Dasypus_novemcinctus Locus C15orf42
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus C15orf42
Dasypus_novemcinctus
C15orf42
GeneScaffold_3802
SNORA28
45286..45412
67198
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCAGAGACAATCACAGACAACTTTCCGGC
ACTCGAGTATTATCTCAAAAGTTCAACAAAATGCGCATACATAGATAAATTGAGGGCTCT
AACTGCCCTGCTGTTTTGCGGTCTACTTTTTCCATCTGACAATGTTAAAAAAAATTATTT
TTAAAACTGCACGATATTCTCCTTGGGGGTGTACCAAGCCTTATTTAAGCATTGCAATTT
AAGTTGTTTCCAATTTTACTCAAATTAAACTCTATGATGTACATACGTCCTTAATCTGGA
TTTCTGATTACCTTCTTCAGATAAACTCGTAAATTACTGGAGGAAAGGAAGTGAACTTTA
AATTTTTAATCCTTCATTTTAAATTACAGAAAATTAAACACTTCATCATCCGATTCTACT
CCTTCAACCAATTCGATCAATCCCCCAAATCCCTTTCCGTGGTAAATTTCCAAGCTCCTC
GCAAATACCTCCCCCAGAGCCCACCCCCACGCCTGCGCACTATTGCCCGAACGCGCTCCT
CCGACCCCATTCCCAAAAATACTTTGGACACGCCCCCGGAGCACCACCCCTCTTTAAAGT
TTAAAACGAAGGCTCAGGCCAATGAACGTTAAGTCGTTCCCGGAACACAGTGCCCCGCCC
GCTGCCAAGCTCTCCACCAATCAAGCTGAGGCTTTCCTCCCCGCCTTTCCAATCACCGTC
AAGAATGGAAGTTGTTCGCGTAGCCCACGTAAGGCAGACGACCAATAGGAGTCGACCTTG
GGAGCTCGCTCCGCCAATGGCAGCGGCTCTTGGAGAGCGCGGGAGCCTTTCGACCGCGCC
AGTGAATGAAAGGAGAGAATGGCGCTGGTTGCCTGAAGCGACAGCTCTGGGGCGAGCCGC
GAGGGCCCCGACCGGAGCCCGGGCGCGGCGGCGCGGCCGGCATGGCCTGCTGTCACAACG
TGATGCTGCTGCTGGACACGGCGGGCGGCGCCGCTCGCCACAGCTCGGTGCGGCGGGCCG
CCCTGCGCCTCCTCACCTACCTGAGCTGCAGGTTCGGCCTGGCCCGGGTCCACTGGGCCT
TCAGGTTCTTCGACTCGCAGGGGGCGCGGAGCCGGCCCTCCCGCGTGCCTGGCTTCCGCG
AGCTGGGGGCGCGCTCCTGGGAGGACTTTGAGGAGGAGCTGGAGGCTAGGCTCGGGGGGC
GCGCCGCTCGGCGCCCGCCTGCTCGGCTCGGCGTCCAGGGTCACCCACACGCACAGCGAT
CTGATGGAGACGCTGCTGGACTACCAGTGGGACCGGCCCGAGATCGCGTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTAGTAATTTGATGTAGGAGCCGACGTC
CAGACTCTGTGGTCGTGCTGCCTGGCTTCCCTTCTTTCCCGTACCAGCGCCCAGGGCCAT
CCACACGCACAGCTTCCGGGAGGGAGACGTCTGCTAGAACTACCAGTGGCACCGGCCCAA
AGATCGCGTCGCCCACGAAGCCGTTCCTGCGGAGCCGCGGGCGACGGCTGCTGGACATGG
AGAGCGAGGCGGCGGAGGCGGAGGCGGCGCTCGACCATATTGGTGCACGCCGTCTTCATG
CTGGCGCCCTGTCCGCACTCGCAGCGGGAGCTTCTGCGCTTCGTGGCGGGGGGCGAGGCC
TCCCCGCAGCCGCCGCCGCCCACCTTGAAGCAGGTCCTGATGAAGCTGTTGCCCAATAGA
GTCCAGGAAGCCATATGAGCCCGGAACATCACCTTGTTATGGGTGGACACCTCCGAGTGG
TCGGAGGTAAGGCACCTCGGGGTCGGGGCGCGGTGTCCTCCTGAATGAACAGGACGTGGA
GTCGGTGGCCTGGCAACCGGTCACCAGAGCGGGACTCGCACGACCAGCGGGCGCCCCTGC
AGAAGCAGGGCTCCGGGGTCACGAGCAAAGAAGGACAGACTTCGAAACACAAGGGGGGCG
GGGGTGGGGAGGGAGTGACCGGTATCGACGACCTCAAAGTTTTTAGGTCCTTCCCCATTT
GGGGCCTCGCCTTCCCGTTTCCCTACCCTTGCCCTGTGTTCCACCTTTGGCAGCCCACCT
GGACGGCTTGCTTTGTCTGGTTCTGCCGGGCTAAAGCTCACCATCCTTTAAGGCCCTGCC
CAAGTGACAACTTTTGGGGGCACTTGCATTGGCTCCATTGTGTTAGGTCGTGTGCCCCTC
TCTCCCCTTCCCTCTAGTCCAGAAACACCCTCAAAGGCAAGCACCAGTTCTTACACCTCC
TAAGTGGTCAGGAAATATTTGTTGAACGAAAGAGTATGTTCTTACAGACTTAAAATCTTC
AGTTGGGCATTTGGATTCCTGTTGAGGCAGTGGGGTCCCCCGCCCCTGGTCAGGGCTATG
ATAAAGTCCATAGCCTTACCGCCACCGTTTTCCTGATTTCACTTCGTGTAGTCAACAAAT
ACCCCTTGGGAAATGGCTGCATTGAATACCTGCTGCCCTCTTGGCTGCTGGGCATATGCT
GGTGTAGGAAGTCCCTTCTTTGTGGAATTTTCTTTCCAGCGGGGAAGATAAATTAAACAG
AAGCAAGTAAGTGACTTCAGATGATGCTCTGAAGCAAAGCTGGGTGAGGGGACGAAGAAT
GGGGAGGGCAGGTAGAAGGTGGTGGCTGCTGTGTAGGGAGGTAGTCAAGGATGGCCTTTC
TGAGCAGAGGGGGTTGAAGAATGAGGAAAGTGAAGACTGGGAGGAGAGCATTCCAGGCAA
CGTGAAAAGCAGATGTAAAGCTGGAAACCAGCCGAGTTTGTTTCAGAAACAATAAAGCAG
AGTACTGAGATTTAGAGTGGGCAAGGGTGAGTGCGAGGTGAAAGGAAGTACGTCAGAAAG
TAGGAGAGGCCCAAGGTAGTAAGTTCAAATTTTATTCTAATAGTGTTGGGAAGGCTTTGG
AGAGTTTTTGTTTTTACAATCAGTGGTATTTGCTACAATTACATAGTTGTGCATTTATCA
TTTCTGTCATTATTAGAGCATTCTCATTAGGTCAATAATGATAAACAAAAAACCCCAAAC
AAGAAAATTCCTCACCTCAATCTCTCTGTGCTTCCCCCAGTGTACATAGCTGGTGTTTCT
GACTATTCTATCCAAAGTGTATAACCAATGGCTTCTAGTATAATCACAATGTTGTACATT
GATCATCTCAAATTTTACAACAATTTCATTACTCTAAATAGAAAGACTCCGAACCCCTTA
GCATCCTTTCCTTACACCTACATAACCACTAATCTCCTTTCATCTTTATAAATTGATTTA
TATTTACATTTTATGTAAATGGAATCATACAATATGTAGTACTCTGTATCTGGTCTCCTT
CACATAGTATAATGTGTTTTTTGTTGTTTGTCTTTTTTTGGTCTGATATTAACATTGTAT
ACTAACTTACATTTGTTAAGCTTCAAGGAAAAATGGTCTTATATATGCAATTCTACCCAT
ATTCTTATTTCACATAATATATTTATATTGACTTTGGAGAGTTTTGACCAATTGAAAGAT
GAGATTCCACTTTTTGGAAATAAATGTCACTGAAACAGGAGTAGGCTAAATTGCAGGATT
ACAGATGGAAAATGAGTAGGCTGTTTAAATAATTTTATAGTGTGCTACAACTTCCAAAGT
GCTTTTGCATACTAAGACCCAAAAATGCATGGAAAGTGCAAAAAAAGGGAGCAGTGGTTT
GTCAAAGAAGAAAAGGACCAAAAGAGGGTTTTAAGGGTATGGTAAACACTTGATGAGTAA
ACAAGATTCCAGAAATTAAAATTTCCTAAGGCCGTAAATCAAGTATATAGCACTTAAGCG
TTCAATCTGGTATAATTGATGTCAAATTATATCAAAGACTTTATTCTGTGATTATAACAA
ATTCTGGAAGACCGAGCTTGGAGATTCTTTTTCTCTCTCTTTCCACCTCCCTCCCTTCCT
GTCTCTTCCAGATAGCATTAAAATAATTAGGTTGACTGGATCTTTCTAAAGGTCCCTTTC
AGTTCTCACAGTCTACCATCTATATGATTGAATTTTTTTTGGCCATGTATGTATATTACT
TTTTAATCAAAAGTTATTTCCTTTTCAACTCATTAAAGTTTTACCTTTCATTTGATAAGC
AGTTTTGTGGGTTTTGTTTTTTTTTTTTCTTTTTTCCTGACTGGTTCTCTAGCTGAAACA
ATTTCAACAATCAAATGTTCTCTTGTTTTTTGGCTGAAGATCCTAATCAGGGTTGATTAA
TCTATTACAGCATTTTCCAAATTTGTACGAATAATGAAGGTTTCACAATACACTATCTAT
CCTTAGTACATGTGACATTTCTGATGTACTCTGATCTTTTCTACTTGGTTTTGTGTTGTT
ATTTCTGTAGTTTACATTATAGTTTACACTTTCCCTTATACAATTTTTTTAGGTTTTGAC
AAAATGTATAATGGCTTGTATCTGTTATTGCAATATCATATAGAACAATTCCAATGAACT
GGAGAGTAGGTGTTGGAACTCTGCTGAGATTCAGGTCTCATGCAGCAGCCGAACAGACCA
AAGATTTAAGTCTCTGGGACATATATTTAGCAAGTATAGTGCTAATTATAGGTTCAAATA
AAAGAGGCAGAAGAGCCATGTGTAGGGAAATTATAAATGAGTCCAACTCTGTTATATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCAGATGGGACAGGAAAGACCTGTCAGGAGAGGCGGGAG
GCACCCCAGGGAGCCCCGTGGGCGCTCGACCAGGGACAGAGGGGCCAGGGGTGGTGGTGG
TGGTATTTTATAGTTGCAATCAGAAAGATGGACGGTGGGTGAGAGCCAGGCCAGAGACCC
GGCAGGGCCGCACGCATGCCTTGAGAGGTGCTCTGCAGTTACAGACTTTTCATGCCAGAA
AGGACCCGAGAGGCAGCTTAGGTAAACCGAGGCCTGCCGCGGCGGCCCCACTTGCGGGTG
GCAGAGCCAGGCTGGGGTCAAGCACCTAGCTCAGGGGACCCCCGTCGGGCGCCCGCCTGG
GTCTGTGGACTTTCCTTCAGGGAACAAGATCAAACTGAACACCCGGCTCCGGCCGCGCCC
ACAGCCTGCGGTGGTCCCGGGAGGCGCCTCTGGGCTTTTCCAGTGGGAGGGCTGGTCCCC
GGGTGCCCGAGGCCCCAGGAAGGGGCGGCCAAAAGCCAGCGGCAGACACACAGCTCAGGC
CGGGAACGGGGCAGCTGCCCCCGGCTCCCAGGTGTGGGCGGGCTGGAGTCCTGGCCGGGT
CAGCGGCTCGGCCGTGCCCTCGCCCTCCGTCCACAGCAGCCCCCTGTGCTGCGGGGGACA
CCCTGAGCAGCTGCTCTTTCCCGGGGTCCGGATCACCCCAGGGGGCCCCGCCTGGGAGCC
GCCTTCGCTCCGCCTGGGCCGGAGGCTCCCGAGGGCCCCCGTGCTGCCCACACCCAGCCT
TGGGGGGTCCCGCGGATGAATGAGGTGTCTTCCTCCCCTTCTCAAAACTTTGGGTCCAGG
GACCAGATGTCCGGGGCCTGGCACAGGCCAGCCTGGGGCTTCAGCTCACCTCATCTCCAG
GAGCCTCGGCCGCCCTCGCCTCTCTGGCTCTCTCCACTCTCTGCGTCTTTTTTTTTTTAG
ATTTTTTTTTATCTTATTTCTCCTCCCCGCCCTCCACCCGATTTGTCTGTTCTCTGTTTC
TATTGCTGCATCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCGGCACGGGAAGTGTGT
GCAGCGCCATTCCTGGGCAGGCTGCACTTTCTTTCACGCTGGGCGGCTCTCCTTATGGGC
GCACTCCTTGCGCGTGGGGCTCTCCTACGCTGGGGACACCCCTGCGTGGCAGGGCACTCC
TTGTGCGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTT
GAACCGCAGACCTCCCATGTGGTAGACTGACGTCCTAACCACTGGGCCAAGTCCGTTACG
GGACAAGTATTATACAGATACTTACTTCAAAGTCATAATTACTGAGGAGTCCTGACATCA
GAATGTGCCTTTTTAATTCTGTTTGTATATAGCTTTTCCTATAAAATGAAATGAACTTGC
AGTGATCTCCTGCTGGCAGTAGAATAATGGTTGAAATATGAATAAGTGAAATTACTAGTA
CCTCTACTGACAACCTAATTTTTTCTTACTGTTAAATCTCTCTTTAGTAACTGTTTCTTA
AGTTACAATTTTAACATTCTTGATCTCTAACAGGAAAAGAGATGCAAGAAATATGGACAG
TTACCCTTGAGCCCTTGGCTATGCATCAGAGACATTTTCAGAAACCAGTCAGAATTTTTC
TAAAAGGTACGGCGACCCAGTGGGCTCTCCCACTGAGTTGCACTTTGGGCAGTGACAGCT
GGATGCTACAGAGTCCAGAGGATGATAAATCAACTCAGAAGCTGTTATTTCAGCAGCTCG
TAAACAGGCTGACTGCTGAAGAGTTACATCTGGTAGGTAGCCCCCATATGGTAAGTTATT
CTTATCTCTTAACACACCAGTAAAGTGAAATATGTAGGTTTACAAAATGCCAAGCATAAT
ATAGTCTCACTGAAACTCTTGTTTTTGCAGATAATGTTATCAATATTGTAGCATTGTGAA
AAAAGGCTTATTAGTGAAAAAATGGTTTATAAATTTACATGTACTCAATCCAATTATGTT
AAGTTACATTCGCATAGGAAAAGAGGCAGTGGGCCATATGGAATGCTTGTCTTAGGGTGG
TGAGGTAATGGGTGATTTCTTTGTTGTTTTTTAAATTTCTGTTAAATATTTATTACTTTC
GTACTAAATATATTTCACTTAAGAAAAAGCTGCTATGTTGTAAAATTAGCTATAATAGTT
GGCAAACTTGGTAATATCTTTTAGAGAGGAGCACGTATATACACAGATTTGATTTAAAGT
TCTTTTTTAAGCTACTAGTAAATTCCTTACCTAAGTTTATCTCTTACCTTTGTAATGTCA
GGAGGAGTCAATACACTGGATCCCATTGTGAAACATTCTAGAGAAAAATTGGATAGTCAT
CCTAACAGATGTTGTTCTAAGAGTCATGTACTATGTTGAAAAGAGCATTGGGTTGGGAGT
CAGGAGATCTGGGTTAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTGGAGA
GTAGGTGTTGGAACTCTGCTGAGATTCAGGTCTCATGCAGCAGCCGAACAGACCAAAGAT
TTAAGTCTCTGGGACATATATTTAGCAAGTATAGTGCTAATTATAGGTTCAAATAAAAGA
GGCAGAAGAGCCATGTGTAGGGAAATTATAAATGAGTCCAACTCTGTTATATTGGAGAGT
ATATATTCCAAAGTAAGGCTCACTGGCAGGGTGGTGGTTATTTTTATTAACGTTTAATAG
TTTTGTTTGATAGCATTTCTTCTGACTTGAACATTTTATGATTGCTACCCAGGGATTTGC
ATCATTTCTGTTCTTGTCATTTTATATTATATTGCCTTTTATATTTCAGTGTATTCCTGT
ACCCTACTCACCCTTCCTCCTCCCATCTCCCAACTTTAAGGTCTTGGAAGACAGGATCTA
GAAGTACTATTTTCACTAAATGGATGCTTCCTGGGAGGCATATTATGTAGTAGTTATATT
CTTGGGCTGTACTGTAACTGGATGTTGGCCATTATCTGTGTTAGTTCAACAAATAGGCTA
ATTATGATGAACTTAGGCTCTTTATAATTTTTCTTTTAGCTTTGGGACTCCCCAGATCAC
CTTGGGTACTGGACAATATGTGAGCTGCTTCACTGTGTGGGAGGTACTATCTTGCCATCT
GAAACTTTCAGCCAGAGTTTTACTAAAGCTGTGGAAACACTGCCTGGTGGTGGCAGAAAG
CTATCAAGTGAACCTCACCTTTCCCCATGGATTTCAACTTTGCCAACTGATTCTACGTTA
AACTGTCTGTTCTACAATTCTCGTGAATATGAAGCATCATTTTCCACAGACAGATGGAAC
ATTATCGCTCCCTGTTGAAGGTAAGCAGATAATTTGTGTGTATTTGTGTGTGTACATTCT
CAATTACATTCCTTTTTCTTCAAATTATGCCCCTGCTTTTAAATTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTATAAAATGAAATGAACTTGCAGTGATC
TCCTGCTGGCAGTAGAATAATGGTTGAAATATGAATAAGTGAAATTACTAGTACCTCTAC
TGACAACCTAATTTTTTCTTACTGTTAAATCTCTCTTTAGTAACTGTTTCTTAAGTTACA
ATTTTAACATTCTTGATCTCTAACAGGAAAAGAGATGCAAGAAATATGGACAGTTACCCT
TGAGCCCTTGGCTATGCATCAGAGACATTTTCAGAAACCAGTCAGAATTTTTCTAAAAGG
TACGGCGACCCAGTGGGCTCTCCCACTGAGTTGCACTTTGGGCAGTGACAGCTGGATGCT
ACAGAGTCCAGAGGATGATAAATCAACTCAGAAGCTGTTATTTCAGCAGCTCGTAAACAG
GCTGACTGCTGAAGAGTTACATCTGGTAGGTAGCCCCCATATGGTAAGTTATTCTTATCT
CTTAACACACCAGTAAAGTGAAATATGTAGGTTTACAAAATGCCAAGCATAATATAGTCT
CACTGAAACTCTTGTTTTTGCAGATAATGTTATCAATATTGTAGCATTGTGAAAAAAGGC
TTATTAGTGAAAAAATGGTTTATAAATTTACATGTACTCAATCCAATTATGTTAAGTTAC
ATTCGCATAGGAAAAGAGGCAGTGGGCCATATGGAATGCTTGTCTTAGGGTGGTGAGGTA
ATGGGTGATTTCTTTGTTGTTTTTTAAATTTCTGTTAAATATTTATTACTTTCGTACTAA
ATATATTTCACTTAAGAAAAAGCTGCTATGTTGTAAAATTAGCTATAATAGTTGGCAAAC
TTGGTAATATCTTTTAGAGAGGAGCACGTATATACACAGATTTGATTTAAAGTTCTTTTT
TAAGCTACTAGTAAATTCCTTACCTAAGTTTATCTCTTACCTTTGTAATGTCAGGAGGAG
TCAATACACTGGATCCCATTGTGAAACATTCTAGAGAAAAATTGGATAGTCATCCTAACA
GATGTTGTTCTAAGAGTCATGTACTATGATGAAAAGAGCATTGGGTTGGGAGTCAGGAGA
TCTGGGTTAGGGTCTCACTCTGATGCAAACTGTCTGCTCCTGGGAAAATCACTTAAGAGA
CAGTGTTGCTTCTGGGTAAGGGCATGGGTTTTGAAGTCAGACACACTTGGCATCTGCCCC
TTACTAACTGGGTGATCTTAACCAGATTACTCATCAGTCTCAGTTCTTCCTCTGTAAGAT
GGAGACAATAATTTTTTATATCAGAGTGGTTGTGAAGAGTCACTGAGTTATAAAAAGCAC
ATAATAAGTGCTTAGTAAGTACCTGAGGTATTTCTTATTTGTAAATTGAGGGATTAGGAC
CAAGTGATCAGTAAGTTCTCTTCTAGCTATAATAACTGTAAGGTTCATCGTCCACCATTT
TCCTTTTTTTAAATATTAATAGTCATTGGGAAAACCATCATTCTGTCTTGCAAAGCTACA
TTCTATTTTAGGCCTACTGATATTCTCAACTAATTAGATCTTCTTCTGTAGGTTGTCGAC
GTGGACCCTGGTGAAGGCTGGCCCCCCATCACTGGAGTTATTTCCCCCCTCTCTGCCAAT
GCTACAATTCTCACTGTGTTCCACACAGAAGAGGCTGAATTTCCAAGACATTTCATTCAA
AGTGTTACGACAGAGAGCCCCCAGGTTACAGCTTCCCTTTTCTCGGATGTTACAAATAGT
GCATTGAATCAGCTCCATAACTCATTTGAAGATCCTGCTACTTCTGGTAAGCTTCTGAAC
CAGTGACTAACAACATAGTTCAGGGCAGTGGTTTACAGTCTTTTTCTGGCATCAGAATTT
TTTTTTTCACCATGCAGTTAAGAACCCCAATACTTTGTAAAACATATAAAAGCAAGCTAT
AATTTTTCAGGCAGTTTAAATCATCATTATTTGTAGAAATCCCACAGCACTTGTGAGGAA
GTCTAAGGCTCTGTGAGACCAGTTGGAAATCAAAGGTATAAGGTAAAACCTGCTTTGTTT
TGTTTTATGTCTAATAAAGGCTGCATGTAAAACTGTAGTGATTCTACCTTGCAATTCATT
GCACCATTACTAATATGATACAACCCTTCTTATTTATGCTAGTAGATTTAAATAAATCAA
TTTTATATTTCTTCCATTCACTCATTTTTTTTTCAACAGTTTTACCAAGTGCCTGGTATA
TGCTGTGTCAGGTACTGTTCTACATGTAGGGAATACTCTTATGGAGCTTATCATCTAGTC
AGGAGGGACAAGACAATCTAGTAAGGAAATTATACAGTATATTAGAAATTACTTAGTATT
TATTGTCCTTGTCTGAATTTTTGGATGACAGGCATTTGTCCTAAAACATGATGTGAGGTA
TATTGTTTTTTAATAACACTCTGAAAATCTTACACTAAAAATAATAAACTTTCAGAAAAA
TAGAGTTGGGGCAGACTTCTCAAAACCTTTGCTAGTAACAAAAATGAATAGCAATCCTCT
AGTTCAACTCTAGTTCAGTTCAAAAGACATGTTAGTGCCATAATAGTAAACTTCATAAGT
AAATATATATTGTCTTCTGAAAAGAAAGGTGATGATGGCTCAATGGAAAGGTTGAGATTT
CTGTATTGTAGAGACAAGGGTGAAAGGCAATGATGGGAGAACTTTCTAAGAAGTCTCTCA
AGGAGGAGAATGTGCACACACAACTAAGTAGAAGAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTC
ACTGCATATCTAACTCTTACTATACCCGGAGTCCCTTCAGAGCAGGTGTTGTGTTTTATT
GATCTCTGTCTACTTGCATTGAAATAGGGCCTGGAACTTGATAGTCTCAATATGAATTTG
AATACATTTTAAGTATTTGGATTTTTTCTCCAGTACTTTCTGTATTTATCTCATTTGTCT
CCTAATAATGTATACTCTAGGTTTTAATTCCGTGTGTTTATTATTTGTATTTATGAACTA
AAGTCATTTTAAGGGATCCATTTCTAAGAATTAAACATTTTTATAACCTATTTAGAGGAA
CATTTCAGAAATAAGAGGGAATTTGTTGCAGGTAATAAGAGCAAAAAGACTTTAAATTGT
GTTTGTACATTTTTGGAGTAGCCTTTTTCCTGGGTAAACTGGTCTTGCTAGAGATGAGTG
AATGCTGCTCACAGTGCATGTCCTTTGGAGGGATGCAACCGTCCAGGCAAAGAGGCGGTG
CATAGAGTTCTTAGATTTGGTCCTGACGCCACTCGTCTCCCGTGTCTGTTCCTTTATACC
CAGTAGCTCCTGTTCCTGACTGGGCCCAGCAGGAGCTTGGCTGTGCGGTTCCCTGGAGGG
CAGCAGTGGTGGAGAGATGGTTTCCTTTCTCTAACCTCAGTGGTGCGAGTTCAAATTTAA
TGGAGTCATTCTGGTAAAACTCTTTTATTTCTCTGGGTGTTAATTATGTAAATCAACTCT
TAGTTATCTGCATGTGTTGTTTTGCTTTATTTTATTTTGTTTGTTTTTTCCTTTGTAGAC
CACATTCTCTTGAGTATAGTCCAATAATATTAAAAAAAATAGAACACTTCTATGGATGTC
AGAAAATATTTAGAACTAACAGCAATAAAAATAGTAAACTTGTAAAATGTAGCTAAATTT
ATACTTAAAGGAAAATTTATAGGCTTAAACGATTATTTCTGTGAAGAAGAAAAATTAAAA
ACCAATTAGCTAGGGCTCCAATACAAGAATTAGAAGAAGAAAGTAAACTTCCCAAATAGA
AAAGAAGGCAATAATAATAAAGATAAGAACAGAAATGAATTAAATAGAAAACAATGGAAC
AGGAAAGATCAACAGAAACAAAAGATTGTTCTTTGAAAGGCCAAATAAAATAGAGAACTC
TATATCAAGATTGAGCTATTTTAAGAAAGAAAAAAAGATAAACAATACTAGAAAAGAAGA
AGATACAGCAAAAATTCAAAGTATTATTGAGAGAAAAGATTAAGGCTTATTTTCTTCTTT
ATAGATATCCAGTTGTTCCAGCACTATTTAAAATCATCCTTTTCCCGTTGAATTACTCTG
CATCTTTGTAGAAAATAAACTGACCATTGATGTACCAGTCTTTTTCTTGACAGAATAGAG
TGCTCATTGTCTTGGGTACTGCATTATGCCAGTGCCACATTGTCTTAAGTTCTGTGGTTT
TGTATTAAGTCTTGGAATTAGGTAATGTAAGTCTTCTTTACTTTCTTCTTCTTTTTTTTT
TTTTAGAATTGCTTTGGCTATTCTAGGGATCCTTTTCATTTCCATATAAATTTATAGTCA
TTTAGTGGATTTCCACAAAAAAGTCTGCTGGGATTTTGTCTGGGAGTGCATTGAATCTAT
AGATACATTTGGGAAGAATTGACATCTTTACAATATTGAGTCTTATGATTCATGAACTTG
TGCATCTCTTCATTTATCAAGGTTTTTAAAATTCTCTGTGTTTTATAGTTTTCAGTATAC
ACATCTGGCACTTTTTTTTTTAATTTCTCAAACGTAGTAATTAAAAGTGAAACTTGAGTA
GCATTCCTTTCAGTGTTAGGATTGAGCCAAGATTGCCAGCTATTATTGCTTTTATAGAAT
GTATTAGAGATCCTACTTAATGCAGTGAGACAAAAAAAAAAATAGAGGTATGAGTGTTGA
AGTATTGGAAAAAAGTAAAATCCAAAAGATTCTACAGACAAGTGATTAAACTAAGAGACT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTATGGACAGTTAGAATGATTCTTACTTTGTAT
TACAACAGTGCCGCAATGGGTATCTTACAACATGTATCTAATTTTGTGCGTTTTAGAACT
GTTTCTATTATGGATTCCTACAAGTGGAATGGCAAATGTCACAGGGTTTCCTATGGAATT
TTTGTTCCTTTATTTTAAATGAATGCCTATTTAAATTTTCTTGTTGGATTTTATTCATCT
TTCAGGAGAACTCCCGCTCTACTCTTCAGCAGCCTCCACCCCCGGTAAAAGATACAGTAC
AAGGTATACTTTGTTTTCTCAGTGTTTTTCTCATTTGTTTGCTACAGTAACAAATTTACT
TTGATTTGCATGTATTTAAGCAACTGCATACAGTTACAAATTGGCTTTATATAATTGTTG
TTCAAAAAATTATGTCCAAAAAGCATCTACCATGCCCTAGGGGAAACAAGATACTCATGT
GATCTCAAAAATACTGCATTCTACAAAATAAATGGTCTGAAATCTTATAACCATTTTTAT
GAAAGACAGGGAGGGAGGGGGAAATAGGCAGAGGAACTGTTTTAGATGAAAGGAATTTCA
GCATGACATCTAAATGCATTACATGATCACTACTTGGATCTTAAATTAGGGGGGAGCATT
AAAAAGGATATTGGGACAACTAAAGAAATTTGAATATGGATTGTGTGCTAGATAATATTA
TGTTAGTGTTTTAAAAAATTTTAATGTGATAATAATGGCATTGTAATTAGGAGAATGTCC
TTGTTCTTAGTGGTCAGGTATAGGGATGTGTGGGGTTATGATATCTGCAACTTACTCTCA
GGTAGTTCAGGGGAAATAATTTTTATCTGTGTAGAAATGGGTAAGGGGAGAAAACAAATG
TTAATAGTTGGTGAATTTTGGTGAAGGATGTATGTTTATTAGTCTGAAATTTTCTGTAGG
TAAATTTTTTCAAAATAAATAGATGAAGGAAAAGAAGAAAATAATAGGTTAGATTTGGCT
TTCAGATCATGAATCAGTTTCACAGACAGCCTATCATGCAACGGGGACTATTTAAAATGG
TAATAGAGAAATGTTTTGTGGAAACTACAAGATGTGTTATTGATGTCCTTCACATTGTTT
ATGTCATTAAAGGGTAAATAGGGGCTCCCACCCAATTTTGTGGATCCTGGTTCATTTGGA
TTTTTTTAAAATGAGTTGTGGACAAGAATGAAATCTATGAACTTGAAAGGAAAATGCTCT
AGGCTCTATATTTAAGGCTGAACTGAATACAAGACAGCAAAAAGTTCCAAAGTGGGAAAA
ATAATCCTAATGCTGGGATATATTAAAAGATCATGAATGTTGTGGAGTTTAGCAGCTCCT
CAAAAGGTTAAACGTAGAACTAACGTATGACCTTGCAATCCTACGTCTAAGTATATATCA
CAAAAGAATTGGAAGCAGTGACTTGAATAGATATTCATACACCAGTGTTTATAGCAGCAT
TATTCACAATAGCTGAAAGGTAGAAGCAACCCAAGTGTCCATCAACAGATGACTGGATTA
AACAAAATGTGGTATATTATTCCAGCCCTTAAAAATGAATGAAGTTCTGATACATGCCAC
TACATAGATGAACCTTGAAGGTATCATGTTGAGTGAAATAAGTCAGACATAAAAAGACCC
AGATAAATGTATGATTCCACTTATCTGAAATAGCTAGAACATGCAAATTCATAGAGACAG
AAAGTAAAACTGGGGGTTGGGGGAGCAGCAATAGGAGCTGATGCATAGTGGGCAAAGGGT
TTTTATTGGGGTGATGAGGAAGTTCTGGTAATGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTACCCCAGCGGAGTATGCAGAATACCTTCAGTGAGCAGTTTACATCTCTAGAGCCTCTG
GAGTCTTGAGTTAGACTGGCCTTGATCCTGCAGGAGATTTATCTTACCCCTCATCAGCTG
TCAGACTGAAGATATTTGGGCCTTCCAGGAAGCAGGAAGCTTTAATTACATTGCTTTTTT
CTCCTTTCCTTTTTTTGGGGGAGTTGGGGGGGGTGGCAATTTCAGTTAGCAAACTGAGTG
AAATGGAATACATTTCCCTTAATTCTGGAACTGTATAAGCAATTTGGAAAACTGCAGATA
TCATGAGATAAAATATTTTGTCAAGTGGCTATACATGTTGTGTACAGTGCTAGCAGTTAA
AAGATGCAAAGAGTTTTCAAACACAGTCCTCCCTTTAAGGACCTTGCAGTCTGAGAGAGA
CAAAACATACCTGAAAAAATAAAATAGATTCCAAGGCCCTGTCTTCAGAGATTCTGACTC
ACTGGGTCTGGAAGTGGGGCCAGGGAACCTACTTTTCTTTAAGCTTCCTAGGTAATTCTA
AAGCACAGCCATATTTGGGAACCACTAGAAGTCTGACAAGTTCAGAGGCCCAGGGCAGCG
TTCCTCAACCTGAGCACCACTGAAATTTCGGGCTAGATCATTTTTGTTGTGGAGGTTATC
CTGTGCACATAGGATGTTTAGAAGCATCCTTGGCTTTCACTCACTAGATACCAGAGGCAC
CCTTCTCCCCAACCCAATTATAACAACCAAAAATGTCTTCAGACCTTGCCAAGTGATTAC
CATTGGCCTAGAGTAATCACGGAAAGTCTGATGGACGTGCTGGGCCTTAAGTTCCCAAGG
AAGGGCAGATCTTTAGTCAGTGGAGCAAGGTGGACATCCTGTGTGAAGATAGCACATACG
AAAGTAGGATGCATATGGCGTGAGTGGAGAGTGGTTAAGCAGATGGTTGGTTGCTTGGGG
CAGAAAGTCTTATATTGGGAGATAATAGAAAATGCTAGGAGGACCTAATTCTTAAACTAG
TGTAGGTACAGTTTATGTGTTACCTTGTTATTCTTTAAAACTGATTGCAAATTTTAAAAA
AATTTCTACTCTTTTGTTCTTTTTTCTTAAAATAGAGAGTAATTCATGTACCATAAAATT
CACCCTTTTAAAGTGTATAATTTAATGATTTTTAATGTAGAGTCCCAAAGTTTTGTAAAC
AACTGTCTAATTCCAGAGCATTTTCATAACCCCAGCAGAAACCATGAACTCGTTAACAGT
CACTCCATTTCCCTTCACCTTTCCCAATGGTAGGCGACCAGCGATATATTTTCAGTGGAT
TTGCCTGTTATAGCTATTTTAGATAAATGGAATCTGACAATGTGGAGTCTTTTTTGTGTC
TGCTTTATTTCTTTTAGTATAATATTTTCAGTGTTTATTCATATGGTAACATGTATCAGC
ACTTAATTTCTTTTTTTTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGATCATACAATATTTGTCCTTTTGTGTCTGTCTTATTTTACTCATTATG
ATGTCTTCTAAGTTCATCCATGTTATAGCATGCATCAGAACTTCATTCCTTTTTATGGCT
GAATATATGGATGGCCCACATTTTGTGTATCCATTCGTCCATTGATGGACACTTGGGTTG
CTTCTACCTTTTGGCAATTATGAATGATGCCACTATGAGCACTGGTGTGCAAATATCTGT
TTGAGTCCCAGCTTTCAATTCCTTTGGGTATATACCTAGAAATGGAATTGCTGGGTCATA
TGGTAATTCTATACTTAACCTTCTCAGAAATCTCCAAAATGTTTTCCACATCAGCTCCAC
CATTTTACATTCCCACCAATAATGTATGAGGGTTCTATATGATGAGTTGCTTTCTCGTTG
CTTTCAGGATTCTTTGTCTTTGTCTTTTGGTAGTTTGATTATGATGTGTCTAGGTGTGGA
TCTCTTTGAGTTTATCTTACCTGGCGTTCATTGAACTTCTTGGATGGGTAATGGTTTTCA
TCAAATTTGGGGAGTTTTCAGCCAATATTTCTTCAAATATTCTTTCTGTCCCTTTTCCTC
TCTCTTTTCCTTCTGGGTATCCCATTAAGCATATGGGTTTTTTTGTTTTTTTTCCTCCCC
TTCCTGCTTCTCCCCATTGTCTGCTCTCTGTCCATTTGCTGTGTGTTCTGCATCCACTTG
CATTATCCGGCATAACTGGGAAACTGTGTCTCTTTTTGTTGGGTTATCTTGCTACATCAG
CTCTCCATGTGTGCTGCGCCACTCCTGGGCAGGCTGTGCTTTTTTCACGTGGGACAGCTC
TCCTTGTGGGGCGTGTTCCTTGCGCGTGGGGCACCCTTACATAGGGGTGCCCATGCATGG
CACTGCACTCCTTATGCACAGCAGCACTGCATGTGGGCCAGCCTACCACATAAGTCAGGA
GAAAAACACTGATTCTCCATATGGTAAACAATTGCTCTATCAATTGAGCCACGTTCACTT
CCCAAGCATATGTTGTTACACTTGATAGAGTCCTACAGGTCTCTAAAGGACTTTTCATTG
TCCTTCTCTCTGCTTTTCTTTCTGTTCCTTAAACTGGATAATTTCAATTGACCTGCCTTG
AAGTTTGCTGGTTTATTATATTCTGCCACCTCAAATCTGCTGTTGAGCCTCTCTAATGAA
TTTCTTTTTCTTCCCCTCTCCCTCCCCTGCCCTGCTATTTTTGCTGTGTCCATTTGCTGT
GATCATCTGTATCTATTTCTCTCTTTCTGTCTTCTCTTCTCATCTTTCTCCTCTAGGATT
CACTGGGATTCAATCCTGGGGACCTCTGATGTGGAGAGAGGTTCCCTAGCAATTGCACCA
CCTTAGTTCCTGGTCTCTGCTGTGCTTCACCTTGACTCTTCTAGTTTGTCTCTCTTTTGT
TGCATCATCATCTTGCTGTGTGACTCACTTGAGCAGGAATTGCTTACCATACCGGCACTC
AGCTCACCATGTGGGCACTTGCATGGGCACTTGGCTCACCACATGGGTACTCAGTTTACC
ACACGGGCATTGGCTCACCATGCAGGCACGCTTTCTCTTCTTTTTCACCAGGAGGCCCTG
GGGATCGAACCTCGGTCCTCCCATATGGTAGGAAGGCCTATCATTTGATCCACATCTGCT
TTCCTCTAATGAATTTTTTATTTCATTTATTGTACTTTTCACTTCCAGATTTCTATGTCT
TTTTAATTATTTCTGTCTCTTTACTCATTCTCTGTTTGGTGAGAAGTCATTCACTTACTG
TCCTTTAGTTATTTAGATATTATTTCCTTTTGTTTCTTAAATATATTTAGAATAGATATT
TAAAGTCTTTGTCTAGTATATGCCCAATGTCTGGGTTTCCTCAGGGACAGTTTCTAATTT
TTTTATTTTATTTTTTCCTTATCTTTTTTTTTTTTTTTTTATTTATGGGTGACAGTTTCT
ATTAACTGCTTTTTCTTCCCTGTGTATGGGCCATATTTATTTTTTGTTTCTTTGCATGTC
CCATATTTTTTGTTGAAAATACTATATATTTATTTGATATAGTAAGTAATATAATGAGGC
AACTCTGGAAATCAGATCACCCCTCTCTGCCAGGGTTTGTTGTTGCTGTTTGTTTAGTGA
CTTTCCTGAACTAAATCTGTAAAGTCGATTCTTTTGTCATATTTGGCCACTGAGGACTCT
GCTTGGCTAGCTCAGTCAATTAATGATTGGACAGAGATTTCCTTAAATGTCTAGAACCGG
AGTTTCCCAGCCTTTGCCAAGTGTCCATGCGTGCACATGGGAACACATCTCAACACTCGT
GTGTACAGTTTACAAGTTCACTTTCTGCTTGCCCTGAGCCTCGCGGTCACCCAGAGGTGG
TCTTCCTGAGCCTGTGCACAGCCAGCCATACACGTTTATGGACTTCCAGATTCCCAGGAA
GACATCTGAGCTTGTCAAAGCCACTATGCTTTTAAGTTTTTTGATCAGCTTGTTGTCTGC
CCCAATCATTAGCACCACCTCCTACAGCTTTGATGTTTAGCAACACTCTCGCTTGTAGTC
TTATATTCTCCCAGAGAAAAGGCTGGTCACACTGGATGAGGTCTGAGCCAGGTCATATAA
GGACCAGCTTCCTGGGTGGGATTTCCCAGAGACTGCCAGACCTGTTAAATAATGCCAATT
ATCTAGGAATCAGTCTTTGTAGGAGTTCCAGCCCTGTTTTGCTCCACCTGGAGGCTGCTA
GGCTGCTGGTTTTCACCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTACTGAGAAATTTTTGCCAGCTAGATGATATATCTCTGTTAACATTTGCCC
AATTAGGTGGATGAAGTGTCAGCCCTAAAACAAGTGAGCATTTTTTCAGAACTGTTTATT
AGATAATAATTTTATAATATTTTACATTGGTTTATATAATTAATCTCTTATAGTGTTGTA
AGCCACTCTATGAGGCAAAGACCATTAAGATCTTCTCCAGCTAAACAACTAAGCCATATA
TAAGTTCAAACTGTTACCCTTGCCTTGCTGCTGCTTTTTAATAAAATTAAGTGAAATTCA
TAATTTTTGCTGCATTTACCTTTTAGATTATCATAAACTGCTGACTAAGAGTGTGGCAGA
GACTCCAGTACATAAACAAATCTCCAGAAGGCTGCTTCACAGACAAATCAAGGGCAGGTG
AGTCACATCCTTAGCAGGGCTCCTTCATAATGGTTTTGGGGCCCACAGCACTTAAGTCCT
AGCTGCATTGCTCATAAACAAAGAGCATTTGAACTCTCTGTGGGGGCTGACAATAACAGG
TTATTCAGCTTAACACAGTAGTAATGTCACAAGATACATTTATATGACATTTCAAAGTTT
ATAAAGGGTGCTTCGTTTATATATTACCTCTTGTGAACCTCATAACCCTGGAAATAGGTA
TTGTGTACATTTTATAAATAAAGGAACCAAGGTTCAGATAAAATACATGATTTGCTGCAG
CTTAAGTAATTAATGTCAGAATCTAAAAGAAAAGAAAAAGTTAGTGGACTCTTAATCCCT
TGGGTTTTTTTTAATATTATTAAAGAAACTTTTTTTAGAGGTGTTGTTGGTCTATAGACA
AATCATGCAGAAAATACAGAGTTCCCAAGTACCTCCCTCACACATAATTTCCCCTATTAT
TAACACTGCTTTAGTGTGGTACTTTGATATAATTAATGAAACAATATTATAATTAGACTA
TTGACTGTAGTCCATGGTTTATATTAGGGTTCACTCTTTGTGTTGTATAGGCCCGTGGTG
GTTTTTGGTTTTTTTTGGTTTTGGTTTTCGGTTTTTGTTTTTTTCAGGTACCAGGGTGAG
GGATAGAGCCCAGGACCTTGGATGTGGAAAGCCGGTGCTCAACCACTGAGCCACATCGGT
TCCCCTGAGTTGGTTTTTTTCATGTTTGCTTGTTTGTTTTTAGGAAGCACCAGGGACTGA
ACATGGGACCCTATGTGGAAACTCAATCACATCTGCTCCCTGCCATGGTTTTTTAAAAAA
TTTCTTCTAGTAATATCTAGTACAAACTAAAATTTCCCCTTCTAACAACATTCAGTGTTA
ATTACATTCATAATGTTGTGCTACCATCACCACCACCCATTATCAAAACTTTCAATTGAT
GCATACAGAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGC
TTATTCTATTTATTTCATATCAGTGAGATCATACAATATTTGCCCTTTTGTGTCTGGCTT
ATTTCACTCAAAATCATGTCTTCAAGGTTAATCCATGTTGTCACATGTATCGGGACTTCC
TTTTTATGACTAATACTTCATTGTGTGTCTATACCATGTTTTGTTTTATCCATTCATCTG
CTGATGGACACTTGGGTAACTTCTGCCCTTTGGCAGTTGTCTGAGTTCTACTGTAATTCC
ACTGAAGTCTGGTCCATGATTGGGTGGATGACAGAACTTTTTTTCAAAATCTCTTAATTA
GTAAATAACAACATCTATTTACTGGTTCTTTCCTTCTACTTGGGATATTATAGTAGCCTC
CTAACTAGTCTCCCATTCTTGCCACCCCTTAATCTATTTATTTCATGTAACCAGAGCAAT
TTTCGTAAACTATAATTCAAGTCTGGTTTTTCCTCTGTGTGAAATCTCCATGTCTTTCCA
TGGCTCCTTCTCATGGCCTGCCTATCCAACCTCAGTGTTTTCCATTCTGCCCCTAACTTT
CTCCATTCCAGCCATTATGCTGCACCCAAGCCCATTCCAACCTGAGAGCCTTTGAGCCAG
CTGGTCCCTCTACCTGCACTGCTCTTCTCCTTGAGACTGGCTCCTTCTTGTTGTTAAGGT
CTTGGCTATAGCTTAGCTCCTCAAAGAGGTCCCTTGACTCCATGACCCAAAGTTGTCCAT
TCCCTGCATTACACCTCTGCTCTGTGGAATTATTGAGTTATTTCCTTCAGAGCAGTTACC
ACTTTTTTGAAACCAACCCATTTATTGTATTCTCCCATAACCCCTAATCCCCCACTGGAA
TAAACACTCCGAAAGACAGGACCTTTTTCTGTCTTTTTCACTACTCTGTTTCTAGTGCTA
GACTTATAGTAGAGAAGCTCAATACATACATATATATATTTGGTATTTGTTTTTTTTTTC
CTTTATTAAGCACTTTTTTTGTTGTTCCTTTATTAAACAGCTTATTTTGTTATTGTTTTC
TTTTTTTTTTAAAGATGTATTTATTTATTTTTCCCCCTCCCTCCATTGTCTGTTCACTGT
ATCCATTCATTGTGTGTTCTTCTGTGTCTGCTTGTGTTCTCATTAGGTGGCTCTGGGAAC
TGATCCTGTGACTTTCTGGAGTGGGAGAGAGGTGATCATTCTCTTGCGCCACCTCAGCTC
TCTGGTCTTCTGTGTCTCTTATTGTCTTTCCTCCATGTCACTTCTTGTTGCGTCATCTTG
CTGTACCAGCTCTCTGCGTGGGCCAGCACTCCTGTGCAGGCCAGCACTCCACANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTACAACATGAAATTTCCCATTTTAACCACTTTCAAGTATCCCATTCAGT
GGTGTTAATTCCATCCATAATGCTGCACTACCACCACCACTATCCCTCACCAAAACTTTT
CCATCACCCCAAACAGAAACGCTCTACACACTAAGCAGCAACTTCCCATTCCTCTCTCCC
TCTGCCCTGTCACCTGTAATCTACGTTTTGTCTATAACTTTGCGTATTCTAGTTCTTTCA
TATTGGTGAGATCATACAATATTTGTCCTGCACTTGGCCTATTTCACTCAACATGAGTCA
AAATAACTTCTTGGGGAAGCGGATTTGGCTTAATGGATAGAGCGTCCACCTACCACATGG
GAGGTCCAGGGTTCAAACCCAGGGTCTCCTGACCTATGTGATGAGCTGGCCCATGCGCAG
TGCTGATACATGCGCTCAAGGAGTGCTCTTCCCCACAGGGGTGTCCCCCTGTGTTGTCCC
ACATAGGGGAGCCCCACACACAAGAACTGTGCCCCGTAAGGAGAGCCACCCCACACAAAA
AAAGCGCAGCTTGCCCAAGAGTGGCGCTGTACACACGGAGAGCTGACATAGCAAGATGAC
AGAAGAAAAAGAGACACAGATTCCTGTTGCCGCTGACAAGAATAGAAGCAGGCACAGAAG
AACACACAGCAAATGGACACAGAGAGCAGACAACTGGGTGGGGGGACAGGGAGAGGGGGA
AAAAAACCACCATCTTGACATTATTTGTATACATATTAATATTTTTACACTCTTGTGCAA
GTTCATCTATAGGATAAATTACTAGAGATGAAGTTGATGATTCAAAAGGTATGCATATTT
TAAATAATTTTGATGTCTCAAAGTCACTTTCAAAAAATATTCCAACTATTTTCATTCTTG
ACAGTAATGTATGAGAGTGCTTGCCAACACTGCTATTATCAAACTCTGTGATCTTTGTTA
CTGGTTAGGGGAGAAGCTGTACTTCTCTTTAATGTGTGTTAATGTTGAGTGACATGGACC
ATCCCTTGTCCTTATTGTTCCACCAGGTCCTCTGATCCTGGTCCTGATATTGACATTGTT
GAAGAGTCCCCTGATAAAGGAGACAGTGGTGAGTATGATTCACATTTAGTTTATTTTTTG
CATTTTACCTAGATTCTGGAGAATAACTATTTTTAACCAATAAAAATGGCACTGGGGAGT
ATATGTGGCTCAGTGGTTGAGTGCTGGCTTTCTGCCCACATAACAAGGTCCTGGGTTCAG
TCCCTGGCCCTGGTATCTAAAAAAACAGAAAATGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTCACTTCTTGTTGCGTCATCTTGCTGTACCAGCTCTCTGCGTG
GGCCAGCACTCCTGTGCAGGCCAGCACTCCACATGGGCCAGCTCGCCACATGGCCCAGAT
TGCTTCACCAGGAGGCCCTGGGCATCAAACCCTGGACCTCTTATATGGTAGACGAGAGCC
CAGCTGCTTGAGCCACATCCACTTCCCTATTAAGCAGTTTTATTGAGATATATTCACATA
TCATACAGTCTATCCAAAGTCTATAATCAGTGGCTTTTAGTATAATCACAGGGTTGTGCA
TTCATCACCACAAAAAATGTTAGAACCACTTCATTACTCCAAAAAGAAAAATTCCACACC
ACTTAGCATGCTTTCCCCAGGCCTACATAACCACTAATCTTATTTCATTTTCATAAGTTA
ATTTATATTTATATTTTATATAAATGGAATCATACAATATGTTACACCATATATTTAGTT
CATAGTAGCACAGTCATACAGTATTTGTCCTTTTGTATCTGGTTTACTTCACTCAATACA
TATATTTTCAAAAATTTATTATGGAAAATTTTGAACATGTAAAAGAGTATTCACTCTTAT
AGGGAAGCCCCATATGTATATAACCTCTTTTAAGGTTATCAACAGTTATCAACTTGTGGG
CAATCATATTTCATCTAGTCAATAATATTTTAAGAATGAATGTTGCAAGCAATGCTCTGT
GCAGATGATTAAAACCATCTGGCACAATTTCTGCTTGCTATAACAAGAAAGTCTGACCTA
TTCTGGTGTTCTCTCTTTGACGAGACAAGCCCCATTATATAGACTACACCAGCATTAAAA
AAAAAAAAAGAATGAATGAATAATTAAATATAATTTATGTAAGTGTAGAAATAAATCCTT
TTTTAACAACTTCAAATTTTTCTTTAATGTAGATAAATCATAATTTATTTATCCAATCTC
CTCTTGATGGCTATTTAAGTTGTCTCCAGATTTCACTATTAAAAATTAGGTTGCAACAGA
AGTAGAATATGGATAACTGTTACTCTGTGTACTTATTTTTAAAAATAGCTCCATTGAGGT
ATAGTTGATACACAATAAACTGTACATATTGAAAATGTAAAATTTGGTAAGTTTTGACCT
CTTTGTACCTGTGAAACCATTACCACACCCAAAATAATGAACATACCCATCAAACTCAAA
AGTTTCCTTGTACTCTTCTGTAATCCCTTTCTCCCACCCCTCCCTGCCCCCTTGCCCTAA
GCAACTGCTGATCTGCTGTCTCTGTGGATTAGTTTACATTTTCTAAAGTTTTCTATACAT
GGAATCCAAACATACAGTTATTGCCTGGGCTCTTTTGCTCAGCATAATTATTTTGAGATT
TATCCATTTAATAGTTTATCCCTTTTTATTGCTGTGTAGTATCCCATTGAAAGGGTGTGC
CACAATTTTAAATCCCTTCATGTACTGACACACCTCTCCAGCCGGGAAGGGTGGTGGAAG
TCTAAGCCTCCCACTCAGCCTCTACTGACCAGCATGGGGGAGGCCACTGTTTTTCTATGG
CACTTGGTTTGGAGTAGGGGGTTCTTGCCTAAAAGTTTTGTCTTGGGGTAGGGGGAATGA
GTGAGGTATCTGGGAATCCCCTATATTTTTGATGTAACATTTTTATACTATGTTTAAAGC
TTCTTTAAAAATTAAAAAAAAAAAAAAAGTTTTGTCTTGCTAGGCTACCCTTTCCTAGTC
CTTTAGCTAGAGAGAGTCAGCTTTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGTGCTGGCTTTCTGCCCACATAACAAG
GTCCTGGGTTCAGTCCCTGGTCCTGGTATCTAAAAAAACAGAAAATGGCATTGAGGGTGA
AAGCTAAAACTACTACTACTATGTGCGACGGCTTATTGAGAAACAATATATGATGGAGGG
GGTTTTACAAACTAAATTCTTTTCCTTGTTCAAGTAATTCATGTTAATTGTAGAAAATTC
AGAAAATACAGAGAAGCCAAATTTTAAAAAATCACTTGGTAATTCCTCAACTCCCAAATA
CTCTGTTAATAGTATTTTAGTGTATAATCTTACAAGTATTATTTCTATAAAATGTAATAT
ACATGTAAGACAAGTATATATTTTACAAAAGTCATACTATACCTACCTTTTTTTCACACT
ATATCATGCTTTTAAAGGTGGTAGTTTATGAGATGTCTGAAGGTTACAGTTTAGTGGGCC
AGTGGTTTTTTTTGTACCTTGTTGTGGCCATATGTTAATCCTCTCTTAGCCTTGATACAA
CAACTCAGACATTTCTTAAGGCCAACAATTTAGAATCTCTATCTCGTACTTACTATTACA
TAAATTTTACCCATTTCTGACAACATGGGATGTCAAACTTTCACTTCTTCATGGTTACTA
ACTGTGATTCTGGTTTTGTAGAAATAAGTTTGAGACGAAGTCCTCGAATCAAACAGTTGT
CACTCACCAGGAACAATTCTGGCTGCTTCTATTCTGTGTCTCAGTTGAAGTCTCGGAGCG
TGCAAAGAGTTCACTCATTCCATCAAGACAGTTCAGGTAACATACAGACCCACCTGTTTT
TTCAGGCTTTGCTGACTTGGTGGGAATTGTTTTTGAGAAAAGAAACATGAAATTTAACAT
ATTCTTTCTTGACATTGGAGAAGTAGAATAGGTATGTATATTTGAAGTTAAGGGTGATGA
CCGTACGGAAAGTCCTGCCAAGATTCAGAGTCATCCCTTTGAACTCTCACAGCTGTTTGT
CCACAGTGTCGTTAGGTCAGTCATTTATTCAATGGGGTTAACCCAGGTTTACCCATAATT
TCCTCCAAACAGCCAGATCCTATGGGCATCCCAGGTGGAAGGGGATATCTTTTTTTAATG
TTCTTTATTTTTCATAATAACATATGCATTTTTATAGGTATATTTACAGATGAAATTATT
TTAGATGCCTGCATTTCCTAACATTGGGGCTGGGGCTCACACACAGTCTTATTAAAATCT
GAGAAGGTAGCAATTATTGTAGTTGCTGACATAATTAGATGGGACTTGTCCTCTGGTTGC
TGTAAAAATTATCAACTTCTTCTATGGACTTACTGTTTTGAAAGTATTGGGAAGGCAGGA
GTTTAGAAGGAGTAAAATATCATCACTTTTTGTGACTTGCAGACCAAAGAAAAGATTTTC
CAGTCCGAAGAATTCGGTCTCCGAAGAGGCTTTTTTTTGGTGCAGTGTCTGAGATGACCA
GTCCCTCAGAGAAGGGCTCGGCCCGAATTCAAAGGCCGTCTCGAAACACGTTGAGTTCTG
AGATAACTACAGTTTATCAGGTATAAAATTTATGTAACATTCAGAATAATCTTGGGGAAC
AGAGACATGGCTAAGGGGACCTATGGAGTCCACTAGGGAAAAGAAAGCAGGTAATGATAT
AATAATCTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAGCAGGTAATGATATATAATC
TAGTATCACATAGTAAAGATGTGGCGCGGTTGGCATTGATTCAGATGAGTGGTCACTGAG
TAGATGGAACTTAAAGCAGCAGGTTTGGCTGAGGCCATGGTTGCAGGGAGGAGACAGAGA
TATCTATTATTTAAACTCTACCCTGTATATCTATCTTTTGAAAGGTATAGTAATCACTCA
TCTGTTCAGTTAGTTGCCCACTCCAGTCACCCACGTTAGAAAGCCGGGATTGGGAAGCAG
ATATGTCTCAAGTGATTGAGCTCCTGCCTACCACTTGGAAGGCCCAGGTTCGTTTCCCAG
TGCCTCTTAAAAAGAAGACAAGCAGACAGAGTCCAAGCAATGAAGGGAGAGGGAATAAGT
AAATAAAATAATATTTTAAATAAATAAAAAGAAACCTGGGATTGACCTTGGGTTCTCCCC
TTTCTGAGCAGGCCAGTCTATCAGGTCCTTCCCATTTTATTTACAAACTTCCTTATTCCC
ATCCCCTCTTCTCCCTCCAAGGGCCACCTCATGTGCTCGCTAAGAACCTCCTGGGTGCCA
GGCATTGGTGTGTGTGGGGAGGGCAGAGACAGGTGTAGGCACTGCAAAGAAGATAACATC
TCAGAGGACACCCTCTCCTATACATCACCAAAGGCCTTTCTAATTGTGTAATATTTTATT
AAGCTCTTTAGAGAATATAGATTATGATAACTCAAGCACCGTAATGTACAATTTTCTTCA
TAGACTCCCAGGAAGAGTTCCCGGAGATCCTCAGGCTCTTCCAAAACGACACCCAGGAGG
TGCCCTCGTACCCCGCAGATGCTGCCTTCTACTCCAGAAGGGCTGTGGAAATCCCCCACG
GAGATGACGCCTGCCAAGCCGGTGGTTCTGACGGAGTCCAGAGACTCCTGCTCCCGTGGC
TGTGGATCACCATCAGGAGCAAAAGTGACCCCTCAGAAAGGCTACTCCCTAGCGAAGAGA
CTCGCCTCGCCGCTGGAAAAGATACCGAGAACTCCCAAAAGGCAGGATGGTCAGCCACAT
GGATTTTTGCAGAATTGTACTTGGTCACATACAGTAAATTCCAGTCCAGGAGCCCGGACG
CCATCCACTGTCCAGACCAGGAGTCAGTGCCTGACTCCTGTCAGATATTCCCTCAGAACA
CCCGTGAAATCGGCAGCCTCGGGGCTGCTAGCAGGGCCTGGCTTCCTAGGCACACCTCCT
GATCAAAAAAGCCACAGTCCCCAAGTCCCTGGTGCTTCTCAGGCAGAGGAACCAGCCCAG
AAACTAAAGGCTAAATCTGTCAAAGCCCCAAAGAGACCAGAGAATGCAACTGTTACCTCT
TTCCTGCCTATTTCTCCAAAGAAACTCTCTAACTCTCCTATNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGGATTCCCCCATCGCATCCTTCCTCTGAGCCCAGCTCTCCTCTGATA
CCGTCCTATGACCTGTACTGTACTGCAGACGGAAGGCAGCAGCAGGCCACAGCACAGCCA
AAGAATCTGCAAGCTTCAACTCAGCTTCCAGAAGCCTCTGCCAGCCCACAAACCTATGAG
GTTGAGCTGGAAATGCAAGCCTCTGGCCTTCCCAAGCTTCGAATTAAAAAGGTAGATCCC
AACCCTTTGTTAGAAGCCAGTCCCCTAAGAAAGGAGGATGGCTTTCGGGATGAGGAGAGC
TCCTTCCCTGCTCTCACCAAGCCCAGGGCCAGCAAGTCCACGAGCAAACCCGAAACTACC
TACATGTCACCTCCTTGCCTTCGCTCCTCGCACAGTTCCCCTGGCAAGAGTGGGGGACAG
ACCTATATCTGCCAGACCTGTACCCCAACCCACTGCCCCTCTAGCACCCCATCTCCTTTT
CAGACAGATGTGGGGATTCCTTGGACACCGTCTCCCAAGCACAGTGGAAAGACAACTCCT
GACGCCATTAAAGACTGGCCCAGGAGGAAGAGGGCAGTGGACTGCAGCGCCAGCACCTCT
GCTGGGAGAAGCGACGTCAGCGCCGACCTCCCCGGGAGTGTGGCGGTGCTTGAGCTAGAG
TGCAAGGAGCGCGGGTTCGAGCTCGGCATCAGCAAGCCTTGCATCTTTGGGGATTTTGAG
CTTGAAGGCGTGTATCAGCTCCCAGACCATTCTCCTCCCAGGGACAGCAGGCCCAAGGCT
GAGGAAGCCTTCTCATGGGGACAGTTTGGATTGGGTTCCAGGAAGAGACTCCTTTCTGCC
AAGGAAGATGAGAATCAAGGCAAAAGAATTTGTGACAACCAGAGAGAAGGCTTGGAAGTT
GTTAGTAAGACGAGTGAAGAGCAGTCCCCGAGTACAAGCCAGCGACAGCTCCCCTCCATG
GGGGACGATGAGGTCTTTGCTTCAGTGAGTTTGTTTCTGGATTCATCTGGGAGGTGCATC
TAGGAGGAGCTCCTTATGCGGCTCCATCTCCTGTGCTGGGAGCTGCAGGCTGGGTTTCAG
CAGGGTTTACTGTGTGGAATCTCTTTAGGGTCTACCCCACCTCCCGGCCGTGCCGTGCGG
AGCTGCCTTTCTGCCAGTGGTCTCCAGGCCCTGACCCGGTCTCCACTGCTCTTCCAAGGA
AGAACACCTTCCTCTCGGGGTGCAGACACCAAAGGTAATTTGTTTGTTGAAGTCCTAGAG
GCTGCTACCAGGGTCAAACTCATTTCCCTTGGGCAACTCCTGGAGCTCGCTCAGGGTCGC
AGGGAGAATCATTTCTGGAGGCGTCGTAGGGCACACTGGAGTTCAGGGGAGTCGATTTTG
TGCCCATGGTATCATGTGCCCTTCCCAGAGAGACACCGCTGAGAGCTCTATGCATCCTAA
CAGAATCCCCCTCAAATCCCATGAAAATCCTCATCTCCTGAAGATGGCAGAAGTGGGCAC
GTAACATACTGCTGGTCTGCAGTCATTAGAATCCAAGTGATGTGAGGGTAGACAGGATGT
AGGGAGCTGGCTGTTTCCTGCAGGCAGTTTATACCCATGTTTTCCTGTATATTCGGGATA
ATAAAGAATGGCTGTTACCAACCTCGAGGCTAGGATTCTCCTTCCTTGAAACTGCCTGGA
AAGAATGGGATTTGGTCGCCTCATTGCGCTGGTTAGGAAGGTTTCCTTCTGCTCCTGGAG
GGGAGGGCCTAAAAAGCCTGCGCTGCCGTGGTTCCTTCACTGGAGACTCTTGTAAGTCTC
CCAGAACAGCAGGAACCTCACCCTTCTAAGACCCAAAAAGAATGCACAAACTATCAAACC
AAGGGAATTCAGACCACACGTACTTTGCATTCAATGATTGCTTATTGCCCTCAGCTAGCT
ACCTGGGTAGAAAGCATTGTAAAAAGTGGAGGTAACTTTTTGCAGCATAAGATAACCTCC
CAGCATCGCTGATTTTCTTAAACCCATGTGTAACCCTGTAGCAATTTCAGCCCGTTTTCT
TTTGTTTAGTCCTCAATTACTTCCTGCATTCCAAATCTTTCTGCCTTTTTTCTAGATGAG
GACCTGGGTATATTTCCCTCCACTGCAGAAGAATCTCCTTTCAGCCGAGCGTTCTCACGG
AAACGCCCCATCAGCAGGACTTACACGCGGAAGAAGCTGATTAGCTAGTCCGGATGGAGC
CAGGCAGTGGGATCTGGGATGACGAGCACCACTGAGCCTGTCCCAAGCCGCCACAGTCCC
TGGACCAGGGGCGGTGCCCTGAGCGTTATCTGGGTGTGTTAGAAGTTCCAGGTTTCTCCC
ACACCTGAATTCTTAGCTGGATACCCAGAAACTAGTTCATCTGACCTGGGGCCTCTGACC
CACAGCCTGTGTAACCCTGGGCCTGCTTCCCAGAAAAGAGTAAGTAGCCAGGGCTTCATC
AAAAGATGAAGGCCAAGTCAGCCCACATCCCCTGGGCATAAAGCAACTAGGGACCTAGTC
CCAATCCTCCTCCTTGGTCAGCTTTCAGAATCCTGCTAGAATACCTGAGGTCTGTCATTA
TCCTCCTGGAATCCACCCACCCCCAGGCCCTACCCCTAATCCCAGCACCCCTGCCTCCTT
GTTAGGAAGACGGGAGGGCGGGCCATGGTGTAGCCATGCCGTCAGTCAGGGAAGTCAGCA
AACCTGACAAGGCTCTAGAAGACTGCGATCCCAGGCCAGCCCCGTCCACCCCACTGTGAC
CTTTGCCCACCCTGCCACACTGATGAGCTGGGAAAGGATCCCTTCACGGCATCCCTGGCA
GAGCCACTCCAAGGCTGGGCACTGTGGCGTCAGGAGTGCTCTGTAAACTGTACAGCACTG
CACACATACATGGACATGAAATGAAGACTGCACCCGGGGTGGCGGGACGAGTTTTTTACA
CCCACCCACACACCCGTGTAGAAAAATAAAGCCACCCGTGGCCACTGGGCATGCAGTCCA
CGTCTGTACATTTTAGTCTGGTTTACTGTGACCAAGGTCCACCTCTAGTGGCTCCTAGAG
TCCACACTTCAGGGTCTGTCCCAAGAATCAGCAGTTTAGGGCACAGTGCTCGCTCACTCG
CTCACAGCGAGACCGGCGGCTGACTCATGGTTTCCTCCCAGAGAGCCCCACTGACCAGAC
TGTTGTGTTGGGTCTTGGCCAGGGGCCTGGTCACCAGGAGGGCTGATTTGGAACTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1259, 1270..1359, 1620..1717, 1719..1874, 1878..1925, 8979..9218, 9220..9259, 10523..10764, 11871..12105, 14106..14232, 27983..28122, 28223..28441, 28542..28693, 28794..28894, 28995..29088, 29189..29268, 29369..29608, 29709..29805, 30125..30182, 35043..35189, 38786..38876, 44246..44307, 48441..48575, 49182..49339, 62643..63078, 63103..63278, 63281..63847, 63972..64940, 64943..64943, 65068..65193, 66055..66160, 66174..66198
1001..1259, 1270..1359, 1620..1717, 1719..1874, 1878..1925, 8979..9218, 9220..9259, 10523..10764, 11871..12105, 14106..14232, 27983..28122, 28223..28441, 28542..28693, 28794..28894, 28995..29088, 29189..29268, 29369..29608, 29709..29805, 30125..30182, 35043..35189, 38786..38876, 44246..44307, 48441..48575, 49182..49339, 62643..63078, 63103..63278, 63281..63847, 63972..64940, 64943..64943, 65068..65193, 66055..66160, 66174..66198
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved