Dasypus_novemcinctus Locus ENSDNOG00000006214
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000006214
Dasypus_novemcinctus
ENSDNOG00000006214
GeneScaffold_2004
SNORD101, SNORD100, SNORA33
1487..1558, 3629..3706, 4039..4168
4430
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTACAAAGCGAAGGAAGAGGGC
GTACCGCTCTGCAAGCCCCAGCCTAGCGGGGTCAGCTACACAGTAAAACAGCCCCGCCAG
CCCGGAACCTGGTACAGGGTCCTTACCACCCACACGCACACGCGCGCTCGGCCCTTCTCG
CTCACCGTAGAACGTGCTCTACGGACCTCCATAGGCCCCGCCCCCGGCAGGGACCCATGA
CGCTTGGGGCTGCCCTTGCGATGCCTGTTACGGCCCCAAGGACGGGCCGAGCAAAGACAG
ACGACTCCAGAACCTCTTCGATTCGGAAACGGGCGTTCCGAGGTCCGGCACCGCGAGAGC
CACCTTTTTCGTGGGCAGGAGTGCACATGCGTCCGGGGTCCTGAAGAGCCTTAAATATCG
TTCTGCGACCGTGAGCACTCTCTTTCCCTGCCGCCGCGGAGGAGGCGGAGGCTCGGGGTA
GGTGAGAAGGCGCGCGACATGCGGCTGTCTGATACTGATTTGGTCATCTCGGGCTGTGTT
CGGAGATTGGTCTTTGAGTCTCAGCGGGATCGTTTAGTTGATTAACGTTTTGCTTTTCTT
GTAGGGGTTTCAAAATTCGGCTCCACCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
CCATGGGGACGGGTGTGGGGGGGCTGTGCTGTCCGGTGAGGCAGTCTAAGGGCGTTCGAT
CAAACCAAGCCACTGCCCTGCAGTCTGAGACGTTAGAGGACGGGGTCTCTCCTGGGTTGG
TAAAAATTGACGTTCTCTTGCGTTTCAGCATTGTTGCTGGAGGTGTAATGGACGTCAACA
CTGCATTACAAGAGGTGCTAAAAACTGCCCTCATCCACGATGGCCTAGCACGTGGGATCC
GCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTATCAGTCTCAATTCTCTCGGTTGTTGC
AATCGGAACAAAATTTCAGCCAAAAGAGGAAAGCCTGTAGTGTTAATGGTGTTAGCAAAA
GTGTTCTGAATAGCATCCGTTCTATGGGAAATCTAGGAAGAGGCATCAGAACTCAGATAT
ACAGATCCCATTTGAAATGGGAGGGACCACTTAATAAAAACTACGGCGTTTGTATGATGA
CTTATGTGTCGGATACCCCTTCACTCTTTCAATGAGTGAAACATTGAAGTCTGACAAACC
TGTAGATTGGTGGGGGTTAGTAATTTTTATTAAAGAACAGATGGAACCTTTTTCTATCAG
TTTGTAAATTGAGTCTTTGATAATGGAATTTGAAGCTATTATAGATAAGGAAACCAATTA
GAACATGGTATGCTTTGTAAAAATATTTTCATCTACTGAAATACTCTGGGCTGGTTACAT
TGGCAAAACAGCATGCTCTGAGTTATTATGTGAACTGAATTTTAAAGGTTTTCAAACGAG
CTGAATTTAAATCAATTCAATCCACTTTGGTAGACTGGCCAGTTGAATCCAGTGGAAACA
GCACTCGCCTTATTGGATGTACTTCAGCAGGTCCTGGTGTGAATCCTTTGCACCATTTGT
ACCTTGGCAATGCTGTGCAATAATACGATGTCTGGGCCAGTAAAAGGTAAATTCTTTTTT
ATCTAGTAGTTATTTGCAGTAGTCTGGTAGCTTGAACAAGGTTTAATAAAGATTAGGGTT
TCTATGGGTGAATTAAAAGAATATGCTGTGTAACAAGCAGATAGAAATGGTTTTGTACAT
AAGTTTTCTATGGGTATGCTTGCATGTGTTTTGCCAGTGTGGTCAGTGCAGATGACTANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGTAAGTAAAGCT
TTTGCATTTCAGGCGCCAAGCCCATCTTTGTGTGCTTGCCTCCAACTGTGATGAACCCAT
GTATGTCAAGCTGGTGGAGGCCCTTTGTGCTGAGCACCAAATCAACCTAATTAAGGTAAT
TTACCTATCTAGGTTCAAGAGAGTATTTGCTTAATGAAAGTTGGGCTAGATAAGGGACTG
GTGTCAGGATTGTTAAAGAGATTTTTGCATCAAAAAAGCAAATTTTTCTGAGACGCATGC
CTTTTGCTCTCTGCAGGTGTAAAAAAAATCACATACCTGTAACATTGTTGGCTATGCTAA
AGCTGGTTGTAAAAACATTTTATACTTGCAGAACTAGATGGTAATTTTGATGGTACAAAA
TAGGTAGAGTGTGTATAGGTGATCTTGTTGCTGTACGTGATGACAACTGGCTCCCTCTAC
TGAACCTGGTGAGGAAAACTGCCACGTCACCATTTCTGACTTACAGCTACCTTTTGGATT
TTACTTTTATTGTCAGTAGCATTATTTCATACTAATACTGTGATGTAAATTTGTATTCTC
TAATAGGTTGATGACAACAAGAAACTAGGCGAATGGGTAGGCCTCTGTAAAATCGACAGA
GAGGGCAAACCCCGAAAAGTAGTTGGCTGCAGTTGTGTGGTTGTTAAGGTAAGTCCCTGG
GATAAGGAATGGTCCTGGGTAGCTATGCACAATCTTGTGTGGATGCTAAGTTAAATGGCT
AAATGAAGAATCCCTAAAAAGTTTCTTTCAGCAGGCTTGAAAACAGTTACTTTATCAGAA
AACGAAAATAAAATTTTTCAAGCCAGCCAATGTCTCTGCTTACCTGAACGTGTTTCTGCA
GAAATTTTGAAAAGGCTGGCAATAGTAAAGCCATGCTACGAGCCTTAAGGACACTGAAGT
CATTAAGGTCCCTGAAAATGGCAACAGCGCATGGTGTGATTAAAACTGCTCTAACTACTG
TCAAGAACTCAGTGACACTCTTAAATGTTTATCAGAAATCATTTTTTCTTTTTAGGATTA
TGGCAAAGAATCTCAGGCCAAGGATGTCATCGAAGATTATCATAAATTAAGAAATGAACA
AATAAAAAAACTTTGCTCATTCTTCATCTTTGGGTTTTTGTTTGGGGCAGGAAAATAGGT
CAGACCCGTAAGTATTAATAAATTGCTGTCCTAAAGGAGGACAGTGAGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1168..1284, 3252..3354, 3786..3887, 4255..4305, 4308..4316
1001..1014, 1168..1284, 3252..3354, 3786..3887, 4255..4305, 4308..4313
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved