCCGTTACTACTTAGCAAAGTGGCAGCTGAGGCTCTGAGGGCTGAGGAAGCTGGG
CAGGGATACAGCAGCAGCAGCAGCAAGGTGCTATCTCCATCAGACCAGAAACCAGGTCTG
CTGGAGCTCCTGGCATCCTGTCACCTAGTGTTTCTCCTGCAGAACTACGAGAGTGTCAGA
GCTAGAAGAGACCCAAAAGATCATCTAGTCTGTAGGGAGGAAAGTGAGCCTGAGAAATTG
TGGCTATCCAAATAGCACCCTAACAGGATCTGGGTTGGATACCCTTGTCTCCTGAACTGA
GCAACAAAGAATACTTAATGAACGTGGTTTTTTTAACCTAGAGGATTCAAGAAAGCAGAC
CTCAGTATTTTTTTCTTATATTGCATTTTGACTATTTTTCTGGTTTAATATTGATGTGGT
TGTTTCCTTATATGTACACGAGAGAAAGGAGATACAAGGACTGCACACACTGCCGTTGTG
TTACGGAAACTGATGGCTAGGAGATAGGATAGGAAGGAAACTTTACATTATGTAAGCCTT
TTTATTTATTTTGAATTTTGACCCATGTACAATGTATTATTTATTAGAAATTAAATATAT
AAAATTTTAAAATAAAATAAATTTATTATTTGAACAAATATTTGGTAACTATTATATGCC
AGGCACTCTGGTAGGTTATCATAATCGTTTCTTTAACTTGACAACAATATGTATCATTTC
CTAAGACTAGGTTCCTGGAGTGTTACAGAATCGGGTGATTTGATAAACCTCTGAAAAACA
ACCACCTTTGCACATGATATCTTATAATATGCATAATTCTTCAACCTATTAAATGTTTTG
CTTTGGGTTCTGACCATTTTGTCCTCTTATGCAGGCAATATCATCAAGAAATAGAGGAAT
TTGTATCAAATTTAGTAAAAAGATTTGAGGAACAGCAGAAAAATGATGTGGAAAAGACTT
CCTTTAATCTTTTGCCCCAGGTATTTAAAATTTAAGAGACTTTAAAATTAGTAAGTTATG
TTTTTCATTGCCAGTCAGTTAGGCCAAATGGATCCTTTTGAATCAAAACCAGAGTGTTCA
TTAAGAATGTCGATTCCTCTCTCATCCTTGAACGGGCCTCCTTCCTTAGCCACAGGCAGA
CCAGTGGAGCCAAGAGGTAGCTCCTTTGCTCAGGGGCGGCATTTAGACCTGACTATACAC
AAAACTAAAGCTCTTTTTCCATTCCCTAACTTGGACATATGTGTTATGTTTTTTGGGCAG
ATAACTTCGGGCCAGGAAAAAAAAATCCATGTTTCTGTGGTTTATATACGATGGATTCTG
TTTATCTACAATAGACTCATGTAATGAAACAAGTATTTTCCCTTTTCCCCCTCCACTTGT
TTGAAAGAAAACCAATAGCATGTGCCCAAAGCAATCCCATAATTTCACTGTGAATATTAG
AGCATGTACTTATGTGAAAAAGAAACAATTATCATGTCTGAGCATTTTTTTAAATTAAAA
AGTAAGGTAAGTAGAGCCAAATAACCTAAAAGAAAGGATCGTCAGCTGTTTCTTCTCAGG
TTGAAGAACACAGTGCTCCAATTAATTAAATTTTTTGTTTATTACCTTCAGTTTTTACTT
ATAGTTTTTAAAATAAATCCAACAATCAAAACCATACTAAAAATTAATAAAATTTAAAAA
ACTAAAAAAACCCATACTGAATATTTCATTTTTGATTCAAGAAATGCTTCATAATTTTTA
ATGGCTTAAGGGTTATTTTGAATGTGAATATTGACCAGTACTGTGAAATTATATATATTT
TTTATCCTTTCTGGTTATCTGATTTCAAGATAAACTCAAGTCTACATTGCCAGTTTAAGC
ATTGAAAGTTCCATAATTAACATTCACCAACACAAAAGTCATGCTGTATGTTAATGCTTC
AGAAGAACCTCCTTTAATTTTTTAATTTCCCATTGGTAAAATTTCTCTCATAGATATTCC
TAGCTTAACTTCTAAACACACCCTAATTATGACAATGATGAATCCAAAATATTATATACC
TTATTTGTTACTATTAGAATATAAAAGGTGTATGTTCAAATTATTAACAGTCGAAATTTA
AAGTTGTTAAAAATTGATAGCCTTCTGTAAAAGGTGTTTTTTCTTTGTATTAGCCATCCA
GTATTATACTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTAAA
AAGTAAGGTAAGTAGAGCCAAATAACCTAAAAGAAAGGATCGTCAGCTGTTTCTTCTCAG
GTTGAAGAACACAGTGCTCCAATTAATTAAATTTTTTGTTTATTACCTTCAGTTTTTACT
TATAGTTTTTAAAATAAATCCAACAATCAAAACCATACTAAAAATTAATAAAATTTAAAA
AACTAAAAAAACCCATACTGAATATTTCATTTTTGATTCAAGAAACGCTTCATAATTTTT
AATGGCTTAAGGGTTATTTTGAATGTGAATATTGACCAGTACTGTGAAATTATATATATT
TTTTATCCTTTCTGGTTATGATTTCAAGATAAACTCAAGTCTACATTGCCAGTTTAAGCA
CTGAAAGTTCCATAATTAACATTCACCAACACAAAAGTCATGCTGTATGTTAATGCTTCA
GAAGAACCTCCTTTAATTTTTTAATTTCCCATTGGTAAAATTTCTCTCATAGATATTCCT
AGCTTAACTTCTAAACACACCCTAATTATGACAATGATGAATCCAAAATATTATATACCT
TATTTGTTACTATTAGAATATAAAAGGTGTATGTTCAAATTATTAACAGTCGAAATTTAA
AGTTGTTAAAAATTGATAGCCTTCTGTAACATGTGTTTTTTCTTTGTATTAGCCATCCAG
TATTATACTAGAAGAGGACCAAAAAGTAGAAGAATCCTGTTCCGTTAAAAATAATAAGGA
AGCTTTTAGTGTAAGTTTGCAATTTAGCTTTGAATTCTGCAGATATATGTTTTCAATCCT
TTGTCAGTTGGACAACATTTAAATATTAAAATATTATAGTTGTATGTCATCAGATGATCA
TTTTCCTTTTGTTAAAATTCTTGTAAAACAACACTGTAGACTTCAAACTCTAAATATTAT
AATTTGCTTTTTAATAAGTTAGCCTTGTGTCCTGTGAGCACAGTAGACATGCTTTGAAGG
ACTTTTTGTCCTAACCTTATTGGATTTATTTTTAAGAACATGGTTGAAGATATAGAAAGC
ATGCTTGTTGGATTTACAGATGACATGAAGCTGAGAGAGATAACTAGCTAATAGAACAGA
TGGCAGATTTGAAATTCAAAAATTTTAAGACTAGAATGGTGAGTGGAAAATGAAGCTTAA
CAGAGCAAACCTACGTTTAGGCTAAATGCCTCTCAGAAGATAAGCAAAATTCATTAGGCC
TTTACAACATAGTGGACAATCCATTCTTGAATTCTATTAAAGGAAGACTAGGTTTCATGT
TTACGAAGTTTTCTGCCTCATTGACAGTCTATAATTTTAAAGACATGGGGCTGCTGAGAT
GATGAAGAACCATAACTTTATCGAAAAGAAGAGCTGCTAGGGATATGACATCTTTGCAAA
CATGACAAGGCTTTTTGGGGGCCAAGGTATTATTTTATTTTAGATCCTCCTTTTTAGTGC
CAAGGGGTAGAATTAGTGATTGAATTGAATACAAGGAGGTACATTGAACTAACTTTTAGA
AAGCTAAAATTTCTTACAATGAGAGATGTGAAAATGAAGTGGTCCATGTCCAAAAAAAAA
AAAAGTGAACTCTCTATTACCATGTTACTTCAAAGAGTCTGAATGCCTTCAGAGTACTTT
AAAGAAAGATTTCTGAATTTGAACTGGGTAACTTTTTATTTCTCTTCTAACACTGAGGTT
CTGGGATTTAAAGTGCACCTGTCTGGAAATTGGGAATTTTGTTTGTTTATTTATTTAACA
AATACTAATGAATATTTATTGAATGCTACTTTGTGCCAGGGCTCATTCTAGATTCCAGGG
ACATAGCAATAAAGTAAAAAAACAAACAAACAAACAAAAAAACCCAGCAGTCCCTGTTAT
CATTGAATTACATTCTAGTGGGGAAGACAGTGCTATTGGAAAAAAAAAAGAGCAGGACAG
TGTAAGGAGTTAAAGAGTGTGGGGTAGGTGCTTTTCACAGATATTGGTTAGTGGTAGCCT
CTCTTAGCTGAGACCTGAATGAATTGAGGAAGTGAGCCATGCTACTGTTTGAGTGAAGTG
TTATTCCAGGTGATAGGAAGGCGAGTGGAAAGCCCTGAGACTGAAATAAACATAACATCT
ATTGCTCACTGTATATTATGTCCTGTTTCAGCTCATTATAAGTAATTCTCATGATGGTCT
TATTATTATTCTCATCTTAGAGTTGAGGGAACAGACATAAAAAGCTAAGTAACTCACCAC
CAGTGGTCACTCAGCTAGACAGTAGCAGAGCCCAGAGTTTGAACGGAGGCCAGTTCACCC
TGGCGTCTGTGCTCTGATCTTCTGTGTTGCTTTTTGGCATTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGATGGA
GAATGAGAAGGATTTAGCCAAGAAGACTGAGAAGGAGAGGTCATCAGTGCAGGAAAAGAA
CCAAGAGATTGGTGTCCTGAAAACCAGGGGAAGAAGAAAAAGTTGCTTCTAGAAGAAAGA
ATCAGCCGTGTCCATTGTTGTTCAGAGGTTAAGATGGAGACAGAACTTTCCATTGAATTT
GGCAACATGGGGGTCATTGGTGAGCTCCATTGCCAAGCAGTTCAGTGCATTGATAGGAAC
AAAAGCCTTATTGGAGAAGTTCAGGAGAGAAAGGCATTGTTTTTGTTGTTGTTTTCAAAG
GGGGAGTTGGGAGGGACTGGTTTTAAATTAAAAGAGAATCAAAAGATTTAACATCTAAAT
GCAATCTGTGAACTTTAATCAAATCCTGGCTGGGGGGATGGGGGAAAGCTGTAGAGGGCA
TTTGGGGACAATTGGGGAAAACTTAGTATGTACTGGATATTAGATGATACTTGGTAATTA
TTAATTTTCTTAGGTGGGATAATAATACAGCAATATAGAATTTCTTTATCCTGAAAAGAT
ACGTACCAAAGTTTGTAGTGTCATGGTGTCATGGCATCTGCAGCTTTCTTTCAAATAGTC
CAGCAAAAATGCACATGCACGCTTAATATGGAGAAAATGTATTAACGGTTGTTAAATCTA
GGTAGAGGGTATATGGGTGTTCACTGTGCCATTCTTTCAACTTTTCTGTATGAAATATTT
CAAAAAATGTTGGGGAGGGGGAAGAAAAAGAAAAGAGAACAAGAGGAAAGGAATTAGAAA
GCATAGGTATAGATAACTTTTCTAAGGTTCTCGCTCCAAAAGGAAGCCAAGAAATGGAGA
ATTAGAGGGAAGTGAGGGTCGAGATATTTATTTTGTTTGCTTTCATTTTAAGTCTATAGA
GAGTGCAGATAATAGTAATGATCCAATAGAGAGGGAAAACTTGATGATCTAGGAGAGAGT
GGGGAATTTAAAGAGGTAGCTTTTACTTACACATTAAAATCTGGCTCATCTAATTAGGGA
GTTGATTATTATTTCTAATAATTTCATCCAAAAATAAATTGTTACAACAATTAATCATAG
TCTTACATTATTTAATGTCTTTTTTCCTGCTTAAATAGCAATATTTTTTGACTTGTTTTC
TGCAGGTTGTAGGAAGTGTCCTGTATTTTACTAATTTTTGCCTTGATAAATTGGGGCAAC
CGCTACTAAATGAAAACCCTCAGCTTACCGAAGGATGGGAAATACCCAAGTATCCAGACG
AGTAGTGAATGAAGATCTTTTACGCATCTTGCCATTAAGTCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTCTTTTT
ATTTATTTTTTAACCAAAACCATAAAATCTTTTAGCTCGCAGAAGTAAATATTCTTTATT
GCTGCGCTAATATAACGTAAATGACAGCATTACGCTGCATATACACGTACATCTATTAAA
CATTTAAATCCATCATCTCTTTATTGGCATTCATTGGTTCATGCCTAATGTGCCTGGGTG
AGTAGAAAAATGTAATTGTTTTTGTCTATTTGATTTATGTCTTATAACCATCTGCCCTCT
TTCATGTTACCTAAAGAAAAATAAGATAATCTGTTTCCCTCGATTTTCCCATTATTAACC
CAAAGAAGTAACAGATTTAACCAGGAACAAAAGGGTTCTTGGTTAGAAGACTTTGTATAG
CAGTCTTATTTAAATCACTAGTTACAGGAGGTAAAAGTGTGTATATACTTTTGCAGATAT
TAAACATCCGTGATCTACTTGTTTTCTCATCTCTGATACACTTTCCTATCATATAGAATT
GTATTGCTTTGTTTTTTATGTTTTCACTTATATTATGAAACTCTTTGTTTTTTTGTTTTT
TTTTTTCACTAAATAGGCCAAAACCTCACTGTTTCAATTGTGGTTCTGAAGAACATCAAA
TGAAAGATTGCCCAATGGTAAATTTTTCTTGTCTTAAAAAATGTCTTTGAACAGAGCTTT
ATAATGTTTTCAGTACATTTATGTGGAATTGTGTGATGTGAATAAACTTTGTGTTACTTT
CTGTCACCCTTTCATTTGAAATATTTTCAAAACGTATTAAGAAATCAAGTTTTTAGGGTG
TTTTTTAAAAAGAACATATTACAGTACTCTGTATATCTGAGATGTGTTAAACATTATACA
GGTTCTTTTTTAGACAGCTTATTCTAAAGACTTGATTTTGATAAAGTGCTTCTCTTCCTT
GCTTATATTTCTAAAATACCCACCCTCTTTTACATGTTAGCCCTTATACATTAAAACCGA
AATAATCTGTTTAATTGACTGAAGAAAATGTGCTTATTTTTATTTAATTTCCAAAATATT
CCTAAACTGCTCACTACCATTCTTTTCAAACATTATGCTTTAGCCTCGGAATGCTGCTCG
AATAAGTGAAAAAAGAAAAGAATATATGGATGCCTGTGGTGAGGCAAACAATCAGAATTT
TCAGCAGCGATACCACGCAGAAGAAGTTGAAGAAAGGTTTGGAAGATTCAAGCCAGGAGT
TATTAGGTACTGCTGTCCTTTTACCATAAAAGTGTCAGTTTTTTTTTTTCTACAGAGTTT
GAAATGTTCTATGCATCATCAGAGTAATTATCAGGTATACTGTAGGAAGGCCCTAAGTAA
TAAAGATCTGTATTAAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCATAATCTAGCCCAAGTTGACACATGAAATTAA
TCATCACAGCATCAGTTCATTCTAAAACATTTATTGAAATTTTAACTGTGTATTTGTAGG
CACTTTGCCACATAGAGTCTAATATAACACATAGAAATGCTTTAAAATACTAGAACAGTA
TTTGTTCAAATGAGAACATAGTGTTTTTCTTACTCTTTTATTTTTACTTAGTGAGGAACT
TCAAGATGCACTTGGTGTGACGGACAAGAGTCTGCCACCTTTTATATATCGAATGCGCCA
GCTAGGATACCCACCAGGTTGGCTCAAAGAAGCTGAACTGGAGAATTCAGGGCTTGCACT
CTATGATGGAAAAGGTACAGTATGTATAGTATGTTAGGTTAGATAGGTCCACTTTTTTTT
TTTTTTTTAATTAAAGAATCATTCAAAATGGGATAGGAATGGCTAGCTGGCTTAATGTGT
GCTGAGTTGGCTAAAAAAAAATATCAAGGGGAGGGGGTGTGGCTCAGTGGTTGAGTGTCT
ACTTCTCATATATGAGGTCCCAGGTTCAAGCCCCACTACCTCCTAAAAATATATATATCA
AGGTGGTGTTTTCTTTCTTTACAAGGAAATAAATAAAACTTATAATTATTAGATGGTTTT
CTGGCTCAGTGACTTACTTAGGCCAAGGTATAGACTCCAGCTATTCCTCATTAGCATTTG
CCTTTCTCAGTAGCAGTAACAGATATATGTGTTGGTGCCAGGAGTCCTATAAAATTTAGG
CTACATAAACCTTTTTTTTTTTTTAAAGATTTATTTTTTATTTATTTTTCTCCTCTTCCC
GCCCCCCAGTTGTCTGCTCTGTGTGTCCATTTGCTATGTGTTCTTCTGTGACCGCTTCTA
TCCTTATCAGCGGCACTAGGAATCTATGTTCCTTTTTGTATCATCATCTTGTTGTTCAGC
TCTCCATGCATGCAGTGCCATTCTTGGGCAGGCTGCACTTTCTTTTGTGCTGGACGGCTC
TCCTTATGGGGCTCACTCCTTGCGTGTGGGGCTTCCCTACGTGGGGGACACCCCTGCGTG
GCAGGGCACTCCTTGTGCGCATCAGCACTGCACACAGGCCAGCTCCACATGGGTCAAGGA
GGCCTGGGGTTTGAACCATGTACCTCCCATGTGGTAGGCAGATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTGTGGAGCAAGATGGCTGCTGATATCTGCTAGGGTT
CACGTACTGGGGGGTTCTTCTCTTCCCAGGGCTCATTTCTCCCTAGGCTCAGCTCCTCTT
TTGTCTCCACAAGGTCAGCTGTAGATTGTGAGGCTCTGTAGGTTTTGCCTCTCTCCACAA
AGCCAGCTGTAGACTATCAGGCAACCAGCTCTGTCTCTCTCCCTGGGGTTTGATTCTCTC
CAGGCTCAGTTGCTCTGCTCTTCTGTATGCTTACTTCCCAGGCTCCAGCTCAGAACTCCA
GCATTGAAACTCCCAACATTAAACTTGCAACTAACTCCTCTGCTCTGCCCTGTAGTGGGT
TTTTTTTTTTATTTTTTTTAATTTTCCTCCTCCTTGCGGCTTGCTTGCTGTCTGCTCTCT
GTCCATTTGCTGTTCATTCTTCTGTATGTCTGTATTTATTTTTATTTATTCCCCCTGCCC
TTGCAGCTTGCTTGTTGTCTGCTCTCTTTGTCCATTAGCTGGACTCTCTTTTGTGTTTTC
ACTTGTCCCCTTTTTGTTGCGTCACCTTGCTGAGTTGGCTCTCTGCAGCGCTTGTGGGCT
GGGCAGCACTCCGTGGCCTGCCTTCACAAGGAGGCCCCGGGATGCGAACCCAGGACCTCC
CATATGGTAGACGGGAGCCCAACTGATTGAGCCACAGCTGCTTCCCTCTGCCCTGTAGTT
TTATCTGTTAGTCCCTGTCTCCTTGGTGGGCAGGGACTCAACATCCTACTGACATGGCCC
AATCAAAACCCTAATCATAATTTAATCATGCCCAGGTACAGACCAGTTTACAAATATAAT
CCGATGTCTATTTTTGGAATTCATAAGCTATATCAAGCTGTTATAGGTTCATTCTTTTGT
GTCATAAAGTTCTATTCCATTGATATATATATACAGTCTTTTAAATCCTATTCTCTACCC
CACGAGCCCCTTTCTTTTTTTTTAACAAAACTGCATATTTTGTCCAGTTTTCAAGATGTT
GCCATTGCATCCCCATGGTGCTATTTAACATGTTCTTCTTTCCCTTTATTTCCTATTGTG
ATGTTTTCAGTCATTGGGAACCATTGTCTATATTCATTAAATAATGGTGAATTGCAAAAT
GATTATAGTCCCATTCTTTCTTTACTTCTTGATTTTATTGGGTAGAATATTTATATAAAG
AGAAACTTCTCTTCATAGACATTATAGGACACCCAGAATAAATATTTGATTTACTTAGTA
GTTTTCAAAATTATAAAATGCTTCCCCATTCTCCTTCAGAGATTACTCTTATCTGTAAAA
TGGTTTTAATCTGGGGGAGAAGGAAGGAAATATTATCTGGCATCTGGCACATAGTAGCAC
TATATAAATATTTATTAAATAAAATAGCATTTGGATAGCCATTAGGCAAATCATAAAGTC
ATAAATTGCTTGGAAAATAGACTTTTGAGTAACCCATAGAAGAAACAGTTTCCAGAATTT
TAAATATTTTTATCAGTAATTTTATCAGTAAATTGTTTAAAAATTTCAATCAAATAGTCC
AGAAAAATTGTAGTAAAAGTAATTCTCAGACTAATTCCATTGCCATGAATAAAAGTATTT
TCCAGGTGTACTTTTGACCTAGGGAAGGATGTATATATATTGGCATCCAGCAATATTAAC
CCATTTAATGGTCTGTGATAGATGATGCTGATGGGGAAACAGAAGCTGGAGAAGTACAAC
AGAATAGAAATGTCACTTACGATCTCTCGAAATTGGTAAACTATCCAGGTTTTAATATAT
CTACTCCTAGAGGAATTCCAGATGTAAGTATAATTTTTTCTTTCTTGAATATGAAATTGT
TATGTTAAAGATTATGGACGATATTAGCTTATGTGGCAGTTACTGTTACATAAAGAAGTA
CATTTTTTGCTTAGGTCTTTAATTTCCTTTATGTTGACTAGATTCTTAAGTGAAATCTTG
TATTCACCAGAAAAAGTTCTGATTTTATGGCCCAAGGAGCTAAAATCAAATGGTTAGATT
TAACTTCCTAATTTTGTTATATTACCTTTTCAGAGTTTTAGAAAAATGTATAAACTTTTA
AATGTGTATTTCTAAAACATAAGTAGGAATAGCTAATGTTTCAAAATTTGGGATGAGTGT
AAGATGTTAACAGTAGGGGAAATCAGGTGTGGGGTATACGGGAGCTCTCTAATATTTTTG
CTACTTTACATTTAAAACCTAGATTCTAAAATAAGATTTTTTTTTAATCTAGGAAGGTTT
TGAGGCAATATTAGAAAATTTTACAGAATTACTTGGGAAATAAATTTCTGCCTTTGATAA
AACCAAATAAATAATAATAACTCTTTTTCTCTTGTCTCTCCTCTTTATTAAACCCTCAAA
GTATTATTTCCCATTCTATAGAAGAATAACTTATTCTTTTCTGACATTGATCTTGTGTCT
TGAGATTTAACAATTATTGTTTTTGTTTTGTAAATGAAAATTTCATTTTTTTTTTTCTTT
TAAAATCACTTTATTAAAAATACATTTTTGGTGTTAGGAACTGGGAGGTAGGAAGAGACA
TAAGATTTGAACTTCAAGTATGGTGAAGAAAGGAAGCAATAAAAGCATACAAGTTTTTAA
GCTTAAGCCATTAAGGGTTCTCCTGCACAATGCAAACTTTCATTGCTTCTCTAAGTGGAT
CCAACTACCAGCTACCCCTTGGGATTCTCATTTAAAATGTACATTCTTGAGTTTCCTCCT
TACTCTCAAACTCTAGAATCTGTATTTTAACAAGAACATAAAGTGATTCTTATTGAGAGC
TACTGTTGAAAGTGCTATTGGAGAAGAGAGAAATGAGCAGTGTTGAACCTTTAAAAGTTA
GTACTGAATTTGGAAACAGAAAGAACAGAAGATGTCTATAATCTGCATGAGTAAATGGGT
AAGGAGAAATGAGCACTCCTTAGCCTTGCTGCTATGCAACCTATGCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGCCACCTATGAAACAGACC
TGTAATTTGAGACCTCTACTTTATCTCCTTTGAGCAAAATCTGAAAGCATGAAAATATAC
AAATATGTACTTGATTTTTTTCTTCTCTTTCCTTCATTAGGAATGGAGAATGTTTGGTTC
CATACCAATGCAGGCATGTCAACAGAGGGATGTATTTGCCAGTTACCTTACTTCTAACTT
CCAAGCGGTAAATAGATTTTTAGGGTGTGGTTTATAAAAATGTTTTACATACATCTGAGA
TTTTGTAACTCATTAGTATTTTATTGCCTTTTTTTGTTCTATATATAAAGGAGTCTTTCT
TATCTGAATGAATTCAAAGGAAAAGGTAGCTAAATTCGTGTTACCTAGACTTAGCTCCAG
AGTGGTTTTCTGTACCATATTTAAGTGAAGGGATAGAGTTTAATTCTTTGTCTTCCCTAT
CTAATTTGTGTCTGATTTGGTTACTGTGTTAGCCAGGTGTGAGGTCTGGCAGTAAGAGGT
CTTCATCTCAGTCAAGCCCTTCGAGTCCAAAGAAGCAGAAGAAGGAGGGCAGTGCAGCAG
CATCACCTGCGGACATGGAGCTCGACTCAGGTAGGCTTTATCCTTGCGGTATTGATTTTG
CTAAGAGGGTTAGATGAATTTGCATGTTCCTGAGTTCTATTAGCACATGATATGGGAACA
CTGACCAAATAGTAAATCTTCTATTTATTTTTTGAAGATCAGAGCACTGCCATTCTTACT
GATAAAAGCTGAGTTGGAAGGACCTAGGTTGGTATAAGAACCAAATGGACCAGCTGACTG
AATTTCTGAATTTGGCAGACCTGCCTACTCAATCCCAGCCCTCCTAGATTAGGACTGGCC
CTCTCTGATGGGGCCTGCACTCTGGCAAAGCAGTGGAAAGTGTGTGCCCTTTCCACAGCT
TGGTCCCAGGAGGAAGAAAGGCAGAACTGAGTCAAGCTTTCCCAGTTATTCCTCCAATCG
TCTTAATCCTCCTCTACAGGAGGAGGAGTTTTTCCTCCTCTCCAAGAAAAAGACCATGAG
AAAAAGCTGCCCTCTTGGAAATCCCAAGTGCAATAGAGGCCTGTCCTTAGCTTTTTGTTC
TCTTATCTTTATGGTCAGCTTTGATTGTGATGGTCTTTTTCAGAACATCAGCAGTTATTC
AGGACAGTCCTGTTCCCACCTTTTTGAGTGTGCCTACCCCCCAGCACCCATCACTGCTTC
TTTGGGTTTCCCTTTGGAACTACTGATTAGCAGTTTAGAAATTTCCCACAGGAGACTCAG
AAATGGATCTTTGGGTTAATAAATTCCAAGGCGTCCAAATCTGAAGATTAAATTTCACCA
CTTATACTATTTTCCATCCTAAATTATGCCCAGCTGCTTCGGTCCTCCATAGCATGACCA
AGGTTTCAAGTTGAGATTAAACAGCAATGTTAAAATGTATAAAGATAGACTAATAATAAA
ATAGCAGTGATGTAAGTTGCCTCAAATTGCGATGTGAATCCCCTTCCCATATTCAAATAC
ACAGGAAGAATTTGAAGGTCAAGGATTAAATCCCTTTAAAGTCCAAAATAATAAAAATTA
TTTTGCACAAATGATTTCATTGTCCAAAATTTAAGTCCCCAGTGGTCTTCCCAAATTTTT
TTCTCTGCTTAGTCTCAGCCACAGGGGTTCTTTTTTTTTTTTTTTCCCCACAGGGGTTCT
TGATGCCTGAGTAGAGTTCACAGCCTGGGCTTTTAGCACCTGCGGATTAACTTCAGTGTC
CATCCTAACTTTTTTTTTCCCCTCATATTGCTGTGGTTTTGTGTGGTTCCCTCCCCTGCA
CCCCCAAAATGGTTTCCTTGTCTGTCAGCTTGCTGTGTCTGCTCATCTTCTTTAGGAGGC
ACCGGGAACTGAACCTAGGACCTCCCATGTGGAAGTCAGGCACCCAACTGCTTGCTTGAG
TCATATCCACTTTCCTATATAGTCTAACTTTTAACAAGGCTAAAGAGACAATAGGAAGCA
TAATTATAACAACTCTTGCCACATGTCCATGAAAATTTGAAACAAACAAAAAGCAGGCAA
GACCCAAAAACTCTGAAGCAGTTGTCCCAGACGAAATTTTGTTCCCAGAGCCAGGCACGT
CTTTTTTTTTTTAAACAAGTAAATTTTATTGAAACATATTAATAAAGCATACAATTCATC
CAAATTGTACAATCAGTGGTATTTGGTATAATTACATAGTTGTGTATTCATCTCTTCAGT
CATTATTAGAACATTTCATTATTCCAGTAATAATAAAAACAAAAAACAGAAACAATTCAT
CACTTCTCAATCTGTTTCACCTGCCATACATAGCTGCTATTCTGTTCTCCTCTTTCTAAA
TTATTTGTGTTTATGTTTTGTAAGAACAGTCTTATATGTGCAGTATTACCCATATTCATA
TTTCACATGAAGTTTCACTATGCTACAGTCCCATGTTACATTTTTTACCTTTCCTTCTAG
TTATATACATGACCTTAGACTTTCCCTTTCAACCACTGTCATACCCATAAAGTAGGACTG
CTAGTTGCAGACCCTATGATTTTCTTTCACCATTTTTATTCATTTCCAAAGATTTACAAC
CCTTTGTCAATTCTACACAGGTTAACCCTCAGTTTTCTATTCTCTAACCTCATTCTGTGT
TCTATTGACCTGTATTCTAGCTTGCACAATATATTTAGTTCATAACAGTGCAATCATGAA
TAACACCATTGAGAACATTGGTGTGCAAATGTCTGTTCTTCTGGTTATATACCTAGTAGT
GGTATATACCAGGTCACATGGCAAGTTTCTATTCATTTTCCTTAGGAACTGCCAAGTAGT
CGTCCACAGTGGCTGTACCTTTCTACATTTCCACCAACAGTGAATAAGTGTTCCTATCTC
TCCACATCTTCTCCAACACTTTTCTGTCTTTTTAATAGTGGCCATTCTAATAGTATGAAA
TGTTATCTCATTGTAGCTTTGATTTGCATTTCCCTAATCACTAGTGATGTTGAACATTTT
TTCATGTTTTTTTTTTTCACCATTTGTATTTATTCTTTGGACAAATGTCTACTCAAGTCT
TTTGCACATTTTTTAAATTGAGTTGTTTACCTTCTTATTGTGGGATTATATTATCTCTTT
TTTTTTGAAGATTTATTTATTTTTCTCCCCTTCCTCCCCTTTCCTCCCATTGTCTGCTCT
CTGTGTCCATTCGTTGTGTGTTCTTCTGTGACCGCTTCTATCCTTAGCAGCAGCACCAGG
AATCCATGTTTCTTTTTGTTGTGTCATCTTTGCTGTGTCAGCTCTCCATGTGTACAGCGC
CATTCTTGGACAGGCTGCACTTTCTTTCACGTGGGGGAGCTCTCCTTACAGGGCACACTC
CTTGTGCATGGAGCTCCCCTACATGGGGGACACTCCTGTGTGGCACGGCACTCCTTGTGT
GTGTCAGCACTGCACATGGGCCAGCTCCACACGGGTCAAGGAGGCCTGGGGTTTTAACCG
CGAACCTCCCATGTGGTAAGCGAACGCCCGATCCATTGGGCTGCCTTTTTTCACCCTCTT
GACGAAGTCCTCTGAGGTGCAAAAGTGTTTCATTTTGAGGAGGTCCCATTTATCTAGTTT
TTCTTTTGTTGCCTATGCTTTCTTTTTTTTTATCCGCCCCCCCGCCCTTGCAGCTTGCTT
GCTCTTTGCTCTCTGTGTCCATTGGCTGTGCACTCTTCTGTGTTTTTACTTGTCTCCCTT
TTTGTTGCATCACCTGGTTGAGTCGGCTCTCCGTGGCACTTGTGGGCCGGCAGCACTCTG
GCGCTTGTGGGCCAGGTGGCACTCTGTGGTACCCAGGCCAGCAGCTCTCTGCAGCATGCA
GGCGAGCCTGTCTTCACAAGGAGGCCCTGGGACACGAACCCAGGGCTTCCCATATGGTAG
ACAGGAACCCAACTGATTGAGCCACAGCCACTTATCCCGTACTTTCTTTTTACAGATTTA
TTTTATTTATTTCTCTTCCCCCATCCCCCTTTTTATCTGCTCTCTGTGTCCGATAGCTGT
ATGTTCTCCTCTGCCTGCTTGTATTCTCATTAAGCAGCTCTGGGAACTGATCCTGGGACT
TTCCAGAGTGGGAGAGAGGCAATTACTCTCTTGCGCTACCTCAACTCTCTGTTCTGCTAT
GTCTTCTTATTTCCTCGTCTCTGTGTCTCTTGTTGTGTTATCTTGCTGCGCCAACTCTCA
GTGTTAGCCGGCACTCCTACGCAGGGTGGTTTTCCTGCACTGGGTGGCATTCCCACTCGG
GGGCACTCCTGCTCAGGGTGGCATTCCAGCATGGGTCGGTACTCTGTGTGAGCCAGCTTA
CCCTCACCAGGAGGCTCTGGGCATCGAACCCTGGACCTCCCATATGGTAGACAGGAGCCC
AATTGGTTGAGCCACATCCATTTCCCTGCCCTTGCTTTTGGTGAAAGATTCAAGAAACCT
ACCACCTACTACTAGATCTTGAACATGTCTCCCTATATTTTCTTCTAGTAGTTTTATGGT
CCTGGCTTTTATATTAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGGTGCCAGTCGAATCTGAGGTACCAGACACTTGTACAAAGACGCCTGAGGTTGAA
CATTCCTCAACAAGTCCAGATTCTGAGGGCACATTGCTTTGTCAGAATGAAAAGAAAGAG
TCTGCCGAGGGAGCCTGTAAAGGTGCTTCTCCTGATAATGACATGGTATCAAACTGTGAC
ATTAGTAATGGAGGCAGCCAGGGGCTCCTTCAGATGAGCAGCAGTCCTTCAACAGCCACC
AAAATTCATAGTCCTATACCTGACATGAGCAAGTTTGCAACAGGAATAACTCCATTTGAA
TTTGAGAATATGGCAGAATCTACTGGAATGTATCTCAGGATAAGAAATTTGTTAAAGAAC
TCACCCCGAAATCAGCAAAAAAACAAAAAGGCCTCTGAATAACTGCTTGACAGAGCACCA
AGAACTATTTAATTATCAATAACTTCTTGTTCTGTTAATTAGTAGTAAGTGGACAGATAA
GGTTGTTTTCCTCTTTGTTCCTCCCATGTTTAAAAATCTATCCAAGGCTTAATTGTGGTC
TAAAGTCAAGCCTATTTTTTAAAAAATGGAAAAACCGAGTACACGGGTTTACTATATTTT
ATTCTCAATGACACAAACTTGGGGGGGCGGGAATGTAAGAATGAACTGGTTTAGAGATAG
TTTGTTAAGGTTTAAACTATTTTTGGATTGTGAGTTTCTGTCAGAGTGATGGTTTTTATC
TGTCTTTTGTACATTGTTTTCCCTTTCTACATTTTGCTAATTATCCTGTATATAAGTTTA
ATATATCACTTTTTTAAAGAAAAAATTGTAACCATTTTAAATTCATATTTCAACTCTGAC
AACCAAATGAGAAAAATCAGGGATGCGCAGCTTTATCCCATTTGGGATATTTTTGTAAGT
GATTTACATGCATCAATTTTAATAACACTTTTACTTTTTTGTAACATCATTCTTCATATA
AGCTTGCTATAGAGGTATGTTCATCTTTGTGTACAGAGGTTTAATAAATTAGTTTTCATA
CTCATAATCTAAGACTTTGAATAGAAAGAATGATTCATGGTTAAATTAGTGTATTAAACC
TTAAAGTTTAGAGGTAAATTGTGTGGTTGCAAAAATCAGTGCAGTAGCAACAGAAATATA
AGAACATGCAAGTTTGGTTTTTTTTTCAGTGGATTTCAGCCTCAGATATAAAAACAATTT
TTCAAGTAATCATTTGGGAGAAAAATGAATGGAGGCTGTTAGCCTTTGTACAATCTTATT
TTCTAGATTTGAACTCTAAAATAATAGTTAAAAAGTAGACATCAATAAATTGCTTTTCAT
TGTCAGATATATAAAATAGAACAGCAACTATGGTTTCCATCTTTATGGGGATTATCATTA
CACCTTTATACTTAGTCAAATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1222, 2607..2641, 4821..4895, 6454..6559, 7733..7750, 8530..8589, 11765..11868, 12072..12137, 12856..12916, 13363..13505, 14331..14473, 17061..17182, 18640..18726, 18992..19109, 23159..23543, 23648..24041
1001..1222, 2607..2641, 4821..4895, 6454..6559, 7733..7750, 8530..8589, 11765..11868, 12072..12137, 12856..12916, 13363..13505, 14331..14473, 17061..17182, 18640..18726, 18992..19109, 23159..23543, 23648..24038
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved