Dasypus_novemcinctus Locus HSPA8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus HSPA8
Dasypus_novemcinctus
HSPA8
GeneScaffold_1863
SNORD14
4486..4577
5916
AGTGCGTCATCGCGAGGCGGGGTCGGATGGGGGCGGGAGGGGGTGAGGCCCGAAGGGTA
GAGCCTGGAGAGTCATTGGGGCTTGTAGAGGCAGACGGGCGCCCATTGGTCGGGGAAGCC
GTGATGGGCAACGGGAGGGGTGGGCCCCTTCTGGAAGGTTCTGAGACGGGGTATAAGAGA
CAGGGTGGCGGGCGGAAACCGGTCTCATTGAATGCGAAATCGGCTTGCGGGGTTGCTGCT
ATTTATCAAAAGTCGGGCCTATCCAAAGGTAAGTTGGCTGTGCTTTAGCTGAAGCCGGTG
GTTATTACTGGGTGAGCGTGCAACCGGGGCCTAAGTCGGGTTTCCTCCCTGAGGATTTAA
TTTGCAAGGCATTGGGCAATTTTGCTGATCGGGATGGCGGCTTCCCCTGGGGTGGGTAGG
AGGGAAGGACGGGCAGAGCAGGCAGGATATGTCTCCCGGGGTGGCCGCGTGTTGAGGTTA
CCGCATCCGCTTTCCGGGCGCGCGGGGCGGTAGAGCCGGCCACTGCCTTTATAAGGGTGG
CCTTTGCTCGATTTTTCTCCTAGTTCGGGTCTTTCTAGGTTGATTCTTTAACAGAAGCCA
TCCTTGGCACACCTTTAGGCGTGGAAACATCCCGTGTAGTCAAAGCAGAAGGCGCATTCT
GTCTGGTTCCATTGAGCTGCATTCGCGCCGGGAGCGCAGGGGTGCGGGGAGGGGGTGAGG
CCTTGCTTCCGACTTGAGGCCTCGTGCTCGTCGACAGCGCAGATCCTCGGCATTTCCGTC
AGTCCGGGGCGGCCTCCGTCCGTTGGCACAGTGTCCTCTCTTGCGGCATTACTGCCGCTG
ACACGCTCCCGTGCCCTTTTCGTGGAAGGGGTGGAAGAGCATAGTTGGAAGGTCGGACCT
TGTGGTCTGCTTTGAAAAGCCTTGCAAAGGAAACAAACAGGTAAACGTTTTAAAAAAGTC
GTTTTGTTTTAAAATCGCCTTTTTTTTCCCCTGCAGCAACCATGTCTAAGGGACCTGCGG
TCGGCATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTCTTCCAGCACGGAAAAGTGG
AAATAATTGCCAATGATCAGGGAAACCGAACTACTCCAAGCTATGTCGCTTTTACTGATA
CCGAACGATTGATCGGTGATGCTGCTAAGAATCAAGTTGCAATGAACCCCACCAACACGG
TTTTTGGTGAGCCATTTTAAGTAAATGCACGTGTGGATTCGGGGGGATGGGGCGAGGGGA
GGATGTGCTGCCGGTAATTTGAAATTGAAATGTCTTAATAGAAAAAGAACTTGGGAAAAG
TTTTTTAGTTTGTATTTTTTTTTTTTTTGCAAAAGGTTAAAAAAGCCGTAATTAGTTTTG
ATTTATCAGTATAATAGGCCATCTCATATCTTAGTGTGGATTTAAGAATAATTTTTCTTC
ATTGACTAATTTGTTTTTTTAAAAAGATGTTTTATGTATACATGTTACTGGCAGCTATCT
CATTAGGAGTATACAGTCATGGTATTTAGTATAATCACAGTCCTGCATTTATCGCTAGTT
ATGTAGAAGATTTCTGTTTCAATAACATTGTGCTTCCATACGCTACTACTGTACGTAGCT
TTAATGGTTATTCTTGCAGAATTAAGGAGTTTTCAGATATATTCACATCATACGATGTAT
CTAAAGTGGGTAATTAAGGGCTTTTAATGTAATCACAATGTTGTACATTTATCACCTCAA
AAAAAAACTTTAGGACAATTCATTACTCCAAAAAGAAAATCCACATCCCTGAGTAGTACT
TTTAAATGGCTACATTTTTCTCACTGGCTTAGAATTTGAAATCAGAATGTTAACTTGGTG
TGGTGAGCCTTTGGCTATGTATCAGTCAGATTCACTTACTATGAACTTAAGTTTGCTTAG
GCACATTTGTGATCTTGGTATCTAAAGTAATGTGTGGTTGGGTCTTTATTGGAAGTTTGT
AGTACGATCCAGGTAATGGGAATTTGGTCGTTTTTCAGATGCCAAACGTCTGATTGGACG
TAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTGTGGTCGTGAA
TGATGCCGGCAGACCCAAGGTCCAAGTAGAATACAAGGGCGAGACCAAAAGTTTATATCC
AGAGGAGGTATCCTTTATGGTTGTGACAAAGATGAACGAAATCGCAGAAGCCTATCTTGG
CAAGGTGAGAGCTCACCACAGGGGCAGATCAAGCTGGAGGTGGCACTGTATGCACCAGTT
TCCCTGCACTAGCACACATACCACACTTGCTTTGGCCTGTGGGACCTAGAAGGGGGTTCA
AAGCTGTGGAGCTGTGAAATGGTGTACCACTAGAATTTTGTGCTTTAGTTTTTTTCTTCG
GTCTTGGCCAGTGCATGCCCCAACAGCTATTGATGGTTATTTACTGACTGTAGTTTTGTT
TATTATTAGACTGTTACCAATGCTGTTGTCACGGTGCCAGCTTATTTCAACGACTCTCAG
CGTCAGGCCACCAAAGATGCTGGAACCATTGCTGGCCTCAATGTACTCAGAATCATCAAT
GAACCAACTGCTGCTGCTATTGCTTACGGCTTAGACAAAAAGGTATGTATTTGATGCAAA
GTTGAGGTTAATTCACGAGACATCCTTAACTTAGCAAGATTTTAATACGCCTTTTGTAAT
GACAGGTTGGCGCTGAAAGAAATGTGCTCATCTTTGACTTGGGAGGTGGCACTTTCGATG
TGTCGATCCTCACTATTGAAGATGGTATTTTTGAGGTCAAATCTACAGCTGGAGACACTC
ACTTAGGTGGAGAAGACTTCGACAACCGAATGGTCAACCATTTTATTGCTGAATTCAAGC
GCAAGCATAAGAAGGACATTAGTGAGAACAAGAGAGCTGTCCGCCGCCTCCGTACTGCCT
GTGAACGAGCTAAGCGCACCCTCTCTTCCAGTACCCAGGCCAGTATTGAGATTGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTGTAATGAAATCATC
AATTGGCTGGATAAGAATCAGGTTGGTAATTTCTAGCAAACATGAAATGGGGAAGGGGTG
AGGGTGTGTATGGTCTCAGCAAAACCTTAACTGGACTTAAAGAGGGTCACAGTGATGAAT
TGCCCAAACATTCGCAGTTTCCACCAGAATTTAACTTGTGTTGGCATAGGTAGCTTCCTT
CCTTGGATGTCTGAGTGACCAAGGTTTCATGGAGTAGCCAAGGCTTTGCTTTCTATTATC
TTAACCTAGGCTCTTAATGTACAAGGTTATATCGAGCATGTGTCCTAGGAAAGGTTCTAG
ATGTGTGGGAGGAAAATATTTGCTAATAAAACATTGTTTTCTTTCTCCCAGACTGCAGAG
AAGGAAGAATTTGAACATCAGCAGAAAGAGCTGGAGAAAGTCTGCAATCCCATCATTACC
AAGCTGTACCAGAGTGCAGGAGGCATGCCAGGGGGAATGCCTGGGGGCTTCCCTGGTGGT
GGAGCACCTCCGTCTGGTGGCGCCTCTTCTGGACCCACCATTGAAGAGGTTGATTAAATC
AGCATACATACCTTAGCATTATTACAGTAAATTGAAGGACCCAAATTTGTAGCAAATACT
GCGGCAGTTTAAAGTCTAGCTGCTGTACAAAATTCTGGGCATTCTCAGTACTTGACTATG
GAATGTGTACAGTGAAAGGAAATTACATTGCACTTTATAGCACTGTATTGTAAGTGAAAA
ATGCAATGTCTTGAATAAATCTATTTAAAATTGGCACCATAAAATTGTCGCGTTTATGTT
TAAAAGGCAGCAATGGGTTACAGGGTTGGGTTTCCCTTTCCTGTTTGAGTCACAGGACAG
TAATCAAAATACTACATACTTTAAAAAGCTACAGGTTTATAGATTAAGATGTAGTTCTAA
GCATCTTCCTAGTCTATGAGAGGTAAGCTGGGCAGCATTGATACTTTAGGAGTAAGCACT
GAAATAGGTTACCCACTGCTGGCAAATGACTTAAGTGTTAAGAGGGGGAAGGGCTTCGGT
TTCATTTGGTGGCTGACAAAGTGAGGGCAGTAAAACAAAGGAAAGTTTCCCAGACTTTTT
TTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 2018..2223, 2469..2621, 2705..2991, 3095..3363, 3464..3666, 3767..3965, 4066..4259, 4362..4400, 4731..4916
1001..1205, 2018..2223, 2469..2621, 2705..2991, 3095..3363, 3464..3666, 3767..3965, 4066..4259, 4362..4400, 4731..4913
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved