Dasypus_novemcinctus Locus CLUAP1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus CLUAP1
Dasypus_novemcinctus
CLUAP1
GeneScaffold_1437
SNORA42
2001..2132
68263
TGTCGGACTGAAAGATTTAGTGTGGGTCTCCTTCGGAACCCTCTATGTTCCACTTACGC
AGGAACCTGTCACTTCGTACTTCGCCAATACCACCCCCAATGGGGGCCGGGGGGTGTCAA
AGCTGCTCCCCTCCAGCTCATTTCACCTCCCCGCTTCCCTGGTTCGCCCGGACCTCGCCT
TTCTTTGTCGCCTGACCGCCCCCCCCCCCCTCCCCATGGTAGCCCGGCACGACGGTCTGC
CGCTGAGGCCTGGCTGGCCCGGCTGACCCCGGCCAAGGGCTGGGCGCTGTCCTCCTTTCC
ACCCTCCAAGCTCCAGCCGGGAGAGGGACGAACACGCCGCGTGCGGGCCTCCTTAAGCGC
CCAAGGAGACAGGCCTCTGTTGTCATGACAACCACCACCTGTCTCGCACTTGGGCCCGGG
ACTGATTCCCGGCCTGTCGTGAAGTCCAAGCTGCACGAGCGCGGGACCCCGACTGTAAGC
TGGGTGTGCACCTGGTCCTGTCGCGCTCGCTCCTGGGCGACCCCGGGTGCGGGCCGCGGG
GCCCTCCCTTTTACGCCGGCAGGAAAGGAAGCGTGCTGTGCACGAGAACCCGGAAAGAAA
GGACCCGGGCTCAGGAGCCTATAGTAATTCTTCATGAGGCAGGTGAGGAGGACGTGAGAA
GCAGTGTGTAAAGCATCTAGCAGTGTCAGGCACACAGTAGGGGCTCAGAATATACGAGCC
AGTGCAGGTGCCCACGAAAGGGAAGCTGGGACTCGCAACCCCCACCCCAGGGTCCTCTCT
CTCTGGCTACCTTGGGCGCTCGCCAGCGCCCCCTGCCGGCCGGCTCTTCTGCGCACGCGC
GCGCGAAGCCCGGCGGTGTCTCAGGCTGGTCCTGTTTGACCCCGCCCGCGCGCCGTCCAG
GGCTGCGATGGTTGTCATAGAGACCAGCGAGCACCCGGCCCGTGATCTCTGACGGGACAG
AGTGGCGGCTGCGACCTGGGACTGCCGGAGACCAGAGCGCCATGTCCTTCCGCGATCTTC
GCAGTAAGGCAGACCTTTTGTGCCCTGCGGATCCTCGAGCGCCTCGGGGTTCCGGCCCGG
CCTGCAGAGTCCCTTTTCTGAGGCCGGGTCCAGGCCCCGCGCCGCCGGGAGCCCTTTGGG
CCTGGGAAGCCGCATCCCTTCGGCCCGGTCCCCCTCGGCTGGGGGTGGTATCCCCGGCTT
TGGTCCCTCCGCTGCCGGCAAATCCCTCTCGGGCCTGCGCACCTCAGAGACCGTCTCTGG
CCCACCGCGGTAACTCCGACCCAGCGCACTAGCTCTGTCCAGGAGAACTTTCTGCGATGA
TGGAAAGTTCTGTATTTGCTACTTGCCCAAATGTGGCTAGTATGGCTGAGAAGCTAAATT
TAAAAATTTTTATATAGTCAAATGTCGCTACCTCTTGGAAAGTGCACAGGCCGAATTGAG
CTGGGTTAAGTTAGGGTTCAAAGACACGGGCAACAAAACCGAGGAGGGAGCTGGATAACA
CTAATAACTGCAGTGAACATCTTTTGAGATTTTACTGTCAGGTACCCTTCTCCGTATGTG
CATCATTTCATTTGATCCTCTCCTTAGAGATGAAGAAACAGGCATGTTAAGTGGCGGGGG
GTAAGAGGGCACGCTAGGATTTGAATTCAGGTCACCTGACTCCAAATCCTGCATCCTTTC
CGAAGGGGCTGGTGAAGAGACCATGTCTGGGTCAAGAGAAGAGGGAAAGAAGGAAGATGG
GAACACACCTGCCTCTGCTAGGAGGGTAGAGTGCTGGAGGAACAGGGATACGAGTTTTAG
TTACGACTGCGAGGGTGACACTTAGAACCAGGCACTTTACGTTCAACACATTCAACATCT
TATTTTAGTCCTCACTTTAAAAGATGAGGTAGGTGGTGTAATTCCTGGATGAAATAATTG
GAGGCACAAAGAAGTGAAGTAACTTGGATTGGGTCACACAGCTAGAACTGGGTGGAACCA
AGCACTGAAAGATAGGACCATGCATGGGTTTGGGTTTATGGCAGGCCCGTCCCCCCGAGC
CTCTCATAGTGTCTCGTGCCAGAGCAAACTGTAGCTCAGAACCATTGCATGTCCTTGTCC
ATAGGCCTTGGCACTGAAGTGGGTCGCACAGTGTAAGAGTAAGGAAAAAATAAGTAAATA
AATTAAAAAACAGAACCGTGTGACTCAAAGCCTCTTGCTTTTGTATGCCATCATTTTCTG
AATCTGAAGGCTGCTTCTCCAGCTCTGTATTCAAGTTTCCCCCAAACAGTTGAGTGCCTT
CAGGCCTTTCTCTTTCCTCTGCTATACACCTTCCCTTCCACTGTCTGCTGAAATGCCACC
GCAAGGTGCTCGCGGAGGTCTTATGTGGGGGTCGTGTGTGAATTTCTTGGGGCCATTTTG
AATATCAGGAAGAGTGAGGACAGACATCACATAGGAAGCAGCTGAATACAGATCTTGGTG
CATGGTAGACTTTCAAAAAGTGTTTTTGTGTTTATCTCAAAGCCCTGCTTTCTTGAAGCA
GTGTGGCTTTTCCTGACATGATAGAGCTCATTGAGCCCAGTCTACCAACAAGTATTAGTA
TTACTATTTCTTCCGTTTTATAATAAATCTAAATATTTCTCTATGGTTCAACCATTCTCT
TTGAGATTTCTCTAAATATAAGGAAACTAATCTTGAAAATTAGTGTTAATAAGGTACTAT
GACCTCATTATATAAAAAAAGATAAATATCAACACTTCACCCTACCAGTTCCCCCCCCCC
CATAGAAGTAACCACTGTTAACACTTTAAAATAATTTTTCTTCAAGATATTTTATAAACC
AGGTATTTCTTGACTTGGAAAAAGATGTCAGAGAGAAATGAGATATCAAGGGGAGATATC
AAAGAAATAAATTCGTAGTTAATCCCTAAACCTATTTTAATGTATAGCTTCTGCTTTCTC
TTCTCTTTTTTTTAAGAGATATTTATTTATTTATTTATTTATTTCTCTCCCTTCCCTCCC
CCCCCAGTGTCTGCTCTCTGCGTCCATTCACTGTGTTCTTCTGTGTCCACTTGTATTCTT
GTCAGTGGCAGTGGCAATCTGTGTCTCTTTTTGTTGTGTCATCTTACTGCATCAGCTCTC
CGTGTGTGCAGCGCCACTCCTGGGCAGGCTGCACTTTTCTAACATAGGGCGACTCTCCTT
ACAGGGTGCACTCCTTGAGCGTGGGGTTCCCCTATGTGGGGGACACCCCTGCGTGGCACA
GCACTCCTTGTGCACATCAGCACTGCACGTCGGCCAGCTCACCACACGGGTCAGGAGGCC
CTGGGTTTGAACCCTGGACTTCCTATGTGGTAGGCGGATGCTCTATCAGTTGAGCCAAAT
CTGCTTCCCTACTTCCTCTTCTCTTGAACTTAAATATTTTACAGGTAATAGATTAGATAT
TTTAAATTTTGTCTCCTCCTTTTCCTCTTAGCGAGTTGATAGTCCCTAAAACTGCCAAAT
GGTGGGGAATAAAAAGGAAAAGCGAAGAAAAATTTGTTAGTTAATAAGTAGCTGCTGTTT
GATGAGGAACTGACTGAGTTGTATTTTGCCTTGAACAGATTTTACAGAGATGATGAGAGC
CTTAGGATACCCTCGACATATTTCTATGGAAAATTTCCGCACACCAAATTTTGGACTTGT
ATCTGAAGTACTTCTCTGGCTTGTAAAAAGGTTAGAACTGTACTTTATTAAGGTCTAAGA
GTGAATATTGAATTTTGTTCATTGGCCACCAAGAAACAGGATGCTCTTGTGAAGCAAAAG
GAAAAGCGAAATGTGCTTTGAGCTTGCAGGCCCCGTTGTAATCTATTAAAAATCAGCCGT
GTTTAAAGAAGGCTGAGGGAGAATGGACTAAACCAGCAGTGGCAAATGGAGAGGACTTCT
CGGCAGGAAGCAGAGGGCTCTAGGGGTCTCATCTCTTGCCTGAGAGGAGCAGGGGCCTCC
CCCACACTAATGAATGAGGCCCCACACTAATGAGTATGCGGATTAGAAACAATTTGGGCT
TTTGTTCTTGCAAAAAATCTAATATGCTTTCAGGGTCAGCAAACCTTTTCTGTAATGGGC
CAGATAAAGTAAATATTTCAGTCACTGCAACTACATAAGGTCTCTGTCACATATTCTTTG
CTTTGTAGTTGTGTTTTTTACACTTTAAAAAGTTAACACCACTCCTAGCTAGCAGACTAT
ATAAAAACAGGCTGAGAGCCTCAGTTTGCTGACCTTTGGTGGGTCATCAATAAACTGGAA
GTAAGTAACTTCAGTAACTTTGTTGCTTCTCAAAGTTCACTAAATTAGCCCTAGAGTAAA
TCTCTGGGTCAAAGGCTCCAGCCAGAGTAATAGTTCTGACTATTTTGATGAAACTTTGAG
TTCCGAAATGGATGGAATTTTGTAAAGGGAGCTCCAGATTTGGCTTTTGAAATCAGCTAA
ACCTGTTCTTAGGCAAGGATTTACTCCCTTATATGTTTGCAAAGTATTTTGTGTTGCCAT
TGAGGTTTTCCTCAGCCTTAGTGCCTTGGCTGGGGTGGGAGAGCCTCAGGCTGCAGATGT
GCTGCCCTTCCTTCTCTGCTCAATGGGCTTCCTCCTCAATGAACTTGTGTCTTCTCGCTC
TTCGGTAGGTATGAGCCTCAGACTGACATCCCTTCTGATGTTGAGACTGAACAGGACCGC
GTGTTCTTCATTAAGGCAATTGCCCAGTTCATGGTTAGTTCCTGGTTATTTTGTAGAGAT
GTAAAATAAAAGAAATCAGAAAAGGATGAGTCCTGTTTAGGGCTGCTTGCAAGTTGGGTT
TACTTTCCAGACCCATTTCTTTACCAGGTTTCTGTGGAACCGTTTTACTAGCAAAGTTTT
TTAAATTATTATTTCATTTGTTATTGTTTATTTATTAGTTTATGTATTGTTGATAGGTAA
TATATTTCATGGTTCAAAGTTTTCAAAGCTTGAAAAGATATAGAGTAACATATCTCTCTA
CCCTGTCTGCCACTGTGCCAGTTTCATTCCCAGCAACCACTATTGTTAAATTTTTGTTCA
GCATTTCTGTATGCATATATGAGCACATAAGAGCATATATTCTTATTTTTCCTTCCTTTT
ACCCAAAGAGCATACTACTCATTGCTGTTGGTATCTTGCTTTGCTCACTTAACAATATCT
TGGAGAACTTTCCTAATCAACACATAGAGAATTGCCTTATTCTCTCTTAGATCTGAGTAG
CATTGCTTGTGTATAGGTACCATAATTTAATTTTTACTGGTGAGCATTTAAGCTCTTTGA
AGCAATGCTGTAATGAATAAACTGTATACCATTTTGTCTGTGTATGAGTATATCTCTAGG
GTACATTCTTAGGATTAGAATTGCATCAGGTGCATTTGTAATTTTGATGGTCATTACCAA
ATTGCTCTCCATCAAGGTTGTACAGATTCATACTCCACTTGGAGTGTATGAGTTAAGTTG
AATGTTTGACTCTTATATGATCAGATTGTATCTTTGTTTTTGGCAAAGATATTTTTAAAT
TACCTGCTTGAGATTTGGTCTAGATATTATGTGGAAGACTTAAACTTTTTTGTGTGTGTG
GGGGTTTGGATCTGAAAATAGGCAACCAAAGCACATATAAAACTCAATACTAAGAAGCTT
TATCAAGCAGATGGATATGCAGTTAAAGAACTATTGAAGATCACATCTGTCCTTTATAAT
GCTATGAAGACCAAAGGGATGGAGGGCTCTAAAATAGGCGAGGAAGATATCAGCAAATTC
AAGTTTGATCTTGGCTCAAAGGTAAGGAAAACAAAAGGCTTACAGTGAAAGTATGGACTG
TTAATTTTGGAATGAAAGTGTTTCTTGCACTGGAATATATCCCATACGGTACCACTTCTT
TCTTAGTCCTTGAGTGAGGGTAATGTGTCAGTTTTGTGTTCAGCATTTGGGTAAAAGCAG
AAGTCACAATAAAGTAACTATAGTAAGTCTACTATTTGCAGGCACTGTCCCAAGTGCTAG
GATACAGGCATGAACAAAAAGGAAATCATCCTAGCTGTAGCTCCACCACTGTAAATGCTT
TTGTATGCAAGCTTGTGTAAGTGTCACGGCAGCCTACGAAGGAAAGTGTGAAGGCAGAGA
ATGAGGAGTCATTGGCAGGGAGGGCTAAACAAAGGGCACCAAGATTCTGCAAGAGGAAGT
GTGTCCCTCAGGTTGCCCCTTCCTTTCGTCACTCCACTGCTGTCAGAGGACCTTACTGTG
ACCCAGGTCACTTCAGAAATGTCCATTTTTACCCTCCTATACCTCTTTTTTTAAAAGATT
TATTTATTTACTCCCCCCTGCTGTTTTTGCACTCGCTGTCTGTGCTCTATGTCCATTCAC
TGTGTGTTCTTCCGTGTCTGCTCTTCTTCTCTTTAGGCAGCACCAGGAGTCAATCCTGGG
ACCTTCTGGAGTGAAAGAGAGGTGCTCAATGTCTTGTGCTACCTCAGCAACCTGGTCTGC
TGCATCTCTTATTGTCTCTCCTATGTGTCTTTTTTTGTTACGTCATCTTGCTGCGCCAGC
TCTCTGCATGAGTCAGTTCTGCGCAGGCCAGCACACCGTGCAGGTCAGCACTCTACGTGG
GCCAGCACTCTGGGCGGGCCAGTACTCGGGCCAGCTTGCCACATGGGCCAGCTTGCCTTT
ACCAGGAGGCCCCAGGAATCGAACCTCAGACCCCCTATATTGTAGACAGGAACCCAATCG
CTTGAGCCACATCCGCTGCCCTCTCCTATACTTCTTTTTTTTTAAAAAAAAAAAGATTTA
TTTATTTATTTATTTATCTCCCCTTCCCCCTTCCCCCCCACCCCGGTTGTCTGTTCTCTG
TGTCTATTTTGCTGCGTCGTCTTTGTCCCCTTCTGTTGTTGTGAGTGGCACGGGAATCTG
TGTTTCTTTTGGTTCCGTCATCTTGTTGTGTCACCTCTCCGTGTGGGCGGCGCCATTCCT
TTCGTGCTGGGCGGCTCTCCTTATGAGGCACGCTTCTTGGTGTGGGGCTCCCCTACGCAG
GGGACACCCTTGCGTGGCACGGCACTCCTTGTGCGCATCAGCACTGTGTGTGGGCCAGCT
CCACATGGGTCAAGGAGGCCCGGGGTTTGAACCGTGGACCTCCCATGTGGAAGATGGACG
CCCTAACCACTGGGCCAAGTCCGCTGCCTCTCCTATACTTCTTAATGTCAAATTAAATTT
GACATTTGCTTTTAGGAGTCCTAGGTGTCCTGGGATTGGTCATATTTGTACTTAGGCCTC
TGTTGTCCTAACTCTTGTCCTGGGAGGACTCTTCTGTGGGATGTGAATGTATAGCTTGTG
AATAAGGTATTGTATAGTCAGGTATCCCAACCGAAGGTAGGAACTGATACTAACAGACTG
GTTATTTTAGTATTTCTTATCTGATCGCCTATTAAAAAATCTGTCACTGAGGTTTCTTTT
TTGGATGTTTTCTTCCAGATTGCAGATCTGAAAGCAGCTAGGCAGCTTGCTTCTGAAATC
ACCTCTAAAGGAGCATCTCTGTATGACTTGCTGGGCAAGGAGGTAGAGCTGAGGGTGAGC
AGCATTCACATAAAATAATTACTCCCTTAGCTAAGCAAATTTTCTCTCAAAAGTTTTCTT
TTTTTTTTTTAAATTTATTTCTCCCCCTCCCCTATTCCCCCCTTGTCTGCTCTCTGTGTC
CATTTGCTGTGTGTTCTTCTGTGTCTGCTTATATTCTCATTAGGTGGCTCCGGGAAACAA
TCCTGGGATCTTCCGGAGTGGGAGAGAGGTGATTACTCTCTTGTGCTACCTCAGCTCCCC
TGTTCTGCTGCATCTTCTTATTTTCTCTCCTCTGTGTCGCTTGTCACATCATCTTGCTGC
ACCAGATCTCTATGTCGGCCAGCACCCCTGTGTGGGGTGGCTTTTCCCGAGCAAGGCAGC
TTTCCCATGCAGGCTGGCTCTCCTGTGCTGGGCTGCATTCCCGCATGGATCAGCACTCCG
CGTGGGCCAGCTTATCCTCACCAGGAGGCCCTGGGCATTGAACCCTGGACCTCCTATATG
GTAGACAGGAGCCCAGTTGGTTGGGCCACATCTGTTTCCCCAAAGTTTTCTTTTTCAATT
CTGATTTTATTAAGCACTACCTCATTAAATGAGATACAATATGGGAAAGTGGTATACAGT
GTTAGCTGCTACTACTGCTTCTAGTGAGCACTGGCCTTTTTTTCTTTTTCTTTTTTTCCT
ACTTTCTACTTCTAGTTCAGGAATGGCAAATATGTGGCATATTGCTGAAATTTTCCTTCT
TTTGCCCAGGACAGACTTTATTGATCATGGTGATTTTTCTTGGTAGAGGTCAGTCTTGGC
ATTCTTCTCAACAATATGCATTTCTAAGCTAGTGGTTCCCAAACCTTGCTGCACATTGGA
ATCTCCTGGGGATCTTTAAAAAATGCTGATGCCTGGTTCCTATTCTGATTTAATTGGTAC
AGAATGCACCTGGGCATTGGGATTTTTAAAAGCTTCCCAGGGATTCTGATTAAAGCAAAG
TCGGGAAAATTGCTCCAGGCAGTCAGTACCAATCAATTGAAATTGATATTACCATCGAAA
TTCATTTACCGTCCTTGTTCAGCCAATGCCAATCAAAGAGTCTGCTTTACCCACTACATT
TAATTTTTTTAAATTGTTACTTTATTTATTCCCCCACCTTGTTGTTTGCACTTGCTGTCT
GCTCTCAGCTCCCTGCTGTGGTGCAGGCTAGCTTGCCTTCACCAGGAAGTGCCAGGAATT
GAACCCAGGGCCTCCCATATGGTAGAGAGGAGCCCAGTCATTTGAGCCACATCTGCTTCC
CTACATTTAATTTTAAGAGTGATTCCTAAACTCTGCGGATTATTAGAATCATCTGGGGAG
CTTTTAAAAATCCTGACATCCAGGTCGTACCCCATACCACTGAACCAGTAACTCTGGAAA
TGAAAGATAAGCATCAATTTAATGGTTTTTAAAAAAATGAAGGATTATTTACTTTTAGAT
AAGGACTTACAACATTTTCATCATACATACTCACATACGACATTTTCAAATTAAATGAAA
AGACACATCCAGAGGTGCAGCAGTCCCTCTCAGGTATGAAGTCCATGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCTGATTTGAATAGCTGGTGAGGCCACTCCAGGCTTCCTGTGTTTAGTGTGTTTAC
TGTGCAGCAGGGCACATGTATACTGCTCTTAGTTCCTAACTGACCAGAGAAAGAGTGACT
TGCTTGCTGATGGGCCAGCGCCACTGTGGCAGCATCATGAGACTTCACCAGGATTCCATT
GGAGACCCTTTTAGCACTGTCCAGTAGAGAATGAATGAAATCAGTGGTTCTCAAGGAAGC
CATGGACCCTGAATACAGTACTTCTCAAGTTCTGCTTACAGTCATGGTCTGGGGAAGATC
CCCTACCCGACACTGGTTTTTCATATGTTCACCCAACAGTCACTGAGGCCCAACGCCAGC
CACAGGCCAGGCCTGAGCTGTGCACTCTTGAGGAATCCCTGCCCTCAGCTCGTTTACCAC
CTGTAAGGAAGGAAGCACAAGGCGGAGCTTGATAAAGTGCCCTGAGACCCTTAGAACCAC
ACCCACATTAAAGTCATGTTTCAGAAGTTTCCCATATTGATATGTCAGGCACAGATGCCT
CCTGAATTGGCTAATGGCTAATGCAAGGTTGGGGCCAAGGTGACCACTGTCCTCTGTTGA
AGTTGTCAGTGATAGGCAACTGAGAGGGACTTATTCATAAGGAAGATGTGGAGGATAACA
GGGGCTTCAGGCAGCTCAGTTTGGGCATCGCCTGAGCAGAATGCAGGTAAAGAGGCAAAT
TTTTTTTTTTTTTAAGATTTATTTATTTTCTCTCCCCCCCCGACCCTGCCCGCCCCAATT
GTCTGTTCTCTGTGTCTATTTGCTGCATTGTCTTCTTTGTCCGCTTCTGTTGTTGTCAGT
GGCACGTGCATCTGTGTTTCTTTTTGTTGCATCATCTTGCTGCGTCAGCTCTCCGTGTGG
GTGGTGCCATTCTTAGGCAGGCTGCACTTTCTTTCGCGCTGGGCGGCTCTCCTTACGGGG
CGTACTCCTTGCGTGTGGGGCTCCCCTATGGGGGGGGGCACCCCTGCGTGGCAGGGCACT
CCTTGTGCGCATCAGCACTGCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCATCA
GAGGAGTCAACTCTCGCAAACAGTCCACAAACCATATCAGTCTGAATATTGGTTTTCAGA
ACTCCTTTTCTGAACTATCATAAAGGATTTATTGTTTCCCATAGGAACTGAGAACGGAAG
CAATTGCCAGACCTCTGGAAATAAATGAGACTGAAAAAGTGATGAGAATTGCAGTAAAAG
ATATTTTGGTAAGATTCACTTTTATTTAATGTTGTGTGACTGACACTCAGAAATACTGAT
TTATTGCCTGGACAAGACAGAACAAGTGAGACCTAGAAAGGAAAAAGGGGAATATATTAA
TGGGGAAATGAGAAATTTAGGACATTCTGGAATACTTAGATTACTTACAACTATTTTTTC
CCCTCATTATAAATATAAACAATTTCTTAAATTATTAAAAATTTCTCAGTTGTAGTCATT
TAATAAAAGCTATTCAATAATTTTAGTAACTAATACTCTACTTTATGGACTCTTCATAAT
TTATTTAATCAATTTCTCTCTGCTGGGCATTTGAGTGGCTTCCAGTTTTTCTTAATTCTA
AATAGCAGTACAATAAATAGAATGACCATTTAAATAAATAAGCATATACCAAGTCCCAGA
TTTTTTTATCTTTTGTATTAAAGGGTAAAATGGACAAAACCTATTGCAAATAAACAATTC
ATAGAAAAAATAAAATAAAATAAATAGAATGATTACCATGCTTTACTACTCATCCACAAT
AAGTTATTATTTGCTCATCTTATCTAAAGCATTCAGTGGAAGGCAGATAGCAAGGGGGCT
TGACTCATCCATTTGACTCAGTGGATTTGAATCCCACTTTGTGATCTTGGGCAAGTTGCT
TAACCTCTCTATGCCTCACTTTCCTCATCTGTAAAATGGGGTCTTCTGAGTATTACTTAG
GACCTTGCATATGAATCCTAGTCTCCGGCACATAGTCGCTGTTCAGTCATTATTAGTCAT
CCACCGTCGTCAGTGAACCCAGGGAGGGGAGCCTTACATAAACAAGAATTTGCTGTAAGC
TGTTCAAAGTTCCTGTAACACCCTTGTCATGAAACAGTAATACTCCTTGGGTGGCCCAGC
CCAAGTCAGAGCGTCAGTAGGGTTAAAATGACGTGGTAGCAAAAATGGGAGACTGGTTGC
ATGCGGGAAGATTGATGAAACCAGGAAATAGGTGAAGGATAATAGAAGCTTCTCACTGTT
GGAGAAAGGAGTTACAAATAGGTTCAACAGATGCATAGATGGGTACAGGGATAACTGTTG
ATATACATGTGTGTATGTAGGTAAATATGTATCTCATATATACGTGCAGACATACACATG
CACACCCACAAACACATATATTTCTTAGCTCTGAGCAAAGCAATAACAACAAACACACTT
AGTGCCCAGATCCTGGCTTCTAAATGCCATTTTCCACTAAAAGGAATGAGGGTCCTTGGA
GAAATGGCTATTTCTAAAACTGGGGCAGGGAAAGAACAAGATGAGCCTGGAACATCTTAG
GCCAGAAAACAAGGAAGTTCTCAGAGAATAAAAGGGATATATCCAAAAGGATACAGAAGT
CAGATCAAGTGGGCTTCCCCTGGCCAAATAAGGCACACTTTAAATACAAAATAAATAATG
GACATATAGACCATTGAATAAAATAGGAAACCCTGAGTCCACACTGATAAAAATAAGTTG
ATGAATCACTGAAAGTTTGAGACCACCAATAACCTGGTCCCCTCACAGAGGTTCAAAATA
GCTCCCCACAAAATGCTGAGGGGAAAAGAGTCACTTGGCCTGGAGATTGCCTGGCAGACA
TTGCCTAAATTAAGACATCAAAGTGAGCGTCAGCAGTAATGGGGCAAATCAGAATCATGC
ACCACCTGAGAAGATAGTCCTCTCTGTGGTGGACTGCCAAAGATGTGGTAGTCCTGCCAA
AGATGCGTAATCTTTACCTAGTCATACAAACCCAAATTGAGGGGCATTGTATAAATTAGC
TTTCCTGTTCTCTTCAAAAGTGCAAAGGTCATAAGAGGCCAAGAAAGGCCAAGGAGCTGT
TCCAGACTGAAGGAGGCCAAAGAGACGTGACCCCTGAGTGCCACGGGGAGCCTGTCCACC
ATGAAGTAGTCCTTAGGACAGTGGCAGAATGCCATCAGTGAGGCCTAGAGGGTAGTCATG
CGTCAGTTTCATGTCCTGATTCTGATGATTACATTCTGCTTATGTAGGAGAAAGTCCTGG
TTTGTAGAAAATATACACTAATGTTTTCAGGGGTACAAGACATCACGTCAGCAACTTTCT
CTGGTAGCTCAGGGCAGAATGCTGCATTCTGTACTCCAGCTTTTCTGTCAGGTTGTGACT
ATTTCTAAATTTAAAAATTAAGAAAATAATACTGTTACGTTTGCCAACGTTCTGGCTGAA
TCAAGTGAACGTGGCATGAACGTGCTCTTAGTGCTCTGTTGAAAATGGAACACCCAAAAG
AGGACACAGTTCACTGACTGACTTCTTTTATTTTTTTATTGCAGAGTACCTAGGAGGTTT
GATAATTCCAAAGAAAACTGAAATGAAGCATAACTCCTTAAAAGGGGTTTTCGAGGAACA
GATACTTTTAAAAAACTGGTTTTATTTTTGAAGTCAGATAAATTCACTAGGTTTGAACCT
GACTTTGATTCAGAAATTGTCGCCATTAGTTTGAGTTGCTTGTTCAGAAAGGAGACCTGC
CTTACCCTCCCGTGAGAGGGAACTCGCATCCCTGCTGGGCTGTTAAAGCACCCACAGCTA
ATGGGCGATCAGTGAGGGATAGGACTATTGTAATGAAATCATCTTAGATGTGGTTAGTGT
ACTCAGACCCCCAAATATTAAACTAGAAATTCATCACCAGTAAAAGTGGTTGCTTTGAAG
TGTTCATGGTCTCTGTGAGAAAGCACGAGTGTCTGGGAATCTCAGAGCTTTAGAGACTGC
ACGTAAACGTCAGGACACTTTTATAGGGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAAATAGAAAGCGCTTGCAGACTCTGCAGAACGTAAGGTATGTGTGAACA
CCTGAAGAATGAGTAGAAACAATGTCTGTGAAAGTCAAAACAAAGACTGAGCAAATGCTG
TCATACTAATCTTCCAAGTAGTGTGCAACGCATCGCATGAGGATGTCACTCCTTCCCGTT
GTACATATTTTGCCTGTCCTGACAAGCAGACTGCTAAACTCAGTCCCTTTGTGGCTTTCA
GTGTCTGGAAAACTGCTTAATTCTTGCAATTGCAGCTTTTTGGCCTCTGGGACTACAAGA
CAAGTAAATAAATCCAGATGGTGAGAGTCATGTTAGGCACAGGCTCCTGAGATCTGTGCC
TTGCCATAAATTAGATGGAAACAGAAATATTCTCTCATTTTTTGGTTTGGATAGATATTA
GATTTTTATAATTCCTCCCCCTGTAATTCAACTTTCTTCTGACTTTATCTCATTGAAACA
CTGTTTGCAGAGGATACTGCTTTGTCCTAGTGGCCCAGGACACCTCTTCAGTCAGTGGAG
TCTCTTTAGCATGTTCCTAACGTTTTCTGGGAGCCCTTTTGTGGTTTATCTTGTCTTTGC
TCGTTTTGTGCCCTCTGCTGCTCGCTCTGTTGTTTGTTTCCCTCTGATGCTCCTCGATTT
CCCCCCCTTTTCCTTCTCCCTTTATTTTTCTCTATCTTTACCAACCCTTCTTCCAGCCAC
GGCATCTGGGCTGAGAGTTTTGCTTCCTGCAGAGCTCCTTGCTGGGCCACACCCTGGCTG
CTGCCCTGAGGTTGGAGGAAGGGAAGGCCGCTCCTGGAGATGGTGGACAGTAACTGCAGG
GGGCTAAAAGGCTCCCCTGCGGAGGCCAGGTCACGCTCCTCATCTTCTCACATTAGTGCC
ACCAGATGGACTGAGCTCTTAAAAATCACACCTTTAAAACCTGCATTTATTTTCGTTCAA
CCCAAATTCTTTTAATAGAAAAGTTTCTCTGTTTTGCTTTAGTCCAAAGAATTTAAGTTA
TTTTTTAGTTCATCTCTTTATATTTGTACAAGAGCAGAGTTCTCCCCTTCAGGATCAGTC
AGAAGAAAAAGTAAAGAAGTTCAGCAAACCAATTGGAATGGGTTTTTATGGTGTGGTTTT
GTTTTTACATTTTATCTAGAAGTTCAGCAAACCAATTGGAATGGGTTTTTATAGTTTAGT
TTTGTTTTTAAATTTTATCCTGTTTGAAAACTTAGCTTTAATTTTTAGCAACCTCTGTTC
TCCTTTTTAGGGGTCTGGTAAACTTGGGAACATCTAGCCAGTGGAACATACCCAAACAGA
GATCATAATGCCCATCTTTATTGATTCAGAGAGATGTCTTAGGCTATAGGATTATTTTTT
TAACTCTTCATTGAGTTGGAACAGATGACAAAACCTCATTTATGCTAATATTTAATGTTT
GTTAAAAATATATTATTTTATAGATCTATGCATAGAAAGGTCTGGAAGAATATATGCCAA
ATGTTAATTGCTTATACTTGGTGGTGGGATTATGAGTAATTTTTACTCTGTTCATACTTT
TATCATTATTCCAGGTTTTTACAAAGAGTACCTGTTACTTTATGATTTTAAAAAAAAAGG
AGTATGTACATTTTGGGAGAAGGAAGGGAGAAAGGGAAATCAGTGTTCAACAGTTATAAG
AGTGAGGGGCCTCTGCCAATGACAGTTTTCCAAAGAAAACCATGGAGGGATCTGGAACCC
TGAATGCCCATTTCAAGCTACTGTGTATAGATCCATCTTCCACTTTTTATTTCGTCTGTT
CTTCCTAGGCCAGCCTTTATGGATGAATATGAGAAGATTGAGGAAGAATTGCAAAAGCAG
TATGACGTTTATCTCGAGAAATTTCGCAATCTGGCTTATCTGGAGCAGCAGCTTGAGGAT
CATCATAGGTTGGAGCAAGAGAGGTTTGAGGTTGGTGCTCACCCTGGTCCGGCTTGGCAG
GCTGTCCTTTTTGGTGTGCTTTGTATACTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCTATCACTTTTTGAATTACCCTTTTCCCTTAGGGATATTCTTGAAA
GAGTGAGAAGAGTCATTTAGCATCTGTGTTTATGGCATTAAAAGAGAGAGAGCAGACGTA
CATTCCTATAATTGGGGCTATAATCGCTCTTTCTTACCTCATCCTTATTAGCTTTGATAT
AAAGGTTGTGCTAGCCTTCTTACAAACCTGGCATCTGAATTAGGTGACTCTGTCTTGTCA
TTCAGAAGCGCTAATGGGAGTAACTGACGCATTAGTATGGATATGTTTATCTTGACAAGC
TACCTGTAGACACCTGTTGCAGTATAGCAGAGAGGCAGGCCACGAAGGAGTGGGGTACTG
CACAGGTAGATTTTGAGGCAAGGAAGAGAGCCTGGAATTTAGGTTGTGAAGTACTTGGGG
AAGAACAGGAGAGGGCCAGTAGAAATAAACATGGGTCGCCCCTGAATTCAGAGAAAGCAC
CTGGGGACATGCCTGGGGGTGGTGAGCCGGAGGCCCTGTACTATGAGGGTTCCCCTTCCC
TGCACCCTTCCTTCATGTAGTTATCCTCCTTTTCTCCCAGACACATACCTACTCTGCTCA
AAACACTCACTCCCTCAAGATAGCCGTGCATGAAACATGCTTTCTTTTTAATGTTCAGAA
CAACAAAATTTGAAATGCCAGTTTCCTCTCCCATTCTCTCTTTTGATAATAATTAAGGCC
ACATTTTGTAGCTTAACTCAGGGGTTCTTAACAAGGGGTCTGTGAGCTTGAATTGAAATT
CAGAAGAACACATCTTATGGGGACATGTTGGTGTGGGTATGATCTATTTATTAAATAATA
CACAGTATGGTGTGGACTTAGCACACATAGGGGTCCATGGTTTTCACCTGACTGGCAAAA
GGGTCCATGGAACAAAAAAGGTTAAGAGTCCCTGGCTTAACTGAAGTAGCTCCCATTTTT
AACATCTTTTTTCCCATGCTGGGATTTGAAAGTACTGTTTCTTGCTTCCTCTTCTCATCC
TCACCATTCTCACCATGTAGCATCCTTTGGGGCTGGAATTAGGATGGCAGTGCAGGGCAG
TGAAACAAAAAAATACATGCTTCGTTCTTTAGTGAGTAAGGCGCCTGCCCCTGTCCTATG
CTTAGGTGTACCTGTTCATGCTTTGACATCCCGCACAGGCACACATGGTGGGCACTTGGT
TATGTGTTTTGTTTTTCTTCAGAGGCTGTGAGGTGTAGTGGCAGGCGTGTGGGCTCCTGG
GCTGAGTGCGTCACTCGGGGAGCCTCCCTTTCCATGGGCTGCTGGAACAAGTACAGAGGA
AGGGCCTGGGCAGCTACTTGGCAACATCAGTTCTCTACACTCTCTATCTTTTTTTCTTTT
TTTTTAAGAGGTACTGGGGAGTGAACCTGGGACCTTGTACATAGGAAGCAGACACTCAAC
CTCTGGGCTACATGCGCTTCCCTGCTGTCCTTTAGATAAAACATTTCCTGGCTCTATATC
ACAACTTAGCAGGACTTAACGAATGATAAAGAATAATAAAACAGTCCAAAAAAGGGGTCA
TTTCTTCTGAATATTGTTTTCCTGTTTTCTAGGAAGCTGAAAATACTCTTCGTCTGATGC
AGAACAAGCTAAAGGAAGAAGAAAAGCGACTGCTCAAAAGTGGAAGTAAGGCTTCATTTT
TTTTTTCTTTAGGAGGTACTGGGGATTGAACCCAGGACCTCATATATGGGAAGCAGGCAC
TCAACCACTGAGCTACATCCACTCCCCAAGGAGGGGTGGTGTTTTCATCTTTCTTTTCTT
TTCTTTTCTTTTTTTTCTTTTCTTTCAAAAATTATTACATTCAAAAAATATGAGGTCCCC
ATTCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATACAGGACAAGTGGAGGGAGTCCTCATG
CCACATCAAATGTCGCCCACAATTCACGTGTAGAGAGGTGAGGGTTACCTATGTGGGAGA
CCTGGTGTCTGGGCAGGAGTGCTCACCAGTGAGGCACTCTTCACCTGTCACCTTCACCCG
ATGCTTGCTCAGCCTTTGAGAGGAGCAGTGACACGTGAGTCTTCATGCTGAATGGATGCC
TCTGCCCACTGGAGTTAATTCCCTTTTTGCTTATTGCCCTCTTTTCTCGTGATGAAATTT
TATTCTCTCTCTCTTTCCTGGTTGTGGATAATATAATGGAGCATCAGACTTGCCCTCTGT
GTCTTTTCCCTTTGTTTCGCTCTCCTTTTGTACTTGTTCTGACCATCTCTTCTGAATCTC
AGGAAACAGGAGAGAGAATAGAGACTGCTGGGAAATACTCTAGGGGCAAGCTTAGGAAAT
TCAAAGGGCCCTCTACCCAAAGGAGCCCCTCCACTTTATAGTTCTAGGTCAGCCGGGAGA
GCTGTGGCAGCTGTAAGGCTGCATGGAGTTTATCCCCTCCCTGAGGTGGGGCCCAGGTTA
GAACCCTGGTTTTGTTTGTGTCTCACTCTGCCCCCAGGCCAGTGCTAAGACTTTTCTCAA
TGATCTCACTTTATTCTTCTGAACTTAGACTTTAATTTTATGATCTGTAGGTCTGGGATC
TCTTGAAATCAAGACAAAGATTTTTATAAACTTGTGTGATTCTGTGCTTTTGGAAAAATA
ATTTTCAATGTAAGCCAATATAATAAAGGGTAGCTCTTCGTCAGCGTGGAGTGACAGAGA
ATTGGGGAAGCCCTTTATGAAGGTGCCCATTCCCGGTTCTGTTTGTCCTAATGTCCCTAA
GATGTCCTGTCTTCCTTTGCCTGTGTGCAGAGTTTTGGGGACAGAGATGTGGGCCCATCT
GTGAAGGACTCCTCTGATGAGAAGAATATGGTAGTACCTTGACATGAATTAAGGGCAGGA
ATGAGAAAAATCCAGATGGTAGAAGAGATCATCTTGTTCACTTCATTCTGTAGGCAGATA
ATTTAATTTAACAAAGTATATTAAATTTTTTTTATTAGTTGTAGATTTACAGAAAAATCA
TAGAGAAAGTACAGAGTTCCCATGCACCCCCTGCCACACACAGTTTTCCATGTTAACATT
TTGCATTAGTGTGGTATCTTTTTATGATTGATGATTCAATATTATTACAGTTACATTATT
AACTACAGGCCATAGTTTACATTAGGTAGTTCAGTCTTTGTGTTGTCCAGTCCTTTGCTT
TTTTCCCCAACTAAGTATTGTTGCCTATTCTGAGTGCTAGGAATACATCACTGGACAAAA
GATAGGGCTCCTTGTCTTAAAAGAGCTCATATTCTAAGTGAGAGGAGACAGAAAATGAAC
AATAATCAAAAATCATGCGTATAGTGTTGTGGAAGATGAAAAGTGCTATAGGGGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGT
AATGGAAGAACTTATAACATTAATAAAGACAATGGTCATCAGAGGTTATGAGGGGAGGAA
AAGGGAAGAATAAGTGTAACATAGAGCATTTTGGGGACATTGGAATAGTTCTGCATGATA
TTGCAATGACGGCTACAGACCATTATACATTTTGTTAAAACCTATGAAATTGTGTGGTAA
AAAGTGTAAACCATAATGTAAACAATAGACCTTGGTCAGTAGCAATGCTTCAATATGTGT
TCATCAATTGTAACAAATGTACTCCATTAATGAAAGATATTGTTAATGGGGGAAGTATGG
GATGGGGAGGGAATGGGGTATATGGGAATCTCCTATATTTTTGATGAAACATTTACGTAA
TCTAAACCTTTAAAAATAAAGAATTATTTTTATTTTAAAAACTATAGTCCATAGTTTACA
TTAGAGTTCACTGTTTGTATTGTATAGTCTATGGTTTTTGTTTTTAAATTTTATTTTAGG
GTATGTATGACCTTAAATTTCCCCTTTAACTACATTTAAATTTGGTGATGTTAGTTGCAA
TCACAATGTTATACTGTCATCAGCACCATCCATTACCAAAACTTTTCCATCATCCCTAAC
AGAAATTCTGTGTCAATAAACATTAACTCACCATTCCTGACCCCACACCACAGCCTCTGA
TAGCATGCATTCTAGTTTCTTACTCTACGATTTTGCTTATTCTAATCATTTCATATCAGT
GAGAACATAATATTTGTTCATTTTTATCTTGCTTATTTCATTCAACATGTCTTCAAGGTT
TATCCATGTTGTTGCATGTATTAGAACTTCACTTCTTTTTATGGCTGAATAATATTCCAT
TGTGTGTATATACTGAATTTTATTTATCCATTCATCGGTTGATGGACACTTGGGTTGCTT
CCATCTTTTGTGAATAATGCCACTATGAACATTGGAGTGCTAATATCTGTTTGAACTCCT
GCTTTCAAATCTTTTGGGTATATACTTAATGGTAGGATTGTCAGGTCATACAATAGTTCT
AAACTTAGCTTTCTGAGGAACTGTCAAACTGTCTTCCAGAGCAGCTGCACCATTTTACAT
TGCCACCAGCAGTGAATGAGTGTTCCTCTTTCTCTGTATCCTCTCTAATACTTGTTATTT
TCCATTTTTTAATAGCATCTATTCTAAGGGGATGAAATGGTATTTCATTGTGCTTTTGAT
TTGCATTTCTCTGATGGCTAATGATGTTGAGCATCTTTTCATGTGCTTTTTTGCCATTTG
TATATCTTCTTTGGAGAAATGTCTGTTCAAATCTTTTGCCCATTTTAAAATTGTGTTTGT
CTTTGTTGTTGAGGGATTTCTTTAAATATAATGGATGTTAATCCTTTATTGGATATGTGG
TTTTCAAATTTTTTATCCCATTGTGTAGGTTGTCTTTTTACTTTAAGAATAAAGTTCTTT
GAGGAAAAACAAATTTTTTTTTTATTTTGAAGAGGTCCCATTTATTTATTTTTTCTTTTG
TTGCTTGTGCTTTGGGTGTAAAGCAGGGGTTCTTAACAAGGGGTCTGTGAGCTTAAATTG
AAATGGAAAAAAATATTACTCTTGTGGGGATGTGTTGGTGTGGGTGTGATAAATTTATTA
AATACACAGTCTAGTCTGGACTTAGTAAGGGATCTGTGCCTCTCACCTGATTGGCACAGG
GGTCTGTGGAACAAAAAAGGGTAAGAACCCCTGGTGTAAAGTCTAAGAAACCATTGCCTG
ACACAAAGTCCTGAAGATGCTTCCCTACATTTTCTTCTAGGAGTTTGATAGTTCTAGCTC
TTATATTTAGGTCTTTGATCCTTTTTGAGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTCAGAAAC
TAGGAAATAAGTTTATTAGAGGTTAGGAATGAGAGGTAAGGAATAGGGAGTTAATTAATG
GGGTGGCAAGAGTTTCTCTTTGAAGGTGACAGAAAAGTTTTGGTAATGGTAACACAAAGA
TTGTAAATGTGATTAGCAGCACTGAATTATGTATCTGAATGTAGTGAAAAGGGGAAATTT
TAGGTGGTCTATATATGCTGCTAGAAGAAAAATTGAAAAAGAAACATAAATCAGCCATAG
GGCTGTACAACACAATAGTCAGCCCTAAATGTAAATTATGAACTATAGTTAAATAGTTCG
GAATTAAGATAATATTGGGGAAGCGGACTTGGCCCAGTGGTTAGGGCGTCTGTCTACCAC
ATAGGAGGTCCACGGTTCAAACCCCAGGCCTCCTTGACCCGTGTAGAGCTGGCCCTCATG
CAGTGCTGATGTGTGCAAGGAGTGCCCTGCCACGCAGGGGTGTCCCCCGCATAGGGGAGC
CCCACGCTCAAGGAGTGCACCCCGTAAGGAGAGCCATCCAGTGTGAAAGAAAGTTCAGCC
TGCCCAGGAATGGCGCCACACACATGGAGAACTGACACAACAAGATGACGCAACAAAAAG
AAACACAGATTTCCGTGCTGCTGACAACAACAGAAGCGGACAAAGAACTACGCAGCAAAT
AGATACAGAGAACAGACAACAAAAATAAATAAATCTTTTTAAAAAAAAAGAAAAAAAAAG
ATAATATTCACTCAACCATTGTAACAAAGGTACCACACTGATTTAAAATGTTAAAAATCG
GTAGGTATGTAGGATCTCTGTACTTTCTGTAAACCTACAACTTTATTTAATAAAAAAATA
AAAATAAAAACTAGAAAATTCTCTTGGAAGTAAAAAAATTACAGTAACCAAAATTAAAAA
GTTAAGACAAAGGGTTAGCAGGTAAAGTTGAAAAACAATCTCCATGGAAGAAGAATAAAA
AGAAAAAGAGGGGGAAAAAAGGAAAAGGAGAAGAAAAACAGAAAAAGAAAAGTTATAAAA
ATGAGAGAACCAATCTCAAGATGGGATTCTACTAATCCAGTTTTTTTGCACATTTCTAAT
GTGTTTAAATTAATTAGAATTATGTATATACTTGGAATCCTTCCATCACACACATACTAT
ACGGTGATATTCAAATATATGATACTAAAATAACTTACTGGCAAATTCTAATATTGAATA
CACAGAATAGTTCTATTCTCTATTGATAAAAAACAAAACTACTGAGTATATTAGAAAATT
TAAAGCCATTATTTCACAATTTGGAAATCTGAGTAATTCAACTTTAAGTTGAGTTTTTCA
CTGTTGAACTTTGCTCTGTCGATGTGTGATTTGGGACTTCCTCTTGTCAAGCCATTCTTG
CACATGATGCTCCTTGGAGGTGCGACCTTGCACTTGTCCTTGAACTGTACCCTGGTCAGT
GGTCTGGATCCAGCCTACCAATCCCAGCTTTTTACCCTCAGCATTTCAGGGCTAATCGAA
TGGACAGCACACCCAGGGCCCCATCCTGGTCTCACCCTCCTCAACTTCCTCAGAGGCCAC
CTGGAACCCCCTTAATACAATTTCGAGGAAAAAGAAAACCGGGGTGGGGACAGAAGTGAC
TCAAGTGGTTGAGCACCTGCTTCCCGCATGGAAGTTACCAGGTTTGGTTTCTGGTGCCTC
CTAAAAACAAAAACAAACAATAAGCAGACAAATGAAAAAACCAACTGAGGGAAGCCAGTG
TGGCTCAATGGTTGAGTACTGGCTTCCCACTTACAAGGTCCCAGGTTCATTCCCCAGCCC
TAGTACCAAAAAAAAAAAAAAGACAACAAGTAGGGAAGTTACCGAAGGGGAAAAACAAAA
AGATTTCCCAGAACTGAAAAATAATTGTAGATTAAAAGGGCAAGTACACAGCATGGCAAA
TGAAAAAGATCCACATCAAAGCACATCATCAGGAAATTTAGAATACCAGGGACAGAGACT
TCTACAACCTTTTGGAGAAGAAAAATAGATCACATACAAAGAATCAGGTCTCAGAATGAC
ACTGCCTTCCTCACAGCTGTAATATTGGAAGGAACTAGCTAGCTCTGTGAAGCAATGCTT
TTTTTAAAATTGAGGGAAATTTTTTTCCAACCTAGAACTCTATATATTTAGCCCACTTTT
TGATAAGAGCTGGTGTGTAGGTTCTTTGCTTCATAGTGAGAAATAATTCAAGAAGGAGCC
ACAAATTAATCAGATAAGCAAAGAATTTATTGGGGTGTAAAGCAAGATAAAGTACACCTT
CAAGAATGAAGGGGGGCATTCTCAAGGGAGAGAAATGTGAAGTTCTGCCCTGGCGTCCCC
TGTTTTATGGGGGTACAGGACTCCAGGGCCTGCACTGATTGGCATATTTAAGGCAAAGCA
GGGGAACGCTGTTGGGTGGTTTGATTTGCTTAGGGGTGTGGGGTTTGCTGTCCGGTGACG
ACTGGCTTCTGGCTGCTGTCCACAAGCTCTGCAGGCATTGGCCGGTGGTGACTGGCCTCT
GGTCACTGTCCACTAGACATGAGGTAACCTGAAAGTGGGTGTGGAGGGTGGAGCCCCTCC
TACCCCTTCCCTCTTCCCCACCGTGTAATGATGTTGCTGGCATGCGTTCTGATGACTCAG
CCCTTGGGTGTGTGTGTGCTTGTAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATA
GAAAGAAAACCAGCTCATCAATAATCAGTACCAAAAAAGAGGGAAGAAAACACAAAATAA
ATGAAAATAATCAGTACCGATAAAATCATGAAATACTGATTTAGCCAAAAAAGCATGCTA
TAACTGTGTTAGAAAGTTGGAGAAAGATGGAGAAAGAAAAAGTAGGGACATGAGGTGGTG
TACAAGTGCTAACTCCTCATTTTCTGTAATAGGAAGTCAGATAATTTTTTTTTTTTTAAA
GATTTTATTTATTTATTTAATCCCCCCCCCTCCCCTGGTTGTCTGTTCTTGGTGTCTATT
TGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCATCAGCGGCACGGGAAGTGTGGGCG
GCGCCATTCCTGGGCAGGCTGCTCTTTCTTTTCACGCTGGGCGGCTTTCCTCACGGGCGC
ACTCCTTGCACGTGGGGCTCCCCCACGCGGGGAACACCCTTGCGTGGCACGGCACTCCTT
GCGCGCATCAGCACTGCGCATGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAA
CCGCGGGCCTCCCATATGGTAGACGGACGCCCTAACCACTGGGCCAAAGTCCGTTTCCCA
AGTCAGATAATTTTTAAAGATAAAGCAAGAAATCTTATATGCAGGATATTTGGTTTTGGA
AGTAGGGGTATTAGGAGGGGTGAGGAATGAGACAGAGAGCTGCTGTGTTCCACTGTAAGC
CCAGTAGTTACTTTCTGGCTTCTGAAACTGAGTATTACTACCTATACAAATTGAATTTTT
AAAAAGCTAAATATACAGACAGAAATGGGGTAAGAGCTGCAGATTCAGGTTTGAGAGTCA
TTTGCATATAAGGTTCCTCAGGGGAGAGCAAAAAGCCTGAGAAGAAAACTGAGGCAGAAG
CCTGAGAAACACCAGTGCTTAATGAAAAAATGGGATTGGGAAGTTATTTTCCAAATTTTC
TAAAATAAATGTATTTTACTGTTATAATTAGGAAAAAAGTATTAATAATTTTTCAAAAAA
GTGTTGACTGGTAATGAGAAGGTAGAAGGAGAAAAGATAGAGCATAATGTGATGGAAGCC
AAGTCAGGAGAGAATTGCCGAAGAAGGGAGTGGTAAACAAGTGCTAGATTCTGGGTATGA
ATTAGATTGCCTCAAAGAGGCAACTGAGGTTGGTTAGTAGCCATCTTTGGTGATCTTAGC
AAGGAGAAGTCAGATAGCAAGTAATGGCTCAAAGAGAGATTGGGATTTGAGGTCAGAACC
TTAAGTATCCATGACCTGCTCAGAAAGGTTGATGGTCAAAAGCCAAAAGAGAGGGCAGAG
CTAAGGAAAAGGCAGGGATCATAGAACATTTTGGAGAGGCGGAGGATTGTTTTTTTTAGA
TAAAGGGATGAAGGAAAATAGCTAGTGAAATGGGAGGGATTGAATCTACAAGAGACGGAA
AAAGTGTGTGTGTATGTATGTGTATGTGTGATTGATAAAGCAAAACTGCTTTAGAAGTCA
TTCTGCTCAGATTTGTACTGTATATTGAAAACATAATACACCAGATAATTATTTGTATTG
ATGCTACTATTTGGGGTAAGAAGCCTAAGGTTGATTTCATAATCATCTAACACTTGGTTA
TATGTAGTGTCTATTTTAGATAAGGCCCAAAGCAGTTGTCCTGACTTGTCATCAGAAGGC
ACATGCTAGTCAGTAGCAGGCAAATAGCACTTCCTCCCTTTATTTAGAAGCATTTCTTAA
AATATTTCTCTGGGAGATGATTAAGAGATCCAGAGAAGCTTAAAGTAAAAATAAAGAGGA
ATGTTCCACTGGAAATGTTTCTTGAATTTTTCAGATAGGATCTGAAACCACAGTGTCAAG
TATTTGAGTACAGGATTTTGGTTTTCGGTACAGAGCTTCCCAGGATAATATATGGTGATA
GTTCATTAGTTATATCAGCCTTGCAGAGAACAACTTGGCAAATAAGAATTATGTTCTCTT
CCGGGAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGTCTACCATATGGGAGGTCCGCG
GTTCAAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCATGCGCAGTGCTGATGCACG
CAAGGAGTGCCTTGCCACGCAAGGGTGTCCCCCGCGTGGGGGAGTCCCACGCGCAAGGAG
TGCGCCTGTGAGGAAAGCCGCCCAGCGTGAAAAGAAAGTGCAGCCTGTCCAGGAATGGCG
CCGCCCACACTTCCCGTGCTGCTGACGACAACAGAAGCGGACAAAGAAACAAGACGCAGC
AAATAGACACCAAGAACAGACAACCAGGGGAGGGGGGGAATTAAATAAATAAATAAATCT
TACAAAAAAAAAAAAAAAAAAAGAATTATGTTCTCTTCCAACCTTGTAGTTTGAACAACC
ACCACCAAAAAAGAGTGGGGAGGTCAGATGGTGCTATTTAAATTGAACTGTTAATGAATA
TTTCTGCTGTTGGCTTAGGGCTCATTGGGAGAGAGAACTATTGCAGATTTTGTACTTTTT
TTTTCCCCACTTTTTATTTTGAAAAACTTCAAACCTTATGAAAAGTACAGCCATATACCC
TTCACCTAGATTCATTAGTTACTAATGTTTTGCCACATTTGCCTTATTCCTTTTTCCTCT
TTATAAACAAGTATATGTATATATTTCTTTTTCTGAATCATTGAGAGTTACTGGCAAATG
TGATATGCCCCTCCTAGTATTTCGGCAGTTAACTCCTATGAACAGGAGTATTAATTACAC
TATATGATCACTATATAATTATAGCATTCAGGAAATTTAACACTGATACAGTACAGACTG
CTGCTTCCAGCAGTGATGAAGTAGACCAAATTTACTCCCCCTCCTTAAACAACTAAAAGT
CTGGACAAGACAGATAAAATAATGATTTTCAGATTTTGGACAACAGGCAGCATAGGATAG
TAATCTCTGAGAGAAGGGAAACAAACAAAGTGAGCCCTATAATTACCCCAGCTTACTGAC
CAGAGATAGTTTCCAGGACACAGTGAAGGGAGGAGAAAACCCAAATAGAGCTCAATAGTC
TCTCTTAGTTGAAGGAACAGAGTTGAAAATCTGGGGAGGCCAAGCAGCTATTGCTCAGAG
AGCAGAGTACCAGAGAGAGAGCTGTGCACAGAGAGACCTCCAGAGATCTGCCGAGTTTCT
CTCATGTCTTTAGCTGAAGACTGATCAGTGTGGTATGTGAAGAAACTACCCAAAGCTGGG
GAAAGTATGCCAAAAAGGAACAGGCAGAAGTCCTCAGAGCTCATACCAGGCCAGGAATAA
TTCATGTTCCCACCAGCCAAGGATTGAAAGTCCTGGTAATACATGGGGCATCAGGTAGAG
TACCCAAAAAGTACTCTCAGTAGTTTGGCCAAAGTAGCCCTAGATTAAAAGAGATCTGAT
CCTGCCTAACAAAGCTTAGAAGTAAGCTTTGAAAGGATCAAATTGTTTCTAAGTCAAGGG
ATTTTGTCTCAGAATAAACCTCAAGAATATTTAAAGGAATACAAAACTATTCAGCACCAG
CATGATAAAATCACCATTGTCTCATATCCAATAAGAAATTACCAGGCATAGTAAGAACAA
TCAAGAAACAGACCTCGAAATGTACATATAATAGGATTAATAGACAAGAACATTTAAACA
GTTACTATAAATGTATTCCATATATTCAGATGGTAGAAGAAAACATAAGCAAGCATGTTA
AAATATGAAAAAATCTCAAAACTTCTAAAGATAAAAAAATGGTCTGAGTTGAAAAATATA
CTAGATGGGATTAAGAGCAGATTAGACATTACCAAAGAAAAGATCACAGAACTTGAAGAC
ATAACAATAGAAATAGTTCAAAATTTAAAAATAGCGGGTGGGGGGAAGAAAAAGAAAACC
CACTGTACTGGTTATCAATTTATTGCCTAAGCCCCAAATTCACCTTTTTTACCTGCTCTG
CGATAAATGAACTAGACCTTGTAAGTATTTCCTTTTCCAGCCAGCAAGTTATTAGGCATT
GTCAGCAGGGTGTTGGAGAGACTTCAGATGAGGAAGGGGCTTTCCTTCCTAATTCTAGTG
CAGCTTGCTCTTGAAATACCTGGAGAACACTTGTGTTTCCCCTGCTTGGCCCCTGAAGTT
TTCCAGTGCTAAGTTCCTGCAGCGCACAGCTTTCTACAACATTTGACTCCTGCAACACTC
TCTTTGTTCTGCCATGCTCTCAATTTGGGCAGAAACAATGCAAACCAGAAGACAGTGGAA
CAACATCTTTAAAAAACTAAAAGAAGAATCTGTCAGCTAGAATTCTATACCCAGCAAAAA
TATCTTTCAAAACCATAATCCAATATTACAAGACCCACATTCAAAATTCCCTAGTTTCCA
AATAACATTCTTTATACCTGATTTTTTCCCCTTCACTGTGGGATCCAATCAAAGTTGTTC
CTATTGTGTTGTTATGTCTCTTTAATCTCCTTTTATCTAAAACAGTCCCCAAACTTTTTA
TTTTTCATAACATTGATATTTTGTAAGAAGTCAGGCCTGTTGTTTTGCAGAATATCCCTC
AATTTGGATTCTGTTCCCTCAGGTAAATATTTTCAGTAAGGCTACTTCATCAGTGATATG
TCCTTGTCAGTGTATTTCATTGGGGCACATGATGTTCATTTGTCCCATTTTTTGGCGATG
TTCCATTTGATCACTTGGTTAAGGTGGTATCTGCCAGATTTCTCCATTGTTAAGGTCCCT
TCTCTCCTTATAGATACCTTTTGTGGGATGATACTTTGGAGACTCTGTGGATATTATCTT
TCCCAACAGGCTTTCATCCATTGGTTTTAGCATCCATTCATGATTTTTGCCTGTGTATTC
GCTTTTAAGGAAACATTTTGGAACAAAAGAAAAGTGATTCCTGTTCAAATTTAAACATGA
TAATCACTTTAAATGTGATAATCACTTTATATTTTTTTTTAAGATTTATTTTTTATTTCT
CTCCCCTTCTCTGCCCCCTAGTTGTCTGCTCTCTCTGTCCATTCACTGTGTGTTCTTCTG
TGTCCACTTATATTCTTGTCAGCGGCACCAGGAATCTGTGTCTCTTTTTGTTGCGTCATT
GCTGTGTCATCTCTCCATGTGTGTGGCGCCACTCCTAGGCAGGCTGCACTTTTTTCGCAC
TAGGCAGCTCTCCTTATGGACACACTCTATTTGTGTGTGGGGCTCCCCTACGCAGGGGAC
ACCCCTGCATGGCACGGCACTCCTTGAGCACATGAGCACTGCACGTGGGCCAGCTCATCA
CATGGGTCAGGAGGCCCTGGGTTTGAACTGTGGACGTTCCATGTGATAGGCAGATGCTCT
ATCCATTCAGCCAAATCCGCTTCCCACTTTATTTTCTTAATCATTTTCATTGGTTATTTA
GTTGATGAAAACTGTAATGTCCATTTGGATTTTTTTTTTCTTTCAACCCAGACATCTGAA
GGAAATTATGCCACATGGAAGCTCAGCTTGCCTGCCTTCATAGGGAAGCTATATCCTCAG
TTGTGGTTTTTGGAAGCTGTATTAGTCAGCCAAAGGGTGCTGATGCAAAATGTCAAAAGT
CTGTTGGCTTTTATAAAAGGTATTTATTTGGGGTAGGAGCTTACAGATACCAGGCCATAA
AGCACAAGTTATTTCCCTCACCAAAGTCTATTTTCACATGTTGGAGCAAGATGGCTGTCG
ACGTCTGTGAGGGTTCAGGCTTCCTGGGTTCCTCCCTTACAGGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGGACTTAGTAAGGGTTC
CATGATTTTCACCTGACTGGCAAAGGAGTCCATGGAACAAAAAAAAGTTAAGAACCCCTG
ACTAGCCCTTGTCTATGCTGACCCTTGACTCAGAAGGAAGAGCCCTGGCCCGTGACCTCC
TTTGATAGCACCTTCCCTTCCTCCTTGCAGAGGACCAGCTCTTGTCAGCATCATTCCCAG
ATCGCAGGAAGGCACCCCAGAAAACAGACTTCCTGTTGGAACACTTCCAGCTGATGCATC
TCTGCCTCTCCTGCCCAGTCCAGCAGGAACTCATCTTGCTCACATTTCAACAGTGCACGT
GGGAGCATTTGTCTTGATAGCCTCTGAGATCATCCTGGCACCAGATTCCCCAATATGGTT
TCCCTGGAGACTAGAAAATAAGGGTTGGGGCAGAGCTTAGAGAATTGGCTGGAGGGCTAA
GGGCTTGTAGTTTCTCTTTCATAGAGTGGATCATCATTCTATAATAAAATGCAGAACTCA
ATGAGAAACTTTGTGCTTCCAGAATGCCTCATGCTGAGTTTCACTCCAGAGCTGCTGAGG
GCATTGGGGTCAGCTGGTTCCCAGAATCAGGGGCCAGGCAGGGCTGACCTGGGAGGGGTT
CTGAGGGTGAGCAGGGATGCCAGGGAAGGGCATGGGTTGCTAAGCCCACTCACTTGATGT
ATTGGAGTCCATGGTTTCCAGACAGAGCAGTGGCAACACATATGGCCCCATCCATCCCCA
GGGAATTCTCTTGAAGACTAGACAAAGAAAAGATGGAGACACCACAGTGAGACATTCAGG
ACAGAAGAAAATGCCAGAAGAAGCAACACTCAGTTATCTTGTACAGGCAGTAGAGTGACC
TGGAGCAGGTCTGGGGTTGATTCTGTTACCATAGCAACAGCAAGGTGGCATTTAACCCTT
GAGACCCTAATGTCTACAAGTAGCCAACTGCCACGGACTGCTGAAAACCATAAATGCAGA
TGAGACTTACCACTGGCTTAAGCCAGAGGAATGAACAAAGCCATCTGCAATGGAAGATGG
ACTACCCCGGCCGGAACAACCCAAGTTGTTCAGGAGGAAAGAGCTGTGGAGAAGCTCAGC
AGCATCTGTGCTGTGGGGACCCAGCAGAGAGGAAGGAGTGCCGCTCCGGCCGCAGGCAGG
TCTCCCAGCTACTTACTTGAGTCCTCGGAGACTACAGTTGATCTTCAGAGCATTCGCCAG
GGCTTTGGCTCCCGCTATCCCGATGGCATTTCCTCTTAAGCTGTTGGGAAAAACGGGAAA
CCTAAGGCGTGGTGACAGGCTGAGAGGTGAGAAGGAGCCCCCTTCAGATGTGTGGGGGCA
ACTTGAGAGATGAAGCCCAGGCTTCCACAGTCCTGCAGGGCGGGGATGCTCCTTCCTCGC
TGCCTGGGTCAGCAGCCCAGAATAAAGGGTCACAGAAGGAAGGAGTGTGGCTGGCCCTTG
GGGGTCTGTTGAAGCCCACATCCTCCTTGTTAGTCCAAAGAAGGGAAAACCTGGTTAAGA
CGGGAGAGACAGCACCGCCCAGTGGGGCCCTAGCACACCCTGCATCGTGGGGGCCTCAAG
AGCAGGGAGCACCTGGGCACCCAAGGGCCTCACAGAGTCTGAGGCTAGCCCACTCCCAAG
ACTTTGGATCTTCTCACAGACCAAAGACCTGGCCATCCTAGGGGCTCTTCCACCTGGGCA
AAGCCAACCCAGAGAGCAGGAACGTAAGGAGACGCAGGCAAACGACAGCGACTCCCAGGG
AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTTACTAGTTTT
AAGAGCTTTTTTTTTTGTGGATTTTTCAGGATTTTCTGTGTATGAGATCACATCATCTGC
AAATAGAGAAAGTTTTACTTCTTTCTTTCCAATTTGGATGCCTTTTATTTATTTTTTTTG
CCTAATTGCTCTGGCAAGAACTTCCAGTACAGTGTTGAATAACAGTGGTGATAGTGGGCA
TCTTGTTTTGTTCCAATCTTAGAAGGAAAGCTTTAGTCTTTCACCATTAAGTAGGATGTT
AGCTGTGGGCTTTTCCTATGTGCCCCTTATCATGTTGAGGAAGTTTCCTTCTATTCCTAA
TGCTCTAAGTGTATCTATCAAGAAAGATGCTATATTTTGTCAAATGCCTTTTCTACTTCG
ATTGAGGCAATCATGTGGGGTTTTTTTCCTTCATTCTGTTAATGTGGTGTATTATGTTGA
TTTTCTTAAGTTGAACCAACCTGGCATAGCAGGGATAAATCCCACTTAATCATGGTGTAT
AATTCTTTTAATATACTGTTGGATTGAGTTTGCTAGTATTTTGTTGAAGATTTTTGCATT
TATATTCATTAGCAATATTGGTCTGTAATTTTTTTCTCTTGTGGTATCTTTATCTGGCTT
AGGTATGAGGGTGATGTTGGCCTCATAGAATAAACTATGGAGTGTTTGCTCCTCTTCAAT
TTTTTGGAAGAGTTTCAGCAGAATTGGAGTTAAGTCTTCTTGAAATGTGGTAGAATTTCC
TTGTGAAGCTCTCTTTTCCTGGGCTTTTTTGTTCGGAGGTTTTTAATTACTAATTCAATC
TCTTTACTAGTAATTGGTTTGTTGAGCTCTTCTATTTCTTCTTGAGTCAATTTAGGTAGT
TTGTATCTTTCTAAGAATCTGTTCATTTCATCTAGGTTGTCTACTATATTGGCATGCAGG
TATTCATAGTATCTACTTATAGTCCTTTTTATTTCAGCTGGGTCAGTAGTAATGCCCCCT
GGATAATTCTGCCTCAGGGTCTCCCAAGCTGTGGCAGGTGCTGGAGTCATCAAAGTTTCT
ATTGAGGCTGGGGGATTATTGCTTTCAAGTTCACTCACATGGTTGTTTGCAGGCCTCAGT
TACTGACCACTTGGGTTTCTCCATGAGGCTCCTTGTCAAGGCAGCTTGGGAGGCGTGGTG
CCATTCTCTTGGTGGACAGCCAGCAAGTGATATGCTAGAGCCAGCTCATAGAACATGTGC
CAATGGCTGGCATCTTTTCCTAACTCTTCATTCAGTAATGTTATACTAGTTAGCCTGAAA
TCAGTCATGGTGGGAATATTTGCATTATGAAAACCAGCAAATGGGACAAACCACGGCTTT
TTGTGCAGAGAGCCTGTTCTTAAACATTTATTAGCACACCACTGGCCATTGTTGATACCT
TCAGTGGCTCCCAAGTTTGCCCTCCTGGCACTGCAGAGCACAACTCTTCTCTCCATGGCC
AAAGAAAGCAGAAAACTTTCCCTCAGTGCCCAGCTAGATCCAGCTACTATTTCTTTTTTT
TTTTTTTAAGATTTATTTATTTTTATTTAATTCCCCGCCCTCCCCCCCACCCCGGTTGTC
TGTTCTCTGTGTCTGTTTGCTGTGTCTTGTTTCTTTGTCTGCTTCTGTTGTCGTCAGCGG
CACGGGAAGTGTGGGTGGCGCCATTCCTGGGCAGGCTGCATGTTCTTTCGCACTGGGCAG
CTCTCCTTACAGGGCGCACTCCTTGCACATGGGGCTCCCCTACACGGGGGACACCGCTGT
GTGGCATGGCACTCCTTGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACACAGGTCAA
GGAGGCCCGGGGTTTGAACCGCGGACCTCCCATGTGGTAGACGGATGCCCTAACCACTGG
GCCAAGTCCGTTTCCCCCAGCTACTATTTCATTGCCCTTTTATATTAGGAGCTAAGCAAA
GCTTTTTTGTGGACTAACAGTTACTATTTTTCCAAATTGACTTCTGAGTCAGCTAATGAA
AACAGCCACCACAAACTTCTCCAATTCCATCCTGCCAAACCCGGGTAACTCCTAAGCACA
TGGAAGTCAGATGCCAAGCTGTGAAAGCTTTTTGTCCATACTGTGAAAACTCTCCTTCTG
TAGCTTTCCATTTGTAAATGGTCAAGTTGCTGGCCTAAGACTCTAAAATAGAGTCAGAAA
GTAATATCAATAGCTGTTGCATTGAGAATGGCCTTTCACATATATTTATATGGAATTTCC
AATGGACTCAGCCTCCTCATCTGATCAAGGAGCGGGAGTTCTGATGGCAGAGCCATGCAC
TAAGCAGAACATATTTATTTCCCCGTAATCAACCAAGCATTTGCAGCTACTTTGACAGCT
GGCAATTCAATATTTTAGTTTCACATGCCGGAATGGTGTTTCTAATACATCTGAGTCACT
TTTTTCTTGCTTCAGAAAATTGTTTTAAAAAGACAAACAGCGTATCATTGTCTTTTACTT
TTTCACTGAGTATCTACAGGCAAATCCAGAGTGACTCCGCAAATCTAATGCCTCAAAAGA
AAGGCCGAGAAGTGCAGATGTCTTTTGAGCAAGAGCCTTACCTACAAGAAGCTTTTCATA
ACTGTAATATTGGAGCCACTCTTTTGATTTTGCTTTCCTTGTGTTCTCACCAGGTAATGA
TGATTCTGACATCGATATCCAAGAGGACGACGAATCTGACAGTGAATTGGAAGAGAGACG
ACCGTCAAAGCCGCGCACGGCCATGGAGGTGCTCATGCAAGGTAACAGGCTTTCTCTGGC
CACCCTTCTCACGCACGTTCTCAGGAGCACCACAGCAAGGGCTGCATCGGGCCACTTGCT
GTCCAGGCCACAAGTGTCTTATGAGTGGCCCCTTGAAGTGGTCTTTGCTCCAGCGCTTAG
CTGTCCTGTCATTTATCAGCATTTGTCCCTTAAACTGCTCAGTGGTGATCTTTGTTACCA
ATAACGTGGTACCAAGAATAGCGGTTTCATGTTTGTGACTTGGTGTTTCTCACACAGGGC
CTCAGAAACACACTTTCCTATGCCACCAACCCATATTCTGCCCATTTGGGGTCCTAAACT
GTTCTCAGTGCAGTTGAGCCCTTATGGTAGAGTACTGCATCAGAGACTTACCTGAGCCTC
TTCTGTCTTTAAAAGTGTTCTTCTCATTGCAAAAAAGTCAATAACCCAGGGTGTTCTCAT
CTCCCACTCAGCCCATTCCCCACCCTTTTAATAGGGTCATGGCCAGTGGCCTGGGGTTGT
GTCCTAATGAGTTGTCTTCCCACACTTGTGTGTACTCATATAATCCAACTTAGAGAGAGC
ATCACATTTTTTAAAAACCTAACTGGTATCAGGCTATATATATAATTTTTTATTTTGATT
AAGCATTTTGGAACTCTTCCAATGTCAGTAAAATATAGATCTACTTCTTTCTTTTGGACA
GCTGCATCGTGTTTCATAGTATGGCTGTGCCAATGACATACTTGGGCATTCTCCTATTGA
TGCACATTTAAGATAGCTCTGCTCTTTTCCTGCAAGATACCTCTTTCTTCATATATGCAA
GTAGTTCTTTAGGTTGTATCATTAAAAGAGGAATTCTCGGGAAGCAGACTTGGCCCAGTG
GTTAGGGCGTCTGTCTACCACATGGCAGGTCCGTGGTTCCCAGGCCTTCTTGACCCGTGT
GGAGCTGGCCCATGCACAGTGCTGATGCACACAAGGAGTGCCGTGCCATGCAGGGGTGTC
CCCCACGTAGGGGAGCCCCACACGCAAGGAGTGCGCCCCATAGGGAGAGCCGCCCAGCGT
GAAAGAAAGTACAGCATGCCCAGGAATGGCATCGCACACACACAGAGCTGACACAACAAA
AAGAAACACAGATTGCCGTGCCACTGACAACAATAGAAGCGGACAAAGAAGAACACGTAG
CAAATAGACACAGAGAACAGACAACTGGGGTGGGGAGGGGGAAGGAAAGGAAGAGAAATA
AATAAATCTTTAAAAAAAAAAAAGGAATTCTCAAAGGTTATATACCTTTTTACTTTAATA
GCTAGTACTAAATTGCCCCATATTTATGTCTAAGCATATTTATTTGTCTACCACCTGTTA
GTTGTTTTTTCTTGTTGTTATCGTTGTTGTTCACCTGTTAGTTTTTGAAGCTAATACCAT
TTTTTATACACATAATAAATTTAAGGGGCAAATCCTCTTTCCTTCATTATTTCATATTAA
CTTTTGTTATTAAATGCTTTCTCTTAAAAAAAAATTGCTTTCCCCTTATTCTAGGCTCAA
ACTATCTTCACTTATTAATTTGTTTTTCTCATAGCATAACTGTATGCTCTGCTTTCCTGT
TTCTTCATTTTATTTTCTAACAACTTAGTTACATAAATAGAGGCTAGACATTATGAATCC
CACTCTGCAGGTGCAAGGGTACCAAAGGGTCTGTGGTTGGCACAGTGTAACTCAGGAAAG
TCACAGGTTCTCCTAAGTGCTCCTGCTGGCCACTCAGCCTGCAGAAGGAAAACTGCACAT
TCCAGTCCCCAAAACTATAAATAAGTACTTCAGCCAAACACAAGGTTTTGCCTTTTATCT
AATAGAAATAAAATTGCAAAAATAGCACCCACTTGCCTATTTCCAAGCTTGGCCTGTCGG
GCTCCTCTCTGAGCTGCCCTTGCTGCCTTTCTCCCGAGTTCTGGACCTGGGGACACTCTT
GTACTTTCTGAGCCTTGAGGTGCCAGTCCAGCTCTCCATCTCCACTCCATGAAGGACCAC
TTCTGAGCTTTCATGGAAGCAACACCCAGACAATAAAGATGAACTAATTGTAATCCTTGA
AGTTTTTAAAAAATTTCTTTGTAATGCTCAGACATAGATCTAAGTAGAAGTGATTTCACT
TGGTCCATAAAGGGAAAATATCTTTGTCAACAGATAACATACTAGTTCAGCTAATTGAAC
TAATACGGGCCTCAGTTACTTTCCCTAAAACCTTTACGGGCCTCAAAAATTTAATATAGA
ATTACCATATGATCCAGTAATTCTCCATTTGGGAATACCTAAAGAGAATAAAAGCAGGGT
CTCAAAGAGATACTTGTACACTGATGTTCACAGAAGCCTTATTCACAATAGCCAAAAGGT
GGAAACAACCCAAGTCTCCATCAACGAATGAATGGCCTCAGTGTCTATCAACAAAAGAAA
TGTGGCACTTAAACATGGGAATATTATTCAGCCATAAGAAAGAATGCAATTATGAGACAT
GCTGCAACTTGGAAGAACCTTGAAAACATGATGCTCCTGAAATAAGCAAGGCACATGTGG
ACAAAAATTGTATGCTATTACCTAGATAACTAGAAATAGCAAATTCACAGAGATAGAAAG
GAGATTAGGGGAGTAAGGGGCAGGAGAAGGGGGGAGTTTGTTTTCACAGGATGTAGGGTT
TTTTTTAATGATGACTTTTGCTTCTATTTTTTTGCCATTTTCCTTATTTCCCCAGAGTGG
AAGTACAGATAATCCATTGCTATTAGTTGACAGTTCTGATTAATTGGGCATTACTTAAGT
AAATTTTTTAGCATGCTTCCATTTGTCTTTCCCAGCTTTCTAAGGAAACCAAATCCTGAA
AACCGTTTCCTGCCTTGTTTTTGCAAGTCAAGTAGATTTTCATTATTTCTTTATGCTTCT
GTTCTCAGGAAGACCCAACAAGCGCATCGTGGGCACAATGCAAGGTGGAGACTCTAATGA
TGACGTGAGTTCGCCCCACTCCTTGAACGCTCTGAGCTTTCCAGTCTTGTGCTGGCTTAG
GCGGGATTAACGGAGGTGCTGCTAGCAGCCAGGGAACCTTCTGGTCAGCTTGATGCAAGG
TGGCGATCTCAGGCAGCCTGTTACTTTACTTGTGGCAGAGTTTCGCCTCCCCAGGAACTT
AGCTGTTTCCTTTGCTTGTAGATGGCTCATTTCTTTTCTTTTCGAATGAATGCGCTTGCC
CTACTTTTTTGGCCTTCTCATTTCTCTTTCCATTCTCACTTTCCAAAGATGGAAGCAGCA
CCAGCTCACTTAGGTAAATGCAAGACTCTCAGCTCCAAGAAGCAGGTTGGTTTTTTAAAA
AAGATGTGTTTATTTATTTATTTCCCCCCTCCTCATTGTTTGTGCTCACTGCTCTCTGTG
CCTGTTTGTTGTGTGCTCTTTGTGTCTGCTTGTCTTCTTTTTTAGGAGGCTCTGGGAACT
GAACCCAGGACTTCCCATGTGGGAGGGAGGTGCCCAGTCACTTGAGCCACATCCACTCCA
TTTCTTCTCTCTCTCATTGTGTCTCTTCTTTGCATCAGCTCACCGCATCAGTCTGTCATG
TCAGATCGCTATCTTGCTTGTCTTCTTTAGGAGGCACTGGGAACTGTGAGAGGCAAGTGC
CTAACTGTTTGAGCCACATCCACTCCCCCGGGTTTTCTTTTTTATCTTATCCACTTATTT
ATGTCTAAATGGAAGGATTTGGCAGTGCGCGTCAGGTGTTGGAGGAGCGGAGGTGGTTGG
TGCATCTGTGTGTCCTGCAGGGCAAGAAGCCACTCAAAATGGACCTCACCCATGAGTGGT
GAAATTAGCTAGAGCTGCAAAGGAGGAGGGGCCAGAACACTGAGCCAAGAGAGAAGCAAG
GTTGTGGCTGGGGGCCCATGGGATGCCCGGACTGTAACCTAGGAATGAAGGGATGCTGCT
GCGGAGCAGGGCACAGCTGCATTCTGGGCAGGGAGCACCGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 3578..3689, 4628..4712, 5601..5780, 7458..7553, 10724..10807, 14553..14686, 16448..16589, 19112..19184, 64193..64300, 67208..67263
1001..1022, 3578..3689, 4628..4712, 5601..5780, 7458..7553, 10724..10807, 14553..14686, 16448..16589, 19112..19184, 64193..64300, 67208..67263
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved