Dasypus_novemcinctus Locus RPS3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus RPS3
Dasypus_novemcinctus
RPS3
GeneScaffold_4387
SNORD15
1791..1941
4469
AGTGCTGGAATTAAAAGCTCAAATGGTCACTGGAACCAGACAAGAAATGAGTGAAAGTG
CCAGGGCCTGTGGCACACTTAAAGCCCTCTTCCATCTAATGGGGAAGGAAAGTACTGTCA
TGAGGAAATGTGGACTAGATCATTACATATTTTTAAAGAAAAACTTAAATCGTATTATAG
AGAAATTTCTTGATTTTTAAATGCTAGCAAACTATTCAAATCTAAAACAAAACTGTTGCT
GAAGTATTTAGGGGTGAAGTGTTTTGATGTCTGCACTTACTTTGAAATGCATCAAAAGAT
GCATTGGTTGACGGATAGGGGGATCAACTCTTTTGACTTTTCTGTACGCTTGAAAATTTT
CAAAATAAATGTAGGGAAAAACAACAATTGTGAAAAAAAGCAAGGAACTAAAAAGTGAGG
CTAAATTCAGATCATGAGCCACTAGTTTGTTGGCTCTGTTACAGATAATAAAAGGCTTTA
GCAAAGTGAGGTAGGCATAAATAAATTAATACTTATGAAGGGCATAGAGCGTCGCCTAGG
ACACTTAATAAGTATCAGCTATTATTATTTAGTAGGGAGGAAATGGACACAGATTGGAGG
ACTTGGGGGTAAGAACTTTCAGCAGGTTTACATTACAGTGTAGACCCGAGAGTGTGCGGA
CCAGGGTTTCAGCGCTTCTTAAATTCCTCTATTGCGGTACGCACTTCTGTCTGTAATTTC
CATGTCTGGGCCACAAGTTGCTCCTTTTTAAACGATGAGAATGGGACTCTGAGCCTCTGC
AGGTCTGGAGTTCGGCTACATCTGCCCCCTTTCCTGTTTCTGCCTCTAGGCGTCTCCAAC
GCTTTTCTCGCTCCCCTGACCCTTTCTTTACGTAAAAACTCTATTTCCCATGAGCGCGCG
CAGGCGTCGACGTCGCGCAGTTCTTTGTCGTCGCGCCGGCCCTTTATACCCACTTCCGGC
CCAGCGCTACTTCCTTTCCTTTCGGCTGCGCGGGCGGCAAGATGGCGGTGCAAATTTCCA
AGAAGAGGAAGGTGAGGCGCTGGGGTCCGGGCCCAGGCCCCCGCGGCTCGGCGCGGGCCA
GGGCCTTCTCCGTGTGCGGCCGCGACGCCCGCAGCTCCGTGGCCTGCCCCGGGAAGCGGC
TGGGGATGCGTGGCGTCCCCGGAGGCCGCGGATGGCGGTGGATTGAGCGCGGAGCCGGGC
CCGGCGAGGGCAGCGGGCGAGGGCAGGGAAGACGGGCAGGATTTTGCCAGTGTTGGGCGG
CGCGCAGAGATGAGCAGGGGGCGCCCCTCCTGTCTTGGAGAAGGCGCTGGTGAGCATTTC
TTCGTCAGCAAAATGAGGTTTTCGCTCCATCTGGGGCCCCAAGGAAGCGTGTCATGGGCT
CACGGACCCGCGAGGGAGGCGGCGCGGTAAGGACGCTTCCTCGGGGTCAGTTTCTCGCCT
CTTGATGGGAGAGAACCGTAAAGTTCTCTTGCTTTAGAAATAGTTTGCCGTTTTGTATAT
ACCTGCGTTCGTGTTGAAGTTAAATCCATGACGCGTTTTGTGGGGTAGCATTTGCTGACT
TTTTTACATATAGAGGTTAGGTAAGTAAAGTTAAGAGCACATTGTTGAAGTTTCTTCAGA
TGCTCCAAGTTGTGTCTAAAGTGAGAATGTTTATAACTTCAGTCGACCCTCTGTTTTTTC
CTAAATTATAAACATAGTGACCCTGCGGTGCTGAATAAATAAGGTATAAATGTGCCGTTC
AGAGCAGCTTTTTAATTTTGTGTATATGAATGTAAATGATAGTCTAAAACCCTTCAATGA
AGAGATGATGACGAGTCTGACTGGGGGTGTTATTTTTGTCCAGGTGACCAGGACTCTGTG
CTGCGTTCTGCGGCATAGTTTTTAAGGTCCTTGGATCAAAGTAACTTCCAAACGATGACC
TAGAGGCATTTGTCTGAGAAGGGTTGCTTACATTCTTGTTTGAACAGAGGTAACGAAACA
GTTGGTGGATCATTTGTTGGAGCTGTTGAATTTTGAAGGTGGTTTAAGCTGAAAGAGTAA
ATGGGGCTCTGTTGTGCAGGGAGGGGAGTGTCCTAATTTTGAACTTGGTTTTTTGGTTAG
TTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAACGAGTTTCTCACTCGGGAGCTAGCT
GAAGATGGCTACTCTGGAGTTGAGGTTCGAGTTACACCAACCAGGACAGAAATCATTATT
CTGGCCACCAGGTAAAAACTCCCTATAATTGTATGTACTAATTATACAGTGGTTCACTTT
GTGATCTTAAGAGGACAATCAGTGAATTTGGTCTTAGTGAAGGTAATGATGTCATCCAAA
AATCAGAATTGCGTATGTCAGATGTATGAGAGTTTACTACCACACATACACATGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAGGTTTTTCAAAGAAGTTCAC
TCTGGTGACAGGGTGGGTAAATGGATTAAGGGGGAAGAAAGTTGATTATGAGCTAGAAGA
GTATTGCAATAAATACCAGCAAAAGATAATTATGGTTATCTAAAAAAAAATGTACCTAAT
ACAGAAACTAAAATCATTTATAACAATATAATCATGTCATAATACCCCCCACACACACAC
ACACACAAAAGGTAAGATGGCCTTTCCTTTCAGCTGTGCACTGTGGTAAGATGGTGCTTC
AAATTTCCGAGAGTTTGCTGCTAATGGCATCTTCAAAGCTGAACTGAACAAGTTTCTAAC
TCGGGAGCTAGCTGAAGATGGCTATTCCGGAGTTGAGGTTAGAGTTAACACCAACCAGGA
CAGAAATCATTATTCTGGCCACCAGGATGCAGAATGTTTTTAGTGAGGAAGGCCGGCAGA
TCCAGGAATTCACTGCTATAGTTCAGAAGAGGTTTGGCTTCCCTGAATGTAGAACTTTTT
GCTGAAGAGGTGGCCACAAGAAGTCTGTGTACTATTGCCTAGGTAGAGTCTCTGCATTAC
AAACTCCTAGGAGGGCTTGCTGTAAGGAGGACCTGCTATGGTATGCTGCGATTCATTATG
GAGTATAGAGCCAAGAGCTACAAGTTCATGGTGTCTGGGAACCTCTGAGGACAGAGGGCT
AAATTTATGAAGTTTGTGGATGGCCAAATGATCTACAGTGGAGACCCTGTTAACTACTAT
GTTGTTACCACTGCTCATCATGTGCTGCTCAGACAGGGTGTACTGGGCTCAAAGTGGAGA
TCATGCTGCCCTGGGACACAAGAGGTAAGACTGGTCCTAAGAAGCCCCTGCCCAGTCGTG
TGAGCATCGTGGAACCCAAAGATGAGATCCTACCCACCACTCCTATCTCAGAGCAAAAGT
GGGGGAAGCCAGAGTTGCCTGCCATGCCCCAACAAGTCCCTACTGCAAAAAAGGTTTCCC
TAACAGCTGGATCTGGAGCCAAAAAGTTGCTCTATAAAGACCTTTAAATAAAGCTTTTTA
AAAAGGCACTTGGCTAGACTTGACTGAAGGTCCAGTGTTCAGTCTGAGGGTCACGTTGTC
CCATGGGAACATTGATGCTTGTCTTTGATTAGTGTTTATTCTCCTGGCTCAGGATGTTTC
TGTGCTTTCTCTAAAACCCTCTTGGTTTAACCATGCTGTGTCGTGTTGGCAGGGGCCAGA
ACAGGAAGACCTGAGCAGAGCTAACCAGAAAAATAACTGGGGCAGTGAGTCTGGTGACAG
TTAAGTCTGATTGTTGGCAGGCAGCACCTTGATTAACTTACCTGTAGTTCAGGATCAGAA
ATGGGATATATAAGTGTTTATTATTTATTGTGGTAAGAGCAAAGAATACTCCATTTTAAC
CATTTTTAACTGTACACTTATGTGGTATTACATTCACAAAATTGTGCTACCATTACCACA
ATTTTTCCATCATCCCAAACAAATAAGTGGGAATTTCACAGTATTTGCCCTTTTGTGTCT
GGCTCATTTGACACAACATGAAGTCTTCAAGGTTCCACCCATGTTGTAGCATTCCTTTTC
ACAGCTGAGTAATATTCCATTGTATTTACATAACACATTTTTTTTCTGTGTGCCAAGGTT
TTCTTTTTTTTTTTTCTGATAAGAAGGAACTCTATTTTATTTTATTTTTTAAAATATTAC
ATTAAAAAAATATGAGGTCCCATTCAACCCCACCGCCCCCACCCCCTACTCCCCCCACAG
CAACACTCTCTCCCACCATCACGACACATTCACTGTACCTGGCAAGCACATCTCTGAGCA
TCACTGCACCCCATAGTCAACGGTCCACATCATAGCCCACACTCTTTCAGTGTGGGCACA
CTCCATCCAGTGGGGCCTGGGGGGATCCTACAATGTCCCATAAATGTGCCGTGATGCACC
ACCTAGGACAACTCCATGTCCCGAAAACGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 2100..2228, 2906..2989, 2994..3038, 3042..3164, 3168..3287, 3290..3469
1001..1030, 2100..2228, 2906..2989, 2994..3038, 3042..3164, 3168..3287, 3290..3469
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved