Dasypus_novemcinctus Locus ENSDNOG00000014939
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000014939
Dasypus_novemcinctus
ENSDNOG00000014939
GeneScaffold_7170
SNORD59
26521..26591
133822
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCCCCCCCTC
CCCAAAACAAAACAAGTGCTATTAAATACCGGGCTTTGGGGTGAAAACACAGTGTTTCAA
GCAGCTCTTGCATAGTAACTCTTACGGATCGAATCGAAATACACGCCGATGTCTTCTTAG
GTATCTCCAGATCTCTGTAGAATGGGTATTTATTTCATAGTTAGGTCAGGGTTTTCTTGG
ATTGGGCTCTTTCAGACAAGTGTGCCTTGTGTTTTTAACAGGTTTCTGAGAAGAATCAGT
GGGGAGAAATTGCTGAAGAGTTCAACTTTCCCAGAAGTTGTTCTAACGCTGCCTTTGCTT
TAAAACAGTATTACTTGCGGTGAGTAGTAGTAACTCTTTCACAGTATTTGGAAATCTGGG
ATTTAAGGGATTTGGGGGAAGATTTGTTTCTAGCATAAAACAGAAAGAAACAACAAAACC
TTGCACACAGAACAGTTTCTAATCACCTATTAATTTCATTCGGATAAACATTAAATATAT
CAATAAAGTGTGAATGGGAAGGTGCAGGTTTTCCTCACCTATTTTAGAATTGTTTACATT
TTTCATGTAAAAACTTTACAGGTGATTTCCCCCCTCCCTCCCATTTTGGTAAACATTCTT
TTGTGACATTGTTATTGATTGTTTGATATTCACTGAGGGGCAGAAAGGTGATGTTTAGTG
TAAGTTAAGATAGTTAATGAAACTTTGTATCCCTTGGGAAATTTTTTTTGGTTTGGAAAC
TCTTTTACCTTTTTATAACTTTAAGAATTTTTTAAAAAATGGAACCTTTAGTACAGAACG
GTGTCATTGAGTAGTTTTTAGTAGATATTTTTACATAACGTGTTGATGCCCTAGGTGACC
AGGATTGTTTTTAGAATCGTCTTTTGTCAAAATTTTGAGTGACTTAGGAACATTTGAAAG
GATTATTATATCTTTAGGGAAATAAGGGATACTGTGAAACAGGATATTATGGTTTGGAGA
TTTTCTTTGATTCTCCTTCTCCTTTGACTGCTTATTTCTTATTCTGCTGTTATGTGATAC
AATTTAGATAATACATTTTTTGATTTAGAGTGGAGTTTTTTTCTTCCAGTTATTCTTCTA
GGAATATTTTCGTTTTGTAATTTACTATGTCATCTTTTCTTTTTAATGTTTATTTACCCA
TAGAGAGTCCTTAGTTGGTGGTTGTTGATCAAAACTCGAATAATACTCTTTGTATTTATT
GCTTTTTAATATTGATGTTACAGGGTGACCTTTTTTTGTAATGTGGCTTCTGCATAATTT
GGGTTTTGCATTTATTGTTGCTCAAAATGCACAGTTATTCTGTGTCATTTTCAGCATTCT
GAAATAGGAAATGCAGAAATGCACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAATTATACATCCTGCCATAACCCACTGAGTGTACTGGGGGAGAGTGTAAACTACA
ATGTAGTGCAGCAGTGTTCCAAAATGTGTTCACCAAGTGCAATGAATGTGCCACACAATG
ATGAAAGAGGTTGTTGATTTGGGAGGAGAGCGATGGAGTAGGGTTTGGGGTATATGGGAA
ACGCTTATACTTTTTAATGTAACATTTTTTGTGATCTATGTATCTTTTTTTAAAAAGACA
AAAAAAGAATTTGATAGACAAAAATAAAAAAATAAAATAAAGTATATGGACATTTAAAAA
ATTTAATGAAGAGCGATTGAGAGGTAAGGAATTTTCTTGTTTGTCTGCTCTAGTTTTATG
TTTATTGTTATTATTGAAATAATAAAAATGTTCTTATAGTGATTAAAGTGATGAATGCAC
AACTGTGTGATAATACCAGATACCATTGACTGTACACTTTGGATAATTGTATGCTTTATT
TTATTGTATGTATCAATAAAATTGATTTGTTTTTTAAAAATGTAATGAGGACAAGTAGGG
GGTGGAATAACCCAGAGCTATAAATTAACAAACAAGCAAAATCAAATAATCCAATAAGCA
AGCTAATAAAGTCAGATGAGGCATCTGCAAATCAGAAAAGATCTGTAGGGAAGAACGGAT
GACAAATTGAAGATGGGTAGAAATACAACATTGAAAAAAGAGAGTGAGAGAAGGAAAACA
CAAACAAAAATTTTAAAAATTTAAAATCCCAGCAAAAGTAGACACAAAAACAATCTCTGT
TTTCTAAAATTAATGTGTCATAAACGATTCTGTGTGATCTGGAAAGTTTTAGATTTACAT
TTTAGATTTGGCAGAAATCATTCTATGGCATATTGTACACTTTAATAGCTTCTTGGGTAG
AACATAAAATGGACCCAGAGATTCTTAGAGCTAGAGGAGACTTTGGTGCTTATTCCACAT
TGGCAGTTTCCCTCTTTTCTGAGGATATTCACATGTGGGACACAATCCTGTGAATAAAAC
CACATTTTCTATCAGCAGTGAGAATCTCACAAGTTCCAGTGAGCTAACTATAATTCCATC
TTTCTCCCTTTAGGATCTGCCCACGCCAGGGTGATGAAATATCTCAGTTGAAAATCATTG
TTCTAATATTCCCCCTATTTTACAGGGGAGATTGGGGCCTGAGTTCAATGATGCACTTGA
GGACTCCCATAACAAGCCACCTAATTCCCAACCCTTTGCCTATTCATCCTGAATAGTTGA
TGTAGGATCATCACTATAGTTATAAGAACCACACTTTAGAGCTTAAAAGCACATCTATAT
ACTATATCCCCTTCAAGATTCTCAACCCTGCAAGGGAGGCAATATTACCATGGAATTTTT
AAAAATATATTTTTACTGAAGTTGTGAAGTTCTGAACAGCCATGGACATGTGTAGAATTC
CCACACAACACCTCTCCACTAAAACACTACATTGTTCTGGAACATTTCTTACAAATTATA
AGATAATATCATCTGACTATTACCACTAACTATAACTATCGCTTACATTTGATATATGTT
TTCCATAACCCCGATCAACATAGTGCATCTTTGGCACTGATGTGAGAATACTACAATATT
GCTGTTGACTACAGTCCATAAGTTTTATTAATTGTATTTTTCCCATGCTTCTCCACATTC
TTACCACCTTGCAATAGTGATGTACACTTGTTCTAGTCCATAGAACATTCTTATTTTTGT
ACTATTAACCACAATTATCACCCACCTCTGGATTCAGTACATTATTCAGTTCCTAGATTA
CTCTCTAGCTTTCTTACAATTGACATTCCCATCCCTAGACTCCCTTTTAACCACAATCCC
ATTTATAAACCCACTGTGTTAGTTCTACTCCCTATAATGCCACCATCAACTCTATTTCCA
CACTTTTACAGTCAAGTTAATTAAAACTTCTATATATATTAAGCATCAGTATCCCTTCTC
AGCCTTCCTCTTATCTCTTAATAATTTATACTCTAGCTTTTAACTCCATGTATTTATTCT
TCATATTTAGTTCATATTAGCAAGAACCTGCAATATTTGTCCTTTTGTGTCTGGCTTATT
TCACTCAGCATAATGTCTTCAAAGTTCATCCATGTTATCATATGTGTCCCAATTTCATTT
CTTCTTATAGCAGCATAGTATTTCATCATTGTATATGCCATATTTTGTTTATCCATTCAT
CAGTTGATGGACACTTTGGGTTGTTTCTATCTTTTGGCAATTGTGAATAACATGGCTATG
AACATCACTGTGCAAATGTCTGTTCAGGTTATAGTTTTCAATTCTTCTGGATACGGTCAT
ACCTTGGTACTCAACTACTTTGAAACTCAACGAGTTTGGAACTCAATGCATTTTGACAAA
AATATGTTGTACCAGTACTTTGTCATTTGTTTGGTACTCGATGCACAAGCTAGAACTTGG
TGTTGGTTGCCTCGTGATTCACTACCCTTTCCAGCTGCAACTAAGTGTCACGTGTTAGTC
ACACAGGTCCGCTTGCCCTGTGCACATCCCATTGCAGTCTTAGCGTCTAGGGTCATTTGG
TGTATTTTGTGCTTTTTTTTCTCACCATGGGTCCTAAGAAAATGAGTACTAATAGCGCTG
AACAGAAAAGAAAATTACTTCACACCACCATCAAGCAAAAAAAGAATTAATAGGTAAATA
TGAGAGCAGTATTCCCATTACTGATCTTGCTTGGGAATACGGTTTGCCTAGAACAACAGT
CTCCACCCTCATTAAGAATAAAGAAGTGATAAAAAAGGCTGATGTTGGGAAAAGAGTTAA
AGCAGTAACAAAGCAGCATTCCCAAACACTTGGGGAAGTTGAAAAGCTGTTATTAATTTG
GGTAAACGAGAAGCAGTTAGCAGGCGACAGTGTATCGGAAGCCATGATATGTGGAAAAGC
AAAAGTGTTGCATGCCAATCTTTTGAAAAACAAACGGAACTGAGTGATGAGAATGTTGAA
GTTTTTAAGGCCAGCCACGGCTGGTTTGATAATTTTAAAAAGAGGACCAGCATCCGTAGT
GTCTTGAGACATGGTGAGGCAGTGAGTGCTAATAAAAAGGCTGCTGATGAATTCGTCAGT
GAATTTCAAGACTGCATAGAGGCCGAGGGTTTTATTCCTCACCAAGTTTTTTACTGTGAT
GAGACTGGAATTTTTTTGGAAAAAAATGCCAAGTAGAACCTACATTACCAAAGAGGAGAA
GGCATCACCAGCCCACAAACCAACGAAGGACAGGCTCACTCTCTTGTTGTGGGGGAACGC
TAGTGGAGACTTAAAATTCAAGCCTCTACTAGTCTATCATAGTGAAAACCTGTGAGTTTT
CAATAAGCATAATGTCATAAAAAGCAAACTCCATGTGATACGGAGAGCAAACAGCAAAGC
TTGGGTCATGAGGCAATTTTTTACCAAGTAGATTAATGAAGTGTTTGGGCCCTTGGTGGA
AAAAGATTTGCTGGAGAAAGACTTGCCTCTGAAAGCTCTCCTGCTTTTGGACAATGCGCC
TGCCCACCCTCCAGGCTTGGAGAGTTCAGCTTCATCTCTGTAAGGTTCCTGCCCCCCAGC
ACTACTCCTTTCTTCCAGCCCATGGACATTTCAAACTTCAGAAAGTCGTGTCCCCAGACA
CTTCTCCAGAGGTGTTTGAGATCACCTCTGACACCCAGGTGACCCTCACCAAATTCTGGA
AGGAGCTTTTCAATATTCAGTGCTGCCTTAACCTTATTGATAAGACCTGGAACAAGGTCT
CTTATAGGACAACGAATTCAGCATGGAAGAGTTTGTGGCCAGAAGCTGTGACTTAGAGAG
ACTTGGAAGGGTTTGAGGCTGACCCAAGCCTGCAGGTACAGAGGGCACAGCTGTGCAGGA
CATTGTACCTTTGGCCAATCCATGGGCTGGGGTCAATGCTGCTGATGTGGAGGAACATCG
TCAGGAGATCAGCACTGAGGAGCTGCAGGAGCTACAGAAGAGCAGCAACAAGAGATGGCT
GAGAAGATTTCTTCAGGTGAGGAGGAGATAAGGGAGGATGTCCCCAGTTCCTTGATAAAA
AAAAAAAAAACATGTGCAAAATGGACAGAAGTTCAAAACTTTTGGAGAAGTACCATCTGG
ACAAAGCTCTGACAAGCAGAAATGCAAATTTATTGAATGACCAAACAATTTCACACTTTC
GAGGAATTCTCTAAGGAAGACAGAGGCAGCCCTCATTGGATGAGTTTTTAGTGAAGGTGA
CAAAGAGTGTGTCAGAGCCTGTGGTGCAAGTTGAAAAAAGGCAAAAAAGAGAAAGAATGC
CTGAAGTGCAAGTGCCGGATGTTCTTTTGGAGGGTATTCTCTCTCCAAGCAACAATGTGA
CCTCTCTTCCTCCCACTCTTCTCCCACCGTCCCATTAGGCCATGGACTCTTCTCAGTACA
GGTAAAGTTAAGTTTTTATTTCATATAATCTAAGTATTTATTTCTAGGTTTACTTCTCAT
GTACAGTAATAATATACAACCCTTATCTTTTTACATATTGCCTTAAAAATGTGCATTGTC
TTTGGTTTGGAAATGCATTCAATTTATTTACTTTGTTTTTTATGGGAAAAATTAGTTTGG
TACTCATCATTTTTGGTACTCATTGCACCTCCTGGAACCAATTAATGATGAATACCAAGG
TACCACTGTATATGGATAAAGTATTGTGTTTAGAAGTTCACAATGCTTCGATTCTTTTTT
TTTTTCCGAGTGTTTGTTAATTTCAAGTACCATAAGAATTCATACTGTTTCCATTTGTAA
TCAGTTTTGTGTTTTCCCCCATCTTTGTTCATTTACTTTCACTTATTTGTATGTATTTGT
AAAGCATTTATGTTTCTAAAATCAAAATTTAAGAAAGGATATACTCAGGGGTTCCTCCCT
TCCCTAGCTCTTCTACTTCATTCCCGCCTGTGCTCTTTTGGTAACCAGTTTCCTTAGTTT
TTGGTATTCTTCCTGTGCTGCTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATCTTTAAATCACTC
TTAGTTCTTTGAGTTTGTTTGTTTGTTTTTTTAGCTGCACAGTGCTCCTTTGTGTGGAGG
TATCCTAGTTTATTCAACCAATCTCCTGTGTAATGGCTCTTAGGTTGTTTCCAATGCAAA
TAATGACAAAATTAGTAATCTTATGCAAATCTGAGTAACCTTATGCAGTCATATTTTTAA
ATTGTTGGGAGGTGTATCCTCAGAGTAAATAACTAAGGTGTGGATTGACCTAGCAGTCAA
AGAATGAATGCATGTGTAGTTTTGTTAAATATTTTTAAATTCTCCTTTGTAAGAAAGAAC
TATTTTGTGTTCCTACCAGCCAGTGATGAGCGCGCCTGTTCCCTTGCCGTATATTGTCAA
GTTTTTAAAGTTTTATCAGTCCTGGGGTGGGAAATGTTATCTCACTATCTTTTTTTTAAA
GATTTATTTTATTTATTTATCACCCACCCTCCCCCCCACCACTTGCTTGCTGTCTGCTGT
GTCCATTCGCTGCGCATTCTTCTGTGTCTGATGTCTCTGTTGCATCTCTTGCTGCACCAG
CTTTCCACAGGCGCTGGCCATCAGCTCTCTGCAGGCACAGGCCAGCTTGCCCTCACAAGG
AGGCCCTGGGAAGTGAACCCAGGGCCTCCCATATGGTAGACAGGAGCCCAGTTGGTTGAC
CCATATCCACTTCCCTCATTATCTTTTAATTATTGAGATTTCTTAGCATGTTTTAGTATT
TGGTAATGCCATTCCCATCTCATAGTTCTTTTTTTTTTTTTTTTCCACAGACTTCCTTGG
GTATTCATTTCTGTTTGCTTTTTAATATAAACTTTAGTATTTTTTCTAGTTACAGAAGAA
AATCTTATTGGTCTTTTTCTGGGGGAGTACATTAGATTTATAAAGTAACTTAGAAGAACT
GACACCTCAGTAGAGTTGTTCTGTCCAAGAACAAGGGAAGACTTTCCATTTGCTCAGATA
TTTTTGTGTTGTTCAAGAGTCTAAAGTTTTCCTCATAACTTTTGAAAATTTCTTGTTTAT
TCTTCAGTCTATACATTTCATGTTGCTATTGCAATTATGATCTTTTCTTCCATTGTATCT
TATGATTACTTATTGTTTGCTTATATGAAATCTAATATTTTATACTGTAATCTCTTTAAA
AATCATTTTACTGTTTATATTCGTTTTAGTGTTGATTTGAGGGGGGGGGGAGGTGAAGGG
GATTTCCAGGTGTAATAGCATGTCATCTGCAAATAGGGATGGTTTTGCCCCTTCTTTTCA
ATTTTTATGTTTTTGTTTATTTTCTTTAGTCTAATTACATTAACCATTACCTCCATATTA
TTAAGTAGTAGGGAAGAAGGGGACATCCTTTCTGTATCTTGCTTCTGACCTTAGTTTGAT
CCCTTTAGGTAAGATACTGCCTATTAATGTGTTCTTGATTCAATGTCTTAACTCCCTATA
TGTTCTACTAATTTTAGTTGCAATAATTCTGTGATATATAAAGGTATTCCTATGTCTTTA
TTGAATGAGCAAAATTGCTATTGTCCTGTCTATTAGCACCTTTTCTTTGCTGGCCTTTGC
ATCACTTGTTATTTAACAGAACAAGGCAATAATTTAAATCATAGCTTGATTTTAATGTTG
AGACTAATACAAACCATGACTTAAATCAAGTTGAAAAGTAATGGTTTTTAGTTTAAAAGA
CTTCTTTATAGGTTGTCTACCCTGTGAGAAGGAAAGCAAATTCACACTTTAGAAATCAGA
AATCTTATATACTTGTTTGGGTGATTTCATTCAAATCTACCACTACTAAATTAAATGTGT
TATTTTTATATTTGTCATTGTAAAATTTGCCCTCAGGATTAAACGTAATTTGGATATTAA
AAGATCTGTTAGTTTTGAGAGTTGCCTTGGAACATTCATCCTTCTTTCTCCCACTTTATA
AACTATGGGGGTGAGCCTAAGTGTGTGTGTATGCACACATACCTATACATACCGCAAGTA
CTCTTTCAAGCCATAAGTAAATTGCTTGGTAATTTATCATTCAATTTTTGAGTATTCCAA
ATCTTGTATTTGAATTTGAATTTGTGCCTGAATTTACAAAGTCTTACAAATTTAAGGGGC
TAAATTGATGTAGTTATTGTATTCAAATTTATTGTTTTATAGAGATGTAGTAGTAGAGCT
TATAGAGCCTGAATATTTAGATTCCTAAAGATATGAACAAGAAGTACGTACTAAGCTGTA
ACTGAATATTGGCTTCTGAATGTGTTAGTCCATAGCATCATCAATATCAGAATTAGAAGG
TAGAAGGGGTTTCAAGAATCTGGTCCAGCCTCCTGATTTCTCATAGGCTAGGTATAATTT
TACTGAAAAGCCAACTAAGGTGAGCATAAGAATAACTTGCGTATAATCACTGGTACTTAA
TGATGGGAGGGAAAAGGAAAAGCAATTCAGAGTTTACTTTATTATACTAGCCAATTCATT
CTGTTTTCAAAGGCATATATTTAGAAGATTATCAGAGATTTCTTAGCTACTATAAAACTT
GACCTTTACTTTTACATTAAGATGCTTCTACTGACTTATACAATCCGTGAGGTGTTAAAT
TGTTGGACTGTAGAAGTAATAAATTTGCTTTTGATTCATCATTTGCACCCAACAGTCTTG
TCTCTTTCTCTTTTCTTTCCAAACGATTGCATTTATAAGATTAGAGAGCGCAGCAAACAT
ATAACAATCACTGGTAAAAAAAAAAAAAAAATTCATTTTTTATTACAGCTAATCCTTATT
TATCTACTTAATATTTTGCTTGGAGAAATTTAAACTTACATATTTGATAAAGCTGGACAT
TAATTAGGGTTTTTTTTGTTTGTTTGTTTGTTTTTTTTTGGTATTTTTTTCGTTTGTTTG
TTAGTAACTCAGAGATACTAATTTAAAGTTTTCAGCCTGGTACATTATTTTTTAGATGGA
GACCTCTACTGGAAATACGAAGCAATAGAAGGATTCTTTTATACATTATAAAATACTTAG
ATAAGGGGACAGTAGGGAGAGAATTGAAAGAAAAGTGACTGCAAAGTAGCTTTGTGAAAG
AACCTTTCTTATGATAATTTAAATAACTGTACTTTTGGCTTATTAAATAATGTTAACTGT
TTAAAAAAGCAGAATACCAAGTTTAATTTTGCTTTTAGCTAAGGTTTTTAAAAATTTACT
GTGTGCTGAGTTCTGTACTCATTTCTTCTCACACCTCCTTATCACATAGGGTACTCTTAT
TTTTCCCCTGGAAAAGATTGAGAAAACAGGATTAAATGGGTTTGAGAACCTTGCCCAGGT
CATAACAGCTAGTAAGTTTAGGAACTAGAATTTTAATCTGGGTCATGTGGCTCTAGAAAA
GACATGGTATATGTACTGTCTTCCCCCAAGTGCACATGATTGCAACTTTATAAAATAGCT
TATGAAGACACAGTCTTAAAGGGAATACACAAAATATGAAAACGGTTGGGTTGTGAGAGT
ATTACTTTTATTTTACTGTAAAAATCCCTTAGTATATATGCTTATAGTAAAATTTTTGTG
CTGCAGTACAGTTAAGAGTATAGTTTACTTCCACAAATGTTCATCTTAAGGGATTTTCAC
AAAAATTCAACAAGATACATATCCTATTTTATAGAATATCCTATTTTATACATGAGAAAA
TCATTAAGTACCATTGCTAATAAGCAGTGGTGTCCAGATTAAAGTTTAGTTTTGTGAACT
ATAATTCAACACTCTTATTGTCTTTATTGAAAAATAAAGTCTTGGGGTTATTAAGGATTT
TTTTTTCTTTTAAATGTTTATGTACTTCATGAAGGCCCCTACTTCAACATCTAATACATC
GTAGTTGAACTAAGTCAGAATATCTTCTGCCACTGGGGAGTTTCTTAGGTGGGTTTCTCA
GCAAATGGGAACTCTAATTTGGTAAATGCTACAAGAATTGAAAACTTCTAAAAATTGTCT
TAGAATTAATAGTATAGCATTCCATTTATCTGACTCTTTCTTTCTCTCTCTTTCTCTTTC
TCTCTTTCTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCTCTTTTCT
TTCTCTCTCTTTCTCTCTCTTTCTTTCTCTCTCCCTCTTTCCCTCTCCCCCTTTCCTTTC
TTTCCTTTCTTTTCTTTCTTTTTTGGGAGTACCAGACCAGGGATTGAACCTTAGACCATG
TATGAGGGAAGCCCTAGTGCTCAACCACTTGAGCTACATCAGCTTCCCGACAGAACCTTT
TCTGGTATGATTTTATGAAAGAGGCACCAGAGTTAGATAAATAATTGTAACAAATGTAGC
ATTTTGTGCAATTTTATATTGCACCTGAGTTTTGTTTATTTTTAGGTAAAACAAACACTT
CTATCTCCCTGTCTGTCTTTACAAGCTACAACAGGAGAATTGAATCTTGTGTAGGATAAG
ATTTGACACAAAATGATATTGATTTTATTTTAAATTGGCACATTAGAATTCAAGGATTTT
GCAAAGTACTATTCCTGAAAAACTGGTACTAGAAATGATGTAATGTGGTGGAGGCATTTG
GGGAATGAGATATGTTTGTTATCATAATAATATTAACATTTATTGAACATTTACTGTTTG
CCAAAGACTGTGCTCTATGGGCATTATTCTAGTCCTGAAAGCCATCCTGTGAGATTGATA
CCATCATCACCATTTTATAAATGAGGAAACGCAACCACAGAGTGGTGGGACTGGAATTTT
ATCCAGGTCTTCTGCCTCAAGACCAAGCTTAAACCACTATTTGGAATCTTGCCCTTCATT
CATTCATTCATTCATTCATTGAATAATGATCAATCGTTTATCATGTGTCAGACACTGTTC
TAGGAACTGGTTATACATGAGTGATGAAAACAGAACAATTTCTCTCCTTTGGAACTAGGC
AAAGGAGATAGAAAACAAGTAAAACAGTGTATAAGATAATACTGAAAAGAGAAAAATCAA
TCAGATAAAGAGAGAGAGTTTTGGGATGGGGGACAGTGTTAGATCTGTAGGTAAGAATAC
AGGAAAAATCTTTCTGAAAGAATGACATCTGAATGAAGACCTGAAAAAGATGATGTAGCA
AACCAGGTGACTCTCTGGAATGAGAGTGAACAACAAGGGAGCATGTCTGGTGTATTCTGG
GAATAGTAAAGGGGCCAGTGTGGTTAGAATTGGTGGCAAGGAGAGAAGTATTAGATCAGA
GAGATAAGAGAGAACTAATATCTTGTAGGGCCTTTGGAAGGGCTTTACTTTTTACTGAAG
CCATTGAAAGACTGATCAGCAGTGTCATTATTTGTATCTTTGGTTGCTTTGTTGTATATA
GATAAAGGAGGTCAAGGGCAGAAGCAAGGAGAAGGCTTATAAGATGATCATGGTGATTTG
CAACTCCTGAGGTGATGAAAAGTCATCATAATTTGGATGGATTTATAAAGTTTCATATTT
TAAAAAAGTTTAAATGTTCATCAGCATACAACTACTCAGATACTTCCTGAGAACTCATCA
AGTGCCAAGTTCCACACTTTTTCTATTTTAAACTTTACTTTTCTTGATTATTGTCTTAGT
TTGCCACAAGGCTACTGATGCACAGTACCAGAAATGTGTTGGCTTTTATAATTGTGGTTT
TATTTAGGGTAAAAGCTTACAGTTCTGAGGCTGCAAAATGTCCAAATCAAAGCACCATCA
GAGATGCTTTCTCACCAACGTCAGCAACTGGTGATCATAGCGTCCTGCTACTTGGCAAAG
ATGGCCGCTGATCTCTGCTGGGGTCCTTGTCTTCCCTTCCAGAATCTGCCGTCTGTAGAC
TCAGCTGTGGACAACCAGACATAGTGCTTGTCTCTTCTGACCTCCCCTCCCAGTCTTGGC
TCTCACCTTTCTTCCTGAATTCAGCTGTGGGCTATCAGGCATAGAGCTTATATCTTCAAC
CTTGAGCTGCTCCTTGGGCTCAACCACTTGGGGACTTCCTGCTTAAGCTTTGGCTGCCAG
CAGTTCTCAACTCCTCTCTCACATGGCAAGATCAAAAATAGCAGCTTCCTTTCTCTCTGT
GTCCCTCTGTTTCCCTTTATATAAACCTCCAGTAAGAGGGTAGAGACCCAGCCTAAGTCA
CACCTCACTGTCTTAGTCCAACCAAAAGGGATCCGCACCTGCCGAAATGAATTTGTTCAA
GAACATAATTGTTTTCTTTTTGGGATTTAGGAAAGAATTTCAAACTGTCACAATAATCAA
AGTATAGTAATAGTACATGCTTATTGTAAACAATTTAGAAAATACACAGAAGGGGAAAGT
ATTGAGCACTGTTAATATCTTGATGTATTTTCTCTTAGTCTTTATAATAAGGATTGTACC
TTAAAACCTATCTTGCATAAGCTGGTGCCCTATCTCTCCCATGTTAGCTTCTTTAGGGCA
AGAACCATACTCTTTATTTCTTGGGTGTCTCACACGGTGTCTGGTTCATGATGACTGCTC
AATACTGTTTGCTTTGAATTAATTATGCCAAATGTTATATGGTGTATTAGTCAGCCAAAG
GAGTATTGATTCAAAATACCAGAAATTGGTTGGTTTTCATAAAGGGTATTTATTTGGGGT
AGAAGCTTACAGTACCAGGCCATAAAGCATAAGTTACTTCCCTCACCAAAGTCTATTTGG
AGTAAGATGGCTACTGACATCTGCAAGGGTTCAGGCTTCCTGGGTTCCTACATTCCTGGG
GCTTGCTTTTCTCTGGGTTCAAGGTTCCTTTCTTCCTGGGACTGGCTTCTCTTTCCTCTG
TGAGCTTACTTCCCAGGGCTCCAGCGTAAGTCCTCAGCATCAAACTCCAACATCAAAACT
CCAACATCAGAAGCCCTCAACTCTGTTTTTTGCCATGCCTTTTATCACCCTTGGAGGGTG
GGGACTCAATGCCCTAATCATAATTCAGTCATGCCCAGGTACAAATCAGATTACAAACAT
AAGCCAATATCCATTTTTGGAGTTCATAACTATATCAAACTGCTACATATGGGTACAGTG
ATTTGTAATTTAGTTAAGGAAACACTCAGCAGGTATAACTGAAATAATAAGGCTGATTTT
TCCTCATTGATGATTAACTTCTGACTTTCGTTCTTCTGAGTTTGCTGAAGCCAGATCCAA
TTCCTGAGAAGGGAAAAGATGGGGGGGGTGGGTAAAGGCTGATTTTTCTTATATATATAC
TTTACAGAGTTGTTATGGGAGGTATATAAGTTAGTATATATAAAGTGCTTAATATGGTAC
CTCGCATAGTAAGTAATCTATAAATGCTAATTCTGATTATTTTCTGGCTGACCTTATTTA
ATTGATTTAAAATTTAACCCACAGATTATGTTTCTATAATTTGATCACCATGTTATTTAC
CAAACTTAGCTCTTAGTGACTTTTGGCATTTTCCACCTCAAGAAGAACAAAACTTTGTGA
TCCTTTTGGGTGTATCTGAAGTCATTTTCTAAAAGAACTACTAAGAAAATTATTTTTAAC
TAATAACAGTATCATTGAAATAAATGTATAACTTTAACAAGGTAATTACTTTGAAAAGGG
TAATATCCATTTGAATAAATACTGGTTTTGTTGTTTTTGAAAAACAAAGTTTTTTTAAAC
TTATAGAACCATCTCATACACATGGAGTGATACAGGTAAGTACTTAAATTTCTTCAGGGG
CTCTCCATTGCTAAAGAAGAAAGTCCAAATTTCTTAGTAGGGCAAACAAGACCCTTCATT
ACTTTTCCATTCTCATCTCCTGTCATATCTCTTGCACATTCTTTGAGGAAAAACACTTAT
TGGATAGTAAATAAGTGTTGGTGGAATTAGTTAATGTACTGTGAACTCCAGCCATACTGA
TCTATTTATAGTTCTTCAGACATGCCAACTTTTTCTTGCCTCTGCCATTGCATGTACTGT
TTTCTCTGCTTGGAAATCCTTTCACTTCTTCATCTGCTGTATTCCTACCCATCTTTTGAA
ACTCAATATAAATGTCACCTTCTTTAGAAAGCCAATTCTTATCTTTCCAGGCAGCTTTGA
GCAATCCTTCTTTATAACTTTGCTTTCTCCACTGTTTATACCTCTGTTATAGACCCTACT
ATTTCCCCTGTTAAAGCGTATGAGCCTAAGAGGCAGGGACCTTGTTTTATGTATCTTGTA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTTACTTAAAATATATG
GGATTAATGGAAATTAAAGAATGAATGCTTGAAAGGCTTATTGGAAATAAGAAAAGGAGA
TAATTTTGTTTTGAGGGTAGAGAGGAACTTATGGCAGAGGCTTTAGATCTGGCATTGGAA
GATTGCTTGGATTCAGATAGAGAAATTTTTAGATAGGAGGAAAGGGGAAAATAAAGGTAT
GCCCAGTGCATTTTACTAGAGTAAGTGAGTACTGTTGCATCAGAGGGTTATGTATGTGAT
TGGTGTTAAGGGAAGACCAGAACTGAAGCTTGTTACCAGGTAGTGGAGGATTTTGAAAAC
CAGGCTAAGATATTTGACTTTTATATATTGGGAGAGTATGGATGTGAGTATTTTTTGAGC
AGAACAATATCATGATAAAAATGGTGCTTTGAGAACATTAACCTTACATTGGTGTGTAGG
ATAGATTTGAGATAGGAGAAAGTAGTGGCCAACACCTGCCTAATTTGAACAGAATATGAT
ATTATTTTTATGAAATATTCAGATAAGTGTGAATTACTACTTCTCAAAAAAATAGACAAT
GGAGTCATAGTCATAAAACATTTCAAAATCTCATTGAATTTTTAGAGTTACAACCATTTT
TACTGGACTATCAATTTACAGAACAGGTTAATAGAGAATTCTATTACCTGATAAACCAGC
AGTTGCTGTACTTCATTTACTTGAGAGTAGGTCCACCATTATGAATTTAGTTATGTGGTA
ACTTTTAAAATTCTAAATGAATTTTTCTATGTATTCTCTCTCTCTGCTGGAGGAAACTTT
TCACAACCTCATCTCTGAGTGCACTTCCCTTTTTTCTTCAAGTTCTGGAACTCAGCAATT
CTCTTTATTAACTCACATAATTTAACAACCTTTTCCTCTCCATCCAGCTAAAACCATGTG
AGATAGGGCCTGGTAGGGATGACTATATATACACAATAAAAACAGGCTGAACTGATGATA
TATGTACATATTCCCTACCTTTAGAGTTCTATAGAATTTGTTTTCTAACTTTAGACATGC
CTGGACAAAAGTTTGTGTGACTGGTGCATGTGGTTAAGAAAAAAGGGTTGCTTTGTAAAA
GGTACTTCGGAGTACAAAGAAAGGTTGCAGTGGGATATGGTTTGGATCATATCTTATTAC
AGTTCTTCTGAAAGGACTGTGCCGTTACTTGGAAGCTTATTTTGACATTAAACTGATTTG
TTTTGGACATTTCTAAATTTTCTCCATCCATCTGTAAGTGACTTTTAAATAGTGATCACC
AAGGTTAGAACTAGTAAAAAAAAATTACCTCCACTCTAACGCATCTTAAATTAATATTTG
AAGAAATATGTAACTGACTATAAGTTCAGAATACAAATAGAGGGCAGGTATTCCTAAATT
ATGATAATAACGCATTTAGAGTCAAGTTAATTTTCCCCAATCTTCCCTACCTATATCATC
CAAATCATGAATTTGCTTTTTCCTATAAAGATAGTGGAGGTTGTAACATGGACAAAATAG
GGAGCTCTCTCCTTGGTATTCAGAGCAAGTTCAGGAATATTGCACTTGCTGCCCAGTAGG
GAAGATTCAGCCTTGAAAACTGCAGCCTGAATTAAAGAGAAAAGCTCAGTTTGTTTTTTT
ATCTGCATCTGTATAGTAAGGAAAAGAAGTTTAAGCTAACGAAATATCACAATACCCTCC
CCTTTCCTTGCACAATCTGTGATGATTGACTAAGATTTGTTTTTTGTTTTCCACAGAAAG
ATCCTTAGGATCACATTCTCAAACTGTTAATTAAGTGGACCTTGGAAAAGAGTCTTTAGT
ACTTTACAATTTGGAAAGAGGTTCTTTAATGCAATGCTTCTCAAAATTTAATATGCTTAT
AAGGTGCCTTTGACTCTACAGAATTTCCTGAGCACATTTGAGTGCTCGTTGTCCCATCCC
TTCCCACTCTGGGCCTCACTAGCCCCCAGTACTCACGGAGTTACTGTGAACAGTTTAGGA
AATGCTGCTGTCAGCAAACAAACTGTTGCTAAATAGGCTTGAAAAAATGCTTAACTTACT
GAGATAGATAATGAATACCCATTGACCTCCCTGTACCGGGATGCATTGGAAGCATGAATT
GACAACTTGGCTGAAAAGAGAGAGAAGCCAAATTTTAATGGGTGTGATTTAAGATTCAGT
AGGAGAGAAAAAAATGCTAACACCTGTTACAGTACTATTAATAAGACCGAGTAGTGTGTC
TTGAGAAAAGTCTTTTAAAGTTGGAAGGTTGCTATGAACCCTAATTAGTGAATTAGCAAA
TATTTAGTATGGAGAATTGTTAGGATTAGGCTTCAGCCCTTCTCTGCAAATGCTTCCTAC
TTTTGTCATGGGAACTCAATTAGAGAAAGCATTTCAGTTAGCCCTGTAAGTTGTTGAATT
ATCTTATTCTTGAACCAATGGAATAGCCAGCATGGTTGTTTCAATAATTATTAGTAAGGA
CATCCAACAAAAAATATATTTACTCTGTAATATCTTTATTCTTTTAAGTGCGCATGCAAA
GATCACAAAGACGTACTTTTAGTTATCAATATCTCATGAAAAACTGTATTTCTGGTGACA
AAATTATTTCTTCAAGACAATAAATATGAAGGTTTGTTTTTTCTGGAATCTAAATAAGCA
GAAAGCTTACAATATCTCTCCACGTAATATACATTCCTTTCTTGAGAAAAGTGTAAAAGG
TCAATGTTTTAGTTTGCCAAAAGGCTGCCAGTGCAAAGTACAAGAAATGAGTTGGCTTTT
ATAAAGAATATTTATTGGGGGTAAAAGCTTACAGTTCCAAAGGCCCATGAAAGAAGTCCC
AACTCAAGAGGTGCTTTCTTACCAAAGTCAGCTGCCTCGTGGTGAAGCAGGGTGGTTTGC
TGGTCTCTGCAGCGTCTCAACCTTCTCCTCCAGAATCCACCATCTTCTTCAAGAATCCAC
TGTCTTCTCCCAGAGCTCCACCAGGCAACTAGTCATAGGATTTATCTCTTACAGGGTCTC
TTCTCTCAGTTCGGCTTCTCTCCTTTCTTTCCAAGTTCAGCTACAAGCTGTCAGGCATAT
GGCTCATTTCTTTGCACCTCTCCTTTCTCTCAGGTGGCATTCTCTCAAATATGACAGAGC
TCCCTTTAAGTCCTTTGTGTCTCCATTTTTAACAGACCCAGCAAGAGGGCAGAGACTCAA
CCTGAGTCATGCCTCGCTGATGTAGTCCACTTTGAAAGAGTGATGTACCCACAGGAATGA
AGCTAGCTCACTAACATAATCTTTTTCTTTTGGGAATTCATAAAATTTTAAACTGCTATA
GTAAAGAATTGGACATGTATTAGGAAATTACTAATATAGAAAACAAACATTGAGGACATT
TCATTAAATCAGGATAGACATAGTCCAACCTCAGACTTTCTAAAACTCTATTTCAATTGG
TGTTCTGAACTATATTGGAATACTGCTTTCATTGCTTACAGAAATTAAAATGGCAGTGCC
GTAAACGTGCCATAAGTTTGTTATTTCTCTCACGTAATAGTTCAAATATAAATAGTCCAG
GACTTAAAATGTAGCTCTGTGGAGTCAGGAACCCAGGCGTCTTCAGCCTTGTTCTTTCCT
GTTCTCTATACATGTCTTCCATTTCATAATCAAAGATGCCTGCTCCAGTACTTGTCACCA
CATCCTCATTCCAGTCAGCAGGACAGAGTAAAAGAGAAGGGGAGCTCTCTCTCTGTTCAG
GACACAAATTGAGAGTTGTGCATGCCTTTTTCACTCATATCCCATTGGTCAGAACCTTGT
CACTCAAAGAAAGCTGGGAAAAGTAGTCTTGAGTATTTACAAAACATTCATAAAAATTAA
TCATATAATAAACCATAAAGACACTTCAATGCATTCCTCAAAAAAATCACATACAGATTA
TATCCTGCAAGAGAACATCATACACACACACACATACTATCCGTGCACCATTATATAGAA
TATATATATATAGAGAGAGAGAGAGTATATGTAGACAGTTAACAATTTCTTATTCATTAT
TCTGAGTTACTTTTCCAAATTCTGAAAAACCCTTTGAATTATCAGAAAAAGAAGAGACTG
CTTGATATAAATTCATTTGTTGAGTATATTGTATTCTAATTCTCTATAAATGAATAACCT
ATGGTTTAGAAAGGTTACAGTGTATTTGTTTAAACACAATATTCAGTTCCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCGTGTATTCTTCTGAGATTTTTTTT
TATTTAACACTTATTGTTGTTGATAGTTTATTTTCACTGCCACATAATATTTCTTTACAT
GACTGTACCACAGTATTTTTATCCATATAACCATTGATGGATATTTAGGTTGTTTCCAGT
ATGTATGAGTAAGAGTGTAACTGCTCAGTTGTAGCATATTCTTTATTTTCTTTTTTTCTC
TGTAGATTATATGCAATGATGTTTTTATTTCCCTATAGTCATTTGAAAAGTAATGACCTT
ACTTTTAGTTTTACTGGTAAATACTTGAAAAATTTAAGAAGCGCAGCCAAAAATACAGTT
CCCTTAATATAAACCTTAAAATAAATCCCTATTTGTTCACTCCTCTTATGTAAGTAATAC
ATAGAGTACATTTGTAATGTTTCTTTTTTTTTAAAAGATTTATTTTTTTTTTACTTATTT
CCTTCCCGTTCTCCCCCGCCCCCAGTTGTCTGCTCTCTCTGTCCATTTGCTGTGAGTTCT
TCTGTGTCTGCTTCTATTCTTGTCAGTGGCACAGGAATCTGTGACTCTTTTTTTATTGGG
TCGACTTGCTGCATCAGTTCTCCATTTGTGTGGTGCCACTCCTGGCAGGCTGCACTTTCT
TTCGTGCTGGGCGGCTCTCCTTACGGGGCGCTCTCCTTACGGGGCGCTCTCCTTACGGGG
CGCACTCCTTGCGCATGGGGCTCCCCTACGCAGGGGACACCCCTGCATGGCACGGCACTC
CTTGTTCGCATCAGCACTGCACATGGGCCAGCTCCACACAGGTCAAGGAGGCCCATGGTT
TGAACTGCGGACCTCCCATGTGGTAGGTGGATGCTCTATCCATTGGGCCAAGTCCACTTC
CCTGTAATGTTTCTTACTACTCCTTCCCTTTTCCTATTTTTGTGGAAAAGTTCTCAAATT
CATACTTGAGGTATCATTCTCAAATTATTCTAATAGTTGTACATTTTTTTATGTTGCACC
TTTTGGAATTATATTTGCATTTTCTTTTGTAACATAGTAGTTGTTTTTCAGACTAATAAA
TGTAATTAGTTTCTGTGTTTATGATTAGTCATTTGTATTGCTACGTAACCATTCCTTAAT
TTTGATACAGCAATCAGAGTACTTATTTTGTTTATTTGGGTTTTTTTGAGAGATATGTGG
CTTTATTTTTTCTGAGTTTATATATATCTGAAATGAATTTCTGCTTTCTTCACAGGTGAC
CAGTATGGTTGGGTATGGAATTCCTGGGAAATAATCTTTTTCAAAACTCTGAAACTTGTA
TTCATTGTCTCCTAACAACTAATTTTGAAGAGAAGTCTGAACCAAGTCCAACTGTTACTA
TGTAACTTATTCAGGATGGGGGCAGATGGGGTGGTTCTGGATACCTCTAGGAGTATTCTT
TGTTTTTGAAATTTAAATCTTCGACAAGATATCTATTTTTCTCTCTTCATTAATTTTTGC
CTTCTGACACCTGACAACCCAGCCTCAGGGATCTTTTTTGATGTGTACATTAAGCCTTTC
AGCTAAAGAAATTCTTATATTAAGTCATTAAACATTGCTTTTATTCCATTTATTTTATTT
TCTCCTTCAGGAACACCAGGGGGTTTTTTTGTTCCTAGGATCCTGTCTTTTCAGTAGACC
ATACTGCCCTCTCAAGAAGTGTTTTACAGGTTAACCTTGAGAATATTTTTAATTGCTTTT
AATGTTCTAGCATTTTTAAAGGTTTCTAACTTCTAACTGTTACAGATATTCCTCTATACT
TACTCTTCACAGTTCATTGAGTTAGATTTAAAGGAAGGAAGGAATGTCAGTCCTTATCTT
TTCCCATAACATTTTCAAAAGTTTTAACGTGGAGGTGTTCCCATCATACACATTTGATTT
TTCTCCTTGATTCAAAAGTGATCAAGGGTTTTCTTGATTGATTGTTGTTGTTATTGTTAC
TTTTAATTTTCAAATATTCTACCACAATATTTACAGGTGAAATTATATACTATCTTGAAT
TGCTTCAAAATAATCTGAAAAAGGATTGTGAAGAAATAAAATTGTGGTATAAATAAATGA
AACAAGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGCTCAGTTAATACTTCTGTGATCAATATG
TTAACTGTTCAAAGTGATGTCACTGACCTTGAGAAGAAGAGAAAGAAATGTGCAGTCTAG
CATTTGTAGTTTGAGTGAACACAGGAAGTATCTGTCTGAATGTAAGTTCAAGGTAATTCT
AGAAAATTAAATCAGAATACTTAGACTTTGAAATGTTACTTTGTGCTTTAGCTTATCTTT
CTCATTTGTTAATACTTTCCAGGGTTTAGAAGTATAACTTTTTTTTAAAAACCCCAAAAA
ACTCTTGGTGCTTATGTATTTAGAAGGACACAAGATCAGAACTGGGTGCCAAAACCTCAG
TTACACCAAGGAAGGTTGAGTCTCAGATGCAAATATTTAATGATGGCAAGGAGAACAAGT
ACCGGCCCTCAAGCCAGGGAAATAAAAATTTCAAAAATTGTAACAGTCTACATCATAAAT
TTCTGGAAATTGCAATTGTACAAAGGATCTGTTTGGAAGAATGGGGTTAGAATGTTACAA
GGGACCAGAAGTCATATATTTTTTAAATCTTATGAAAATTTGAATATTTAGGGCTTTTAT
GTACACTGCTATATATATATATATAGTATATAGTCTTTGTTATCAGTTACTCTGTATTAC
TTACATTCCATTTTTTATGTTCTGGATGGGAAACGATTATATTTATGGTCTTACTGCATT
GTTTTTTCTTTCCTAGCTGTAATTGAAAACATGAATTATTAAATCCAGTATGCTTATTTA
TGAACAACAGATTTATAAAGAGTATCTTAGACATCTTTAGTTGTAAGATTTTGATATTAA
AATGCTATATTTTCATTGTTACTTTGATTATATTTAGATAAAAATTATTTCATAAAGTTT
ATCGTTTAGTCTATTTTCAACCATTCCAGAAAGTTTAATTCATTCTGAAAGTCAGTACTG
TCCAAAATATCTCTAGTAACGCAATTGTTTAAGTGAATTCATGTGACGTAGATTATCCTT
CCTTTGCAGAAAAGATGTCACATATTTTTTGAGCAGCTATTATTCCAGTTTGCTGTTAAC
AATCCAAAGAGAATAGGCCTGATTCATTTACTTATTTAAGTCCATTGGGGGTCTGTATAC
CTATTTTTAATCTCACACACACACACACGATTCATTTACTTATTTAAGTCCATTGGGGGT
CTGTATACCTATTTTTAATCACACACACACACACACACACACCCTGCCATTTTGTTAATT
GTAAATTCTGAGATATCAGTAGCCCCAGGATCCAGGATCAGGTTGAAATGTGTGCAGCTG
TGTACTCTGTTTAATGCACAAGGGTTACATCTATGCATTTATCCTTGCTTTAATATGCTT
TATCTGCAACAATAAAAGAAAATGTTGAATTCATTAGTTACCATGCTGTGAGCTAAGGAA
AGTGTTCTCTGCTCAAATTGAGTTTAATATGGAAAATTCTGAAGGAACGGAAAGGGAAAG
TTTAATTCCTTCCCAGGCTCAAGGACATGAATTATTGTGCCTTTAAAGCTAAAAGAGGAA
AATGAGGAGTATTAATGATTTTACGTGTCATTAGTGTTTTTGTTTTTTTTCCCAGCATGT
AACAAGGATATGTATTAGTTTTTGTATTTGTAAAATTATCGCTTCCATTCATCGCACCTT
GAAAACTAAGCTTGGTACTAAAAACAAAAACTACTTCTAAGATCATCTGTGTTCTTGTTT
TAGCTGTTTTTCATTTAAAAGTCAAAGTAAGGAGTGGCAGCAGTGCATGAGCACTTTATT
TGCACTTTTAAAATAGCTGCTAATGGGTTTAGTAGCTTCCTAGATCAGGAATGGAAGGAC
TGACTCTAGAATATTGTAAATCAGTGTATTAATCAGTTTACTCCCTTATTTGTAAAGTAC
AGGTTTAACAAATTGTTTCCCTACTTCAGAACCTTACTTGGGAAGCTCATTATAAACTGG
TAGGTGATGACAGATTATGAATTTAAAAATCTAATTCTAGTTAAGATTAAGAAGCTTAAG
AGGATACTCTGTGATGGTGATTCAGCAAGGGAATAGGAATGCTCAAAATGTATTAGGCAT
ACCACTTTTGGATGGAAATTTGATCGTATTACTCTTTTAAACAAGCATACTCTGAGTCTA
AGAGAAAATATTCAAACAAGTGTACAAAATAAGCTTATTGGAGTATGATTTGTAATAATA
AAAAAAATATTGAAAATAGCCTAAATGTATCATAGTTAAATAAATTATGATATCAATAGG
ATCAGATATTATCCATTTGTTGAAAAATAATGAAATGTACTGTAGGATGTACTCTTGGCA
GGTTAGAGCTCTAAAATAATGGAGTTATATTTAAAAAGCTACTTGGTGAACAGTATGGAT
ACACCCTATTTCTATTTTTTTAATGTGCATGGAAAATACACTGAAATATGTCCTTGTACC
TGTGGTTATCTCTAATGAGACTGATGAGGCTATATGCTTTTTATTTTCACTTAGGTTTTG
CAATGACTGTATAACTTTTAAAAAAATACCCCTTTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTGTGCGTCTGCCTATTCTGGATATTTCCTA
TAAGTAGAATCACACAATATTTCTCCTTTTGTTTCTGACTTAATTCACTTAACACAATGT
TTTCAAAATTCATCCATGTATCAAAACTCCATTCCATTTTACAGCTGAATAATGCATTGT
ATGCACTGACCACATTTTGATTATCCATTCATCTGTTGATGGACACTTGGGTTGTTTTCC
CCTTTTGTGAATAATGTTCTGTAAACACTGGTGTAAAAATACCTGTTTCAGTTCTCTGGG
GTGTATATCAATGGAGTGGAATTGCTGGGTCCTATGATAATTCTGTGTTTAAAATTTTAA
GGAATCACCTGCATCATGCATACCCGCCAATAGTGCATAGGGTTCCAGTTTCTCCCCATC
CTTGTCAACAATTGTAATTTTTTAATTTTTTAATAATAGTCACCCTATGAATGAAAAAAC
GGTATCTCAGTGTAGTTATGCTTTGCATTTCCCTTAGGTCTGAAGCATCTTTTCATGTGC
TTATTGACTGTGTAATATCTTCTTGGGAGAAATGTCTTTCCCAATTTTTTTAAATTGTTT
TTTCTTTTTGTGGTTGAGTTGTGAGAATTATTTACATATTCTGGATATTAAGCCCTTATC
ACATGTATGATTTCCAAATGTTTTTTCCCATCATGTGGGTTATTTTTTCATTCTTGATAG
TGTACTCTGATGCACAAACGCTTTTAATTTTGATGAAGTCCTATTTATCCTTTTTTTTTT
CTTGTTGCCTGTGCTTTTGGTGTAATACTTAGACCCATTGTCAAACCCAAGGTCTTGAAG
ATTTTCCAGTATATTTTCTTTTAGAATTTTATAGATTTAGCTCTTAAATTTAGTCCTTGA
TCCATTTTGAGCCACTTATGTTTGTGGATTAAGATAAGGGTCCAACTCCATTCTTTCGCA
TGTGGATATCCAGTTTACTCAGCACTATTTTAATAGATTATTCTTTCTCCATCAAATATA
CTTCGCCTCCTTGTCAAAAGCCAATTAACCCTGGGGAGCAGATATAGCTCAAGTGGTTGA
GTGCCTGCTTTCCATGTAGGAGATCCCAGGTTTGATCCCCTGTACCTCCTAAAAATAACA
AAGCAAACAGACAAAAAAAGAAAACAGCTTTCATTGGGGAGCAGATGTAGCTCAGTGGTT
GAGCATGTGCTTCCCATATATGAGGTCCTGGGTTCAATCCCCAGTACCTCCTAAAAAAAA
AAAACAACATCCTTCCCTATTTGTGAGAGTTGGTTTCTAGATTCTCAATTCTATTCCATC
CATTAAATGTCTATCCTTATGCCAGTACCACACTGTTTTGATAACCACCTTTGTAGTTCT
AGTAAGTTTTGAAATTGAAAAGTGCAAGTCCTTTGCTTTTGTTGTTTTTCAAAATTGTTT
TGGCTATATGGCACCCTTTCACATTCCATGTGGATTTTGTGATGGCTTTTATATTTCTGC
AAAAAATGCTTCTAGGATTTGGGTAGCAATTACATTAGCTACATTGGGTAGCAATTTATT
AGCATAAAATACTAATTTTATGCTTCTTAATGCTATTGTAAATGCTTTTCAAAGTGTTCA
TTACTAATTTATAGAAATAAAAATTTCTGTGTGTTGATTTTGTATCCTACAGCTTTGCTG
AATTCATTAGTACAAATAGTTGTGGGTTTTGTGTCCATTTTATTTAGGGTTGTGTACAAA
TAGGATCTTGTCATCTGAAAGCAGAAATATTTTTACTTCTTCCTTTCCAGTTTGGATGCC
TTTCCTTTATTTTTCTTGTCTAATTACACTGTCTAGAACTTCAGGTAAGATGTAGATTAG
AGTGGTAAAAGTGGGTATCCTCGAAGTGTTCTTATTTTTAGTGGGGGGGGAAGCTTTCAG
TCTTTCACCATTGAGTATAATGTGAGTTGTGAGTTTTTTCAGATATAGCTTTTATCATAC
TGAGGAAATTCCCTTTATTTCTAATTTTCAGAGTGTTTTTTATTTAAAAAGGGAGTTGGT
TTTTGTCATTGGCTTTTTCTACATCTATTAATATGATAATGTAGGTTTTTCCACCTTTAT
TATCATGTATTAATTACATTGACTTATTTTCTTAAATGAACCATCCTTGCATTCCTGGAA
TAAACCCCACTTGGTCATGGTGGATAATCCTTTCAATGTACTGTTGGATTTGGCAGGCTA
ATAATTTGTGGAGATTTTTGCATCTGCATTCACAAGCAATACTGGCCTGTAGTTTTCATT
TCTTGCAAGTGTCTTTGTCTGACTTTGGTATCTGGGTAATGCTGGCCTCACAGGAAGTGT
TCCCTCCTCAATTTTTTTGGAAGAGTTTAAGAAGGATTGGTGTTAATTCTTTAAATGTTT
GGTATAATTCACTAGTCAAGTCGTCTGGTCTGGGGCTTTTCTTTGTTGAAAGAGTTTTCT
TTACTGATTCAGTTACAGGTATATTCAAATTTTCTATTATTGAGTCAGCTTTGGTAGTTT
TTGTGTTTCTAGGAATTTTTCCATTTTATCTAGGTTTCCAGTTGTTGGCATTCAGTTGTT
ACTAGTATTCTCTTATAATCCTTTTAATTTCTAAGTTCAGTAGTAATGTCCCCGCTTTCA
CTTCTGATTTTAATATTGAAGTCTTATCTCTCTTTGTTCTTAGGCTAACTAAAGGTTTGT
CAGTATTGTTGCTCTTTCATAACAAACTTTTGCCTTTATGGTGGTTTTTCTCTATTGTGT
GTCTATTCCCTATTTCCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCATTTGTTTTCTGTATGACATATGTCTTTTCCCTCAATTCCTCCTTTAC
TCTGTTCTTTATATTTATTTGTATTTTTAGAGTGTAACATTTTCCGTTCTTCCTTTTCAG
TGTTTTATTGTTATTTTCTTAGGGGTTATTTTGGAGATTACAATTAATGTCTCAAACATC
TCAAAACTAACAATGTACTACAAAACCCCACTTAATATCAGTTGTTTGCAAACTTTCTGC
CCCTGTACATCTCCATCCCCATTCTTTCGTATTGCTATTAACTCAGATTACACCTGTATA
CATTGTTTGCTCATCAACCTATTTTTATAATTATTTTTTATACATTTGCCTCTTAAATCA
TATTCCTAAAAAGGAAAAACAAAACCAAAATAAAATAATACTGGTTTTTATATTTACCTA
TGAAGTTTATCATTATTCATTTACTTTTACTTACAGCTTCAGGTTACTGTCTTTTGTCCT
TTCAGTTCAGTGTAAAGGACTCACTGTGTTTATCTGAAATTGTCTTAAGTTCCCCTTCAT
TCTTGAAGGATGGTTTGCCAGACACAGAATTCTTAATTGATAGTTGTTTTTTTCTTTCAT
TATTTAAACTATGTTGTGTGCTGCCTTCATATCTCCATGGTTTCTGATGAGAAATCAACT
ATTAGTCTCACTGAGGATCTATTGTATGGGATGAGTCACTTCTCTGTCTGCTTTCAAATT
TCTCTTGTTGTCTTTGGGTTTTTATTATAATGTGTCCTCTTGTGGATCACTTTTAGTTTA
TCCTGCTTGGATTTTGTTGCTTTTCTTGTTTGTTGTGTATAATGGCCATTATTTCTTTAA
ATATTCTGTTGCCCCATTATCTCTATCTTTTCCTTCTGGGAGTCCTATGATCATAAATTT
TGGTCTGCTTGATGATGTCCCACAGGTCCCCTAGGCTTTCTTCATTTTTTTGTGCCCCCC
TCCCCATTCTTTTTCCTTCCTGCTCCTTGGACTCAATAATTTCACCTGTCCTAACTTTAC
ATTTGCAAATGCTTTCTTTTGCCTGTTCAAATCTGCCACTTTGTGAATTTTTCACTTCAA
TTCTTGAGATGTACTTTTCACCTCCAGAATTGCAGTCTCTTACTTTTCATAATTTCTATT
TCTTTATTTAGGTTATCATTTTATCCATATAATATTCTCCTAATTTCCCTTAGTTCTGTC
TCCATGGTTCCTTTAGCTCATTGATCATATTTAAGAGCATTGATTTTACATGTTTGGCTA
GTAATTCCAATGTCTGAGCTTACTTGAGGATTGTTTCAATCTTGTGAAAGTAACTTTCTT
CTCTGTTTCTTTGTATGTTTGTACTTTTTTGTTGCAAACTGTACATTGTATAATACTGTG
GTTAAATATGGATAGCTTTTTTTCCTACTCCTCAGGATTGCTACTTTTCGTTTGCTGAAG
GTTAAAGCTATTTGTGATTTCTTCAAACTATTTTTTGCAAAGTGTGACTTTTTTGTTATG
TGTGGTCACTGAAGTTTCTGTCTCAGTAGTCATTCAGTGATCTGACAAAATGTTTCCTTA
ACTGTGGCTCAACAAAGAGGGTAAAGAAAATGGCATACTTACTTTAAGTTTCTGATACGT
GCTAAAGGTAGAAGCTGCTATAGCCTGAGAGGGCTAAAACTTAGGCAGAGAGGTCTGTAC
TGTTCCCTTGGGGATCTACCAAACCAACTACAACATGCAGCCCCCCAAATTGTGAGGGCA
GAGTCTCACTGCCCACTCTGGCACAAACCAGCTGCTCCAGGAATGCAGGCCACTATCCCC
AGTGCTGCAGAGGGACTGAAAATTGGAAGGTGGGCACTGGTTAATACACACTTCCACTTA
AGAATGATCCACAGCCTTTCTTTTCATCGCCCACTCTCCTGGTTTTTATTAGTGTCAGAT
AGGTTCCACAGTTACTAACTAGTTGATTCCAGTCTCTCTTTCCAGTCCCTGCCCACTGCA
GCCAGTTGCGCACTGTCAGCCACAGTCACCTCTGCCCACTGTTATCACTTGTCCCTTCCT
CCCCACTGTCCCCCTCTGCCCTCTGCTATAGTGGCTTCCCAAGCCTCTGGCTAGCTGTGA
AGTGTAACCTCCATGTCCTAAAACTTCCTACTCTTTGGGTCTATGTAACTTTTTTTTAAA
AATCAGTAAATAAAAAATACTGCCATTCATTTACATGTAGCTGTCCTGTGATATTCCCTT
CTTTTGTATTTTTATTGACTCAATGTGATCTTTTCTGCAAATAAAAAATCCTTTTGGAAA
CATTACTGTGAGTATTTCTAGAGTAAGAGTACTAATGCTGAAGTTACTGTTTCACTACTA
TAAGAGGTTTGTGGTATCTTTTTTATTTTAATTTTAGGGTATCTAGGAAAGGAAGAGCAG
ATATATGTGATGAATGTGGTGAGTTAAATAAGACAAATATGTTTTTAAATCTTTATTTTG
CTGTTTTTCTATTTCAGTTACCTAGAAAAGTACGAGAAAGTTCATCATTTTGGGGAGGAT
GATGATGAGGTACCACCAGGCAATCCAAAACCACAGCTTCCTATTGGTGCAATTCCATCT
TCCTACAATTACCAGCAACACAGTGTGTCAGGTAAACATCATTTAAAATTAACAGGGCAT
AGGTCCTCAGTTTTGAAATAGGAAAATAAAATCATGCAATTAATTAGTCCCTAACTTTAC
ATGTGAGAACACTTAAGGCCTTGGGTAATGGGACTGTAGAAGAATGACATCTAATTGACA
TCAGTGCTCTTTCTGTCATAGACTGCTTAAAATTTTTTTATAGAATTTGCATTTACAGAT
ACTTATAGTTTAAAGCAAAGTTTTTCCTCGTGGCTTTGACACTATTCTGAATAGTCCCTA
AATTAGGAAGAAGAATGTCCTATTAGGATTAAGGGTGCCAAGAATACTCTAATAATATTT
ACTCCATTTCTACATTACTGGGATTTACAGAAGCAGAATTTCTTATTTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAATGAAGAAATGCTAAAGTACATTACACTGTAGGGT
ATGAAATTCAGATTGAAAAGATGAAGTATTTGAAGGCGGCAGTTATTAATTTGGAGATGC
TATCCATTTTTAAAGAGGAGGCATGCAACATCATAGTGATATTCTAAAAATTACCATGAT
TATCAATCTACAAATATCCATCATTCACAATTCTTTCCATGTGTCATCAAGAGTAGTAAT
AAAATGTCACACATTAGTGGAATGTGGACTTGAATTCTCCTTCAATAATATTGACTCCTT
TGCCTAATGACTTCACATGGTAAAATGTATGGAGAACTTTTGCGTTGAACTTTAGTGTTA
TTCAGCATTAACATCTGTGGATGGTAGGTGTGTCATTTATTTCATGGTTTTTCATATTTT
CCTCACTGTAAGTATATAATTACTTCATTTCCCTCTTATGATTTTTTTCCTTTGTATTAA
AATGGATATTTGAAAAATTATTGGATGGATTATTAAGAAGTTTTTGGGGTGAAGTCTGCC
CCCACCCCCCAACCCCAGGGTCCAAGCAGGGAGCTGGAGTGCAGAGGGGTCTGGTCCAGG
CCTCTCTGGGCTAGCACACGGCCTTCCCTGAAACCCCAGGCCTGGCACATGTGTCCTCCC
TTCCCCATTTACATCTAGGCTGCCTTGGTGCTTGGGCAAAGGCCAGGGGACCACCTCAGA
GCCCTGGACCCTGACTGGAGCCACCATCTCTTATGGCAGTGTGGACGGTGGTTACCTGCT
CTTTCATCCCAGGCCCACCTATCCTCCTGCCCTCTCCCAGTGGGGGAAGATTTTGGCTGT
GCCTCTTGTCCGAGAGATGTAGAAACACTCAGTGATCTTGACGTTGCCTTTAGACAACAG
CTGCATTAGCCTCTTGCATATCAGCTTTTTCAGAGTCATTTATGAGCAGAAAAATTTTGA
AATAAAACTTTGCTAATCTTAAAAAAAAAAAGTTTTGTGCTCTTCTCTTATAATTAAGAG
AATTTATCAGCGGTATCTTCAGTATAAAATTTGTGAAAGAAAAAACTGACAATTGACAAC
TCATTTAAATTAATTTTTTTAAATAAATCCTTAATATTTGAGTCAAAAGTTTCCTTTAAG
AATTTCCTATTCTAATAGATATTTGCCACTATCAGTGGAAAAAATGTATTGTTAAATTCC
TGCAGTGAAGTAAACAACTTTAGGAACAATTCCCCCTTTCCTCTAAATGGAAAACTAAGA
GAAGTGATTGTCACAAATTAAGTTTATGAGCAGCAATCTTCTTGGATAGGGGATGAAGAG
TAAAATTATACTCAGTCAAGGATGTTGAAAAAAATATTCAGTCCCACTCCATTTATAAAA
TTGGTTCATGTATCCTTGGGGGTGGAGTGTCTTAAAATCTTGAAAACAATTAGTTCTTGA
GCAAGATGGTGGAGTGAGAAGCTCTAGGGTTCTGACTCCACACAGCAGGATTGAAAAACC
AGCATATTGGCCACACCAACTTTTTCAGAGCTCTAGAAAACAGTAAAAGTGTTGTAGGAA
TTGTATTATAACTGAATCAAGAAAAAGGCAACTTTAAAAAGGTAGGAAAACCTGTGGCTC
CTTTATTGGCCTATATTAGTCAGCGAAAGGGGTGCTAATGCAAAATACCAGAAATCTGTT
GGCTTTTATAAAGAGTATTTATTTGTGATAGAAGCTTGCAGTTACCAGGCCATAAAGCAT
AAGTTACCTTCCTCACCAAAGTCTTTTGCCACATGTTGGAGCAAGATGAATGCCAAAGTC
TACCAGGTTCAGGCTTCCTGGATTCCTCTCTTCCTAGGGCTTCCTTCTCTCTGGGCTCAG
AGTTCCTCTCTTCCCAGGGCTTGCTTCTCTTTCCTCAAAACCAAGCTCTTCTGTATACTT
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCTGTTGAACACTAATTGAATACAAGTTTACATAATAAGTATGTCAGTAACTACATGTCA
AGGGATATAGTCTTTCATAAATAGTTAGAAAATTAATAAACAGGTTGTTATTGTCTTCAA
CAATAAGAAGGGAAAAATAAAACAGCAAACCCTAGGGAGGGGGAAAATCTGGTTTCTAGA
GCTAACACATTAAATTATTCAAATGTCACAATTTCAGTAAAGATTCACAAAGTATACAAA
GAAACAGGTAAACATGGTCCATTCAAGGAAACAAAGTAGAATGACAAAAACCATCAATGA
AGAAAAAGACTTTAACAGAACTGCCTTAAACATGCTCAAAGTGTAGCACAAGTTGCTACA
TGGTATGTTGTGGGAACAGGCTCATACACAATATAAATTCTCAACAAATCACCACTTTAT
TACTTACACAGTACAAAGGGTCCAAAATAACAGGAGAAGGTCCTATTGTGGGTTGAACCC
TGGGGGCCAGCTTCTTGGGCCAGGATCAGTGGATGGTACCTCTGCATATCCTGCTTCACA
GTGTAGGTGAGAGACAGTCTATGCTGCCCAAAGCTAGTTATATGCCCCAAGGAGGGTCCC
TGCCACTAATCAAAAAGCAAGACCCAAGCAACCTTTGTGTAGTGTTCCTGCCCTGATAAG
CAGCTGTGGTTGCTTATTCCCAGTTTAGGGTTCAAAGTACGGTGCTACCATTCCATTTCT
GAGTAACAATTTTTTTGTTATTGAGACTTAACATCTCTGGACTGTGAAATGGAAACATAC
TGAAACATCTGCACACAAGTAAGTAAGAAGGGAAAAGGAAGGGGATAGGCAAGGACTAGA
AGATGGCTGCTGAAAATGTCCATGACTTTGCCCAACAGTCTACCAAGCCTAACTTACATT
CCTCCACATTAGCTTCCATATCATAAGCCTACCACCTCCCATTCTTGGACACAGTGACAG
AGGTGGGTCAGACCTACCAGTCTATGGCTCTCGGTAGTGTTGCCAGTAAAATTGGGGAAC
ACCAGTGACTGCAGCACATTAGGAGTTCTTTGCCTGTGCATACCATTACTCCAGTCTGGG
CAAACAGGCCTTTCTGGAGTAGTGATTACATCCATGCTCCCCAACTACCAGGGAGCAAGC
TGAAGAGGTCCCACATAGAATCTCTTTGTACACTTAACAGCCAATGGGCTTGCCATTGGA
TTTTAGTCAACTCCTATTCCATCTCCCCTGATGTATTAACCACCTTTTGCAGCTTGGGGA
AGCAGGGTACACAGCCAGTGGCTGTGCTGTCATCCTTGTCACAGGGACTTCCTGATGTTA
GTACAAGGCAGGGGAAATCAACTCCATGAGTGGTCATCTGGACTCAGCAGAGAGGGGAGA
TGGAGCAAGGATCAGATGGCAGGACCAGCAGTTGGTCAGGTTCCCGGCTGCCACAATGGC
CTGGGTCAGTCAGGCGAACTTATTTTCTTTCCAGGTTCCAACAAGCTAAATCTGTAGAAA
ATAGGAGGGGAGGAGTAATAACTAGTCCTGGCAGTGGTTGTATGACCACTTTCCATGGGA
GACACTTTTCTCACTTTATTTATAATAGCTTATCTTTCCCTCTAAGGCCACCCAGTCTGT
CTGCACATTGCCTTGAGCTATAACTTCACCTTTTTTCCATTGATCTGAGTGTCTTACCCA
TATCTTCCAGCCACTTCCACCCCCTTTTTGATATATGGGAGTTTCTCGGACTCCTTGAAG
TTATTCCATGACCATTTCCAAGGGGACCGGTAGCCCAACTAGAAATAGGTATTGTCCATT
GACTTCCATATGTGTTATGTCAGGGCCAGTGGATCCAGCCCACTGGATTGTCACCTCATG
TGTTTTAAGCACTTCTAGGACCACTTCCATTATCCCATCCCTCTGCCCAGCAGCCCTAAC
CTCCCACTATCATAAGAATTGTGTAGAGGGTGTACTGGTCTAAAAAGTGGGATGTTACCC
GGACAGTGGCTGAAAAGGAGAGTCCCAACTATTGTGTCCTTGTTCTGCCTTTCTGGGCCA
GTCTTTATCTTGATGGATGTAAGGGCAGACAGCAAAGCCTGGGTTCCTCTCCCACTCTTG
TCCCTTTCCTTCTGTTAGGAATTTAAGATAAAACCATGTTTTCCCTTCTGAGAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCCTTCCCCACATTGGG
GTACCTTTGATTCTTCAGTTGCATTCCCTGCATTAACCTGACCAGACTATTAAGCTATTG
GCATTATCCCAAAAGTCAGAAAACTGGGTCCGAGTGTTCCAGGGCTAAGAGAACTGCTCA
GAGTTTAGCCCATTTGGGTACTTTTTCCAGTGTCCAAGGTGGTATATGGTCTGCCTGTGA
CCAGGGAAACAGCAGCTGATGCCTTGTGAATGTTGGATGGTTTCAGCCTGACCAATCCAT
CAGTGAACCAGTGGCAAGTATCCATTGGGGCATCCTTGAGTTGGTATCCTCTGGATGCCA
ATGCAAGTAGGGAAGGGACCTCACCTGGTGTTGTAACAGGATCGTTGTTGAGGGTGACCA
TTCATGTAAGCATGTCACCACCCATTCATGTAAGCATGTTACTTCCTCGGGGCCTAGGGA
AGTGCAGTCCTTAACTTGCTGCTTCCATTTGATGATACTCTATTGTTGGGCACTGCCTGA
GTGAATGTTCAGATGACCCAGGACCCAGGACATGATGGGGATTTCTGGCCTCAGGAGGAC
AGAGGCTCTTGGTAATCCTTTCCATTTCCACCAAGGACCAATAGTATACCAGAAGTTGCC
TCTCAAAGGGGAAGGAGTGCTGGGCTATGCCTGGGAACTTCTTGGTCCAGAAGCCCAGGT
GTCTGTGGATTCCTGTTGCTTCTTCCTTCTGCCAAAGGGAATAGCCAGTATGGGTCCAGG
TAGCAAAAACCTGTTGCTTGAACAGAAATCTAGGATCCAAAGGCCCCAGAGGTAGGATGG
CTGAACAAACCACTCTTTTCTCTTGCAGCATTTGCTCCTCCTTTTTCCCCTACTGGAAAA
TATCTGCTTTCTGTGTTCCCTAATATAGAGGAGCCAGAAGGAAACTGAGATGAGGAATAT
GGTAGCACCAGTATGCAAATAGCACCATGTCTGGTTCCACGGACACTAAATGGGGCACTT
CTGCATTCAAGTACCAGAAGTCTATAATCAGCCAATATACTCCACTCACCTTTTTCACTG
GCCACATCATAGGCAGAGATGGTGAAGTAGAGGACACCCACAGATAGAAGGTCCATTATA
AGTTCAGTAATGTCCTTTTTCTACCATGGAGGTAGTATTGCCACTGTTGGCAATGTGACA
AAGAGGTGGTTGCACTGGACGTGCATGATCTATCCCTTACCCAACCATGATGGTCACGGA
CTGCCAGGACAGGGGAGCATATCCCTGCATCCATTGTTGGAACGTATAGTGGCATTGGAT
ATCAGTCCCTATAATGCCTTCTCTGGCAGGAAGGGGCTAAAGGGACTGTATTAGTCAGCC
AAAGGGGTGCTGATGCAAAATATCAGAAATCAGTTGGTTTTTATAAAGGGTATTTATTTG
GGGTAGGAGCTTACAGATACTAGGTCATAAAACATAAATTACTTCCCTCACTGAAGTCTG
TTTTCATGTGTTGGAACAAGGTAGCTGCCAATGTCTGTGATGGTTCAGACTTCCTGGGTT
CCTCCCTTCCAGGGGCTTGCTTCTCTTTCCTCTCTGTGCTAACTTCCTGGGGCTCCAGCT
TAAGGCTTCAGCATCATACTCCAACATCAAAACTTCAACATCAAAAACCCTCAACTCTGT
CCTTTGTCATACCTTTTATCTGAGAGTCCCCACTCACCAGGGGGCGGGTAATCAATGCCC
TACTGACACAAGAGGTTTACCTGATTAAGTAATCAAATAAACCTCTGAATCCAATATAAT
CTCATATGCCCAGAGGAAAAGACCAGTTTACAAACATAATCCAATATTTCTTTTTGGAAT
TCATCAACAATATCAAACTGCAACAGGGACCAACCCACAGGGTACTGGTAATCTCCCGTC
TCCATACTCTTGTGGAATATCTAAAACCTCCCTGTACTATTCACTGCCCCTATTGTAAAG
GGAACAGCTACAAAAAGAGATCCTCTCCAGGCTTCTGGCCATACCTATCTTTCATGTCCC
ATACCTCCTTCTCTGTAAAAGCTCATGCTTTAAATTATTTAACTCAGCAATTTAATAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATTTTCTACATTATCAGTGAACCTCTCAGGTGTT
TTACCACTTGTACCTTGTGTATAGCAAATGCCAAGTAAAGCACGGTAAATGAATTTTTTT
AAAAATGCTTTTGTTTTCACCTCTGGGTCCCCGTCTTCTGTTCTAATAGTCTCTTGAATA
ATGACCAGTCTCACACTGACCTCAAGATCAGTCTTGTTGGCCCGAGTGTGAGTATGCCTG
GTTCTAGAATGAGAACAGATAGTAGAGGTCATGAGCAGGAGGAGTATACGCCGGCAGTGA
AAACTTCAATCTCATTATTTGTAGCATGGAACCAGCTAGCCAACTCTCTGGAATTCTTGG
GAGATTCTCAAAATCTCATTTGTGTCTCCACTTTCCACAAAGGACATGGGCAGCACTCCC
TAGATCTCCCACCCATAGGTTAGTACTTTTGTCCAGGCTAGTAGCAACATAGTCTTCTGT
TTAACCCACAAAGCCATGAGTCCTGTTGCCCAAGATGTTCCCGTACAAAAGTCCACAAGA
TCAATGGGGAAAAAGCCAAAGAATCAGGCCACTCTATACTTCCTCATGTACCCTGCTTGT
TGTGCCAAAATCTGTGGAGCAAGTTGCTATATGGGGTGTCATGGGAACATAGGCTCATGC
ACAACAGAGATCCTCAACAAATGACCACTTCATTATTATCTTGCCCAAAAGGTCTTATCA
TGGCTGGTCTCCCAGGAAGGCCAGCTGCTCTGGCCAGGGTCACTAAATGATGGCACCACA
TGCTGTCCTTCACGTCAGAGATGAGGGACAATCTGTGTTGCCAAAGAGATAGGTATTCCT
GTATCTCAGTGGGAAGAAGCCTTGCCACTGAGCAAAAGGCCATGTATCAAGCAACTTTTG
TACAGAGTTCCCACCCTGGTAAGTTGCTGGCGTTGCTTGTTTGGGTTTGGGTTCAAGGTA
AAGTCATTTGTATGTACATTAGTACAGATACACACTACACATTTCTGGGTAGTGTGTTTT
TCATGGTTGAGACTTAATGTCTTCTCTGGGCCACAAAATGGAACTATATCAAAACATCTG
CATGCAGACACGCAAGAGGGGAGAAGCAGGAGAAAGGCGAGAGCTGGAAGATGGGCACTG
ATATGTCTGTAACTTTCCCAGCAAAAAGCTAAAAAAAACATGGGCAGAGTTACAAGGGAA
ATCAGGAAAATGATATTTGAAAAAAAATGAGAAATTTAATTAGAGATAGAATTTTAATAA
ATAGGAACCAACAGAAATACTGGAGCTTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTCAGCTGTAGGCTGGCACAGAGCTCATC
TCTCTTCCCAGGGCTTTAGCTATTGAGCCTTCTCCTTTTGTCACATGGCAGCGTTGAAAT
AACCAGCTTCTCTCTTTCTATGCCATCTTCCATGTCTTCTTGAGTGAGTGAGTGTTTATT
ATCAGCCCACCAAGGGGCGCGGCGGACTCAACTCTGAGTTATGCCCTACTGACATCAAAC
CAAGTCCCTAATCTTAACATAATTTAATCAAGGACATCTCAGTTGAATCTAATATAATCA
AAGAGTACCAAATCCAGAGGAACAAACCAGTTTACAAACATAATATCTTTTTTGGAATTC
AGAAATAATACCAAACTGCTACATACACTTATGTATGACTTAGCAATTCTACTTCTAGGT
ATTTAAGCAAAAGAATTGAAAAAGTTATAGCCATATAATATCTTATATATGAATATTTAT
AGTAGCTATATACATAAGTGCCCCTCAGTGGAAACAATCACATTATCCCACAACTAGGTC
ATCAATAAATAAACTCTTTTACCCCCATGGTATAGAAATAAAAAATGATGAATTACTGCT
ACGTGCATCAACATGAATATGAATCTCAAAAGCATTATGCTAAGTGAAAGTAACCAGACA
GAAACATTTACATACTGTATGATTCCATTTATTTTGCAGTTTGAAAAAATAAAATAAAAC
TACAGGAAAAGAAATGGTTACCTGGTGTAGGTAGGGATTGTAAATTGATAACAAAAATGT
AGGAAAAAACTTTTGGGGATTATAGAAATTTTGTATATCTTGATTATGGTCATGGTTAAA
AGATTGTATACATATGTCAAAACTCATAGAACTCTAGAAAATGATTTTACTATTTTAAGT
ATTTCTTAATATATCTGATCAAAAGAAAAGTTAATTCTCCCAGAATTAGTTAAAGGGAGG
CAGTTGGTTTAAAACATAATAATATTAAAATTCGAGAGAAACAGTCTCCATGGCTTATAG
TTTATAAAGTTCAGTATCTCTTGAAATGCAAGAGTATAAAATATGTGCAGATTAGGTAAA
TTAAAAGAATGTTTTTTTGTCAGTGATATCCAAAGCTTTTATACATTTTTAAATATTTTT
TCAAAAATGTAATTTTAATGAGTAGTCAGCCTTCACAAAATCATTTTTCTTCTACTCAGT
TTATATTTGAGTAAACAAATCAAGCTTCTGTCTCACATTCAGAAAATATTAACCATAATG
GTATCTTTGATGTATTTAATCTGTCGGGTTTTTTTTTTTATCTTTGTTAGATTATCTCCG
TCAAAGTTATGGGCTATCTATGGACTTCAATTCGCCAAATGATTATAATAAATTGGTGCT
TTCACTGTTATCTGGACTACCAAACGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTAAATTA
GATAGGTATTAGTTAAATAAACCATTTATTGGCTTATGTAAACTTTTTTGAATGTTTACT
ATCTAATCAAATATTTGATATCATTTTTACTTTAGAGTAGGTTTCTAAAAATCAAATTCT
TCATTTTATTGGAAATAATCTCTGTTAATGCTAGACCAAATTACTCATTTATTTAATGGT
AATTAAGGATTTGAAAAAATATGTCTTGAAATCTTTTCTTGCTCATACATTTTTTCTTTA
AATATCTGTGTTAGTTAAGTGTTATCGATATAAAATTTTTCTTAGCTTCCCATCTGTCCC
CTTATCCTGACCACAATGTAACTTCTTTTGCCAGAAGTATATTCTACTAAAGAATGTCTT
GACACATACTGAAATTATTTTATCATATGGGAAACTACGTAGCATAGTAGACACAGTCTG
AAAGAATTGCGTATAATATTATACAGATTCATGACAATTTTTGTTTTTATCTTTAAATAG
AAAAGTGTTTACAAATGAATCCATTGGTCTAAAATTTGGTTTGAGCCCATTATTAATAAA
ACATAATTTTATTTGGGATTATCCAAGTAGTAGTTTTTGAAATTTGGCCTGTAATTATTT
CATATGATAAAATTTTCAAGTTAGTTTAAATAAAAATTGAAAATTAATTTCTTGGTTATA
TAGAGGAGAAACCTAGATCATTACTTCTCATTTTCTACTGTAACTTTGAAATTTTTAATT
TGATGGAGTTTTTATTTTCTTTTTATTTTTTTGTATAAGAAGTTGTAAGTTAACAAAACA
ATCATGCGTACCATACAGGATTCCCGTACATCACTCCATCACCAACCTTTTAAAGACGTT
GTTATACATTTGTTTACAAATGATGAAGTTGATGATTTTTACTTTATTATTCATTGATTC
CTGATTTTTTTATTTTGATTTTTCAAATACTTTTAGCATTTAATATAGAATGAAATTGAA
CATTGTCTCACATTTCTTAGAAACCTAGAAATGGGGTGTTTAGAAAGAATGCATGTATTC
TCAAACTAGAATATTTTAATATCTCATAATCTCATCATTGAAAAATAGATGATGTATCAA
TAACTTAAGTTGGATTTATAATAGAAGTAATTTTACCTGCTTTTTGTGGACTAAGGAGTG
GCATTCTTTAGACCCTGTTTATATTCTTGCTTTCTGTAAGCATTCTAATTATCTAAAAAG
CCTAATTATGAGTCTGACAATCTAAAGCATTAATAAGTTAGCAAATGCTATGTAAGAAAT
GTTTCTATTATTCCAACAGTCTGAGAAGTTTAGAGTCCAGGTTACATAGGGACTTTGTGA
TGACCCTTAAAACAGTGGTTTTACTTTATGGAAGTAATAGGCTTGATTTCTTTAAACTTT
GTTTTCCTTTAATTTTTAAAATATCAATGTTACAGATTACCCAGTTAACACAAGATACCT
ACAATAAGAATAAATTTAAGTTATAAAGATTGCTTTTTCCCTTATTTTTATTCATCCTCA
ATCTGGATTTGGGACAATGTCCACTCTGACTGCTGGCAGCTGAGGAGGGATGTAGATAAT
ATGGGGCAGAGGAATGGAATTCTTTTAGCTTGCAGTTGATTATATTCCTTAGTTTTGAGA
GAGGACTGGTCCATCATCATCGTTTTGTCAATCATCCCAAGGCAGGCTGAAAGAACTGGA
GATTGGAAGTTTACTGCTTACCTGCTAGATTTCAGGGCTCAATGATTTTGTTAAACTTTA
GAGGTTTTGATTTATTATTTTAGGACATGAAATTTAATTGATAGACAAATGTAGTTGCCA
TTTCCTTTAGAAACAGTTTGTGTTTTTGAAGAAGTAAAACAAAAATCTATGACAAAAAAA
TTAATTTTGCATCTTACACTTTCATGCAATATTTTTTCCCAGTGACCTTTCTCTTTGTAA
GGTATTATCAAGCAAAAGAAAAACCTTGTTTGTCTTCTAGAGATGTGTGGGCTTCATTTT
TCTAGTTAAGTTGCTACTCACATATAAATTCAGTATTTTATAAAATGCTTCTTTCATATC
TATTCTTTATATAATTTTCTCATAGCCTTAATAGCAATATCAATGCTCCTTAACAAATAT
AATGAAAATGTTTCTGTTTTTCACTCCTTTTAATATTTTGTCTATGAAAATTCTTATTCT
AACCTAAGTACCATCTAAAATTTACTTACTCAATATTATCTAAATAGGTGTATACTTAAA
GGAGATGTAAATAGTACAGGGTCAATAACTCTTCACAACAAAATATATGTTTGTTAACAC
TTGTCACAACACGTCTGATAGGAAGGTTTGATTTTATTTGTTAAGAGATACTGAAGTTCA
TAAAAACTAGTTTTCTTTTTAACATTTGCCACCATGATGTTTTCTTTCTGCGTTTTGATA
GTAGCTTTCATTACTGAATTAATGGTAGTTGAAGCATTTACCTGATTTTTAAAGTATGTT
ACATAGTCACAATTGTATCATAGTGCTTTACTGTCTGGTTATGTACGGCACAAAATGAGC
TAACAACGTAAAGGAGGAAAAAGTGTTATGGCTTGTACCCATATTCCTTAATCCTTTTTT
TCGGGGGGGAGGGGGTGTTGGGGCCACAGCTGGGTGGGAGGGTTGGATGTTGTTAAGAAG
AAGCTTTCAAAAATGGATTGAGAAACACAAACAAGGTATAGCTCTGGAAATTTTTTAAAG
GAGATTTCATATTGTGGGAATTATGTCCAAGGAATGCCTGGCACTATAGTACTTGAGGTA
CAAATTACACAAATATATCAAAAATTAATAAGATTTTAAATTATAATTATCTGGCAATCA
AATGTTAATATACTAGTTTGACTTTTTAGTATTTACCTACAAATGAAAACTTATGCCAAG
TAACTATTCCTTACAGTACTTTTCATTTTTCTTTATTACCTGTACAGCTACTATGAAAAT
GAGTTGTGCATTTTTAGTTTGTAGAAATATGAAATTTTTTCTTTAATTCCTATGATTTAA
ATATGCTTCAAAAGGCATTATCATGACTCTTTATTATTTACTATAAAATAACTCCTAATA
GGATATCTTAAAATGTAGTTTTACTGTTTTTCCAAGCCTACTTATTATTAAAGAATTAAA
TGAAAGAATTAATTCCATTTTACTGAATGTACTACTGATTCTTTTAGCTTTAGGATCCTT
TTCTACTGTATTTGGAGAAGAATGGAAGGAGAAGACTGATAGAGATTTTGTTAAGGTAAT
TCATATGAATTAAAATTTTGAGCCAAAGTATCAATGGTTATTCAGTTTATATGCATGATG
ATGCCTATATTTTTATCTTTGGCATAATATGTAAAAATACTTCTTAATAAATTGTGGTTA
AGTTGAATAAAATATTTTTAGAATATTTAACAGTGGAAATAAAGTTCTTATTTTATTATA
TGTTGATTTCTGAAATGATAGATCTAAAACAATAGCAATAAATAGTTGATTCACTCTTTC
GTTAACCTTGACTCTGGAATGGGTTTCAGGGAGTTTTATTTTTATGCACGTTTTGAAAAT
GTGCATTTTAGGAAAGACAGAGGTTCTAGCTCTTTCATCACATTTTCAGAAGGATAAAAA
TCTAAAAGATTAGTAACTTTAGTATGGAAGAAAATTTCTGAAACTATTCTCTAAGCAAAT
CTAAATTATGATTTCAAGTAAGAAGATATAAAAAACTTTGAAGTAATGGTTTCCTTATAC
TTGTCAAACTCTTCCTGGCTTTCAATAACTATAGTTTGCTTCTTCTGCTTACTATCTAGA
GTACAATCCACAATTATTACTAATCTACAATTATTAGTAATAGAACATGCATATTAAACA
TTGTCTGAAAACATTTTATTAGCCTAATGCATGAGAAACTTTTGTATTTTAGTACTTTAC
CTAACATTGTGTCGAGCTTTCCATTTTTTACTTCTTCAGATTAAATTTCTAAACCTATTT
ACTTCATTTTTTAAAGTTGTCAGTAAAAGCACCATGATATATGTGTGGATATTATTTTAT
TAATCACTCAAATATTAAAAAATAATTGCAGTGAGATTTTGGATAATGAGATAGGTGATA
AATTTGGGTTAAAAGATTTGTTTTAAACTATCAACTAACATAGGATTTTTCTAGTTGCAT
TGTAAGTAAAGAAACATGAAATTGGGGTACATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATATAACTTAACCATTATAAAATATTCAAACAAGAATCTATAATAT
AGTCTTTGGAAAGTTGTACAAGAACTGTATTTTAATGAGCTGATAACATTTGTGTTAAAT
AATGGAAGAAGAGAGGAAAATTATTTTCATGCTTTTATAAAAGTAATTGTGAAACACAAT
GAAAAGTTAGAATATATAACAAATGGTAAAAATTAAATCACTATTAATCCCCCATCTAAA
AATAAACTATTAATATTTTATATGTATCCATCAAGTTCTTTCTATGCAAATAATATGTTT
TTAAATTGTATTCTAAACTTAATTTGTAGCTTGCCCTTTCACTTACTATATTGTGAGTTT
TTCTTCTCAACCTTAAATAATCTTTAATACTTTGGCTCCTTATGTCATATTAGAAACATT
ATTCATGTAAACAATCCATGTTTTAGAAATTAAGGTTGTTTACTGGTTTCATGATTATAA
ACCTAGCTGGGATGAAACATAATAGCTGCTTCTTCAAGAATACAAAGGATTTTCTTAAGA
TAAATTCCTAAGAAGTAAAATTTCTGAGTCAAAGAGTATATTTAATCCTTTAAGAAAAGT
ATAACACCTTAATTGAGTTGTAAGATAAAATTACTTTTTTGGGGGGGGTAAAGTTACTTT
TTATATCAATGTGTGAAATAAAATTTGCATCCAAAAATAGCTAAAACTAGTGCTGTTTGA
AATATTGTATAATCATTAAAAATTTGATAATACCCAATTAGTAGCTTTAAAATACTTTTT
TTTCAAAGATAAATGGTTTGAACTATTTCACTTGGTTGTATGTCTTTTAAATTATTTTAC
AAATCAGTTTATCTATTTAACAAATATATACTGAACACTTTATAGGCATGGAAAAAAAAC
AAGATGGCTGCTCTCATGAAATTTTCTTTCTAGTTCAGAAAGACAATAAAACAGTGTAGT
TTGAAGATTTAACAAGTACTGTGAAGAAAATAAGGCAAGATAACGTGATAGAGACTTAAG
AGACACATGATAACATTGGTAACATTTGATAGTGTGGTAAAGAAAGGCTTTTCTAAAGAG
ATAAATCAATGATTTTGGGTAGATTTGAATGGTAAGAGATCAACCATATAGTTAGCTAGA
GGAAGAGCTTTTCAAACACAGATTAGCAGGTGCAAATGCTCTGAAATAAAGAAAGTATGC
TTATGTTGTGAGGACTAAGGAAAGTAGTAGCAGACAGATGTGCATATTTAGAATATGCAT
ACACAGTTAAGAGAAAACTCTGATTAATACCAAAAGAAATTATATATTTTATGTATAACT
ATATATTTATATATTGTTTAAAAATGAATGTATATTGCATGTATTAAAACTAAGCTTCAG
GATACATTTAATTTTTTTTCCTTAATAACTTTCCCCCTGATTCCTTTACAATTTTTTTCT
TAAATCATAATATATACTTAGAAAAGTCCATATAACTGTACAGCTCAATAAATGTTTACA
AACTGAATACTCCAGTGAAATCATAACCCAGATCAAGAAAAAAAACGTTATCAGCACCTC
TGAAGGATCCCTCCTCATTCCCCCTTGCAGTTACTCCTTTTATGCTTCCTTACCTGCTCC
TCCCACCCCCACCCACTCACCCAGTGCTTCTTTTCTTTTGGGTAACATGTTTGTGAGAAA
TTCATCCATGTTTTTCTAAATATTTGTAATTCTTACTGCTGTATAGCATTCCTTTTTATG
GATATACAGCAATTTATTTATTTTTCCTATCTACTTTAAATAGAGCAGTAAGGACTGGTT
TATTCATTTGGAAACAAACAATGCTATTCTGAAAGATTTTGTACATGTCCTTTGGTGAAT
ATGTGCATTTCTGTTAAGTAATAGACCTAAAAGTGGAACTGCAGTGTTATAGGGTATGCA
TGTATTCAGCTTTAAGAGATACTGCCAAATAGGTTTTTTCTCTCTCACCAGAGTTCAGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGATTTCCAGTTTCATTC
CATTGTGATCTAAGAAGATGCTTTGTATTTTGTATAATTTCAGTCTTTGTATATTTATTG
AGAGCTGCATTGTGTCCTAACAAGAAGAAAGATTTATGGGCACTTGAGAATCATGCATAA
CCTAATTATTTGAGATGCAACTTTCTTTATATGTCTGTTAGGTGTAGCTCATTTATCATA
TTGTTCAAGTTCTGTGTTTCCTTGTTGATCTGTCTAGTTATTCTATCTGGTTATGTGAGC
TGTATCTTGAAGTCCCCAAAGATTATTGTAGAGATGTCTATTTCTCCCTTCAGTTCTTTC
AGCATTTACTTCATGTATTTTGGGGCATAGATATTTATGAGTTTTATTTTTTCCTTGTGG
ACTGTCCCTCTTATTAATATATAATGTGGCCTTCTGTATCTCTTATAGTTTTGCATTTAA
AGTTGTCCAATATTTGTATAGCTACCCCTGCTCTTTTTCAGTTACTATTTGCATGAAGTA
AAGAGATCCTGGACTAAAGAGATCCTGCCCTTCCAATCTCCCTCTGTGCTAACTGGGACT
GATTGTTAAGGACACAGAGGGGAGGGGAATTCTTTCCTATCCAGGAAAAGGGAGGAGGCT
GCCAGTGAAGGCTGGAGAACTGTCTCTGAGAAGGTGTTAATTATAAGGTTCTTAGCTTCC
AGGCAGGAACCTGTATCACTTTTATCCTGTCCCTGTTGCAGCAAGCACTCTGACCAAGTA
CTCAACTGAGAGGGCTGCCAAAGTGCACCATCTGCTGGCCAACAAAGGAAGTGCACATGA
GGAAATTAAAAGTAAATAAGTGAGAGGATTTTTCTGGCCTTTAGAGCTTCCCTCCCTAAG
GCCCTAGTGAGTCTGCAACCCATTACTGGGTCCAGAGTCCAGTTTTGAACAAACAATGGT
GCAGCCCCACCCAGTCTGGGAGGGCCTATGGGACAGCAATCCAAATTTGTGGGTCAAAAG
GTGAGTGAGCCTTAGGCTGTGTCCTCCTCTCTCCCCTTTCCTGTAGCCACCTTTTGTCTA
TGGCTGGCCCAGAGGTCTGAGAATTCAAGTCATTAGTGTAGAGGAGGGTCCAGGCAGTAG
CAGCCTTGGCTTTTAACTCACAGTTTTGCTGTCACAGTCTTTTCCTATGTCCCTTTCTCT
TCTGGGCAGTGTCCCGCTTTTGCCTGGTGTACTAGACCCTTGAAGATTTTTTTCCAGGCC
ACTTCAACCTGTCCTATAGCTATTTTTCTGGTTGAAAAGAGTCCTGTGTCTTTCTAGTCT
GCCATCTTCCCAGAATCTCTCTTTAATTCTTTCTTGAGTTGTGTCCGATCAGATGTGAAA
CTCATCCATTGAGTTAATTTCAGTTGTTATCCTTTTAAATTCTACACTTTCTATCCTATT
CTTTCTTTTTTAAAAAACAAAATTTTATTACATTGTCCTTTTTTTAAAAGATACATAAAT
CACAAAATGTTACATTAAAAAATGTAAGAGGTTCCCACTTATCCCACAGCCCCACTCCCC
CGATTCTTTCTTATAGTTTCCTTTTCTTTCCAAGAATTTTCAATTGTCTTTCATTTCTTT
GGACTCTCTATTCATAGCCATTTAAATTCCATGTTGATATCTTAGTTATTTGAAGTCCCT
GTGGCCATTTTTTTCTTGGTTATAGAACTTTGTCTTTTTTATTCATATGCCCAGTTTTTT
TATTTAGTTGCCAAACATTGTTTATTATGAATGTTTTGCGTAGTGATCCCTTTGCTGTTT
AGATGAAACCTATGGATCTCTTCTCCAACTAGTGTCCTTAAATGCAAAATAACTTGAATT
CAAAAACAAGAAGAATTTATTTTGAAATACATATAACAATGTTAAGAAATAAAAAATGAA
TAGTCCATATGCTTCTTTATTAATACATAAATTAAAAATAGTAGTTAAAATACAGTCAAA
TTGGGGAAACGGACTTGGCCCAGTGGTTAGGGCGTCCGTCTACCATATGGGAGGTCCGTG
GTTCAAACCCCGGGCCTCCTTGACCCTTGTGCAGCTGGGCCCATGCGCAGTGCTGATGCG
CGCAAGGAGTGCCGTGTCACGCAACGGTGTCCTCTGCGTAGGGGAGTCTCACGCCGCAAT
GAGTGCGCTCATGAGGAAAGTCGCTCAGCCTGAAAAGAAAANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
AATTTGAGAAATTAGTTGGTTTTTATAAAGGGTATTTATTTGGGGTAAGAGCTTACAGAT
ACCAAGCCATTAAGCATAAGTTACTTCCCTCACCAAAGTCTATTTTCACATGTTGGAGCA
AGGTGGCTGCCAATGTCCGTGAGGATTCAGGCTTCCTGGGTTCCTCTCTTCCCAGGGCTT
GCTTCTTCCTGGGCTCAGCATTCCTCTCTTCCTGGGGTTGGCTTCTCTTTTCTCTGTGAG
TTTGCTTCCTGGGGCTCCAGCTTAAGGCTTCAGCATCAAACTCCAACATCAAAAAATCCT
CAACTCTATCTTTTGCCATTCCATTTATCTGGTTTTTCTGTGATTCCGGCTCTCACCAAG
GGGTGGGGACTCAATACGCTAATGACTTGACCCATTCAAAGCCCTAATCATAACTTAATC
ATACCCAGGTATAGACCAGATTACAAACATAATCCAGTATCTATTTTTGGAATTCATAAC
TATATCAAACTGCTACACTCCACCCTCTGAATTCCAAAAAGATATTACAATATTTGAAAA
AATCTTAAATCAGTAACAATGCAAGTACTAAATCATATCACAAATTAAAGAAAAATAGTT
TGTCTTGGGGCAAAGTCCTGTCTGCTTGTAGACCTCTGAAACTTACAAAACAATTTATCT
GTTTTCAATATACAAATGGACAGACAAAGAATAAACATTTTCATTATAGTAAGGAAAAAT
TGGGAGGGACGCATGAGTCGTGGGTCCTCTACAGTTCAGTAAACCTGCAGGGCATCCTCC
ATTCCATTTCAGTCTGAGAATCATTCTAAAGATGAAGGTTTCTTCTCCTTAGGGCTTGTG
GGAACCCACCCTTTCCACATGCTTGCTCAGAAACCATTTTCTTGGTTCCACCCTCATCAA
GCATCTGGGTGTTGACCAAGCTCCAGACCTCACCCTCCAAGAGTGTTGGGATGATTGCCA
CACCTTACCAGTCTTTGGGTTAACCCCCCTAGTATAGTGACGTGAAGACAACATTCCCCT
TAACCTTTAATATACAGGCTCAACCCACTCGGAGCAATGAGTTGACTACCTGGCCTTCCC
TAACATTTGGCATAAAAGTTCAGCCCTCTGAGAGGAACAAGTTAACCACCTGGCCTTCCC
TAACCTTTGGCATGCAGGTTCAATCCTCTCAGCCCTGGGGTTGCTGACCTCAACCACCCT
AATCCTTGGGGAATGAGCTCCACCCTCTCTGTACCCTCAGGCAGCAAAACTGTCCCAGAA
CCTGGGGTGGAAACATCCAAACTCTTCAAGTGCTGGGGCAAACTCACCCTCTTTGTACAC
ATGGGTGGGGTTCCTCTCTTGGCCCAAGGTGATGTCCTAATTCCAGATCTCAGCTTCCAT
GGTTTTCCTCTTGAAGTGTTTTCCCCTTCAATGTCTCCTTTCCATGTCCTTTTTATTCCA
GGCTGACAGTGGCTTTGTTCATACAGCTCTCTCAGAAACCTTGTTGGTTTAGCATGCAAG
AAGCAGGAGTCCAAGTCAGCAGACAGTAAGACTTTCCACAAGTCTTTCCAAGATAACTGC
ATCTTCAATCCTGATTTACAAGTTCCAAGTTAGTTAAGTCCTCCAATGGGGCACTTTCAT
CTCGGAGCTTGATTTCCAGGGCTTGGAATTTCCAGAGTTAGTTTCTGCTTCCTTCGTGCC
TGACAGTTCAGTCTTCAATAGATCTCTCTATCTAGCATTTTGCTATAAGCTACAAGCAGA
AGCCAAGCCGCATTCTCAGGGTTTACTTTGGAAATTTCTTCAGCTAAATGCCCATTTTCA
AATTCTGCCTCCCATAAAACACCAGGAGTTAAACTTGCTACGTTCTCTGCAACTTTAAAA
CACAGATTGCCTTTCTTCCAGTTTCCAATAATAGTTTCATCATTTACTGCTAAGGCATAA
TAAAAAGTCTCTTTAGCATCCTTATTGCTATCAACAGTCTCTTCAAAGTGATCTAGGCCT
TTTCCATCAAGCATCTCACAATTCCTCCAAAAAACACCCCTTACCCATTTAGAAAACCAT
TCCAACATTTCAGTAATAGCAAAAGCACATTCCCACTCCTAGGTACCAAATTCTGTATTA
GTCAGCCAAAGGGGTGCTGATACAAAATACCAGAAATTGGTTGGTTTTTATAAAGGGTAT
TTATTTTGGGTAGGACCTTACAGATACCAGGCCATAAAGCATAAATTACTTCCCTCACCA
AAGTCTGTTTTCACGTGTTGCTGCCAATGCCTGAGAGGGTTCAGGCTTCCTGAGTTCTTC
CCTTCCAGGTTCTTGCTTATCTCTGGGTTCAGGATTCCTCTCTTCCCAGGGCATGCTTCT
TCCAGGGCTCAGCGTTCCTCTCTTCCTGGAGCTTGCTTCTCTTTCTTCTGTGAGCTTACT
TACTGGGGCTCCAGCTTAAGGCTTCAGCATCAAACTCTAACATCAAAAACCCTCAAGTCT
GACTTTTGCTATGCCTTTTATCTGCCCTAAGTGCTGTGGCCCAATCAAAGTCCTAATCAT
AACAATCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATAATACATGAAAAAGCAATTTAAG
TAAATATGTATTTTCTGTATAGAAGGTACATCAGGAGAATGGATTTGGGAATCTTTTATT
TCATCCACATCGGAAGTTGGGCATTAATGATATTGAAGGACAACGGGTACTTCAGATTGC
AGTGATTTTGAGAAATCTTTCCTTTGAAGAGGGCAATGTTAAGTTCTTGGCAGCTAATCG
TACCTGTCTTCGTTTCTTATTACTTTCTGCACATAGTCATTTTATTTCTCTAAGGCAATT
GGGACTTGACACATTAGGAAATATTGCAGCTGAGGTAAGCAGTGACAGTACCTTAAAATT
TATGTAGATAGCAAAGACATTTACTCTCAACTCAATTCTAAAATTTTAGGATATAGCATT
ATTATAGTTGTTATATTTACAGAATATTAAATGCTTGCATATATTTGTTGCTAACAGCAT
AGTTTAGAAGTGTCATAACATATTTGTCGAAAATATTTGAAATGTTTCAAATGCAGTGAT
GGTTATGCTTACAGTAATTACATTTTTAAAGTTATATGACATTATTCATATATATTAAAT
TTTAAATATACAGTCCTAGAGGAAGCAACCCCAACAATAATGTCCTTTCATTTTTCCAGC
TTTTATTGGACCCTGTTGATTTCAAAACTACTCATTTGATGTTTCATACTGTTACAAAAT
GCCTAATGTCAAGGGATAGGTTTTTAAAGATGAGGGGTGAGTGCTCCCTTAAGTTTCTTA
TTGTCTAAAGTGCACAAATTTCATCATTTGTTAAAAACAAAACAAAATAAATATGTATGT
ATGTATATGCACTTTTCAGGCATGGAAATTTTGGGAAATCTTTGCAAAGCAGAAGATAAT
GGTGTTTTAATTTGTGAATATGTGGATCAGGACTCATACAGAGAAATCATTTGTCATCTC
ACTTTACCCGATGTGCTGCTTGTAATCTCAACACTCGAGGTGCTATATATGCTCACAGAA
ATGGGAGATGTCGCTTGCACAAAAATTGCAAAAGTAGAAAAGAGCATAGGTAAGATTAGA
CCAAAAGAAACATATATTTTGTTTACTGAGGGAAAATATTTGATGTGGTGCTATACAAAA
ATCACAGTTGATATTTGGGGTTCACTGTTTTGTTTGAGGAGTCATTACTCCCTCTGACAC
ACTTATTTACACTATTCATTTTCCTTGTTTAAAACCAACAGGAAACACCTATTATCATGT
AGAGGCTAGGATATATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATAAAAAGGGTTGGAAAAAAAATAGTTACTTTTTA
TTGCCCAGTACCCCCCAAAGGAGCCCTCCATCACTAGGCAATAGATAGATATTGGGGGAA
TTTCCAATCCAGATTATTTACCATTCTCAACCTTGATTAAAGGAATGAAACAGTTAAAAT
TTCCATTTTTGTGGTGGTTTAAAGGATATATTGATATCCACAAAGAAAGAAATTGAAGAT
TAAATTATTTGAGAACCATAGAAAAACTGTCTAACAAAAGTTTGGTAAATTGTCCATGAA
GACACTGAAACTATAATTGGCCATTTGAGAAATATTCAAAAAGGAAATTTTTATGAAAGC
TACCTATTTTTGCTTTATGACTGACCTTTGACTTTAAACAATGCTTTAACAAGTGAATCC
ACCACAATGTAAAATTTCGTTCTCACTTGGCAAATGGAGAAAATTAAACATTCAGCGCTT
GTGGCTTATTAGTGTATGTAGAAATATATTGGTAGAAGTGGGAGTAGGTGTCTAGGGACC
TAAAAGAGTTCATTTTTGAGCTTGAGGGTACTTTATAATTTATTCGCTCACCTTGAATGA
CAATCTTTAATTGTTTGATTAGTTATCTCTTATAGTTTGATCCCTGACCCCCCCCTCATA
TTTTAATGCTTTCTTATGAAAATGATCTTCTTCAAACTTTTCCTCATCATTATGAAAACT
TGTATACTCTTTAACCCATCTTAAAGTTGACATCTAAACTTCTTCATCATGACTTAAATT
GTTGGCAAGAATATACTTTTGATGATTCTTAAATTGACATTTTAAAGTAAAAGGGAGTGA
GTGTAACTTAGCGATTGAGTGCGTGCTTCACATATATGAGGTCCTGGGTGCAATCCCCGG
TACCTCCTAGGAAAATAAAATTGTTTTGGGGGGATGTGCATAGCGCAATGGTTGAGAACC
TGCCTCCCATGTATGGGGTGCCAGGTTCAAGCTCCATTACCTCCTTAAAAAAAAAGAAAG
AATACTTTGTATCCAGTGGAATCTTGATAACTTAACCATCATCTATTTTAAAAATATACA
AACTCTTAACATCAGAAATGTTATAATATCCTTCTTTCTCCTTGAACTCATTTTCCAATA
TCCCCGTGTATTTTTATCCTAATATACATTTTATGCTTGAAAGTTTTTTATTCATTACCC
TATCATATTTCTCTGCTATAAAAATGTATAGACATTATAATTTAAAAATTTTTCAAATCC
CTGTTCGTTTATAAGGTTCTAAGTCCTTAAAAGTTTTTATGATTATGAATTTTAGTAGTA
AAAAGTACATCAGGGAAGCGGACTTGGCCCGATGGTTAGGACATCCGCCTACCACATAGG
AGGTCCGCGATTCAAACCCCAGGCCTCCTTGACCCATGTGGAGCTGGCCCATGCGCAGTG
CTGATGCGCAAGGAGTGCCATGCCACACAGGGTTGTCCCCCGCGTAGGGGAGCCCCACGC
GCAAGGAGTGCACCCCGTACGGAGAGCCGCCCAGCGCGAAAGAAAGTGCAGCCTGCCCAG
GAGTGGCACTGCACACACGGAGAGCTGACACAACAAGATGACACACCAAAAAGAAACACA
GATTCCCATGCCACTGACAACAACAGAAGCGGACAAAGAAGACAACACAGCAAATAGACA
CAGAGAACAGACAACCGGGGTGGGGGGGGAGGGGAGAGAAATAAATAAATCTTTTTTTTT
TTTTAATTACATTATCACAGGCACCTTGTGTAACCAAGTATACTCAGAAAGTGTTAGCAC
AGTGCTTCTCAAATTCAAGGTATATTAGAATCACCTGGTGGATTTATTAAAATACACATT
AATCTGCTCTACCTCAAGTTTCTGATTCAGGTGGGATACGAGAATTTGCATTTTTAACAA
GTTCCCATGAGATGCAGATGCCGATGCCACTGGTTTAGGGACTAAACCTTGAAGACCACC
AGGTTAGGGAAATTGAAATATCATTCATTTCATTGTTTTTTTCAAGTACAGTACAATTTT
TTTATATATATAAAATTCTTTTATATGCTTTGAATACATTTTTGTCAAAACCAGATTTAT
CTCATTCATTTTATGGAAAGTGTTTGCCAAATAACCAAACCAATGAAGCTAGACTTTANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGA
ACGACAAGAAGAGAAGACAAGCAGACACAGAAGAACACACAGAGCACAGCAAGTGCAAAC
AGTGGGGCAGGGGAGAAATAAATAAATTTTTTAAATTAAAAAAAAAAAGAAGCAAGAATG
TTCATATGTGTTCCCATAACACACTCTTCACTTCTTAATTCTAAGATAGTTAAAGCTGAC
ATGAGTTGATCATCTGAATGAAATAATTAGGTGCCAGCACTTTGAGATTTTTTGGTTTTG
TTTGTTTTTTGAAGTACTGGGACCTCATATGTGGGAAGCCAGTGTTCCAACAACTGAGCC
ACATTTGCTTCCCTGAGTTAGTTTTCTTGTTTGCTTATATTTTTTAGGAGACACCAGGAA
CCAAACCCGGGACCTCCCATGTGGGAAGTAGGTGCTCAGCTGCATGAGCCACATCTGCTT
CCTTCAGTATTTCTTTAAATTTTTTTCTGTGATTTTCTTATGAAGGATGCTGCCTCCAAA
ATAATGCACTGTTTCAAAGTAGCTGAGGGTTAAAGAGGCAAGAACATTAAACAAAAATCA
TCATCACTTTATATAATTTATTTGAATTCAGAACACACCAAAGGTCCAGAATACCCAATT
TCTAATTCCAAGCCTTACCCTTAACAATAAATATAAAACACTAGGATAGACAAGAAGCCC
TACCTTAATACCCTGGTTAAAAGATACTTTGTGAACACTAATGTTTTAATTCTCTCTTTG
TTTGGTATTCCAAAGGTTTTTTCCATCTACAAAAATATACCACAGTACTAATAATATCTA
ACATTTATATAATGTTATTATGTGCCAGCCATTGTTTTAAGTGATTTACATATGAATTCA
TTTAATCCTCGTAACAACCTATGAGGTCTGTTTACTGATACTTTTTCCCATTTGTATAGA
GAGAGTATAAGTAACTCACTTGATTACAAGCCTGTCATGCAGTTAACCATAATCCTGCAT
TGCTATAAAAGATAAGTAAGAGTTAACCCTATCTGTACCAAAACGGGAAAAGAGCAATTG
TCAAAGGGAAAGTGATGTTCTCAAGCAAAGCAGTTTTAGGATGGAATACATACCAAAGTT
GAGTATCTGAAAATTGATTCCATTAAAAATATAAGTACCTATGTACCATTTGGAATGTCT
TCAGTATCCTAAAGTTATTGCTTCTCTTATTGTAGCAACTTCTATAGAAATTATATGTTT
CCAGTTTATATTCCTACTTTATTTCTTATAATTTCTTCTGGTTCATGAAATTGACTAAAT
TTATTCAACAGATTTCAGTTTGGTATAGGGTATACTCTTTCATAGTACATGTAATGGAAA
AAAGGGAAGAAGATTTCTATAGAGTTTCCAGCCCTAGAAAGGTATTATCTGTAATAGTAT
CTTAAAGGTAGAAGAAGAAAGGAAAAGCCAGAGTTTCCAGCAGGAAGATGATTTTCACTG
TAATATTTTCTGTTAGGAAGGGGCATATCACATTATGGTCTCTGAAATGTGACAGGATCC
AAATTTAACACTTCTTTAAAGAATGCTTTCCAAGCTACACCCAACTCTGTCATCTTCACC
ACGCTTCCCTGAATGGACAGAAGAGCTTTAGTTTTCTCATTTGTAAAATGGGATAATTAA
ACTTAGACTTATAAAGATTAAAACAGTAAATATTTGGTGGCTGCTATTATTGTTTATCCC
CGTAAAAGCCTAGGTCCTACCTCATCAAGGGGTCATGATTGCTTCAGAGCATTCACAGAA
TTGGTTTCTTCAGTTCCATTGTTTTGGAATTGCATTTGTTCTGTTTGCGGGGCCTGAGAA
ATTTTGCTAAAATGTCATCTGAAAAGAAGTGGGCACAGTCTATATGTTTAAAACTACAAA
ATAATGCTATTTCAACGGTGAAGCAGTAAAATAACTTTTCATTTTTATCTACAAATATGT
AAGGCATTTATAATTTATCATAATATGACTAAGTTTGTATTATCTTACACTTTTCATTAG
TTTCCTTTGAATTATGTAATAGAATAGCAAAGAAGATAACTTATAATCTATTACACTTAT
TAGAAAATAATTGATGATTTTCCTCATTGATTCATTGGCCTTGAAATTGTTTTAAAATAT
GTCAGTAAAATCATAGAAATTATGAGTTTAAGATTAATAGCTAGTGTGTTTTTATACAAC
CAAGTTGCCTCTTTCAGGACAAAAAGTATACTTCAAAATTATTATTAGAACAGGTCTCCC
CCTACCCACAAACCTCCCCCCTTCCACATGAATAATCTTTGAAAATCCTTTCTTGAATGT
GGGATTTGAAATTGGTTCAAATTTTGTTCATCTTATTTCAGAAGTATTTATAGATGCCAC
TTAACAGTGTGAATATCTTTTTATATTCAAAAGCAAAGTTACAATTTCCGATGCAGTCTG
CTATATAAAATTTTAGCTTTTAAAGTCAATTCTCTTAACTAAACTGAGATGCTTATTTAC
TGATGTATTTAACTATGTGACCATAGGCTAGTTATTTTGTGATACTCAAAATGATTACTT
TGAGTCTGTTTCTTTATCTATCCCTACCTCATAGAAGAGTTAAGTGAAATAATACATAAA
GTATTTAGCTCAGTATCTCGCCAGTGAGGAAAAACTGAGTTTATATTAGCTATATCACTG
ATATTGTTATTATTTAAATAATTATGAGGTTAAACAAAACAATTTATATAAAGCATCTCA
GACAGTATCTGGTATAGTATGTGCTCCTATACATTAGTTTCTTTCTCCAATTTTCATATG
TTTATATACCTTTTTAAAAAGTAGTCTTTGTGAATATTAATCTGATCAGTCTCCATGAAA
TGTATATGGCATACAGTGACTAAGTTTTAAAAAATAATGTATATAATGTTCTTTTTCTCT
TTAGCTTCCAGAGCAGTTGTAGCACAGCATGTTACTCCACCTCCAGGAATAGTGGAAATA
GATAGTGAGAAGTTTGCTTGTCAGTGGTAAGTGGTTTATTTCTATTAAGACTTTATTTTT
GGGAAGAGTAAAATAAAAGGATTTCTGAAGTATATTCCTTGGTCATCCAATTTATTCTGT
ATTTCTTTTTAGTTATATTAGACTATCATTTCTACAAAGAAAAGACTATATAAAATCACT
TCACCTGTGTTTTGGAATAACTTTGAAAGACTATTATTCATCAGAATCTCCAGAATTAAA
GTAGTCTTTGACTAGAATTTTATCATATTACACCCATTAATTCCTTTTCAGGTTAAAATT
TGTGTTAAAAGGTTTTCTGACTTTGTAGAAAATAAGATTTGTCAGATATATAAAACTTGT
TTTCTTAAATTAATGTTTTGTTAGAACTCAATTGAACTGACTTTAGAAAGTAAAACTAGA
TTTTGTTCTTAAATGTTACTTCTTCTTCATCAGAATCAAAATTTTCTTGTTCATTGATAT
TAGTTTTTTTCCTTTTTATGAGTGTTAAATAATCAGATGATAGACTAACCAGTGTTTCTA
CCTTGAAATAAGCAACTTGAAAATAATATTTTCTTGATAATATTGAGTAGACATAATTCA
GCTACTTTTTGGGGAAAAACATGTACACCTGATTAGATTTCATCTTTGTCATGGATAGTT
GCCTCAACATTTATGAAATCTGACTTTAGTTATTTTAGAAGATGAACAGATTGAAATATA
ACATTACTTTCTGATGATGTATCACTTTTTAAATTTTCTTTCTTGATCCCTTTCCTCCCA
TTCTTTAACCTAATTTATTCCTCATTCCCTGTGCCTACCACAATGTGTTCCATGTTTTTG
GTGCTTTCCTATCTTTGCCTATGACAGTTCTTCTTTTGTTTATGCCAGGTTTATGGTTTT
AATCTCTAGTTATTTGCTGTTTTTTCATTACTTTCTGTATTTTTCCACATTGATCTTGAC
CCTTTATTCTTGATTAATCTCTTCCAACTGTATTGGAAATTAGTCATTTTCTACATTGAA
ACCAAAATGAAATTTTTATATCTAGTCTTTTTAAATCTCAGTATAGAAAAGATATAAAAG
TTGGGGAAAGTATGTACCATAACAACTAGAAAATGTGGGTTTATTTTATATATAGATTTG
TTTTTATAAATCCCAGTTGCACATTTCGCTAGTTCTTCAGGGTGTGGGGGCAAGGGGTGG
TGGTGGTGAAATTATTTTACAATTATTTTATCATAATTATTATTTGGTGCTGTTTAGAAG
AAACAACTCTAAGCTGGTCTGTTGTTTATAGAGTCCTGGAAAGAATGCTGTAACAGTAAC
TAAACCTCTAATTCTAATTTATAAATAAACACACTTTAAGAAAAAGAGAAAAACTGAAGT
TTGAATTCATTCGTAATGGATTAGGAAATAAAAGTGTTTTGAGTTGGGAGAAAGGGAATT
TGCAGCATGAAAAGTGTCGTTTTCAAGAGTAGTTAAAAAACATCATTAAATTTTTTCTGC
AGAGGGAATTTGGTCCAAAAGCCATGCAAAGTTTAATTTTGCTCCGTTTTCCTCCATTTA
TCTCATCTCCAGCAGAAATAGTTCATAATCAGGAACTTGTATTACGTTGTGATTATTACA
AGACAGGAACCTGAGTAGATAGTCACTGAATAAAACTTATTTGTTATGGAACATCACTGT
AACCAGACCATCACTGAGAGCTCACTGAGATATGAATACAATTTTTATGTTTGTTGTTAA
TGACATTTTTATGCTAAAATAAGTATGATTAAGAAGTTAAACTTTTTATTTGATTTTTGT
CTGTCCAAAACTCTAGTATATATTTTTGCTATTAACAAATGAGATACTTAGTGAAATTTG
TTTAGTAGGTATAATTATTCATTTATAACATATTGCATACAAATGGTTTTGGTATATTTA
ATATGGACTTTGCTGTGGTATATTGCACGAACCATGTATTTTTCTCTTTTAGGTTAAATG
CTCATTTCGAAGTAAATCCAGATTGTTCTGTCTCTCGAGCAGAAATGTATTCTGAATACC
TCTCAACTTGCAGTAAATTAGCTCGTGGTGGAATCCTAACATCAACTGGATTTTATAAAT
GTCTTAGGTAGGATGCATAGTTCTTAAATTTATATAAAATTCATTTACGTTATTTACAGC
ACTTCTTACTTTTTAGAGACAATACCAAATACTTATATAGCTTTAAACATCTCCATTTCT
TGAAATTTTATATGGTAAAGTTGTAGGGTGGTAGAGATTTAAATTAAAGGAAATTTCAGA
AATCACAACTTGTTTTTTGTATTTGAACATTATGCAGTTTATCAAAAAAAAATTAAAGGA
GAAAATTAAGTTGACTTTTCCCTACCTACTTTTATAAGTTAAAGACCTGACTTTTGCCTA
TCTTAATTTTGAATAAGTGCATAACCAGTACCCTGTCTTGAAATATCAATGGTTTTTGAT
ATTTTACAATGTTCATAAAATAGTGCCCAAAAAAAGTGATATTGCCTTCATGCTGCCAAT
TTTTTGTTAATTATATACATGGGCTAAAATTGTTTAAAACCCAACAACACCTGATAAATA
ATGATTTTTTAAACTGGAAGATTAATCTCTTCTTTCTCCTTACCCTTACAGAATATAACC
TTATAAATGATACTGGTTCATACATAAGTAGCAGTGAATACATTACTGTTGTTCATATAA
ACATTGTTAGAAGTCAGTGTCTTTTGCTAGTGTAGTAATTATCAAAACTAATTGAGCATA
TATATACTTGACAGAACGGTCTTTCCAAATCATACAGTGAAGAGAGTAGAGGAACCCAGT
AACACCGGGCAGGCACATATTCATGTAGTAGGCGTAAAAAGGAGGGCCATACCACTTCCC
ATTCAGATGTATTATCAGCAGCAACCAACTTCTACTCCTGTTGTTCGTGTTGATTCTGTT
CCTGATGTATCTCCAACTCCTTCACCTGCAGGTATTAATTTTTATTGTTTTAAATAATAT
TAATAATCAGACCAAATGAAAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTTAAGGCTACAGTAATCCAGAATTCTGTTCCCCAGTCAGCAGTTCCTGTTAGT
CTTGCTGTTGGAGGAGGAGCTGCACAGAGTTCTGTGGTTCAGAATCATAATACAGGGCCA
CAACCAGTCACAGTTGTAAATTCTCAGACTTTGCTCCACCATCCATCTGTAATTCCACAA
CAGTCGTCATTACACACAGTGGTACCTGGACAGATACCTTCAGGTACTCCTGTTACAGTA
ATTCAACAAGCTGTACCACAGAGTCATATATTTGGCAGAGTACAGAACATACCAGCATGT
ACTTCTACAGTTTCACAGGGTCAACAGTTAATCACTACATCACCCCAACCTGTGCAAACT
TCATCTCAACAGACATCAGTTGGTAGCCAGCCACAAGACACTGTTATCATAGCACCTCCC
CAGTATGTTACAACTTCAGCATCCAATATTGTCTCAGCAACTTCAGTGCAGAATTTTCAG
GTAGCTACAGGACAAATGGTTACCATTGCTGGTGTCCCAAGTCCACAGCCCTCAAGGGTA
GGGTTTCAAAACATTGCACCAAAACCTCTCCCTTCTCAACAAGTTTCATCAACAGTTGTA
CAGCAGCCTATTCAACAACCACAGCAGCCAGCCCAACAAAGCGTAGTGATTGTAAGCCAG
CCAACTCAACAAGGTCAGACTTATGCACCAGCCATTCACCAAATTGTTCTCGCTAATCCA
GCAGCTCTTCCAGCTGGTCAGGCAGTTCAGCTAACTGGACAACCAAACATAACTCCATCA
TCCTCACCATCACCTGTCCCAGCAACTAATAATCAGGTCCCCACTGCCATGTCATCATCA
TCTTCCACACCTCAATCACAAGGACCACCTCCTACTGTCAGTCAAATGCTATCTGTGAAA
AGGCAGCAACAGCAGCAGCATTCACCAGCACCTCCACCACAACAGGTACAAGTACAAGTT
CAACCACAGCAAACAAATGCAGGAGTTGGTCAGCCTGCTTCTGGTGAGTCGAGTCTGATA
AAACAGTTGTTACTTCCAAAGCGTGGTCCTTCAACTCCAGGTGGTAAGCTTATTCTCCCA
GCGCCACAGATCCCTCCCCCTAATAATGCAAGAGCTCCTAGCCCTCAGGTGGTCTATCAG
GTGGCCAATAACCAAGCAGCAGGTTTCGGAGTACAGGGGCAGACTCCAGCTCAGCAACTT
TTGGTCGGGCAGCAAAATGTTCAGTTGGTCCAAAGTGCAATGCCGCCCACAGGGGGAGTG
CAAACTGTACCCATCTCGAACTTACAAATATTGCCAGGCCCACTGATCTCAAATAGCCCA
GCAACCATTTTCCAAGGGACTTCTGGCAACCAGGTAACCATTACAGTTGTGCCAAATACA
AGTTTTGCAACTGCAACTGTGAGTCAGGGAAATGCAACTCAGCTCATTGCTCCAGCAGGA
ATTACCATGAGCGGAACACAAACAGGAGTTGGACTTCAGGTGCAAACGCTTCCAGCCACT
CAAGCGTCTCCAGCTGGACAATCACCGTGTACTACTGCTACTCCCCCATTCAAAGGTGAT
AAAATAATTTGCCAAAAGGAGGAGGAAGCAAAGGAAGCAACAGGTTTACATGTTCATGAA
CGTAAAATTGAAGTCATGGAGAACCCATCCTGCCGACGAGGAACTAACACCAGCAATGGG
GATACAAAGGAAAATGAAGTGCAGGTGGGAAATCTTTTAAATGGAAGAAAGTACAGTGAC
TCAAGTCTACCTCCTTCAAACTCAGGGAAAATTCAAAGTGAGGCTAATCAGTGCTCACTA
ATTAGTAATGGGCCATCATTAGAATTAGGTGAGAATGGAGCTTTTGGAAAACAGAACTCT
GAACAAATGGACATGCAGGAAATAAAAAACGATTTGAAAAAACCCCTCGTTAATGGAATC
TGTGATTTTGATAAAGGAGATGGTTCTCATTTAAGCAAAAACATTCCAAATCACAAAACT
TCCAATCATGTAGGAAATGGTGAGATACCTCCAGTGGAACTACAAGGGACTTTAGATGCT
TCTCAGCAAGATACTGCCAAAGGTGATCAACTAGAAAGAATTTCTAATGGACCTATATTA
ACTTTGGGTGGTTCACCGTCGGTGAGCAGTATACAGGAGACTTCAAACGTGGCAGCACAG
CAGTTTAGTGGTACTGATTTGCCTAACGGACCTCTAACTTCAAGTTTGAATTCAGATGTG
CCTCAGCAACGCCCTAGTGTAGTTGTCTCACCACATTCTACAACCTCTGTTATACAGGGG
CATCAAATTATAACAGTTCCCCACTCAGGATCAAGAGTGTCCCAGTCTCCTGCCCTGTCA
TCTGAAGTTCCAGCTACAAATGGCACATCAGAATGCAAAACTGTAAAGAGGCCAGCAGAG
GATAACGATAGGGAAACAGTCACAGGAATTCCAAATAAAGTAGGAGTTAGAATTGTTACA
ATCAGTGACCCCAACAATGCTGGCTGCAGTGCAACAATGGTTGCCGTGCCAGCAGGAGCA
GATCCAAGCACTGTCGCTAAAGTAGCAATAGAAAGTGCTGTTCAGCAAAAGCAGCAGCAT
CCACCAACGTACATACAGAATGTGGTCCCCCAGGTAAGTTCCTCTATCTCATTTCTCTTA
TCATGAAAATTCTGATTTGTAAATATGATTTTAGGGGGAAATTATTTTTGCTAATGTGAT
CATTCTCCATTTCTTACTGTGAAACGTTATGTTGTCAGCTTACCTATGTACTTAATGTGC
TTCTTTTTTATTTTTCTCTGGTTTTTGTAATAGTAAACCGTTTTCATTGTTAACTTTAGG
ACATAGTTTAAAGAATCTCAGTTTTCTTATAGACCCAAATTAGTAATTTTGTAGACGCAA
GGTAAAGAAGCACATCTTTTGAAAACTTAAAAGTGGATCTTAGTCTTACTGGGCAGCGTT
GCTAAAGTGTACTCCAACAGGAGGTTTCTATGTTTGATTTTTGACCTCAGTATGTTTTTG
TGTTCCTTTTACATAAAAGAGTAATACCATAAGAAATGTATCAAGTGCGTTCTTGTTATA
TTTATGTATTGAATTCATTTTCTTTTTTCTTATAAAGTATTTATACTTATTTCAGTACTT
TCAATCTATTCTGATATTCCTAATTTTGTTTCTTGTCCCTTTACTGTCATGTTGCTGCTA
TTCCTTTTTTTTATTGCCACTAATCTAATTCCATCTTTATAAATTGATTTATATTTACAT
ATTATATAAATGGGAATTATACAATATATAGTATTTTGTGTCCGGGTTTGTTTCACTTAG
TATAATGTTTTCTGTTTTTGCCCATATAACATCTGTAACTTTAACACATGTAACATTTTG
TTCAGTTTCAAAGAAAAGCAGTCTTATATATGCAGTATTACTCATATTCATATTTCATGA
GGCTTACTATACTATACCATCCCATGTTACATTTTACTATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAAGAATAGGGGCTGCAATCCACCTTTATTTCTGATTGCC
ACGTATTGGGCCCTGGGACTAGGTCAGCCTGGGCTTCTCCCATAGGGTCTTCCTAGAGGG
GTCTTCTTACTCTTAGGCACACAAATATGCTCTACAGACTAGCTGTGGCCCTGCCTAGCC
CCTCTTATGCTGGGGACGGAGATACCGGGAGGGACTTGGACTGTCCGCCCTGCCAATTTG
CCCTGCTATCCCTGACCACAGCAGTCCCAGCCCCACTAGGCAGAGTGTGAGGATGCAGTG
AGAAGGACGGGGGAACTGTTGAGCAAAGGTGGGAGGCAGGCTCTAACTGGGGGCCTATTA
CGTTTCTCCAGGTGTCACGAGGTCTGGATTCTGGCCAGGTTCATGCTTAGAATGTGACAG
CAGCCATGCCTTTGTTCTAAGAATTTATTAATACCAGGGATATTTGAGAAAACAACTGGG
TTATTTGGTCTCACATCAGAATAAACACTTGAAATCATTGTTATCTCAGCAGTGAAGAAA
TCTTTAAAACCTCCTGCTACCCATAGCACTTTCTCGCTCTATCTTCCACTTAGCGCCACC
CGTCTAGAAGACTTTGGAGACTTGACCCTTTGTAGTTTGTATAGGGTTACTGAACAACAG
GCCTACTGAAGCGCTTTCTGAGGTACTGATATGCAACCCTGGGGGCTGTGACCCTGATGA
GAATCCTGGTGTAATGTGAAATCCTCCAGACCCGTGTGGGATAGGGGTTCTCATGCCCCT
TCTTCAGCTGAAGAAACCGAGGCTCAGAGACTTGAGTTCAGGATGTCTAGAGGCGGCAGT
GGGTTCTAGCCCAGGCCCTTTGACTCCAGTCTGTGACCATCCCACACTAATAGTTTAAAA
AAAGGAATAACTTTGATTTAGTTTTCAAAGCATCACAAGTAGAATCAGAATTTTCGAAGT
GCAGTTTCCCATCAGGAGTGGGTGAAAATTAAAATTTGAAAGTTGTAAGTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACCCAACCTCTGCTTGC
CCTCCTCATGTTTGATCTTCTAGTTCATAGATGGCGAATAAGCTTCAAAATACCTAATAT
GTCCAGTGGACTAGCTGCAAATGTCCAAAGAATTGTGTTGAGAAGGGCTCTGAGACCATG
TCTAGACTGAACAGGAAAGAGATCATTGGTGTTGGAGTGAGAAGCTTTAGCATGTATGTC
ATGTATCTGCTCTCCTTATTCTCCCTCAAATGTTCACTTTAATTGTCTTATACTTAATCT
TAGTATAGTACAAATGCATAGAGTGGAGACAAACCAAATGGGGTCCAAAGAAAGAAGCAG
ATTGGAAGAAAAGCCACATTAGTCAACATCTTCGTAAAGTGTTTTGCTCCATCCATCCAT
CCATCCATCCATCCATCCATCCATCCATCCATCCACTTATTCAACAAATCTTTATTGTTC
ATCTAAATGTGTCAGATAATGTGCTAAGTTCTGGGAATACAGAAACGATTCTTGTCTTCA
GAATTCAGAATCTCATAGGGAGGTACTGAAGAAATGGGTAAGTATAATGCAGTGTGCTAT
GAGCTGGGCCAGAGGCCTGAACACAGGGCCGTGGTGCAGAGGCAGAGACTCCTGACTCCA
TCTGGGACAGGAGAGGGGATAGGGTAGAGGTGGGGATGTGGTTTACTCATTAGGCTGGAA
GCTCCATGAGGATGGAGGCTGTGCATTTTATTCATTGTTGGATCCCCAGCACCCAGCACA
CTGCTTGGCACATAGTAGGTGCTCGATATGTTTGAATGAATGAGGTGTCCAAGGAATTGA
AGGAACCCTCAAAGGTCATCTAGTCCATCCACCTGCTTCTGGGTTGAGCCACACCTAAAC
CATCCTGTGTGCTATTTTGGGTGCGGTTATTCTTAGCTGGCCTCTCTGACAGCTGGAAAG
AATAAGAGAAGCAGCCTCTCCTCTGAGGCTTTAATGCAAGGGCCGCATTCGGGAGGAACT
CTGATGGAAATAAGAGATGGGGCAAGAAAGAGCAGCAAGTGGGTCCTAAGCTTGGCTGGA
GGCAACTCAGAGGTGGGTCAACCCCTCTTCCTGGGTGATCAAGAGGTGAAGCTGTTGAGT
TTGCCTTAAGGAGAGGCATAAAGACTTTTAATTGAGGCTCCAGAATGACTGGGGTGTTGT
CGGGTTCCTAGCCTGGGAAATTTTCAAGGCCTCCATCAAAGTTCCCCTACAATCAGCTCC
CCTTGGGGCAGAGGTCTCCTGAAATGTGTAAAGGACCTAGGAAGGAAGAACCGTGGGCTT
TGACCTGGATGTCAGGCCCAGGGGCGACTTCGAGAGCCTTCCCCTCTCATGCTGACTCAG
TCAGGATACACCACCCCCCCTTCCTTCAACCCTGCCGACAACTTTGGTGAAACGGGAATT
GAGGTTGCAGCTCCTTAAGATCTTTTCTTCCAGGATCTGTTTTTTCCAGGGTATTTTGCA
GTGGCTGGGAGTGTCGGGACCTAACACAGTCAGGCCGTACCAGGAGCCAGAGCTCAGAGT
ATTATAATCTCATGGGAAGATAGGAAGAAATGATTAGTGTGCATTGAATGGCCCTGCTGT
GAGCATTTTGAGCTGGGCTGGTCCTGGGGCAAAATCAAGGGCAAGTTCTAATCTCATTTT
CAGGTAGGGGAAGGATAGAGAAATGACTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATGACTTTCAGGGAGCATAAACAGGGAACAATGGAATCTTTCCTTTCTG
ACGGGCTCAACTTTGTGCTCGATATGAAAGGTGCATGCATGTGTCAGAGAGAGAGAGAGA
GAGACAAAGAGGGACAAAGTATAACCTTGTGAACCCTCTTAGGAGGCTAATGCTTGTTCC
CAAATCTCCCCTGAGTGGGGATGGATTTGCCCCTTGTTTTCTTATTAAAAAAAAAAATCC
TCTGTTTTCTAAGTGCAATAAAAAAATTAAAAAAAAAAAGGCTTCCTGGAGCTACCCTCT
GAGCTTCAGAGCCCCTCAATGGCTCCCCCCATCTCTACCCCTGCCCCTCTCTGCCCTATC
CCCACCCCCCACCCCGGCTTCTTGATTGAAAATATAAGTTACAGAACAAAACCTGGGAGA
CTTCTTCTGACCCGGGAGAGTAGGGGTCTTCAGCCAACTGTAACCCCTGGTCTCAGGTGG
AGGGCCGAGGTGATGGGACAGTCAGCACTGGATTTGCCAAGCACTTATTGATCAGCGACC
GCATACCTGGGACTGTGCGGCAACCTGCAGATCCTGCAGATAAGAACTAGACGCTATCTC
TGTTCCCAAAGAACGCTCAAGACACGGTTCCCTTTATGCCTGTCTATAGCAGGGTCTTTA
AAGACAAAGTCAGATGCACCTGCTTTAGTGATAATGATGGGTTGAAAATAAGTACTTTCT
TTACTCTGAGCTGGACAGTGTGCACACAGTACAAACTTCCAAGGTTGGCATTTCTGAAGA
TCTAAAATGCTCCTTGCCAATCCTCCTCTTATCTGAACTACTCACTAAGCTTGAACATAA
GGTTATTCAAACTTGTTGCATTTGTCCTTCTTTCCTTGTTCTTTTTTTTTTTTTTCAAAC
TAGAGAAGTTGTAGGTTTACAGAAAAATCATGCATAAAATACAGAGTTCTAATATACCAC
CCTGCTATTAACACCTGGCATTAGTGTGGTACATTTGTTACAATTCATGAAATAACACTT
TTAAAATTGTACTATTAACTCTAGTCCATCATTTACATTAGGGTAGACTGTGTTGTACTG
TCTTATGGTTTAAAAAAAATTTTAGACTAGTAATATATATACAACCTAAAATTTCCCCTT
TTAACCACATTCTTTCCTTGCTCTTTAAACAGCACTGGACGTGCCTGGCTTTGCCAGTCT
TTTGCTCTGTGACTGTGGGGAAATCACTCTCCCTTTTTGGGCTCAGTTTCCTCTTTGATA
ATAGGTTGACCCATAGGAATGCTCTTTACTTAGGTAAAAAATGGCCAAATATCAGCAATT
TCATTTGGTTCAAGTTGCGGAAATGAAGGGATTGATCTGCACTGGAAAGTCCCTTCCATC
TTTAACATTTTAGACTTCTTAGATGATTCCCATCTCCTCCCTGCTCAGCCCTCAACAGGG
AGCATTTACTGCTACTAGTTACTTACCTACCAGTGCACCTCGACCTGGCTGCAGAGCCCA
TCCCCCAAGTTGAATTTACTTGTCACGATGCCTTTCAGGCAAGTCCCACTCCTGGGTTAA
TGGGCTTATTCTATTTTCTGGATATCTCAGATGCTCTTATCATACTCCTTTACTACTGGA
GAGCTGTTTATTCTTCAATGCCAAATCCGCGTTGCCTGTCTTTAGATACCTCCTCTGACT
CCCTCAACCAGAAATAGTCTACCTTGGTGCCCCAAGAGTCCTCGTATTTTTAGAAACATT
GTTTTCTTTCTTTAAATGTAAGCATGCTCATTCTAGAATATTTAAAAACTATAAAGATGA
AATAAGAATCATGTGCACATTGTATGGTGTGTGAATAAAATTGTTTAAAAAATCATTTAG
AAAAAATTTTTTTATGTCCTTAAAAATATCATGTGGGGAAACGGACTTTGGCCCAGTGGT
TAGGGCGTCCGTCTACCACATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCCG
TGTGGAGGTGGCCATGCCCGACGGAGATGATTATAAGGAGCGACGTGTCATTTACGGGCG
TGCCCCGGGCGATGGAGACCCACGCCCATAGATGGCCTGCGATTACAGATACCCCAGTGC
TTGCATGAACAAACAATTGGGCACCATTAGCTGGCGCACATTGATACAGAAGTCTAACAG
ACACAGAAGGCTATACAATATTCTCAGAAATTTAATCAGCTTCTCTTACTAAATGGCTCG
ATGTGCTGAGAGACACACCCACACTTCTATTTTTGAGCTATGCATCTCTCTCTGTTTCAT
CTTCACTGCAAGTATACTTAAGGCCAGCTAAGTAGGTGCCACTTTAGTTTGGGTTTACTT
TAAGCCATTATGGTCCAAAACGTAAAGATAAAGTAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTCACATCCCCATTTATAAACTAGCTGTTACTCACTGTGTGTTACCATCCACTC
CACACAATTCCAAAAAGCTAATTAAAACTTCTACATACATTAAACATGAGTAAACCACTC
AGCCCTCCTCATATCTCCTTTAAGAATCCACCACCTACCACCAGGTCTTGAAGATATTTT
CCAGTCATTTCTTCTAGAAGTCTTATGGTTCTTGCTTTTATTTTCAGTTTTTTGATCCAT
TTTGAGTTAATTCTTGGATAAGGTATGAGATAGGGGTCCTCTTTCCTTCTTTCAGCTATG
GATGTCCCATTCTTTCAGCACCATTTGTTGAATGGATGGTACTGCCGGAGCTGTGTGAAT
TTGACAGGCTAGTCAAAAATCACTTGGCTATACCTGTTAGGGTCTGTTTCTGAACCATAA
ATTTGGCTCCGTTGGCCTATTGTGTCTGTCTTTAGGCCGGTACCATCCTGTTTTTACCAC
TATAGGTAGATATTATGATTTAAAGTCTGGAGAGGAGGGTTAACTTTTTCTTTTTAAGGG
GTTTCTGGTTGTTCAGGACTCCTTACCCTTCCAAATAAATTTAATGATCATGTTTTCAAT
TTTTTTTTTTAATGCTGGTGGAATTTTATCGGTATTGCATTATATCTGTGTATCAATTTG
GGTAGAATTGACATCTTAATATTTAGACTTTCAATTCATGAGCATGGAATGTTCTTCCAG
TTATTTATGGCTTTTTAAATTTGTTTTAACATTGAGATGCAGCTTTCTGAATACAACTGC
TTTACTTCATTGGTTGACTTTATTCCCTATTGAGTTTGTTCCGTCATATTTTATTTTCAC
CATTCTTTTGACATTTTTAGTTACTTTTATTGATACAATCTTCATTTCTAGACTCTCTTC
CAGGCCTCTCTCTCCTGTCTTTTCTTTTCAGGCTCTAGCACACCCTTTAGTGTTTCCTGA
AAATCTGGGCTCTTGGTTAGAAATTCTCTCAGTTTCTATTTATTTGTGAATATTCTAATC
TCACCCTCATTTTTGAAAGACAATCTTGCCAGATATAAGATTCTTGACTGGAAGTTTTTC
TCTTACAGTATCTTAAATATCATACCACTGTCTTCTTGCCTCCATGGTTTCTGGTGAGAA
ATCAGCACTTCATCTTATTGGGTATCCTTTATAGGTTACGTATTGCTTTTCTCTTGCTGT
TCTCAGAATTCTCTTTGTCTTTGTCATTTGACATTCTGATTAGTATGTGTCTTGGGGTTG
ATCTATTCAGATTTTTTCAAATGGGAGTAGGTTGTATTTCTTGGACATAGATATCTATGT
CCTTCAATAGGTTTGGGAAATTTTCTACTGTTATTTCTTCAAATATTCTTTCTGCCCCTT
TTCCCTTCTCTTCTTCTGGGACACCCATGACACGTATGTTTGCAAGTCTCTTGCTGTTTT
TTAGTTCCATTCTTTTCTTTATCCATTCTTTTGTATGTTCACTTTCCTCAAATCCAATAT
TATATGATTCCAATGTTTTTTAAATTTCATTGATTGCAACTTTTGTTCCCATAAGATCTG
CTATTTTTCTACGTATGCTTTCAAATTCGTCTCTGTGCTCATCCAATGTCTTCTTAATGT
CCTTAATCTCTTTAGCCATCTCATTGAATTTATTTTTTTATTTTTTATTTTTTTAAAAGA
TTTATTTATTTTATTTTATTCCCCCCCTCCCCCGTTGTCTGTTCTCTGTGTCTATTTGCT
GCGTCTTGTTTCTTTGTCCGCTTCTGTTGTTGTCAACGGCACGGGAAGTGTGGGCGGCGC
CATTCCTGGGCAGGCTGCACTTTCTTTTGCCCCGGGCGGCTCTCCTTATGGGGCGCACTC
CTTGCGCGTGGGGCTCCCCTACGCGGCGGACACCCCTGCATGGCTGGGCACTCCTTGCGC
ACATCAGCACTGCACATGGGCCAGTTCCACACCGGTCAAGGAGGCCGGGGGTTTGAACCG
CGTACCTCCTATGTGGTAGATGGACACCCTAACCACCGGGCCAAGTCCGTTTCCCTGGAA
AATTTTTTATCCAGCAAAACTGTCCTTCAGATATGAAGGCGAGTATAAAATATCCACAAA
CAAACAGAAACTAAGAAATTTGTAAAAAAGAATCCACCTTTGCAGGAAATATTAAAGGAT
GCTTTAAAGTCTGAGAGAAAAAGACAGGAGAGAGAGGTTTGGAGGAGAGTATGGAAGAAA
GAATAGACAAAGGATAACCAAAAGAGTAAAAGGATAGATGAAAATATGGTATGACACATG
AAAGAAAAAATGGTGGAATAATGGATTTACAGTAATATCATTGAATGTGAATGGATTAAA
CTCCCCTATCAAAAGAAAAAGCCTAAAAGAATGGATTAAAAAACATGAGCCATCCATATG
CAGTTTACAAGAGACTTACCCAGGGATACAAATGGGCTGAAAATGAAAGGTTGGAAAAAG
ATACTCCACACAAATAGTAACCAAAAAAGAGCATGGGTAGCTATACTAAGAGGGACAAGA
CAAACTTTAAATGCAAAAAACTTATAAGAGATACAGAAGGCCATTATATATTAATAAAAG
GGACAATCTACCAGTAAAATATAACAGTCATAAATATATATGCACCTAACCAGGGTGCCA
CCAAATACATGAGACAAATTCTGGCAAAACTGAAGGGCAAAATAGGCATCTCTATGATAA
TCGTTGGAGACTTCAACACACCATTCACATCATTAGATAGAACTAGACAGAACGTCAATA
AAGAAACAGAGAACTTGGACAATATGATAAAGAGGTTAGACATATATGGAATGTTGCACA
AAAACTCAATGGGTTATACATTCTTCTCAAGTGCCCATGGGTCCTCTCCAAGACAGACAT
GTTAGGGCACAATGCACCTGTCAATAAATAAAAGACTTAAAGTATACAGAGCAATAGACA
GGAAAAAGGTAAATTCACAAATGTGTGGAGGCTAAACAACATACTCCTAAATAATCAGTA
GGTCAAAGAAGAAATTGCAAGTGAAATCAGTAATATATTGAGACAAAGGAGAATGAGAAC
ACAATGTATCAAAACTTATGGGCTAGGAAAGCGGACTTGGCCCAATGGATAGGGCGCCCG
CCGACCACACGGGAGGTCTGCAGTTCAAACCCCAGGCTTCCTTGACCCGTGTGGAGCTGG
CCCATGCACAGTGCTGATGTGTGCAGGGAGTGCAGTGCCACGCAGGGGTGCCCCACATAG
GGGAGCCCCACACGCAAGGAGTGCTCCCTATAAGGAGAGTCGCCCAACATGAAAGAAAGT
GCAGCCTGCCCAAGAATGGTGCTGCACAGACGGAGAGCTAACACAACAACAAGATAACAC
AACAAAAAGAAACACAGATTCTTGGTGCCGCTGATAAGGATAGAAGCGGTCACAGAAGAA
CACACAGTGAATGGACAGAGAGAGCAGGCAACTGGGGGAGAAATACATAAAAAAAAAAAA
TCTAAAAAAAAAACAACTTATGGGCTACAGCAGAGGCAGTGTTGAGAGGGAAATTTATAG
CCCTAATCATCTATATTAAAAAAGAAGAAAGAGCTAAACTCAAAAGATTTAACTGAACAA
CTAGAAAAACTAGAAAAAGAACAGCAACAGAATTTCAAAACAAGCAGAATGAAATAATAA
AGATTAGAGAAGAAAATGAAATTGAGAACAACAACAAAAAATACAGAAAATCAACAAAAT
CAAAAGCTGTTTCTTTAATATGGATTGGAGTGGACTTGCTGGTATTCTACTATAGAACTG
CTGTGACTCTAGCAATGGAAGAAATTGTATCATTGATGTGGAGATGGTTGCCACGGGAAT
TGCTGAGGGCAGGGAGAGGGAGGAAGAGGTGTGATACGGGGCATTTTTGGGACTGGAGTT
GTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCCTTAAACAGTGTTTGGAAA
TAGTATGCTACAATTCCTATAAGAAATTCAAATTTATTTTTTCCTTTTGTGCTGTGTCAT
GAATGAAAGCTGAGTTAAAGCTTCAAAGGATATGTACTGCCTAAAACTATTCAGAACTAC
ATTATAATTATTTACTTAAGTGTATGGCAGAGATAAAGGGATGGGATCTAGAAGGGGGAA
AAAAAATGTAGCTTATATTTAAAACACATACCCATAATTAGAATCCTTTACTAGCATTAT
ACATCAAAAGCCATAATTGAGCAACTTTTAAGATTAAAATTATTATTCAAGCAGCTTACT
AAAAATTAATATTTACATCATTCTACATATATACATATTAATGAATTTAAACTAGCTTCT
GAATTTTTCTTTGCTTTTACCCACATATAAATTGCTTGATATTATGTCCCTTTAAAATTC
TGAAAAGAAATAGTATGCAAAGAAATAATGATTTACAGTTGAGTTCTTGTGAAGAATATA
CCCAAGTAAATTGATAGGTGCATTTGTAGTATATTTTAAGAATATTTTAAAGTAATGATT
AACTTAAATGAAATGCATGTCTATAAAATGTAGATTTCATGTTAGAAATGCATAACTATT
AATGAAATAAAATTTATGAGACTGCTACAAAATGAATGTTCTTCAATATCATTTCACAAT
GTATTTGTGCTTTTTCACAGAACACTCCTATGACACCATCATCAACTGTGCAAGTGCAGG
GTCAGCCTAACAGTTCTCAGCCTTCCCCATTCAGTGCATCCAGTCAACATGGAGATCCAA
TGAGAAAACCAGGACAAAACTTCATGTGTCTGTGGCAGTCTTGTAAAAAGTAAATGGCAA
TTTTATTTGATATATATAAATGTTATCTTTGTTTTGGAATGCTTTTATATTTAAATTTTC
CACCTATAGTTCTATGAAAATTTTCTTTAGAAATCACTGGTTTTTAGCAACTATAGTTTA
AGTGATATTTATATAGGTCCAGTGGCACTTAAACAGAGAAACTTACGTAAATGGTAGAAC
TTCATTACCTAACAGTAGATTATTAAGGAATGTGGTTCATCATTAGTTTTTCATATAAGA
AAATAAGGGAAGTGGTTGTGGCTCAACTGATAGAGCATCTGCCTACCATATAGAAGGTTG
AGGATTCGGTATCCAGGGCCTCCTGACCCATGTGGTGAGCTGACCCAGGCATGGTGCTGC
CACGCGCAAGGAGTGCTGTGCCAAGTAGGAGTGACCCCCGTGTAGGGATGCCCCACGTGC
AAGGCATGTGTCTACCCCCGCGAAAAAAACGCAGCCCACCCAGGAGTGGCACCGCATACA
TGGAGAGCTGACGCAGCGAGGTGATGAAACAAAAAAAGTGACACAGTTTCCTGGTGCCGC
ATAACAAGAATAGAAGCAGACACAGAAGAACACACAGTGAATGGACAGAGAGCAAACAAC
AGGGGGAAGGGGAGAGAAATAAATAAAAACTTTATAAATAAGAAAAAAAAAGTTAAGAAT
CTGATAATATATTTGACTATGAAAAAGATTTTAGCAGTTTTAAATGTCATGGAATATAAG
TGACTTGAACCTAGTGGAGCTAATTTTTGTATAGTAGAAGCTTAGAGGTAACAATCAGGA
AGAGAACAACTTGTCTTAAATGTAAAATTGGGACACACACCCTATGAATATTATTTTTAA
ATGCATAATGTCTCACTTTAATAACTAAGATGAATAATGAGTAGAACTGAACTTAATGTT
AAAAATCCTAGTTCTTTTAAGGGCCTACGGTCACTCTTTAGATGGCTTAGGACTAAGACA
CTCATCATAATAGGCATAGCACCCTTCATTTCTTAGATAATAAGGATTCTATTTCAGTCT
TAAGTAAACGATACCAGAAATTACTGTGTCCTTCTGAAAATACTCTTTGCTGGTCATCAT
TTTTTATGATATATTATAGATATGTTTTCACTATAAACTTCAGGCACAGATTTCTTGTAG
GATTATGTAGCCTAGGGATTATTAATAGTATACAAAATTTCTGTAGGACAGTGTTTATCA
AACTTTAAATCTCAATCCTGTAATGGGGTCATTTTAGTGAGTATCAATCAATAGGGTTTT
TTCTTTGTTTTTCTTTTCAATCAAATAAAATATAGTCCATCTTGCTTGTAAGGGTAAGTA
TTGTTTCCTGTTTCATATATATATAATATGTGTGTATTATCATAGCATAAAACCTATTTG
TCAAAAGTTTTTTTAAAAAACAGTGCTTTAGATTGTCTCTGCTTTTATTCATTTAATTTG
ACCATGTTTTTGTTTTTGTTTTAACTAATAAGTTAATATAAAAGTTTAAAATTTTTGCAG
CATAAGGGTCATGGAGTACTTTTTGGTATTCAAATGAAGCTATTTTAGTTAAAGTGCTGT
TTTCAGCCATCTCCTTTATGTGTTTTCATTGTGTTTTATAAAAAAAAGAAAACAGCTTTA
TAATCGTAATTGTTTTAAATTTGTTTTAAATGTGATGAAATATTAAATACCATAAAATGT
ATATTACATATTTTTATAATATGTAATCAATCTCCTGAGTAGATTACAGGCTTTTAAAAA
ATAAACTCTTAAGATGATAGAAAATGTTTATTTACTTCACCTATTGCTTATGATACCTAA
GAAATTCTGATAATAAGAAAAGTAATGTTAATAATCATATTATAAATGACACCAATAAAT
TAATGTCATTGACTTTATTTTAGTTCAGATAAGAAGTATTTTATCTTATGTGGCTGCTTA
GGGCAGCTGGAATCAGGAAATATGCACATCTAATAGCCTTATGGGAATATTTATTCATTT
GAACTAAATATCTTTTCAATGGGATGATAAAAAAAAAAACAAACCTTGGTTGAAGGGAAT
ATAAATGAGAGGATAAAGGCTAATCCTAGCCTTTAGCTGCAGTTATTTAAACAATGTAAT
GTAATGGAAAATAATAATATTTACCCTTGGAAGAGCACCAGTGACTGAGCGAAAAGGATG
AGATATAGTTACTATATAATAAATTAATTAAATATTAATGAAATTTTGCAGTGTTTTGCC
AAACATTGGTAAATCCTGGTTCCTATCCTTTTAGAAAATAACAGAAGTTTTTAAAAAGTA
TTGTTTTTCATTGGAGTAGCATATTATTTCTATATGTAAGGATAGGATTCAATAGAGAGA
AAAATAGGAGATACAAAAGAAGGGATAGGACATTCTTCTTAACATTGCAAAACTCATACA
GGGATGAAAAACTCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTCTC
TCTCTGGGCAGGTAGAGTGATGAGCCCTTAAAAATCTCTTTTGTCTTAAAATCAGATCAT
ACTCATACACATAGTGTTGTATATATTTAGCCATGAAAATTGATTTAAAGAAGGACTAAC
ATCCTTTTTTCCTGTAGCTGGTAAATTCATCCATTTTGTGTATTTTGTGTATTGCAGATA
AACTTACTTCATTTTATGTACTGCAGTGTAGTTTAGAAATAGAAATCACCGACTGGTGAC
AAATTTAGTAGTACATTTGGATTTTGATTTATGTGTGTATGTGTCAGTTTGTGTATAGAG
GCTTTATATTTCAATTAATGATTCAGTAGTATTTATAATCTTAAATACAGTAAGAAATGC
CTCCTTGTGACAATTGTCTATGTAACTGAGCTCCAGTATTTTATTTATTATTGAAATTAT
GCTATGAATACAGAAAATTTTAAAAATTCCAAAATGAAAACTAAAAAAGTATTTACTAAT
TTTAGTTTCACAATAAACTTTTGGTGTATTTATATATATGAATTTGAATGGAAATGGAAA
TGAGTGTTATAATGATTTCATACATTGTCTTTTATAATTCGGTATTTAATTTCTTTTTTT
ATTAAAAATTATTCCTGAAGGAACATTAATTTGAAATATTAAATATATACTGTACATTAA
AATTAGTTAAAATATAGACATCTTTGTATGACAGCCATACAAATTTAACCCTAAGGATCA
CTGTGATAGACTTCAAAGATACTGGTTGTACAAATGTTTGAATTATGAGGTAATTAGTAG
TTGAAGCCTTTTAATCATTCCTTGTTATCTAGATTCCCAAGGTCTCTCTCATTTTCATTT
ATTCTAATTAATAAGGGAGAATAGTATCTGACTTTCTTCAGTTTTGTCTTCTTTGCCACT
CACCTACTCAGACATTTATATTGCTAAGAACTGGTAGTGATTAGGGTATGTTGGAGAAAT
AAGAGATATGACTTTTTTTTTTTTTTTAAAGATTTCTTTTTTATTTATTTCTCTCCCCTT
CCAACCCACCCCCACCTCCCGCTAGTTGTCTGCTCTCTGTCCATTTGCTGTGTGTTCTTT
TTTGCTTGTATTCTTGTCAGCAGCACCCAGAATCTGTGTCTCTTTTTTGTTGCGTCATCT
TACTGCGTCAGCTCTCTCTCTCTGTGTGCGGTGCCACTCGTGGGCAGGCTGCACTTTTTT
CACACTGGGCAGCTCTCCTTATGGGGCGCATTCCTTGCGCATAGGGCTCCCCTACATGGG
GGACATCCCTGCGTGGCACAGCACTCCTTGCGCGCATCAGCACTGCGTGTGGGCCAGCTC
ATCACACAGGTCAGGAGGCCCTGGGTTTGAACCCTGGACCTCCCATGTGGTAGGCCGACA
CTCTGTCCATTGGACCGAATTTGCTTCCTGAGATATGACTTCTTAAACATGGACATGTAA
AATGTGAACTCAGCTAAAAAGCCAAATTTACCAAAATTTATAGCATTTAAATTGGCTCTA
CTAGATTTCATTATAATATGAAATCTAGTGAAGCTCGAGTATCTTCTGAAAGTAATAGAT
AAAAGTATTTGTTTATAGGGTAATATTATATTGCATTTTTAAATATTTCATTTACTTTTA
AGAAATTCCTAATATAAATAGAAAAGTTTTTAAAATAGTTTAAAATATACTGACATCAAA
TGCCCTATTTTGCTCAATGTTTCTGTATATTGTCTGGAGTTTGTATTAAGGAGAACAAGT
TTTCTGCTTTCAAGAATACTTCCAAGTGTCAGAAAATTTCTATTACATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTG
GTGTGGACACTGTCCACATTGCTTAAGTTCTCTAACCTTCACTTTTCAAACTGGCTGTAC
TACTAGGTCTGTAAGGTACCTCGTAACTAACATTTTGTGTTTCTACTCTGTAGACAAGTC
ATTGGAAATGGCAGATGATATATGTGAAATACTTTGTAAGCTGAAAGTACTTTATTTGGT
TCCTCATCCTTTGAGAGATTAATTGAACATGTATTTGGTAATGGCACAGAGATTTCTTTA
TGTAACTCCCCCTTTGAGGGGAGGCCGGGTGGCATGTGAGTGTATCCTATATAGTATAAA
TGCCACATTTACTATAGACCTGTTCATTTACCTTTCATTTCCTGAACATACAATTATCGT
GCATGTAATTAAACTGAAATAGATTTACATAGTTAGTATCACCTGTTTTCTTTCTAACCA
AAGCATTTAGCTGTAAATAATACTTTTAACTCTCAAAATGTGAAAATAAATTAATTTAGG
ACTATTTATTGAGAGCCTGCTTTATACTGGGCAATGTGCTAGGCAGAGGGTATTCCAAGA
ATAAAATATGGTCTATAACTTCACAGAGATGAAATTCTAGAAATAGAAGTATGGGAACAC
AGCAGCTGCTACATACTTTATGCATTCCATAACCATTTAGTGAGCAACTATTGTGTGCTA
GGAATTAAGATAAAATGGTGACCAAGATAAGTTTTGCTATTCTTAAGTGTCTGGAGGTCC
ATTGAGGGGTATAAGTAATTCTACTTTACAATGAAATAGATACTAAAATGAAGCTATATA
CAAAGTGCTAAGAGAACCCACCTAAGCCAATCTGGAAGTCCAGGGAAGGCTCTCTAGTAG
AAGATGCATCCAAACTAAGACCCAAAACATGAGGATGAATTAGCAGAGGGTCTCACAAGT
CCATATTTAATGGATTTGGATTTCACTCTAAAGACAATGGAAAATCATTTTTCTTCATTT
ATCTCTTTCTAAATTTGTCAATTTTTAAAATTTGTATATATTGGTAGCTAATAAAAATTA
TGTCAAAATATGTTTGATTTAGCCCAAGGTTGGGAGAAGGGATATTTGATCCCAGTTATA
ATAAAAAATCTTCATCACTTATACATAAAAACTTACAGCAGTTTAAAGATTACATTTACA
TGGTCTTATATAACTAATTCAGAATTAGTTTATTGGTGTAAAAAAATTGCAGGAAATATC
CCCACTTTACTGATGTGAAAACTGAAGCACACAGGGATAAAATGAAATATTCAAAGTCAC
ACAGCTATAGTACCAAAAATAGGGTTTTCTCACATCCAGACCATTGCTCTTTCCACCACT
GCCTCTCCAGAGCACAACAGATTCAGTGTTTCTGCTTGGACAGAAATCTAGAGTAAATAA
AATCAGATTTTATATAAAACTTATAACTCTGTAGCCCCTCCAGTCTACGGGATGGTCATA
GAACTATAATGAAAGGATTGATTGAAATTATTAAATAATGATGAAAAATAAGGTTATCTA
ACAAGGTAGCAGTTTGAAATGTAGTGCTTAACATAATTTAGTATTATCATATTAGGTTAC
CTTTTCCAGAGTGACCTGTACCAAATACATTCTTTTTTTTTTTTCTTTAACATTTTTACT
TTTAAATGATTTCAAGCTTACAGGACAGTTTGCCAAAAATAATAAAAAACCCATACAGAG
AATTAAAACATAACCCCCCACCACCACTACCAGATACCCATTAATATTTTGCCACATTTG
CTATTCTTCCTCTTTCTTTCCCTTTCTCTCTCTTGCCTTCTTTCCTTTCTTTTTCTTTCT
TTCTTTCTCTTTCTCTCCATCCGTTTTCTAAACATTTGAGAATAGATTGTTTACATTGTG
CTCCTTGAACACCCCCATGTATATCTCTTAAGAACAAGAATATTCATTTATTTAACCACC
TAAGTATAGTTACCAAGTTCTCGAAATTTAATAGTGGTATGAAGGTTGCTGTCTATATTC
TAATTTTTTCTACATGACCCAATACTGTCCTTTTGAACCTTTTCTCCATTATTAGATCCC
AGTTCAGGATCATGCATTACATTTAATTATCATTGTCTCTTTAGTTGCTTTTTTTTTAAT
TGTGGAAACATACGTACAACATAAACTTTCTCACTTAACTACTCCCAAACATACCATTTA
GTGGGATTAGTTACTTTCACAATGTTGTGCTTTCCTCACAACAGTCTATTACCAGAACTT
TCCCATTTCCCCAAACAAAAATTCTATGTTCATTGTGCATTATCTCCCCATTCCTCCTAT
ACCCTGCCCCTGGTAAACTATACTCTACTTTCTGTCTCTATGAGTTTGCATATTATAGCT
GTTTCAAATAAGTGGAACCATAAAATATCTGCCCCTTTGTGTCTGACTTATTTCATTCAA
TATGCTATCCATGCAGTGGCTGTATCAGAATTTCATTCCTTTTTATGGTGCAGCAATATT
CCATTGTGTTATATACCACATTTTGTTTTTCTGTTCATCTGCTGATGGATATTGGGTTGC
TTCCACTTATTTTTAGGAAGGACTGGGAATTGGACCCGGGACCTCGTATATGCAAAGCAG
GCACGCAGGCACTCAGGCACTGAGCTACACCCACTCCCCTGCTTCCACTTTTTGCTTATG
CTGCTATGATCATTGTTGTATAAATATCTGTCTGAATTTTTGTATTTAGGTGACCTTTTG
TAGTGAACCCTTTAGATTAGAATAGAATTCCTCCTCATTTCCTTCTGAGCATATTTTTCC
AGTATTTTCTTTGGGGTTACCATGGAAGGGTTAAGTTTAGCGTCGTATTGCTGTAAATAT
CTCATTTGATTTGATATCAACTTAATTTCAGTAATACACAAAAACTGTTCTTAAATCCCT
TTATCCCCCTAACTTTATGAAGTTCTTGTCACAAATCATATATTTAAGGGAAGCAGATGT
GGCTCAACAAATGACAATTAATTTACATTAAGAATCCAAACAATTGATTTATGATTATTT
TTTATACATTTGCCTTTTATTCCTATAGGAAGCAAAAAAATTGGAATTCCAAACCAAAAA
TATAGTACTACTGGCATTTATATTTACCCATTTTGTTAGCTTTATTAAAGATCTTTATTT
CTTCATTTGGCTTTGGTCTTTCATCTAGTGTCCTTTCCTTCCAACCTCTAGAATTCCTTT
TATCGTTTCATGATGAATTTCTTCAGCCTTTGTTTCTCAGGGAATGTCTTAATCTCTACC
TCGTTTCTGAAAGACAGTTTTGCAGATATAAAATTCTTGGTTGGCAGTTTTTTTTCCTTT
TAACTCTTTTTGCATATCCCACTGCCTTCTTGCCTCCATGGTCTCCAATTAAAAATTGGC
ACCTAATCTTATAGAGGGTCCTTTGCACATGATGTGTGGCTTCTCTCTTGCAGCTTTCAG
AATCCTCTTTTGATCTTTGGCATTTGGCCTTTGATTATAATATGTCTTGTGTGTGTCTTT
TTGAGTCTGTCCTGTTTAATGTTCATTGAGTGTCTTAGAGGTGCATATTCATGTCTTTCA
TTAAATTTGGGAAGTTTTTGGTCATATTTCTTTAAAGGTACTTTGTCTCTTTCTCTCTCT
TCTCCTTCCAGGACTCCCACAATGTGTATATTGGTACACTTGATGATGTCCCATACATTC
CTCAGGTTCTGTTCACTTTCTTTATTCTTTCTGGTCCTCAGACTGAGTGATTCCAATTGT
CGTATCAGTGATTCCTTCTGCCAACTCAGATCTGCTGATGAAGGATTCTAGGGAATTTTT
CATTTCTGTTATTGTGGTCTTCAGTTCTGTTTGGTTCCTTTTCACAATTTCTATCTCTTT
ATTGATAATCTCTTTTCCAAATGTCCTTTTGTTCTTTGTCCTTGTTTTCCTTTAACTCTT
TGAGCATATTTAAGATCATTTTTTAATCTGCTATGTCCCAACTCTGGTCCTCCTCTATGA
TGGCACCTGGTGCCTTTTTTATTTTTTTTTAAAGATTTATTTTATTTATTTCTCTCCCTC
CCCCCGCCCCATTGTCTGCTCTCTGTGTCCATTCATTGTGTGTTCTTCTGCATCTGCTTA
TATTATCAAGTGGCACTGGGAAACTGCATCTCTTTTTTTGTTGTGTCATCTTGCTGCATC
AGCTCTCTGTGTGTGTAACACCACTCCTGGGCGGGCTGTGCTTTTTTCACACAGGGCAGC
TCTCCTTGTGGGGAGCATGCCTTGCGCGTGGGGCTCCCCTGTGTGGGGCACCCACGCATG
GCATGGCACTCCTTGCACACAGCAGCACTGCACATGAGTCAGCTCACCACATGGGTCAAG
AGGCCCTGGGTTTAAACCCTGGACCCTCCATATGGTATGCGGCCGCTCTATCAGTTGATC
CACATCCACTTCCCCAAATGCTTTTAATCTTCTCTTTTGTACCATCACTTCATTTCAGTG
CATGTTTTGTAATCTTTTGTTGAAACCTGGATATTTTGATATTTTACGGTGTTATGTCTG
GAATTTAGACCCTGTACATTCTGTTTCTTAAGCATCCAGCTTATGTTATGACAGAGAATT
TTTTGAATGCTGGGAGCTAACATTAAAAAGAAAGGAGGGAAGTAGATGTGGCTTAAGTCA
TAAGGCCCCTGCCTACCATATGGGAGGAGCCAGGTTCGATCTCTGGGGCCTCCTGGTGAA
AAAGAAGAGAAAGCATGCCTGCACAGCAAGCTGAGTGTTCACATGGGTGCCTGTGTGGCA
AGCCAAGTGCCCATGCGAGTGCCCACGTGGCAAGCCAAGTGCCCAACATGGTGAACTTGT
GCCTGCGCAGTGAGCCAAGTACCCATGCAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCGATCTTGCAGATT
AGCCTGTGGGAGTGTTCTTCAGAGTTTAGCCATGCAATGACTTATAGAACAGCCAAAGAC
AAAAGGGAGGAACTCACTGGTCTTTTTCACGAATATGTCTTGTCCTGGGTCATGTTGGTG
GCCCTAGGAATTCACCCATATACACCAATACGAATGATCTTATTTCCTCAAGGCTCCAGA
TGCTACACTCTGTGTCCCACAGCTGGCACTCCTTTGCCCAGTCAGTTACAACTTGACTTT
TCCTACAGAGTTCTATAAAAGAGTTCTGTGAATCGCCTTAGGCACAGTGCAAATTCTGGG
CAGCCAGCCTGCAAAATGTGTCCTGGTTTAGTACTTCATGCTGCCTCAAGATAGATTGCC
CCAAGACAGACTCATGTGCACCCTAGTACATGCACAAAGGTCACTCTGCCCTGTCTGGAC
CTGGAACCAGGCAACTACATAGGATGCGCAGGCTGATTTGGCTTAGCGGATGTGGGGACG
GAGGAGGGACCAGGAATCCTACCATTTTTAAGTTGCCTTTTTCTTGATTCAGTGCTCACC
CTGTTACTGTAATCCCTTAACTCTTTTCTGGAGCTTTGAGAAAGATGTTTCTGCCTGTTG
TGTTTGTTCAAAGCTTCTGTCAGGCGAATGGGGCCCTGGAGCATCCCCTTCCACCATCTT
GATCAATGATATTATTTTACCCTTAGGTACTGTTTAGAAATAATAATTTGCAGCTTAAAT
TAAAGACTTTTTTCTTTTTTGCTAACATCTTCACTTTACATTCATAGATGAGAACTCCAC
AACTTCACTTCTATGTCATATTTATTTTGGCTACAAACTTACCAGCACAATAACTTTCAA
TATGGACCATACTGGAACAATTACTGTTTTTAAAATAGATACATTGGAAAATAAGAGACT
TGAACCTTACCCTTGGTACTAAGAATCCCTTTTTCTGGGCTGTCACAGAGCATAAATATT
AATGTTAGACTATGGGATCTTTCATTCATCCTATATCCAATGTTTTAAAATAGCCATATT
ACGGCGTTTGGTGGAAGAAAGGGGTCATCATTTTCGGTCTGCAGCATCTTGTTTTAACAG
TTTTTCTTTCTCTGATCAATTTAGGCAGCCACCTGTAGGGGGTACAAGCTCAACTCCAAG
AGCACAGAAGGCCATTGTGAATCATCCCAGTGCTGCTCTTATGGCCCTTAGGAGAGGATC
AAGAAACCTTGTCTTTCGAGATTTTACAGTAAGCAAGCTCTAAAAGCCTTTTCTGTAAAG
GGGCAATCATTGTAGGGTTTATTTTATTTTTTATTTTTTTAAAGATTTATTTTTTACTTA
TTTCTCTCCCCTTCCCCACTTCCCCCCCCCCCCCCGAGTTGTCTGCTCTCTGTGTCCGTT
CTCTGTGTGTTTTTCTGTGACCGCCTCTATCCTTATCAAGGGCACCAGGGATCTGTGTTT
CTTTTTGTTGAGTCATCTTGTTGCATCAGCTCTCCATGTGTGCGGTGCCATTCCTGGGCA
GACTGCACTTTCTTTCACGCTGGGCGGCTCTCCTTATAGGGCACACTCCTTGTGTGTGGG
GCTCCCCTATGCGGGGACACCCCTGCGTGGCACTGCACTCCTTGTGTGCAACAGCACTGC
GCATGCGCCAGCTCCACACGGGTCAAGGAGGTCCTGGGTTTGAACCGTGGACCTCCCATG
TGGTAGACGGACGCCCTATCCATTGGGCCAAGTCTGCTTCCCTCAATTTTCTTAAGAAAT
GGAAACCAGTGGTGAGATTTCAACTTAAAAATAAATTTCTACTCTAGTTCCTCAAATCAT
CAAAGGATCAAATGCCCCCAAAGAGATGAAAAAAATCAGAGCTTCCCCTTGGGAGCCCTG
GAGCCCACAGAACTGTTAGTGCAATGACTCTGACTTCTGCACTTGGAAATGGCAAGATTC
AAATCTGGCCTGAGGTGCTCTCCACCACCCCACTCATGACATGTTTCGTTGGATGGAGCC
CTCTTTCACTGTCATCGGGTATCTTGGTCATTAATTTGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGCCCATTTGCTGTGTGTTCTTCTGTATC
TGTTTGTCTTCTCTTCTCATCGTTCTCTTTAGGAGGCACTGAGAACTGATCCTGGGACCC
CCACCAGGGGAAAGAGGCATTCAATCACTTGAGCCACCTCAGCTCCCTGGTTTGTCTTTC
CTCTGTGTCTTATTTTTGTTGCATCAGCTCACGGTGTGAGTCAGCTCACCGCAGTGTGGA
CCAGCTCACCATGGCATGGGCCAGCTTGCCTTCACCAGGAGGCGCCAGGAATTGAACTCA
GGATCCCCCCATATGGTAGATGGTACCCCAATCGCTTGAGTCACATCTGCTTCCTTATTC
TGGATATTAAACCTTTATCAGATATATGGTTTCCAAATACTTTCTCCCATTGTATAGTTT
GCCTTTTCACTTAAGAATGTCTTTTGATGCACAGATATTTTTAGTTTTGATGAAGTCCAT
TTTTATCTTCTTTTTTTCCTTTTGCTGCTTGTGCTTTTGGTCTAAAGTCTGAAAATCCAT
TGCCCACTACATGGTCCTGAAGATATTTCCCTATGTTTTCTTGTAAGAGTTTTATTTACA
TCAATGATCCATTTTGAATTGATTTTTATATATGGTGAGAGGTAGAGGTCCACATTCATT
CTTTTGCATGTGAATTTCCAGTTGTCACAATATCATGTGTTGAAGAGACTATTCTTTTTT
TTTTTTAAAGATTTATTTTTTATTTATTTCTCTTTCCTTCTCCCACCCAGTTGTCTGCTC
TCTCTGTCCATTTGCTGTGTGTTCTTCTGTGACCACTTCTATCCTTATCAGCGGCACGGG
AATCTGTGTTTCTTTTTGTTGAGTCATCTTGTTACGTCAGCTCTCCGTGTGTGTGGCAGC
ATTCCTGGGCAGGCTGCACTTTCTTTTGCACTGGCCGGCTCTCCTTACGGGGCGCACTCC
TTGCGCGTGGGGCTCCCCTACGCGGGGATACCCCTGCGTGGCAGGGCACTCCTTGCACGC
ATCAGCACTGCACATGGGCCAGCTCCACACGGTCAAGGAGGCCCGGGGTTTGAACCCTGG
ACCTCCCATGTGGTAGGCAGACGCCCTATCCATTGGGCCAAGTCCATTTCCCTCTCCTTC
CTTTTCTGAAGCGTTTTTCTGTGTTTCTACTTTTAGTCTTCTGTTTATAAAAGGACTCTA
GTGAGAGGATTAGGGCCCACCTTGGGTCCCACAATCTAATCAAAGGCCCTTAACCATAAT
GTTCTAATGAAGAGTGATCTAATCAAAAGATCTCTTAACTAAATCAAACCAAACCAACAT
ACGATAGGTTGATATGCTCAGGAGTTAGTGAGTTTAAGAACATAATTTTCTAGGGTCCAC
AAAAAACACACACCATTATAGGCTCCTTCACTAAGACGTCATCCTCAAAAGGTACTTGAT
TTGGTAATAATCACTTTCTCTTACAGACCCTGTTTCTTCCCTCACATAATTTTCTTCGTC
TCAATATATCTTGAAATCTACCTTAGTCTTCTCCTATCCTGAACTCCATTTTACCTTGCT
TTAGGTCTTTTATGATATTTCTTGCAGTAACCTTCCAACTAGATATTCCAGGCATAAAAA
GTATTATTAATGACATTTTGCATTAGTGTGATATCTTTGTTACAATTGAAAAAGAACATT
AAAATAGCACTATTATAGTCCATAATTTAATTAGGTGCATTTTTCCTATATACCACCCTA
TTATTAACACCTTGTAAAGTATCATTATTTGTTATAATTCTTGAAAGAACATTCTTGTAC
TATTAATCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGACATAT
ATATGAACTACAAATGAGGAAGATACCTAAAGGGCCAAAACATGTGAAGAGGTGCCCAAC
CTCATTAGTCATCAATATCAATTCTTAACTTTGCTTAGTTCTTTCTCTGCTTTGCTCTGT
AAAAATGACCATAGTCCCCACACATTAAATGTTGGTTTTGAATTTTTTTGTCTTCTTTTA
TAAGCTACAATGTTTATTCCCTAACATTTAATATAAAAATTTTCAAACATTTGGCAAACT
TGAAATAATTTTGCAGTGAAGACCCATATACCAACTACCTAGCTCTTAACATTAACATTT
TATTATACTTGCTTTATCACATGTCTTTCTAGCTCTATTTCTGGCACGTTTTTACTATTT
TTCTCTTCAGTACCACTCATTTCTTTGCTAGAAGATAGCTTTTTTTTCCCCACCTTTTTT
TCATTGAAGATACTTACTTTTATAGTCTCTCATCTTTATATACACAGCCACATCAACAAA
TCCAGAGTAATATGGCATTCAGACTAGTTAAGCTAGATATAGCCTGGTTTACTTATTGAA
AAGAAACTACCTTTAATCATATCTAGAATGTAATTTGTATTTCCAACTCATCTCTTCAAA
GTAACCATTTTGTTCCTCTCAAGTGGTTTCTAACATGATCTGTAACTTTTCTAGAAGCCT
GAGTGAGGATAGATACAGAGTTATGCTCTGTGGTCTCCCTATCTGGAAAGGTACTATGGA
GAAAAGACAAAGCTGGTACTATGGTGCTGGTTAATTCTGTCTCTGCTATTTAACTAGTGA
CTATTTTAAATCAGTTCATCTTCCTGGGCCTCTGTTTACTCGTATATTGAACATGTTAAA
CGAATTGTTTCCCAGGTCCCTCCCTCTCTTTCTGCAGTGAATTAAGATTTATTGGGTGTG
GAACTGTTGCAAAATGCATGATAAGAAGTCTTCCCTGTGATGCTGGAGACTGATGAACTT
CTGTGTGTTTTTTTCCAGATTGCTAAAGAGACATGAAAACAACTTATCAGTGCTAGCCAT
TAGTAACATGGAAGCTTCCTCCACCCTTGCCAAATGCCTTTATGAACTTAACTTTACAGT
TCAGAGTAAAGAACAAGAAAAAGACTCAGAAATGCTGCAGTGAGAAAGAATTCCACTTCT
ACAGTGGGGACTCAAGAAAGTCAAATACATTTCACATACTGTTACTAAAGAAAGCACCAA
GTCTTAATGGAACAGAGACCATAGAATGAATTATTTTATCTCCTCCCATGATGCTGAGAG
GAAGCTTCGTATTCTGATCTCTGAGTGAATCCCTTTGTTCTCTGTTTTAAAAAAAAGCTA
AAAAGAAAAAAAGAACTGCTGTGGGATTGTCAACCAGCTTATCTGCAGGATGTCTTTCAG
ATCTGATAAATCCTGATGAAAACTGGTATGATCAGAATTCAGTACCATCCACATTGGAAT
ATACATGGAATATTGTAAAACCTACATGAGCAGATGAAATAGAAGCATTAAATATTTTTA
TCTATATCCAAAAAGGAGCACATTTTTATATTTACAAAACCGTTTAAGCTGGTTTGAATA
ATTGAAAAGTTTCAGCACACCTATACCCCTGATCTCGGAGGGGGCCACCAATTATCTATC
TATGGATTGTGTGTTTTGTTTAGAAATCAGTAGCTTGGTTTTCTTACTTGAGCCAATATA
TTTTCACTTATTTATTATCATAAAAATTTACCAGTCTGAATAGATCTTGTAAATATTTGT
GAATAGAATGAACACCTTTCATGCCACTGCAGCCACTGGAAATACATTCTGTGGTGTCCT
AGAAGCATTATTGGTAGGTTCTAAAGTTTTCTAGACTTTCCTGTCAATTGTAAGTAATTG
TGATATATTCAACGCAGTGGATGAATGTTCTTTAAATTTGTGTAAATACTTCTGCAAAGG
TACTGATGCTGTAAAGTCAAAACAGTTTGTGGAACTGTGATTCTTTTTTTCCTTTTTCCT
TTTTATTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTATTATACACCTTGTAGAACTC
ATTTTGTTGGCTGAAAGAGTATGGAATAATATATCTCATGTCATTTTTGTAGAAGAAAAA
CTATTTGAAGGTATTTTTTGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 43937..44070, 59930..60148, 63707..63774, 70306..70372, 74002..74035, 74037..74253, 74579..74675, 74779..74988, 75297..75464, 81364..81445, 83392..83526, 84194..84390, 84619..87452, 114680..114828, 120789..120927, 121028..121113, 127944..128067, 128143..128145, 132679..132822
1001..1098, 43937..44070, 59930..60148, 63707..63774, 70306..70372, 74002..74035, 74037..74253, 74579..74675, 74779..74988, 75297..75464, 81364..81445, 83392..83526, 84194..84390, 84619..87452, 114680..114828, 120789..120927, 121028..121113, 127944..128067, 128143..128145, 132679..132819
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved