Dasypus_novemcinctus Locus LAMA2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus LAMA2
Dasypus_novemcinctus
LAMA2
GeneScaffold_7249
SNORA73
601845..602039
700633
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATTACTTCCCCTAACTCCAAAGAAGTTCAGTTAAGAGCTC
AAGACGAGCAGGGATCCTTCCTCACAGGGAAGGATGGTCCTTTTTCCTGGAGGACCCTTT
AAGGCCCGCGCCTGGCGGTCCGTGGGGCAAGAGCCTGGGAAGGGGAGGGTGGGGGAGTGT
CCTTCTTCTCCCCCCACCCTCAGCGGCGGCCGAGCCAAAGCCGGCGGGGGCGTCCCCTCC
TCCTCCCCGGCAGCTGTTGCTCGCGCCGCGCAGAGCCCGGGTCGGGACTGGGCGGCAGCG
GCGGCTCTCGCGCCCGAGGAGGAGATCCGCTCGGGCCCACGATGCCAGGCGGCGCCAGGG
GCCTCCTCCTCCTGCTGCTCACCGGGCTTGGGGCCCTCGGGAGCGGCCAGGCACAGCGGC
CGCAGCCCCAGCGGCACCCCAAGGCGCATCAGCAAAGAGGTACAGTCGAGGCACGGGCTG
TGGGTTCCATCCTCGGCGGGGCCCCGCGGCTCCTGCGCCCCTTCTTTTTCGAGAGCGGCG
GGCCTGGCACGCTCTCTGGCTGGACCCCCGAGGAGCGCGCTGGGGGTGAGAGGGGCTGAG
CTGGAGGCAAGGTCACTTTCCACTCTTCCGGGGGCTGTGGGGGGAAATCGCCCGCACCCC
CAGCCGGGAGATGAAGCGCTTGCCGTGGTCCCTTCGTCTCTGAGATGACTCGCTCTCTCT
GTATATGCAAGATAGTGATTTTCGAAGTCTTTCCAAGAGACGCGCTTTTTCAAATTGAAA
AGAAAAAGTTTCTCCAAGTCGGATTCAATCCCTGCAGAGGAAGGTTTCCCACGCTGTTTG
TTCTTCTGGGAACTTTATAGAGGAAGCTGATAATACCTTTTTTTTTTCTTTTTTTTCTTT
TAAGGGTCTTTGTTTCCAATGTAGTGTGACCCAGGAACAATTTGAACAGAATGTATAAGT
ATGTGGATGTTTTTCTTTCAGGAGAGCAGCCCTTCCAGCCTCACCTTTTCTTTAGTCAAC
TGTCCTATCCCAGGTGTCCTACTTTATATCATAGTGAAATGTCTCCTCTTGCTTGAATAC
AAAAAAGACTTTTATGTCATGCGTATTTTAGTTGAGAACGCAATGAGGAGATATAAACTT
AAGGGGAGTTTTGACGACAGAGTTAAATGTAACAAATTATTCTCCTTAGAGCTCCTTAAT
GTTTATATGCATATCATTTCTGAAACTCTTGGGAACCTCTGAGGAGTTATTTTATTATCA
TGAATTTTAAAAGGAGCACATGTGCAACATTTTAAAATAGGATTTGAAATAAATTCTTTC
AGCAAGTATTTCTGTAGGTTGGAAAATATATATCAAAGTAAAAAAATATTTAAGAAGCGA
TTTTAAATTTAATTTCAAAATGTTTATCCTAAGAGTACAAAATCTAAAGATCAGAAGCTC
TTTAAAGTTTTGAAGAGGCCGAATCTGCTGAAGTTTTAAAATACACTTATTCCTCTTCTA
GTAAACTGGAATAAAGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGCCTGGAGAGACTGATGAAGCTTCACACCCCTTCCTC
CCCTGCTTGGGGTAGAATGGAGCTGTGAGAGTGGGCAGCAGTCTATGCCATGTGGGTCCA
AAATGACCACAGTTATCCTGCAGACTTCTAACTATTCAGTATGTGCCAGCCAAATGTACC
TGCAGTTACCCAGAGAAGCTGGTGCAGGGCCTGCCAGCCTCCTCCCTGCTAGAGGTGGGG
CTGAAGCCTAGGCTAGAGATGCAGTCCAATCTGGGTGAAAGAAGCTGCTCCCTACTGTCA
CTCATTTTCAATCAACCAGGATTCCCCACATGCCAGGGGTGGAGTCAAAATGGTGGCTAC
TGGCCTCTTTCTGACCTGGACAGGTTTAAATTTTAGCTGTTCTTAGGGTTATACTTTAGC
CAGCCGACTTTACTAATCAGTAGCTGAAGTCATCTCTCTCTCCCCTGTTTTTGGGAAATG
GAGCTTCCAACTCCAGCCATAGAATAGCTCCCAAGGCAGCTTGTGCTGAGAGTAAGATGA
TCACCAACCCCTGTGGCGTGGCCTGTATTTTCTTGGAGATGCTGGCGCAGGTTCCCCCAG
TTTCCTCCCTGCTGCAGGTGCAGCTGGAGATTAGGCTAGAGCTGCAATCTGATTTGCATG
GAAAGAAGCCAGTCTCTACCAGCACTGTGATTTTCAGTCTTCCCCACTTCCCCTTGTGCC
AGGTTGGAGTTAAGATGGCAGCTACTGACCTCTTTCTGACTTGGACAGTTTTAAACTTTA
GCTGTTCTTATGATTATACTTCAGCCCACCAAATTTACTAATCAGTAGCTCAGGTTGGAT
CTCAAACATCTCTTCCTCCTCCATTTTGGGAAGTGGAGCATCCACTTCCTGCCACAGCTC
CCAAGGCGACTTGTGCCTCCAGTGGAGGATGGGCATGGCCTCACGGCATGGAGTGCTCTA
CTTACAGAGCTTCTCTGCAGATGGGTAGTCTTCTCCTTCTATTCCTTCAAGGATATTGCA
GGATGCTCTTCTGGTCACCTGGAGGCCCCAAACTGGTGCTTTAGGTAGCTCTGCATGATT
ACTAATTGCCCTATAGCACGAGCTGACTCTCGGAGCTCCTTATTCTGCTGTTATCTTGCT
GGCTGTCCTAACACCCTACTTTTGAAATAAATTTCCTGAATTTGAATCTTAGCTTCACCC
CTTGCTAGCTGAGTGATGTTGGATAAACTATTCAGCTTCTATGAAGCTCATGTTCCTCAT
CTTTGTAATGATGATGATAATAATGCCTGCATTTGAGGAAGTCTTCTTATATTGGAATAT
AATCTCTGTTGAAAAAGGACATCCATCTTCAGAACCTAGAAAATCAATACATAAATTATT
TTTCATTAGCAGATGCCTGTTTTCAGGCTATTCTGGACATAATTCCATGGATTAGGCCAA
AATTAGATTCATGTGTATGATGAGTCCATCCACTTTTGGTTTTTACTTATTTAATGAGTT
AAAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCCCCCAGCGTGGGACATGACACC
CAGGGATGAGCCTCCCTGGCAACGAGTGACCACTATCAACTACCAACTGATGATGCAACT
GGAAAATGACCTTATACGGAAGGTTCAATGCGGATCAGCAGAATATCCATGTCTACATAA
AATACCATGACTTTAAAATGCTGTTTGACCTAAAGTAAGGGGGAAATGGAAAGGAGAAAT
GAGTTTATATGGCTACGAGTTTCTAAAAAAGAGTCTGGAGGCTGGCAGAAGGTTTGCCCT
CATGCACAACTGAGCAGAGTCAGAGAGACAGATAAAGCAGATACAACCCCCAGATATTGG
TTCCTTTGAGGGCTAAAGAGACCCATGGGAGTTATGGTCATGGCCGATGGGGTTAACTAC
CAGGGCAGATGGCCCCTCTTTGGAAATGGTGTTTATGTGTGATGAATCTGGACTCAGATG
GGATCTCCCTTCATAAGACTTTCATGCTAATGTGCTGGAGGTGCAGTTAATGTTGGGGTT
TAAGATATATTTAGGGGATTTGAATCTCTGGACTGACAATGTGATAGCCAGATCCTGAGC
CTCAACAGACTCCAGCACCTACAATCTGATTTATTGGACTTACCACACTCAGCTAAGATG
GAGGTGAAGAAGGACAACCACCACACCATGGAGCCTAGAGTGATTACAACTGAAAATGGG
AGGATTGCATCCAGCATCCAGGTGGAATCTGAGCCTACTCTTGACATAAAGGTGCAATGG
ACACAACCAATCCAGTGTCCACATAGAAGAGGTGGCATTGGATTGGGAAAAGTGGACATA
ATGGACAAAGGGTATGGGGAAAGGCAGGAAGAGATGAGAGGTGGAGGCGTCTTCGGGACA
TGGAGCTGCCCTGGATGGTGCTTCAGAGGTAATCACCGGACATTGTAAATCCTCACAGGG
CCTACATGATGGAATAGAGGAGAGTATGGGCCATGATGTGAACCAATGTATATGAGGTGC
AGAGGTGCCCAAAGATGTACTTACCAAATCCAATGGATGTGTCATGATGATGGGAACGAG
TGTTGTTGGTGGGGGGGAGAGGGGGGGTGGGGGGGTGGGGTTGAATGGGACCTCACATAT
ATATTTTTAATGTAATATTATTACAAAGCCAATAAAAAATAAATAAAAGGCTTAATTACA
TTTATGCTGCTCAAATTATCTTAACTGGTTGCTGATAACTAATAAAAGTGTTTCCAAGCA
AAAAAAAAAAAAAATTACATGTGTTTTCTTTTTGTATATACCAGTTGAAACACCTAGTGA
TTGAATTCTATATGAGTTCACCAGGCCATGGCAACAGTTTCAACTGGGAATCCTTAAAGA
GAATAGAAACGTAGCATGCTGCTTTAATTTTTATTCTCTTGGTATATATTCTTCATGGAT
AAAAAGACAGCAAAGTGATTGAAAAAACAATATGAATCAAATAACGGAGAAACTGTGCAG
TCAACTGTGGAACTATGAGCACACCAGCAATTTTCTTTGAAGCTGAATATTCTCTTGATG
CTGGGAATTAATATTAAACACTTTTAAGATTTCTCTTCGGTGATTAGCTAATGTAACTTT
CAGATGGAGCAGATCCCATAAACTATCTAAATTTAAGTAACTACACAACTTAGTTATTGT
GATTTCCATGGAGAGAGAAAATCAAATCCTATCTAATGGTCTTAATTACTGCCTCCCTTC
CCCTAGGCTGAAATCATAGTTTATAGTTATGTAGCATCTGGCATCTGGGATGTTTCATCG
TTACTCCATCACGTCTATCCATTGGAGTAAAGGGGGAGGGTAGGCAATGCTTAAAGTGGA
TTGTTTACCTGAGAAAATAAGGCACAGAAATAGAACCCCCGATTTTCTAAATCTCAGGTA
TACACTTCAGGTCTGTATAGATTTTTGTCTATTATATGGAAAGTATTCTTTTTTTTTAGA
AGCAGAGAGCTATTATGAAAATTGCAACATCATCACAGTATTTAGAGATGGTAGGGATAT
GATTTCTGAAAACTGAATCTTTGGGTAATCTATAACATGTTTATGTTGAGTCAGCCAATA
AATGTTGGTTTTTCATGTTCTCCAAAGAGAGATATGCATTCGTTTTGTCACTGTATTTCA
GGTCATTCTTTCTCCTTCTTCCGTTTAAAATGTTTAATTAATATTTACAGTCTATTCATA
AATATGAGCAAATACTTAGAAGATATATTTTGTATAATTTTATACTAAAACATATATTCT
TTCCTTCATGATACATTTGTGTGTCATTTCACATATTAGGGAATTATTAAAAATTCTTTT
AGTAAAATATTGTTAAAATTCAGTATGTTTGACTATTTTCTTTGAAGTTCATGAGGGGAC
TTACAGTAAAATCTTCATTTCACCAAAATTTCTTTCTGAGAAGACATTCACTGTTACTGG
AATTGTATTCGTGCATTACTTTCCTTTGACGTAATTTTAAACTTCCATTCTACTTCACTA
TAAATGGAATTTCATTGTATCTGACTCTACAATAAGTGGGTCCCAGTATTGTTGACATTT
AGTAGAATTACAGATCTCAGTGTCTTTGTATATTCTGCATTAAAATGTATTATGTGTGCT
TTCAATTCTGTTTCAGAGAAACTGCTATTGATTTACATAGTTGTGTAGAAGAGTTCTGTT
TAAGCTCTGTGCTTGATTTCATGGTGGATTTTATTTCTTTCAGAAACCATTTGGAAATAT
TTCTTAATGTATTTGCAACCATTGGATAAAAATGAGATAATGCTTATAAATGATAAATGT
TTGTGCCAGTTTTCTCTCACAGTGAATCTTTATAAAAAGGACTTGGAGGAAATTAAGTGT
TTTTTGTTTTTTTCTTAAAGAGTGAAACTAACATATTTCTTATGTCCCAAGCTCAGGGAA
ATGGCTAGTGGGAATAGGGTCTTTTAATTGTGTTACATGCTTCTGGGATTTGATGGCAGA
GGGACTGCTGTGGAAGGAAAGGAGGAATCTGAGCTGAGAAGTGACAACGACAGTAGGCTC
TGGTTCCAAGATGCCGCGTCCTGGGGTCTCTATCCCTAGAAGATCTCAGAAGTGGGAATC
CAGCTGTAGGTTAGCCTTGATATGGTGTCAGAGGGGCTGTATTAGTTAGCCAAAGGATTG
CTGTTAATCGATACCAGAAATGGGTTGGTTTTTATAAAGGGTATTTATGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATG
CAGTAACTAACAGATTTGAAGTAGAAACGCCCTTGACAACAGTTTTAAGGACAACAGTTT
TTCAATAAACTGATTCTGAGAATCATTTTCCTTTGTCTCTATCCCCAAGACAGAAGTGTC
TGGAGCTTGAATTTCCTGCTGAGTTCCTTAGCATTATTGCCAGGTCAGAAACTAGGCATA
TTAATATGAAAGATGTTCTGCATCTGGAAGCCAGAAAATAATAAGCATTGTTAATTTAGT
TAACAAAAAAGGCAGCTGTTTAAGATTAGCCTTCTTCTGTGTATGTGGGAGTTAACAGAA
CAATGGGTCTTTCCCAAGATGTGTATGATTTTTCTTTTGCTTATATGAAAATTTTAATCG
ATGAAGGAATTAGTTATATGCTAACTAAAATAATAAACATTTAAAAATTTTAATTGGAAA
TTGGTCAACCAGTACTCATTTGAATGGTGGTATATAGTTCTAGAAACCAGATAACTTCCC
TAATCTTCCCTAATGCATTGTATTCTGGGCCATAGATTCCTGTGGTATAACTACTAAGTC
AGAGAAAGCAATTCTATTTCCAAAATCAGCCTTCATGGTAACAATTATTGAGAGACCTGG
CCTAATGGATGCCTTGGAGTTCAACCACTGTTGCCTTCTGATATGTGTTTAGATCTTTAT
TTAGATTACACACATTTGTGTAGGAGTTTGTAATGAGATTTCTTTGAAAACAATAGTTTT
GACTTTAAAGCTCTTATCTCTGTTTAGCTTTTCAAGCTTTATTATTATTTTGGGTACATA
GTACCAATTATGTGTCAGACACTTTATTTCAACTATCCCTGAGATGCTGGAATACTGGCA
TCACTGCAGTTAACCATTCTATAGCTGAGAGAAGGAGACTTTTCTGGACTATAAGCAGTT
TACTGTATAACACAAAGGCACATCTCTGTTTTAAAACAAAAAAAGACATATAACTCATAT
ACAATAAAATTCTCACATAAGCATACAGGTTGAAATCATTTGACACGTTTGTACACCCAT
GTCACCACCACACAATTAAGAAAGTGAACATTTCTACTTCCCAAGAAAGTCCCCTCTTGT
ACCTTTGCAGAGATCTCCTCCCATACCTCCATCTTAGTTTGCCAGAGCTGCTATGACAAA
TACTACACAATGGGTTGGTTTTATCAGTGGGAATGTATTGGCTCATAGTTTCAAGGGCTA
GAAGAAGTAAAAAATCCAGATAAATCTGTGGCTTTATAGTGCTGGCTTCCTGAAATTCTT
GGGGTTCAATGGCTTGTATTTGTGGTCCCATCATTATATGAGTTCTCTCCTTTCTCACTG
TGACTTCCCAGTTCTCTTTTGGCCTCCAGGAATAGGTATTAATACCCTCTCTCATTCAGT
TGGGTCACACATTAATTTTTAAAAAATATTCAAGAATCTTTTTATGAGTTCACTACCATG
GGAATCCTGATTAAGAACTTGCCTAAATTCGTGTACATAATTCAAACTACCACACCCCTC
AACATCTTATCTGATTAGTTTATCTGTTCTAGAATTTCCTGTTTATGAATAATAAACTAT
CTGCCTTCTTTTGTGCATAATAGCTGTAAAAATACACCACATTTTTTTACATTCATCACT
GCTTTGTTATTTTTAATTGCCTGAAGGTATTCCAATGTATGGATGTATCTCAATATTTTA
ACCCATTCCCCAACTAATGACATTCATAGTTTCCGATTTTTAACTATCGTAAGTGAAGTG
CTATGTACAACTTAGGTATAAGACTTTTTATGGACATGTTTTCATTTCTCATATTTATCT
AGGAGTGGGATTTGGGGGTGTGTGGTTAACCTAAACCTAATTTTATAAGAAATGGCCAAA
CTCTTTTCTAAAGTGGTTGTAACATTTTGTTTTTCTAAACAAAGTCATGATATTAATTCA
GTGAAGTTTACTTACTTCTTACACCATCAATATTTGGTATGAAAACTTTTGGGATAAGAA
ATGATACCCTTCATTTCTTTCTCTTTTTTTCCTAAAGAATTAAAAAATTAAGGCTAAAAA
CCTTGCTTTTTTGGGGGAAGATTTAAATTTTAAGAGCCATTTTGACAAATTAAGATAGGC
ATACAAATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACTTTTTCCTTCATACTTGTATAAGTAGA
GAAAAATAGTAAATGTACATATATGACAAGATTATAGGCAGTAAGTCGAAAAGGTTTTAA
TAAAAGTGTTTTTATCTTCCTAGGATGTAGAAAGACTTACATCTCATAGGAATTGGGACA
ATTTCAGAAGGGAGATGAAATCTGACTTATCCTAATAGGAGAATTTAATGTTTCCATCAG
GAGAGAGCAATTCAGGGGGAAGTGAATGGTGAGTCATGGGGAGTGGCTGGTTAGAGAGGA
AGGGAAGTTAAAGCAGAGGAGAACAAAGGATTAAGGGAATCCTTAAATATGAATAATATT
TAGTTCCATTATTAATAATCAAAGATTAGTTTGTGATGAGGGAAGGGAATCTCAAAATTT
AAAATTTGAAAATTTATCCATTTGGGAGAAAAGAAAACTAAAGGTATGATCTGCTGATAT
GTTATTGAAATAGGTTGGAAAGAACAGTTGGTCATTGGCCTCCATCAAGCCTAGAAGCTG
TGAAAAAGCTTATCACAAAGTTAACATTTCTAAGCAACTGGAGACTTCAATTTTCAATTT
TACATATTTAGTAACTTTTCATATTTGGTTAATTTAGCCCAGGAAAAAGGTACCCCATCA
GTTGATTTGATCAATTAATGTAATGATTTATTTGTGTACTTTTTCTCAAAATAAATTACA
TCTCTATGAAAAAAGATCGGATTTACTCCACCCAGGTGGGTGGCTTGGAATTATGTACCC
CATATAAACATGTTCTTAATTTTAATCCATTCCTGTGGGTGGTAAACCCCTTGTAAATAT
GACCTTTTGAGGTTACTTCAGTTATGATATGGCCCAACTGAATTAGGTTGGACTTAATCC
AGATTATTGGAGTCCTTATAAACAGAGTAAAAGTCAGGCAGAGAGAAGCCACATGGGATG
CTAGAAGCTGGAAGTCAAGGGAACCCAGAAGAGAAAGGAGAAGATGCCGCCATATGCATT
GCCATGTGAGGAAAAGCCAAAGACCAAGAATCACCATCAGCCAATCTCAGAATGCCATCA
TCTTTGGGGAGAAATTATTGCTTTGCTGATGCCTTGATTTGGACTTCTTCTAGTCTCAAA
ACTGTGAGCCATTAGAACCCTGTTGTTTAAGCCAACCAATTGTGTGATATTTGCATTAGT
GGCTAGGAAACTTAAGACACCAGTCTTCTTGTTATGACTTGTCATATGGAATAAACACCC
ATATGAACTTAAGCTATCTCTTTTCTTCACTGTTGTTTGGAAAAAGTTAATAATATGATC
TTATTCATTATTATTAACAAAGGGCATTTTAATATAAAATTCCTTTTAAAATTGTGTACT
TGCAACTTATTGCAACATAGTGATTAAGTGCTACACTTCTACCTTTGGAATTTGATTTGT
GGACATTGTCTTACAGTATACTAAAGTAAAGCAATCAGTAAGTCCTCAGAGCAGATTAGG
GAGTGCTTATTAGCAATAAAATATAGTTAAAATATACCAGGCATAAACGTATTTTTGAGG
CAATGGAAATACCTCAGCACATAGTTAGTCTAAATTAAATGAGTTTATAATTGAGGTTTG
TATGCAAGGGAAAAGAAAATTCATCTGTTATGTAGACTATAAATGTTTTTAACATCACAG
CCAAAGTCTTAGATGTCTTTTGAGAGTGTAAGTGCAGCTGTCCTTTTTTGCTGTGAGCAC
AAGGATATAGGAAATCTAGATCATCGCTTGAAAAATAAAAAAGGGATTGTGAGGGAATAG
AAGAGAAAAGGAAAGCTAACTTCCTCCTTATCCTTTGCTTCTCAAGGTTGTTAATGAAAA
TGTTTTTCAACCTTAATGGTTATGAAAAAATAATGTGTTTTGTTTCTATTTTAAAAATAG
CTCTATATGGCTCAAGGTTTGCTTCAATTGTTTCACTGCCACAACACCTGAAGCCAAATG
GCTTTGGGATGTCATATTAATTTGATACTTTAACCAATAGTTTGTGCTCACTGGCTCTCT
GATGTAAATGCGGAAATGAATGTTACTTAAATCCATTTGATTTAGAACTTAAGAGCATTT
ATACTGTTTATTAGAAAAGTGAATTCTGAAATCAGCAACCAAAAATGTGAAGTGAGCAAA
GAAAAGCAATAATACCTATGATACAAGCTAAGCTGTGTATTTGAAGTGTACTGCTCTATA
ATATATGCAAATAAGACTTGCTTCAAGTTGAGTAAATCTCCCAGGACCAATCCATTACAA
TCTGTCTCAGGCATATCTAGTTTGGAAATGGTTATGTTCACTTTGAAAGAGGAGTTTGCC
ATAGTTTTATAAAGTTGAAATGCATAGGTAGATAAGAAAGGCAAATCTTGTGGACACCCA
CATTTAGAAGAGTCTTATGAGCACTTTTGGATATAAGTGGCAAGTAAACCTGCTAATCAG
ATATTTCTTTCGCATGAACCTTAAAGTGAAGATAGTAAGTCTTCTAAAATAGACTCATAA
TTGACTGTAGGTCATTCATTTTTGAGTTCATTGCTAGTGAAACTGAATATGTTTTAATTT
ATCATGATATCTAAAATATGTTCTTAAATTCAGTCGACTATATTATCTAGTATTTTCAAA
ATTTCTAAATTCAGTAGGATATTCATAATGTGTCACATTTCATTTTTTTATTTCGCTAGA
AACAATAAAAACATTATTTTCCCCAAAATGTTTCTATTCCTAATTACACTCTCTATTTTG
AGTGACAGAACACTTATGAAAACAATTTAGCTAGACCCTATTTGGAGCAGTTTGTTGCCA
GACCCTATTAGGCATTGGAGATGAAATTGAGATGGGAGAATAACTGATATAATCCAAAAG
ATTTTGGCTTTATATGTAAATTTGCCTGAATAACGTCACCATACATTCATATTTGACTAA
GTGCTGAAAATCAGCATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AACCATTTCACTCACTGGACAAGACAGGAAATGTTAAGGGGATATACTACTTTTCTTAAA
AAAACAACATACATACCTATATAAATACATACATGCCTATCTACTCACACGCATATATGT
TTTACCCCTTTTATTTACTATCCCGTTTTTTAGATTAGTCTGTGTTGTCTTTGACGCGTT
TTGGGTGTACAGGGTAAGAGCGAAGGAAGGAATACCCTGGGCATTTCAGATTCTCTCAGT
ATTTTGTGGAACAGCATGCGAGATGTCTTCCATCTGTGTAGAATAAGTACAGCCTCCTGA
ACACTGCTTAACAGTAGTTTACCACAAGCCAGTTATAATGTCAAAAGCATCGAAACCTTT
TCTTTTCTTCTATATTTGAATAATGATAAATGCTTTCACGCTGTGTGGAAACTATTGAAG
TGTGTTCTCTGCAGGTGAACCTGGCAGTGTCTTATATAACTCCACTCAATGGGAGTATTA
CTTAAACAGTGTGAAATACATTGTCTGACAGGAATTGTATCACTGTTTGGAATGATGTTT
ACCCAAGTGGACAGTCTGCCACTTATTTGTAGTTTGGAAAATGGACCTCGATACAAAACC
CAGGTCTTTATTTGGATATTTGTAGTGAAACCAATAACTGTTCCTTATAGAAGAATAATG
TTCTTATACCTCATTCAGACCTTATTCATTACACCTAATCATTTGGCTATGGTATATCAA
GTATGTATGATGAGGGATTACTTGCTTGCTCTTAATTTTTTAATTAATTTATTTAGTCAC
TATTTTAAAAAAGTATCTAGATATAATTTAAATCAAAATGCAAATATTCGGTTATAAATG
AGCCTAATGCCTGATTACCTACATGTTAGATGCTTATATCTATTATTGAACTACTGTGCC
GTTCTCCTTCTTTGCTGCTAGTCCCTAGTTGTCTCCATCCAGCTCCTTGGTGGTAATAGC
CCTGCTTCCTAGTACAAGCTTCAATAATGTTCTCATGGTCCCCGCTGGGTAGCATAATAG
CAAGGTAACCAAAAAATCTATTTGGCTAAGAGGGATATGGGAATGGAGTCCAAAAATTTA
AAAGTCCTTGGCAAAATTTTGAGAGACTTCAGTTCCATTGATTCATAATCCCATTCATTG
ACTTTGTAGGCATTCCAAAACAAATACAGTAATCAGAGAGAATATTAATGTGATACCAGT
TTTAGCAACTGAAGCCATTGATATTTGAATCACTGAGCTTATAATATGCTAATATATGAT
TAGCTAATGCATAACTATGTGGCTAGTTGTGGATTGGAGTATGCAGTGCTCTTACAATTG
GGCATGTGAATCAAGTACTGTAACCTGAAAAATCTCACCCTTCTGATCATGCATCAGTAG
AATAGCTAGCATTTCAGATTTTCCTTCCCATATAAGTGTTTTATCTTTCTCCAATGATTG
CTTTTTAAGTTAGAATCTGGTTGCTTAGAATCTGGTTGCTTTCCTATAGGAGTATGCTTC
TCAAATAGTAGGGGCATGGGAAATTGAGGAGGCATCATACAATTTCAAGAAGCTGTTTGG
GTCATGGTAGCAGGGACTATGAGGTCAGTCCATGAATTTAGGACTCAACTTCATTTACAA
CTGAACTTCCTAACAAAATGGATTCTTATTGCCCCTCAAACTGTGTATTAGTCAGCCAGA
GGGTGCTGATTCAAAATACAAGAAATCTGTTGGCTTTACAAAGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCATAATTTAATCAAGTAAA
AGCAAACTTCTGAATCCAATATAATATAAATATGGCCTGGGTACAGACCAGTTCACAAAC
ATAATCTGATATCTATTTTTGGAATTCATAAACAATATCAAACTGCTACAACTGAATCCT
TTCTCTGTTTTATTGGCAATGATTTGGGTAAAATTGAATTGGATGAGGTGAAGCTTTGGC
ATGTGGAAATTTTTAAGCATAAATTTTAAGATCAGTGAGGAGTGTTGACCAGTCTCTTCC
CCACTTCATTATCTTCATGTTTGGATTTACTTTTTCCTTTTCTCCATTCTTCCCCACCTG
AATCTTGTTCTTTCTTTCTTTTCTTTCTTTTTTCATTTCTTTTCATTTTCTCTATCCCAT
GGTTGTCTCACTGCCTCTTCTTGTCCCAAAATAAATTATTCACCTTCTACAAATAGAATG
TGAACCCCTCTTTTTAAAATTAATTATAGAGGTAATATATATTTATTTTGGGACAATGAA
AAACTGTATATAAACAAAAAAAAAAAAAGAAAAGAAAAAAATTTCCATCATTCCACTACT
AGAAATTGGTCAGTTACCTTGGAGATTTGTAATAGGTATAATATAGAGAATGCAATTTAC
TTTATTTTTCTTTGCTCCTTAAAAGTTTGTACCATGTTCTCAATTTAAAAAGCCATTTTA
TCTTTTATTTTACTTTCTCTTTTACTCCAGTTCTGTGCCACAAAAACTAAATTAAATTTT
ATTTGCTTTATATATGGCCTATTAATCTCAATGGAGAAGGAAGTTCCCCTTGCATGTTTC
AGAATTTATATATTATTATATTTAGTCCTTGAGGTAAGGAAAATGAGAGAAGCTTGACTT
CAGCACTAGTTCTTCTCCATGGAATTTTAATTCTACCACAACCCCTGTACTGAATGTGTA
CGAAACAATCTTGAGTTCTATTTTATTTTTTTACATCTTTGTTTTTATTTTATGCTATAC
CCTAATATCTGTCTTCTTTATATCTTGCTAATAGCCCTAATTTCTCTTCTTCTTCTTCTC
TTCTTCAAACCCTACACTATAGGGAAAGTTTAGAGTCTTATTTTTTTGTGAATGAAAGGT
TTAGGGGTAGATAAATAATGTGTTTACTAAAGAGCTGGTATCATTACTGCAAATTACTGT
ACATTTTCTAAACTTCTAATATAATTTAGTGAAGTGGGAATTCTGTGTTTGAGTTTTAAA
ATATTGCAACCATACACTTCGGGGTCTAAGGTGCATTCTGTTGGATGAAGGTGCATGTAT
TTGCATTATAGTAATGGTTGTGTTTATCTAACAATGTAATATATTTTTTAATTATAAAAA
TCTACATTACACTGAATTATCTAAAGAGTGGTTGGGATTAATAAAAGAGGAATGTTGGAA
ATTAGAATTTGCACGTGTATCATGTGCCAACCTGAATTTATCTTCAGCTCCTATCCCAGC
TCTCCTCCAATAAACACTGAATAAAAGGTACTTTCACCCAACCCATTGTCCAACCAGAAA
CCTAGTAGTCATCATTCTCTCCATTATAATAAATACCCTTTGTAGCAGGCAAAATAGTCA
CAGTGTTGTGTGAAGCATATAATTTTTAAATCTCTATTACAAAATTGGTTTTCTGGCTCT
GACCCTCCAGCTTGCCTTAGCACACACAATTTATGCTACAGACTTTCAGGTAATTCCAGT
ACAATTCAATAATTTTTTGCTCACTTTTCCATTTAAAACCAAGTCAGTTCAAAGTTCAGC
CTCCTGCTCTTCCCTTTGATATGGAATCTGGGTGCAGGGAGGAGCTTATGTTTTGCAGCG
GGAGGTGGGCATTTTGGTCCTGGGTAAATGTATCAACAGAGGTAGTAGACTGATTGCTTC
AGCTAGGTGGAGATCACAATCTCCCCTGTACAAATGCAGTTCCTCCACGGTCAGCTCAGA
ATTAGCTTCAACCCCACTTTCCATCTGACCCTGCTGGCAGCTACTCAGGGCATTCCTCTG
ATGCTGGTCACTTTATACTGGCCACTTTATACTGCTCTCTGTTGAGCTCTAGCAAATGAG
CTGACCTCAACTCTGCTTCCTTAATGATGGATCCTTGAAAGTTTGGGGTTTTATTCCACC
TCCTCCTTTGAGAATTATGAGGAACTCATGGGGATATGCTCTGTGGTTAATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCATATGGGAGAAAACAGGACACAGCAGTTA
ATGCTTTGAATTCTTATCTGGGTTAACACAGTAAACAAAGAAGTCCAATTAACCCTATTT
CCTTCAAATCTATTAGTTGAAACTTATGAAATGGCCATTTTTTTTAGGTTAAGAATGGAA
AGTGGCAGCAATTTCATATGGTTCAACCTAATTTGCATCATTAGTTTCCTGCCAGGCACA
CAATCCTCACAGTTTCTAAAGCCACCATCATTATACAAGTACTAGTTAACACAGTGGCCT
TTTAATGGATTCTCCTGCTTCCAATTTAACCCTCTCTCATTCGTTTGTTATACTTCAGCT
AGAGTAAGCTTTATAAAATTCAATAGTATCGAGGCACTGCTCAAGAGAAAATGCTGCAAC
AGCATCGGATTGACCTTCTTATAAAATTCAAGCTCCATTATTGTGGTTTATAAGTCATGT
AGCCACACATCCCAGTTAGTCCCTGACAGCCCTGGTTTATAGCAGCTGCCCCAGCATAAT
TATTAATGGTGTCCCCTTTTATTCTCAGAAGTGACCTGGTTTGGATGATGAATTGTATGA
TCATTTTATTTATAAGGTATCTCATGATCTGCCCTCTGCTTTTTTCTCCAGCCTCTTCTC
TTACCACTATATAATCATAATCTGAGCTGGAATCATTCTGAACTCCTTTGGATTTATGGA
ATATGTCACAGTCTCTCTCAATCCTGAGCTTAGGCCTATGCTGTGGCCCCTGCCTCAACT
ATCCTCTATAAATCTAGCTCATGCTAATTTGTCAGGTTTGCATATATAAATGCAATATAA
AATGACAAGAAATGCTTTCTGATTGCTAGACAATTTTATTTATTTTTTTAAAGATTTATT
TATTTCCTCTCTCCCTCCCCCTCGTTGTGTGTTCTCTGTGTCCATTTGCTGTGTGTTCTT
CTGTGTCTGCTTGCATTCTTGTCAGCAGCACCAGGAATCTATGTCTTTTTTTGTTGTATT
ATCTTGCTACATCAGCTCTCCATGTGTGTGGTACCACTCCTGGGCAGGCTGAGTTTTTTT
GCAAAGGGCAGCTCTCCTGGCGGGGCACACTTCTTGTGCGTGGGGCTCCCCTATGCATTG
GACACCCCTGCGTAGCATGGCAGTCCTTGCATGCATCAGCACTGCGAGGGGCCAGCTCAC
CACAAGGGTCAGGAGGCCCTGGGTTTGAATCCTGGACCTCCTATATGGTAGGTGGATGCA
CTTCCCTAGACAATTTTAAATCCCCCTATTTTCTCTACCCATATTTGTTCTGTACTCAAA
CCCTCTTCCCACGTAACTGTGTTTGTATATTCATTTCTGTGCTTCCTTCTAGAGTGTCAA
TACTAGTAATACAGGGTTTTCTCAGTTGATTCACCACTGTATTTCCACAGTTTAATAGAT
GCTTACTTCATAAATGGCACAAAAATATATTCGTTGGATGAATGAGTGAGACAAAAAAAA
TGTTAGGGTGTCTTTGCATGTTCTTCCTCCTAATATAAAAGCTCAAGAGCAGATGTCTTA
ACCTTTTTTGTTAGTAAGAAGATGTTGAGAGAATAAGAAACACTAGTACAAGGGAGAACA
AGAAAAAAGAAAGAGCAGACAAAGGCTATGTCTTGAACACCAAAGAAGAATGAATGGGAA
AAAAACCTGAGAGGCTTTAACTGACAATTTGGATGGACACCTACATTCCATTTATTATTA
TCTGCTTCTGTCTTTGCAGTGCTTCAGGCATTTATCTTAGCAGGGGAACTTAAAAAGCCT
GAATCCCATTATATTTTTGCCTGCAATATGCAAACTTATTAGAAGCATATTATATAGTAA
CATAATGTTCAGTAAATGCAGAAAGTAATTATATTTGAAATTTGAGGAAGTGTTGGACTA
ACATAATATCTCCTTTTTAAAGTTGGTAAGAGTTGTGTAAAACAAAAACAATTTTAAAGT
GGTGACTAAAAGTAAGAGCTGTCTGAGTTCAACTTATAGAATTTACTTCCAGAAGTTGAA
AGGTAAGAGATAGAATGAAAGCTCATTTGTAAGATATTTTAGAAGAGAAAAGAGCGTATC
CAGTTTATTTGATATAGAAAGGATGGGGGAAAAGATGGAAGAATGATCAGAGGAATATGT
TGATATAAATTGTGTGGTGAGTTTTCTTACAGCTCTCATTCCTGCATTAATTCTTTTAAT
AACACAATTATTAACCTGCTGTAGCAGTCTGATCAAAGCTAGGTCATGCTCCAGGAACAA
ATATCCTCCTAAATACCAATGGCTTGCCACTACAGAAGCTTATTTCTCAATCATGCAATG
CCCAATGCATGTCCATACAGTGACTCAGGGACCCATTTCCCTGCCTCTTATGATGTCTTC
AACTCAGCAGATGGCTACCATAGTTGCTGCAGCCCAGGGCGACAGGAGGGTGGCATAGAT
GCTCAGGGTCTTCAGTGCTTCAGCCAGGGTCATACATTTTATCATCTAAAACTAGATGAC
AGGGCTCGTAGATGACACAAAGAATATTTGGTGAGAACTGCTATCTCTGCTTAACCAGAA
GGGCAAAAGAAAATATGTTTTTAATCTGTTGAAATTTACACGGTGATCTCAATGATTCTT
CCAATTTAATTTGATTTCTTTCCATCCTAGGGCAAGTCTTTGAACCCGCCTCCCCCCCCC
CAAACACACACACATCCACAGCTGCTTTACAAGTCTCTTTTTAAACACGGTCTTACCTTT
GACACGCCAAAAGTAGTGACAACAGAAATACATTCTTCTCCATCTGAAATCGTTCTTTAT
TTAAACATTTATTAATGTTCACTCCCTATGTATTTGAACTGCTTCCAGAGATGATGAAGG
AGAAGAACAGGAAGGATGTGTTAGGAGCATCACAGACATTCATTAAGTAACCATAGCCCA
GGCCTCACCTACCCCCACTTCTTTCTTTGGGGAAGTCATGCATACACACTAAGCCACCAT
CCTCTGGGCCTTCTGCCACCCCTACTTCCTTTTCTACTGTGTGCCACTCCACAACACAGG
GAGATGTTAAGTCTAATGAAAAGGCCCATCCAGACCTGTGACGGTTATGCTCATATGTCA
GGTAATGTTGCCGGTAGTTCGTCAAGTGAGCACCGGCCTAATTGTTACTGAGATGGTATT
TTGTGGACTTCAGTCACTAGTGAGTTGATCATCACGTCTATGGCTGATTACATCTACAGT
TGACTGAGGAGATTGCCTTTAGCAATGCGTCCAATTAGTTGAAGGCCTTTAAAGGAGAAG
GGATGATTTCAAGAGAGAGAGAATTTTAATCTCTACTTCAGCCAGCCAGCTCCTCCTGGG
GAATTCATCTAGGATCTTCATGGGCATTCCTGGCTTGCAGCTTGCCCTGTGGAATTTGGA
CTTGTGCACCCCCACAGCTGCTTGAGGCAATCTTATAAAATCTCATGCTATTTACAGATA
TCTCTTATCGGTTCTGTTTCCCTAGAGAACTCTGATGAAAACCTTAAATCTGGAAATTGG
GAACAAGAAGCCCCAGATACTTATCAGAACAGGAATTCTCACTGGTAGGGTCACCTCCTC
CCAAGCTGGATAAAAACCACCTGGAACAGTATAGATTTGTCTATCTTCTCTGATGCGAAC
TGGGGTATGCAGAGCCATCATCTACCAACGCTGACCCAGAGCAGTTTTTGCCTTCCCCGG
GGCCCGGCCACATGGGATTTCTCCTTCTACTTTCTGTACTCTTTGTGCTGTGTAAGTGAC
AAAGAAAATATTTGTCCTTTCTGGATTCTTTATCCCGTGCAAGTAATAAAGGGATCATTC
GTTGAAAGTTTCCATTGTGCTCTGAACCTGTATTTCCATGACACACCATTGTCACAACTC
ACTCCAGAGGAGGAGGAGGAAGAGAAGGGGGAAGAGAAGACTCTACTGAGGTTTTTAGAG
TAAAAGAAATATCCTGACATTTTAATTTTATTATGTTGTATACCAATTGAATTATCAGTA
ACTAATTCAGGAAAACGTACCAGGGGGAAATCTTATCCCTATGAAAAAAAAGTGAAGCTT
TACTCAGCAATCTTCTCAGTCCTTCATATTGTTGTAGCAGTTGTGAGAGTTTGAGTTATT
TGCGTGTAGAAAGGCCAGGACTCAGGAATGATTTTGAGAAGGAAAAATGGTTTATTGACG
GCCGGCCGGACTCGGGAGCTTTCTGTTTCAAACCTGAGCCTCGAACAAGATTTTCAGGTT
CCTTATATACAGGGTAAGGGCTTAATTGTTCTTTGTTTCAGTGCTCAGTAGGTTTGAATT
AGCATATATCTTCCACATCCTAGGTAAGCTTTTAGCATGGACTTCATATGTTCTAGATAA
ACTTTCAGCACATTTGGTTTGCATTTTCCCTGAATATTTAAAGTTTATAGAGTTTGCACT
GATAAACTGTTTCCTGCGACTGGAGTCGTTGCCATGGTCACCAAGGGCAGGACTGCAGCC
TCTTACCAAACCACACCCACAAGTCACAGACAGCTTAGGTTATCTCTTAAGAGACAAAGA
GCCTCCCACCCATAGCCCACATCAATATGAAAAAAATGTACACTTTCCCCCTAGATATTA
GTATAAGCTCAATGCACAGGTGTCCAAGGCCCCCCAGTTCCCCCACAGAATTGTGGGTGT
AGCTCATGCAGGCAGGTTCTTTCATGATGTGCAGTTGCTCTATCTGACTCCACTGCCAGT
CATCCAGCCTCTCACCCCACCCCAGTTATAATGACTTTCCACAATTACATCTCCCCTATC
TCCTTTTAGGGAAGAGAGTCATTTAACCAGAAATAACATCAATAACCTTTTCTAGTATGC
TTAGGCATGAGTCTCCCAGCATGTTTTTGGAGACATTTATATGTGTTTACAAAATGTATG
CATACTTGTCAGTTGTAATAAATTCAAACGTAATACCCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGTATATGTGAGTAGTAGTGGCAGATGAGGATGCAGCACTGGGCTGCAAAGTTGAAAT
TGCCTCTTTACACAGCACCTCAAATTTTAAAAAAATATGGTGCGGGTGGTGGAAATAGGG
GGTACAGTGCAAATATCATCTCTTTTAATCCTCTGTTTTTAAGATTGGAGCAGTTTACAA
GTTTCAAGTATCCAAACATATAAAATCCCAAATTTATAAACCCTAGATATTTTTCATATA
CTCTAATAATAAGTTGATTTGGTTTTATGATTTAGGCTGGGTCCAAGATAAAGAATTGGA
AAGAAAACTTTCAAAACTCTAATGTTCTAAAAGACTCCCAGACTATTGCTAGCTCAGAGA
TTACTGTTTCTTTTTTTCAACACTGAGAAATCCAAAATAACAGTTAATTACTATATACCT
AACCATTTTTTAATACTAACATTATGTCTTGGTTATTAAAAGATATTATAAGCAACATTT
TGAATGTTTATGAACCTTTTAATATTAGTACGCCTTTTATGAGATAAGGTCAGGAAATCT
GACCTTTATTCTGCCCTCTTCCTTTGAAAGTAGGTAAAGACCACTTAAAATATTTGCCAA
TTAAAAATACTTGATAGATTAGTAAAGGCCAAAGTTGAAAAGATGATTCAGTGTTCAACA
GATACAATGGTGTAGTCTTACTGGTAAAGCTGTGAAACAAATCCCAGTATACTTAAGCCC
TGCTAACAAAGACATAATAAAATGGAAAAGTAAGAAACTTTATGTTGTATTTGATTAAGG
TTGACATCGAGTTTGAATTCATCCTCAGGGATAGTTTAGAGTATAAATCATCAACTAAGT
ACAGAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAATGGGC
TCCTAGCTGATATTTGTCTATAACTCGTACTAAAATGTCTAAAGCATTCCCTGTGTAATT
GCACATGCCATTTTCCTAGGCAACCTACCAATATTCTTCCTCCTTCCTTACTCCACTAGC
ACAGTGGGCTTCAAACTCTTTTCTTGGTAAGGAATACGCTAAATTTTGAGGAGTTTCTCT
CTCTCTCTCTCTCTCTTTCTTTCTCTCCCTCCCTCCCCCTCTCCCTCTCTCTTCCTTTCC
TTCCAGCCCTATCCTTTTTATCTCCCCAAGCACAAATACACACACTCACACACATAAATG
CAATACAAATATCATAACATATTAGAAAGCAATACTTGGACTTATCACATTTAGTGCACA
CTGATATTTCTCTTCTATACACTCTTTTAAAATACTGGCTTTGACCTACTAAAGTGACTT
TAAGACCCACAAACAGATTCTAATAATTCGAAAAATAGCCCTCAGTGTATTTGGTTTTGT
ATATTAAACTTGAATTATGAGACTATTTGGTTGAATAATGGATCACTTCAAATTTATCTT
GATAGGGAAAAAGTTTTTGTGAGCTAGACTCTTTGTTCATGAAATTTGCTTGAAAATCTT
CATAAAGGACTCACCTCATTATTTCTTTACTAAAAGTTCATGTCTGTACATGCTAAGGCA
AAGGAAAATGAAAGCTCTTATGCCTCTTAATTATTCCAGTGGAGATCAACAGTCTTTACT
TTTATTTATATCGTGACCTTTCAGCAATAAGATACAAAAACTGCAAGACTACTAACAAAT
CACTCTGAAAGATTAAAAGAATTCATAACTCTTACTCATTTTAATAGTAAATGAGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTAAAGTGCATTTGA
TTTAAAACTGCCATTTTGCTCTTTGGAAGCACATGCTATTAGCAACTACAATAGGACAAG
TGCTGTTAATGAGATATTTCTTAAGTTAAAACTGTAAATGTTGTGGTAGTTGTTTTCTTT
CAAGTGATCTTATTAAAATTTTTTTCTTCTAAGATCAACTCTGACTTCTATGCTGTTTTC
TGAATTATTAATCTACTTTCAAACATTTCTTTGTGACTTTAGTTGTTTATTTTTTTAATT
CAAAAATAAAATGTAGAAAACTTCCATTCCAACAGTTACTTTTCAAGTAGTGCACTCAGG
CTGTTATTGTAAAAAATCTGTCCTTACTCTTTTCATTTCAGTTCCATTATTGTGTTTTTT
AAACTTATAATTATTCATTGTACTTTTTCTCAAATTGCTTTAAATTCACCAACCATTCTT
TTCTGGGTAATATAAAAACTCAGGCCAATTAATATTCTTTCTACATTATCCTGACCTTAA
GGAAAAAAACCCTAAAAACTATTTGTTCTACAAAATCATGCCTAAATATGTTTCTACTTT
GAACTGTAAAAGCCAGAAGAATAAAATTGAACGATTCTTCATCACTCATTGCAAGGAAGT
GCCCCCTTCTGTTGTGGGCCTTTCAGCAATATTCTCTCTAACAGTACTCTGTGTCATTGA
CTGTACTTTTGCTAATGTGAAATCTTCAGTGGGAGTGACTGGGGCCTTATGCAAACCTCT
CTATAATTGTTTCTTCCAGTATCTATGCCTTGGAGTCTGAGAATCACTCACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGAGCACACTCCTTCCGCTTAGGGCA
CCCCCATGCGGGGGTGTCCCTGTGTGGCATGGCTCTCCTTGAGTGTGGCAGCTCTGCACG
TGGGCCAGCTCATCACATGGGTCAGGAGGCCCTGGGTTTGAACCCTGGACCCCCCTATGG
TAGGCGGATGCTGTATCATTTGAGCCATGTCCGCTTCCTACACCTATCCTTAATTCTAAA
CCAAGTCTCTGAATTGTAAAACTCCTTCATTCTACTGAAATACATTAGGGAATCTATTAG
TTTTGTGGTAGATTGATTTATGTACCCCAATTTAGACATACTCTTCATCCTAACCCACAT
TCCTTGTGTGTCAACCCATTGTAAACAGGATTTCTTAACTATGTTATTTTAATTAAGGTC
TGGCTCAACAAAAAGAGTGTGGTTCTTAATATTCCTGAACTCCTTTATAATTGGGTCTTA
ATCAACCTTACTGGAATCCTTTATAAGCAGAAGAAATTCAGATGTCAAGAAAGCTATGAG
AAGGAGACAAAAGCCAGAAGTCAGTAGGAACCCAGAAGACAAAGGAGAGCGTATTGCCAT
GTGACAGGAAAACTGAGCCACCCAAGGATCACTAGCCAGGAGCATGCTATCTGGGAGGAA
GTATGCCTTCCAGCCAAGGCCTTAGTTTTATCTGGTCTCTGAAGCCATGAGCCAATGAAT
TCCCATTGTTTAAGTCAACGTGGTTGTGTCGAGGGAAGAATATTGGCATGAGAATGGTTG
GGCTTGTTTTGGTTCAGCTCTTTCACTAACTGGTGGCTTTAGACCTTTTAAGTTAAAGTT
AATAGTAGGACAGATGATCTTTAAAGTCTTTCTGTTCCTCTTCCTTTGCTTATTTTGTCT
TCATCCCTTATTGATATTAAGACATGATTCTTTCTCTAAACTCTCTCCAATTCCAGGGTG
AAATAAAGGTACAGTAGTTGCAGTGGGAGACAAGGATACAAATAAATACCTACCATGTGG
TCATATTACTGCTATAAAATTATATGTTGCTAATACAAGGGTAATCATGACTATTTTCTT
GACAATCTTATTTTGTATCTAGTAAACATTTAACACTTCCAATCAGGGAAACATAATTGA
AGTAGTGTCTCACATGACTGAGATTCTTCACATGTGGCAATCTTTAGGCCCAATATTATG
TGAAATTCACAGCATTTCCACTAAGTGCTTTGTTTACAGTTATAGAAGCTTAAATGAAAA
TATTACATCAAAGGAAAAGTTCCATTAAAGGAACCTCAGCAAAACATCAAAACAATCAGA
CACATCACTTGTCTGTTTAAATCATTAGCAAAGGGCAGCAGTGTTATTCCAGTTTATAAA
CTAACTAGATTTAAAATTTTTTCCTTACACATGTGCTTTCGCCATGTTTAAAATGGCCTG
TATTAGCAAACACCCGCAAGTGAGAATTTAGAAACAGGCAAGTTCCTGCATTTTAGCTGA
CAAAACATTCATTGAATGTTATGTGGGAGCCTTGAGAATTCATTCATATGAATGGTCTGA
TTATGGTACATGAGATGTAGCCCACCACGGGGACGGAGCTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTTTCTCTCTTCTCCTGTGCAAGTCTGATAAAATTCTTTAACTATTAACTAGCATTTTG
GAAGACAAAAACATTTAGAAGAAAATTGGTCTGCGGATATAAATCCTAGATCTGGTAACA
TGGAAATCAATCTACCTATTCTATTTATTTAATATTTTAAATAGGTGACAAGGTGAAAGA
TCACTGGGATTTGTCCACTTGTATTTTACTCCCATTCTGTTTCTGTAAATTTGGATCATT
CATTTTATTCATTTTGTTCAGAGGAGCTAAGTTCTCAAAAGGAAATGAGAAACAATTTAA
AGTGTATACATTTCCGTGTGGGTGTTTGTAAACAAATAATTTTCAAAGGCCTTATTATTT
TATGCCATTACAAAACTGCATTTAAGCAGTTTTAAAATATTGCCTTGTGAGTTAAATTTA
TTTTATAATGTTTAAAGAGTGAATCTTCCAAATATCTCTTAGCATTTTTCTCCCTCCAGG
CAGCAATTTTTGAATCCTTCTTAATTCATCTTTTATTCTAGTCTTCCCTTTCTTAAGTGT
AGAGGCAATAAATTAAAATAAAATACAAAGGCCTATGTTCCCAGGACCCTAGTTCCTTTT
TTTCTGTTAAATTATAGCTAGTTCTTAAGACTAATATGTAAACCAGGCTACTTGTTTTTA
AATGCTTAGCGCAATCTGACTACTCTAAAATATTTCTTAGGATATTACTAACAGTGAATA
AGGAACCTTGAAATCTACAGATAAACTCATAAGGAATTGAAATTTCTTATGAATAAATTT
TAATATTTAGATAGGAGTGGCTAAAAACTAGATTTTAAAAATGAAGTTTTCAATTTACAG
GACTTCAGTTTGGGTTCCACACAGTATCTTAAATACAAATGTTTTGATTTATTGTCTTTT
TGCTGAGCTATGGTCTAAGAAATTGGCCACAGGTTTAAAACCTTTTTTTAAGGTTTTTAA
CCTTTTTGTGACTGCTTCTATATTCTGTATTTGTTTGAGGTTAGAGGCTAGATACTTGTT
GAAGAGCCTTGAATAACTGAGTTAAGTTCTTTTGAGGAAATTCAAGTTTCTTCTGTCATT
TCCACTTTTGTAGACATCTCCTTGAGATCTCTCTTATTGCTCTTGGTTAACACATGCGCC
TTCAACTTAAACAAATAAAATAAAGCAATGCATATGGACAGAGGCTGAAAACAAAAGAAA
AAATAATTTAAACTGGAAGAATGTTCCTGGGTAGGGCCTCAGAGAATGTGCCAGCTCTTC
TTAAGAAAGGCCACATTTAGCTGTTTGAATAGATTGAAAATCCCTCTTATTTTGATAAAT
GATTCAATTGTTTCCAGGTTAAATATTCATAAAATGCATCTATTCATTCACATAATCCCT
TTTAAAATGAGGTAAATTAAGGAAAAAGTAGGTCAATCTGCTGAGCTTTTCTTTCCCAAA
TGGTTGCTTCTGAATTCTTTAAAAAGAGCAAAGGTAGGCTCAGCAGACAAGGAACTCATA
ATAATGAGAGTACTATAAGCAATTAAACTGTCCTTTTGTTTTTAATCTAGCATTGATTAA
CAATATTTCATTGTAGGTGTCCTGCATGAAACACATCTCTCTCAAGGGCACAAGTCTTCC
TCATTATGCAACTAGCAAAGGTCCACATTTCAACCATTAACTCAAGTGTAGGTGGGAAAA
TGTGGTCACGAACTTTACTTAGCTTGTTAGAAAACAGATCATTGTGAATACCGACCAGGG
GCAGGCTCAAAAGTCAAGAGGCTCGGAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGT
CTACCATATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGC
CATGCGCAGTGCTGATGCGCGCAAGGAGTGCCGTGCCACGCAAGGGTGTCCCCCGCGTGC
GGGAGCCCCACGCGCAAGGAGTGCGCCCGTGAGGAAAGCCGCCCAGCGTGAAAAGAAAGA
GCAGCCTGCCCAGGAATGGCGCCGCCCACACTTCCCGTGCCGCTGACGACAACAGAAGCG
GACAAAGAAACTAGACGCAGCAAATAGACACCAAGAACAGACAACCAGGGGAGGGGGGGA
AATTAAATAAATAAATAAATCTTTAAAAATAAAAAAAAAAAAAAAAAAGTCAAGAGGCTC
AACTCATCCTTGCTGTTCGAAAGTTTTCTAGGGTAGGTGAGTTGCACAAAGACAGAAGCA
TTTGGAAGCTTTGCCTCTCACCTGTGCTCAATACTAATGAACACTGACACATTCAAGCTC
TCTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATACATTTTA
AAAGGAAAAGAAAATACAATTTTTTAAAAAAGTTACCAAAAGAAAAACACAAAAAGCAGT
TAGTATAGATTATTTCATTAAATACTTTTGAGTAAAACATTTGTGCTAGGCATTCAGGTT
GGGTCTCAGGTGCTTTGCATGAGCACCCACTCACTTGCTATTTGTCCGGTTTGGTAGATA
CAGCCCCAACTCTCATAATGCCAGATATAACTCCTGTCTGACATTGTGCTGAGGAGGCCA
CAAGAATCTCTACTGACCAACCCATGATGAGAATGTTTGTCAAACACTTCAAAACTATCC
CTGCTCCAAAGAGCCAGGGAATCTCTGCTAATCATGAGCACAAGCTTTACAGGCTCCCAG
GAGGAAGGGACCTAGGGAGATCAATTTATTTGCCCACTATCTCAAGGACCCAGTTCTCTC
CCTAGGGAAGCAGAGCAGACTTTACTGCTCAGTGGATAATAAAAATTTGAGTCTGAGTTT
TGTATCCCAGGTGGCTTATAAGGTACCCAATTTCTAAAGAACTGGACTGCCCCAGTTCCA
CCATTGCCCAAGGAAGGATGGGATCCTAGCACTAGAGTCTGAATTATTTTCCTCCAATCC
AGATTGTGCAGGACATGTTTGTTCTTTAAGGATATGCATTTAAAAAGGCAATCATCCCTG
TTTCTTTCTTCAAATGAAAATGGAAAAGGAAATCAGGAAATGTGAAGCAACTATTAAGAA
AGGGCTTAGCTCTCTGGTTTGTGAGCAGCCTGCTGTGCTGGCTCTCCTCTGGAAGGTCTT
TACAATGGCAGAAATGAAGTGTTAGCAGCGCTGATACCCTGGGCATATTTGTCTGTTTTG
GGAAATTTGGCTTTGTAAATGTATTGGGAACTAAAGCGTGTTGATTTCATTCACCCACTT
ATGCATTCATTCATCTACTCAACAAATATTTTTTAGCTCCTTCTATGTGCCAGGCACAGC
TTCTAAACTGTGGAGAAATAGTGAACAAGTCTCTCTTCTCACAATGTTTTCTTTCTAAAG
GGTATGGAGGCCAGGGGGAAAAGAGCCAACCAACAAGGACACAAATAAATCAACAGGATA
ACTTCAGGTAGTGATAAGGGCTAGGGCGAAAAGAAATAAAACAAGTGATATGAGAGAGAG
TGTATGGGGTGGGGGACAATTGGACTGGGTGGTCAGAAGAGACCTTGCTTAAGATGTTCT
GTGTTAGGTGAAGCTGGAGGGGACACTTTCCAGCCATAGAGAGGTCTCAGGCACAGACCA
TTCTAGATGGACAAAGGAATGCAAAGGTCCTAAGATGGGCTGGACTTCTAATTTTGAGGG
CCAGCAAAGCCAGGAAGTCTACAATATTGTAAGCCAGGGTAAGGGTGGTGTGAGGGCAAA
TCAGAAGAGAGACAGGGGCCAGATTGTGTAAGGGCTTATAAACTGTGGTGCTTTGTTTGA
ATTTTATTCAAAGTGCATGGGAACCCATTAGATGGTTTTGAACTGAGAAGCGACGTGGTT
TAGAATCCTTGTTTAATGCTGTGTCATTCTGACTGCTGTTTGGAAAATGGATTTTAAGGA
GACAAGAGTTGGAAGCAAGCAATACTTCTGGTCAAAGACTCTGCAGGAGACTTGGGCCCA
GTTCAGTTTTTATAATTTCCCAAACTCTAAACAAGCACACTAGGGCTTCTTTCTCTGTTG
CTATTACTTGTTGTGGCTCAAGACCATGAGCAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACCAAGAACACTGTTCGTTCTGGCTGAAATCCTTGACCAGCGGAAA
ATAGTTGATGTAACTTGCAGGAACATAATAAAGGAAACATCATTTTTCACCTTTAAAAAA
GTCTCCACAGAAAGATAACAACACATTATAATAATCATGTTTATGCAATTTATGGAAAGT
TTTGAAATCTTGGATCATTCACTGTCATTCCAATTTCTAAGGGTAATTTCTTATGAATTC
TCACAGCTATCTGTGAATTTTAGCTATTATAACTTCCTACATAGCTTTAAATACCTGGGT
TATGATAGCCTTTGAATTTAAAACAAATTAGTATTATGTATGCAGAAGCCACAGCAACAA
TTCGTCTATTTGAAAAACAAGGAAAATTGAGAGTGCTTTAAAAGTGACAACGATCTCATG
CTTTATGACTATTCGGTATTCCCAAGCAGGTGGGCCCGGGTCTAATGCCAGATGAAAATC
AACGCCAAGGACAAGTATAGACGGTGTTCCAGTTATTTTGGAGTCTAGAAATAAAAAAAT
AAACATCTATACTAAGAAACAGAATCTGAGCAGAGGTCAGTGAAGACAAGCTTTATTTCA
GGATTTAGGTTAAACTGAATGAAAGATAGATTCTGGCTATTAGAGAAAAATATGATATGC
TTTTCTTCACATTTTATGTTATTTTATAGCAGAAAATTGAAAATCATTATCACTATTATG
TTGGTAAGTGACCAAGTTTAAATCTTATGAACAGTGAAGTAATCATCTATGACTCTGGGT
CATTTTCTAACCCCAGGTCTTTTAGTTTCATTTTGTTTGGTTTCATCAACAATTCTTGAA
AGAATACCACCTTATGGTGACTATTATAATATGACAAGGTATGTTTTTAAATTCTGGCTT
AAATAAAATTAGTCTGGGTGTGAATCGTAAGAGCTGGAAATTAAAGTCTGAAGATCCTTC
AAACCTTTGGTTACTTTTTATAGTCCCCCTCTATATTCTATGACCTACCAACTCTAAGAG
TTTGTAAGAGCTTTTTCAGCCGCATTTGATTTGACCAACACCCTGAGGACAGTTTGGAAA
AAGACTTATTTTGAGCTTTATAAATGAAATTGAATAAGGTTCAACTGACATAAACAGACT
TTAATTAAAAATAAGTTACATATTTTTTAAAAAAATTGCTCAAACAAGATTTCTCTAAAA
TGTGTTTCTGAGCTTCCACAAATAAACTTACAAAATATAATTACATTTTAGCATAACAAT
ATAACAAATTCACTTGTTAGAAATCGTATTGTATCTTATTCTGAGCATTTGTTTCTCCTC
ACTTGTCAGGATGCTTGAAGTGTGTTTTCTGGTTGATGATGGAATTAGCATTACTAAGCT
GATCATTCCCTGTAGGTTTGTCTTTTGGTGTAAAAACTTGATTTCTAATTTGGAATGGCT
GTGAACATCCATGGCTAAATGTGTCTCTTCTAGTTACCTTTTGCATGTTTCTTAAAGCAG
GATTTATTTACCTTAAAGCAGAAGGTAAGAAAAGGAGCCCAAACTCCTCCTCTCTACTCC
TGATTGCCCAAGGCTTTGACAGGAAGATTCCATCTCCTTCTGGCACTGATAAGGCACAGC
AACCACAGAATGAAAATTGTTTATTTTCTTAGAGTATTTTTAAGCATTTTATTACCAATA
TTTATAATTGAACATGGTACCTATACTGATAATTTAAAATTCAACATATTATTTCAGAAA
GTAATTAATAACAGGTTTTTCTTATATGCTTTGAAATGAATTTGGATACTAGCCCTCAAG
AAAAGTACCTTCCTTATTAAGATACAGATGAGAGATGAGTGCTTTTATAAGAAAAAATTT
AATGAGTAAGCACTAATACAAAGAGTTTAGGCAAATAAGCGACGTGAGGATGTAAAAGAA
ATGATAGTCATTGCCAGGTGAAGAATCAAAGAGAGCGTTCTAGAAGAGGTGGGACTTGAG
ATGGTACTTGAGCTGGGATAGGAGTAAAGGAGAGAGAGAAGACAGGCAGATCTTCCCAGC
AGAGTGCTTTTGGTTGACTCCATAGAGGCAGAGCCTGTGGCAGAGATTTTAGTGTAAGTA
ATTTATTGCAGGAGGGGTCTAAGGAGTAGCCCATGAGAGAGTGAAAGGAAGCAGGACAGG
GCGGGGGAAGAAGCTGGGAAAAGATGTGATTTAAAGAGCACCTGAGCTTCAGCTCGACCC
ACCGGGAAGTCTGGAAAGAGAAATGAAGCACAAAAGTGGTTTTCCCTGAAGGCCAAGATG
TCCGGGTATTTTAGCCATATCAGCCCATCATTGGCTATGGGCCAAAAGGGTTGGGGGAGA
AAAAATGATGGAGCTTGCTGAGGGTTCCAGGGTGAGGTGGTTTGCATCACATAGGGCAAG
TCCTCAGCTGAGAGACCTCTAGAAGAATCTGGGCAGGACTCCAACAGAAGTTCCTGCATT
AGGGAAATAAACATTAGAATTCTAGAATGTAAGATGTGAGAGAGGAGACTGGCTGGAGGG
AAGGATTTCTGAATGCAGAGTGTTCAAGACTTCTCATTGGTGACCTTCATATTAACCCTT
AGATATTGCCACTTTATATGTTTTGAAGCTACGACTGTTTTAAAAGGAGTATTTTGTTAA
AAAAAAAAAATTCCATTCCATTCTCTTCCCAGAGACAGGGCACTTGATTGGTTTAGGGGA
GTAGATTTGGAGTCAGCCAGACCTGGACATACACTCTGGCTTGGTGCCTTGCTGTATTAA
TGGCTTCGCATAATTCCTTGACCATACTGTGCCTCATCTGTAACATGTGGGTGATAGTGT
CTGCCTCGTGCTTGTCGTACAGATGAAGTGCAATGATCCATGAGAAACATTTCACACAGT
GCCTGGCACAGGGTCAATGTTAAATGCATGGTATACATGACCTCATTCCCGAAGACTAAA
GCTTTTATTCTTTCAGTATAAGTATTTCGAACTTGTGATGCTTTCTGAGAAATGACAACA
CTGGGACTTAGAATGAGCAAAGAGATACCTGGGGCACACTGAACTTGCAGACCCTGAGAG
AGAGTGCCTCCTTAAATTCGTGCCATCGGTACCTCTGTCACCTCTAAATCAATCTTCATT
CTGGACTGGAAAAAAAATTGAAATTTGAAAGTCTGGTTTATAGAAATCCTAGAGCACACC
AAAAAAAACCATTATAAAAAGAGTATGTATTAATAGTGAAATGGCTTTAGCAATTCCTCA
AGAAAAGCTCCAAATCCAGAAGATCTCTGTGTCTCTCGTAGTGGCTTTCCAATATTCCAT
GAAAAGCATTCACATTGTTTTAATTCTGGTATTGCTATCTCGATTGTTTTAAGTCATTTT
AAATCCTTTTATAAGTTTAAATATAAACTTTAAACTGGCAGCAATGCAAGTGTTGAAAAT
ACACAGAAAAATAGTGAGTCACAAATTAATGAACTTGCATGTTCATTTAAAAGCAGTTAC
TAGCAAATCACTATATTGCAATGGAAGAAAGTTTCTTTTTTAAGATCGGTAATGCAACAA
ATCCTGTCCTAATAGCGGAAGTCATTTTTATGTGGGACAATCCTAAATCAAAGTAAAATG
CCGCAGACCTCTTACTAGCTTGGCTCTGGTGCTAATGAACCCAGGATATTAGTGCTCATT
TGTGAGCAGGATTCACGATTCCTTTACTGTGCAATATTCCTGCCTCTGGCTTTGGCTCAA
ACACATCACCACACACAGAGAAAGACACTGATAATAACAGAGTTTGACATACTTTATTAT
TTCCCTTCTGCCAGCATCATTTTATAATCCTTGAATCAAAAAGAATGAGAAATTATATTT
AAAAAATAGAAGCTTGATTTAAAATATATTATTTTTATGCCCTTTTATTTTCTTAATATT
ATTTTGTTTGCAATCCCTTTAAATTCTTCACTGATGATTAAAATATTAGAACTATAACTG
TTCATGGCATGATCTTTAAAAAAAACTTCTTTTTAACTATATGCTTCTCTAACTATATAA
CTTAGTATTTAGTGTAATTGTTCTTAGACATTATTAATTAAGAGTAGGCTGGGTTTTACT
CTTGGGAAATTTGGAATGAAGGAAGGGGAAAAGAGGTGGTGGGTAGAGGCAGGCTAGTAA
TTCTGTTTTTTCTCCTGCAGGGGTTTCAAATTGCCAGAAGAGCTGAAAGTTAAAGTCACA
GAGAAAAGGCACTCTTTAATTAAGTAAAAGCTTAACTCTCTTGATTTACTGACCCCATAA
ATAAATAGCCAAGCCAAATCACCACAAATGGTCAACCACCAGGAGAGTAGATGGAGTTTT
GCTTCATGGGTGGGCAATGTTTTGGACCTTATAGCCTATGCCCCCTCCTATAAGAAATCC
TAGGAACTGTCTTCTAGCATGAATGCACACTCATATTCCCAATAAATGCATTTTTCTCTT
CAAGTGCTTTTCAAGCTTTGTACATTAACAGTGACATAGTGCACCAGTTAAAAGTCCTAC
ATATATCACGCAGTGGCTACCCCAATCAAGGTAAATGGTCAGACCCCACCATGCAGTGCA
CAGTGTGTACGCTGGCCTTTTGTGTAATTCAGGCTAGTCCATTTATGACTGGTTAACCAG
GAGACCCTCTAGTTCTTTTGTCAACCACAGGCTTAACTGTCATAGACACTGAGGACAAAA
AGTATCCCTGCATCCTACAGAAAGAGGTTCTTGAAATGGCAGAATACTTGCTATTATTTA
CTAATATCCAATTTCTACCATAAGTCATGCCTCCATAGATTAAGAGGAAAGTCAATCCTG
TAGTTATTGAGTGATTGAGGCTCTGATGCTCACATACTCATACCTATCAGTGTATAGCAG
CATGCCAGGGGAAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTGAACTCTTTAACAAGGCTCATACAGCATTCATGC
TCTTGCTCTTGCCACTTCTACCATGTTGGTGCTTAGAATGAAGTTGAGGGGTCAGAGCTG
GGAAATGAATTTGAAGGCAATAAAGGTCTTTGAAAGTATTCACCATAATGACCTGACCTA
GTAAGGTGGTGATGGGGATGACAGGGCATGAATGGACAGATGAGCTTTATACTAGTTCAT
CCCAACAGCACTTGGAAGCTGATGAAATGTAGAGTGTTAGGAAGAAGGAATAAGGCGTGA
TAAATCATTACGGTTAAAAAAATCATGGAAAGACAGGTGTTGTTTTTTTTTTTCTTTTTC
CCAGGAGGTACTGGGGATTGAACCCAGGACCTCATACATGGGAAAGAGGCACTTACCCAC
TTGAGCTACATCCACTCCCTGGCTTTTGAAAGGTAGCAAGAGCCTCCTCCTGTTTGGATT
TCCCCCCCCATTTCCAGTTCCTGGGAGGCAGCCACAAGTAGATATCTAGGAGAGAGTTGA
GTATACAGAGTTGAAGCTCAGAGAAAACTTCTAGCTGCTGATAACTGTTGAGGTATTTCA
GCATTTAAATACCTATTGGAACTCAAGGCAGTAGGTGACATTGCTCAGGTCAAATTTGCA
AAGTGAAAATAAGATGTAGTGCAGTATGAACACTGTAAAAGACTGTCAGCAAGGAGGAGG
AAGAGATGCTTTGCTGGAGGGTATAATTTTTAATTTCTCATTGAGAGAAGCATCATAACA
AATTAAATTTCTCCCACATTTCAGACTATTTTTAACATGCTATCTTGCTAATGAAGAGTA
TATGTGAACTCTTGATATTCATGTGGAATGTATCTTGAGGCTTCAAATCTGTAAATATCA
TTTTGGTGTATACTAATACCAAGAAATTCTGTGATGCTTAAGTGTATGGTCTGTGTTACA
AGATATTCTCCAAATGCAGCAGGATCATAGAAACTGACTTCTACAGTAGCCTTGTGACCC
AATGCCAATGTCTCAACAAAGATTACAATTCTCACCCTTGAAGCAGGGGTTCCCAGTCCA
CTCGCCCCCAGTTGGAAGCTGCAGTCCAGACTTGGCCATCTGCTCCTCTCTGGATAGTGT
CATAGATGCATTTTTATTCTGGTGTATGTGTATGATGAATGCGTTTTCTGGCTGTATCCT
ATTATCCATGAGCAGCTTTGGTTGGAAAGAATTTCACATGACTGTGTGATCAACTTTTAA
CTTTTCCTCCTAATGCTTTTCTTATGAAGGGGAAAGAAAGAGGGAGAGAAAAAGGAAGAG
TGTGTGAGAGAGACTGAGTCAAAGAGAGGGAGAGATGGATTCTTAAACTACGCAAACTAA
ATTTTGCTTGTGATACATACTAGCTTCAATATTGCCTTCACTTCCTGTTGCTTCATTGAA
ATTATTATGTAGTCTTTACATTTCTCCTGAATCAAGTTTCTGTTGAGACAAGTATTTTCT
GAATATGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGACTAAGAACATCTTCAAGGTCCTCTTACAAGTGGGTTAACGTGCAGGGGGCTAG
GGTTGGGAACTTGAACATGCCTTTTGTGGGGAACATGATTCAGTTCCCAGAAGAAGTTAT
GGAGCAGTAAATCCGAGGTAAAATGAGGATCCTGGGCATCCACCAGGTTTGCTCACTCCT
CATGGATTCACTCCTACACACTGGTCAAACAAGGTTGAGATCCAAAGCCAGGCCTGACGA
AAATTATCAATGAATATTTGAAAAGCATTGCTGCAGCTGTTTGTGAATAGCTGAAACTTC
AAATATTAGATCTGTGGGTGCCAAGAATCCAGTCATCCTTTCAGCAAATATCTTTTGACC
ACTGACTCTGTGCCTTAAGCACTGTGTCAGAACTGAGCAAAGTCAGAACCATCCTTGCTC
TAATGGCACTTGCAGGCTTGTGGGGGGAAACCAACTTTAATCAAATAATCAAGCTAATAA
AAAATAATTCGACCTGAGGTTAAAGCAAGGAACAGGGTACTCATTAGTTTGTAATAAAAG
AAAGTGACCTCTAGGATGGACGGCAGTAGCTCAGAGCTTCTCTAAGGAGGTGATTATTAG
AAACATTTTTATGTAAATTGGGGTGGAGCAGAGAGTTGGGAAAGATACTTAGAAAGAGAG
AGAACTTTTAGAACATAGTCCCTCTCCTGGTACACCCCAGAGAGCACAGAGCCTTCAGGG
ATCTAAAAATGTTGCATATGGTTGGAGCACAGAGGTAACGTGGGGTGGAATGTGGGGGTG
GGGGTTTGAATTAAGGAAGGGATCAGGTCATGCAAGGCTTTAAAATTTATAGTAAGGATC
CAATGCATTTAATCATGACTGTCTTAGTTCTGGGGTTCACAAACTTGTTTTATAAAGGGC
AAGATAGTAAACATTTTAGGTTCGGGCAAGCCATACAGTCTCTGTTGGCAATTATTCAAC
TCTGCTATTGTAAAAGGAAGCAGTTGGAGACGTGTATGTCCCTGGGTGTGGCTGTGTTCC
AGTAAAACTTGATTTACACAAACATAAACCAGCAGTACCCTGTAGATCCCCTGTTTTGGA
CACTGCGGAAGTTAATGCTATATCTCCAAGTTTTTCTGGCTGAACTGGTGCAGGGATATT
TTGAGGGCTTTAACAGTGCATAGTCAGCAAGCATCTGTGTACTTTATATATTGAAAATTG
GGTTAAGAAAAAAAATGGACTCCTTTGATTTTCCTTTTAAGTCATGTTGCAAGAAGGAAG
CAGCAGGCTTGTTCATCTACCAAGAACAAGAGCATAAAAGACAAAATCAAAGGCCAGAAA
CTGGATTACTAGAGGGAATGAGTACTAAGGAAATGTTAAGAAGGTTTCTTGAAAAGCAAG
GTTCACATGGGAGGTGAACTTGTTCAACATGCGCATTAACAGGCCTCCTGCAAGAACTAA
CTGCCTTACGAGGGCTCTGCCCCAGCCTGTCTGATGTACAGCACCTGGGATCTCCATAGA
CAACAGACTCTGTACTTGAAAAGAATTGAGTTTCATAGTGCTCATATTATAGAGAATGAT
GTACTCTCATAAAGACATTCAGATGAAATCTGGAAAAACTAAAAAATCCTTTAAAAGTGT
ATTTTGCTCACTCTTGTATTGATGGCAGTAACTTCTTTGAGTAATTTCATAATTTTTTTA
AAAGGTTGAAGTGGTCCAGTTATAAAATTAGTATCAAAGTCACATAGTGGTTTTAAAATA
TTTTGAAATGATAGTACTGGACAGAGTTTGAAGAAGGTATTTATCACTCTGAATGGGCTA
GATTATGCTTCAGTAATGACTAACCCAGAATCTCAGTGGTTGTAAACAACAAACTTTTTT
TTTTTAAAATATGATCCATGTATGTCGTAGTCAGTGGGGGGTTCTGCTATGCTCATGGAA
CAGTCACCATCTCAATGCTCCTGGTGGCCATGAGAGAAGCAGAAAGAGCTCCAAAGCAGT
TCAGTGCCTGGCCTGGCCATGACGTATTAATTTTTCTCACAATGCATTGGCAAGACCTAG
TGGAATGGCCCCCGCCAACCCATGCTGGGTTAGAGTACGCAGCCCTACCACCTACCCAGA
AGGTGGAAAGCTGAGACTATTGGGCAAACAGCACTACAGATGATCGCAGAATTTTTTGTT
TGCTTATTGTATTAATGCCTATTACTTTGATTAGATTTGGAGCAATATGAGAGCAGGAAC
TGTGATTGTTTTTGTTCTCAGTTTTCCCCACCTGGTATCTAGAACAGTTTCTGGCACTAG
GAGGGATTAAACAGATACCTGTTGAGTAGATAAAGCCATCTATCCAGTCTAGCCATTTAA
TGTTGCACTCAAGCCATAGAAAATCATCCACTCCTCTGGTCTTCAAGATCTTTAGGTATG
CGAATTTTATGCAATATTACCCTTTGAAGTCGATGCAAAATTATTGTTGAAAATCGTAGC
CAGAAATCTGTCTTTAAAAATTGTACCTGGGTTATAAGGACCTGAGGATAATATTTTTCT
AAAATGGAAACTTTTCCTCACTCTAACAGGAAAGGCTGTTGAGATGTAGAGCAAATTACG
TTGGATGTTAACTCTATCTGTACATATTAACTAAGGTATTCTGAAACTACTGAACAACCC
TCTAAATACTTGTGGTTTAACACATCAAAGTTTCACTCTCACACTACTTTTCCAATCTAG
GGGTTGTTAGGGAATAATGGAAAAAGGAAACTTGGCTTCCATTCCACTTCCTTATTAAGG
ACAGAAGGCTTATTATGGGATTGCCTCTCCCTATGTAAGAAATTTTGCTGGTTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCTTCAGCTTTAGAATGAGTTCTTAGCCCCCTCCCCAAATGTGGCTGTT
ATGCACTGTTATGGTACAAAACAATACAGGTCTATTAACTGCTGTTAGGAGACATATTTT
ATGAATTGGTGCAGTATTCACTTCTCATATCAAATATTAGAACAATTCAAGAGAAAATGG
TTATTTTACTTTTATAGATTGATATCACACACACACTAACATTTGATGTATGTTTTTAAA
TGTTTTGATCATTGTCCTATAACATACCTCGACTTTCTGCCTGGTGAAGGCACTGAAATG
ACAATACTCCATGGGTATGAATAGCCTGCTGATGATATAACCTGTCAGGTTCTAGACTTT
CATGTTGATTGCTGTTAGCAGAGTGTATAGGTTGACTTTTAGTGAGGTATGCATGTTAAC
TTTCACGGAAGACAACAAATACTCTTTGGGACTCAATTTTCTGTATTAAAAAGAAATCTT
ATTCTTTTTTCCGAGGGACATTTCTCATGGAATATTGGGTCATATTAGGTTAAGTTTAGG
AAACTCATGTTTATTGAGCTCTCCCTCCGTGTGTCTACTAAGGAATTTCACATCTATAAA
TAAATAAGTTTATTTTTCCAGGGTGCCAGAGAGATAATGAGACTTTTATTTAAAAATTTA
TCTACCAGCTGAAATATCATGATTGTTTTTCTAATACTCCCTCTACGAATACTTAGTGAA
CTGTGTTTTTGTTTTAGGAAATTGGAGTAAATATTTAAATTTTTTGCTCCTTGAGAAATA
CTTTCAACAACAACAACAAGAAAAGATGATTTTAATATGTATATCTAGGTTTCTTTGGAC
TGATACTAATAACATGAAAATAAATCTGGGATACTAGTTATTGGACAAACATAGGATTGC
TGCTTTAAGTTGAACTTAAATTAAGTGTAAGATAGCATTTGGGAAGTCCTTGTGCTTATC
TTCCCAGTTATAATGGTAATTGTTACTTGCCCCAAATAAGCAAATGTGTTCTTCTCCTGC
ATTTCCTAACTTGATGAGGGACAGTGTAATCATGCAGATGATAAGGTTAGAAACCTGGAG
TTCTCCTATCACACTTCCTCTCTCTCACAGTCACATGTAGTTAGTCCAGTAGATTTCAGT
CTCTAAATACTTCCCAATTCCATCCCCTCTACCTTACTGTTTCTTTCCTAATTCAGGCCA
TCATCACTTTTCAAGTAGCTTCTCAAAGATCAACCTAGTTGATCCCCCTGCAGTGATCTT
CCTATAATCTGCATCTGATTATATCACTCCCCTGATTAAAAGTCTTTGAGACTCACCGTC
ACTCAGGATAAAGTCCAAAGTCCTTTAGGGTTGGGTATGTAATACCTCCTTTCAGAATCC
TGTTCTTGCCTCCCTTTCTAGCCTCAACTTTCATGACTCCTTTACACACAACCTGAACCT
GAACTATTGAAAGTGATGTCCAGGGAAGCGGACTTGGCCCAGTGGTTAGGGCATCCGTCT
ACCACATGGGAGGTCTGCAGTTCAAACCCCGGGCCTCCCTGACCCGTGTAGAGCTGGCCC
ATGCGCAGTGCTGATGTGCGCAAGGAGTGCCCTGCCACGCAGGGGTGTTCCCCGCGTAGG
GGAGCCCCACGCACAAGGAGTGCGCCCCGTAAGGAGAGCTGCCCAGTGCAAATGAAAGTG
CAGCCTGCCCAGGAGTGGCACCGCACACATGGAGGGCTGACACAGCAAGATGATGCAACA
AAAAGAAACACAGATTCCTGGTGCAGCTGATAAGGATAGAAGTGGTCACAGAAGAACACA
CAGCTAGTGGATACAGAGAGCAGACAAATGGGAGGGGGGGAGTAAGGGGAGAGAAATAAA
TAAAAAATAACTCTTTAAAAAAAAAAGTGATGTCCAGTTACTCCAAAATATCAGGTTTTC
TCTTGCTTTGTAAATACTATTCTTATTGCCTTCCACACAGAAACACAACCCCTGACTCCC
AGCTCATCAGCTCCTACTCATCTCCTAATTGTATCCCCATATTTGGGAACTCTTTTTCTA
GTTTGCAGTTAGGTACCCAACCCCCCTGCTCTCACTGCACATAGTCTGTACATCTAATAT
AACTTAGTCACACTCTATCAAAAGTGCTGTTTTATTTGCTTGTCTTCTTCACTGCACTGC
CCCTTGAGGGTAGAAGCTGCATCTTCTTTATTAGCTTTTTTTATGAGAAAATTAAAACAC
ACAGAAAAAAGGAAATGATAAAATAAATACCTAAGTTTCTATTTCCTAGAAATGACAACT
CTTGACTTGTTCATTTTTTTTTCTTACTAAGGAAATAAAATATAACTCATCTTTATCTCT
ATCCTAAGGCGTCCTCCTTTTTTGCCTCTCTAAGAGGCAAACACCATCGTCGGTTTGTTG
TAATTTCCTGCCCAGTAAAAATGCTTCTACCTACATATTTTGGGCCCATAGTCAGTGTAT
TATAATTTTTTGTTTAATGTTTTATTTTTAAAATGGTTTCATAATGTCCTTAACATACTG
ACTCTTGCCATTTTTTCTCATCCTTATGTCAGTATGTATAGAGCTCAAAAACATAATATT
GAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTGCACTTGCTGTCTGCTCTCTGTAGCCATTTGTCATGTGCTCTCTCT
CTCTGCTCATCTTATCTTTAGGAGGCACCAGAAGTGAACCTGGGACTTCCCATTTGGTAG
AGAGGTGCTCAATTGCTTAAGCTCCCTCAGCTCCTTGCTTTGTTGTGTCTCTCATTGTCT
TTCCGCTTTTGTCTCCTTGTTGTGTCATCTTGTTGTATCAGCTTGTCATGCCTGCCCATC
ATGCCAGCTTACTGTCTTGCTCGTCTTCTCCAGGAGGCACTGGGAACCGAACCAGGACCT
CCCATGTTGTAGGTGGGAGCTCAGTTGCTTGAGTCACGTCCACTTCTCTGGATATGGACG
TTTGCATGTGGTCTTTTTTTCCTGCAAAGAAAGTGAGACATTTCTCACCAATCTTATTGG
TTTTCATTTGCATTTCTATGTAGTTTAATCCTGATGGTTACTTGGATTGGGATAGACATT
GTTTACCTAGATTTTACTCCATCCCTTAGTTTTCCTGCGGGGAGGACCTGACACTCTAAA
TCTTTGTATCATAAAACAATATAAGTTGTACATATACACCTTGGGAATCACTTGACTGCA
TTAATTCAAGATAGTATATATTCTCTGTATATCATCTGCAAATTAGTTGGTTGGACTAAA
ATACATGGTTTTTATTATGCAAAGACTGTATTAGTTTTTCATCTTTTGAAATAAATCAAA
GTATATTATCCCACAAATACAGCACTTTAAAAACTCTTGTTCATAGCCTGTCTCATTCTT
TTTGGATTTATGCTCCTGATATGCCTGGTCCTAAGTGTGGACTGAGTCTCTGTGAAGGAA
GGTAGATCAAATGGTTGCTTGTGCAGAGTGGGGAAAACTGATGGCTTCCTGGGCTTTTTG
AAAGGTGTTGTTTTAAAGCACGATTAGTCAAGGCTTACAGTATAGTTAGCTGCCTGAAAA
GTTCAAACCACCGTTCAATTTAAACTATTCAGTGCTTATGGCAAAATTCTGATCTTTTAA
TGTTGGGGCTGGAGTAGACATTTTGTTGCAAAGTTAGGCAAACTAGAGACAAAGACAGTG
GACTACTGCTGGGGTGGTTATTTTTCTTTTACTAAGAAAGAAATGGAAAGATCTGGAAAT
GGCAATAAACTAGCAAACAAAATGAAACAAAAATTTAATGCTCATTTAAGAATCTAATTT
TGATCTACCAATGGTTTAAAATATTTTTATGAAAAATGTCATACTTATAAAAATAGACAA
TATAGAATAAAGAACTCCTCAAAAGTTACTAATTTATCACCTAGATTTTTAAAAACCTAT
AACCTTAACCACTCCCCTTATTCACCAAAGGATTTAATCATGTATCTCTAAAAGTTATGG
GTTCTTTTAAAAACATAAGTCCAAAACCGTTGCACACTAAAAATGTAAAAATAATTATTT
CATGTAGTCAATATTAATGATCTATCATTCCTTTCTTATATATTAGGCTGGAATACATCT
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
GGGGAAATTCCAGTGTTATATCTTTAGTTTTGGAAGGAAGAGTGTCATCAGTTCAAACAA
CTATTAGCACAGAGATGATAATTTAAGTTGGATATTGATTCAAGGAGTAAATTCTTGGGA
TTTAGAAAATTGTACAATCTGTTCTCTTCATGGGGGAAAAAAAATCACCTTTTTTGTGAC
TCTGGTTTATTTTTTTCCTCTGAGAACAGCACCCTTTTTTGAAGCTTATTTTATTCTCCT
AGGATTTGTTTCCTTCTCTTTCTTCCCCTTTTAGGATGATAAGTGGTTTACAAATAGAAA
TTTATACCAGCTGACACAGTCCTTTTCCCTTCTACTGTTTCTGCATTCCTGAATTATGAA
ACAATATTACTTTTTTTTTTTTTTTGGTGCAGCTCATGCTCTCAAAAATTTAAATGGATA
AAGGTGCTCCATCTAATCTATTATGCAAGCAGAAACATCTTCATATTTGCTTCTCAAATT
TTTGAAGCAAAATATAGTCAGGTTTGTAACATCACCTAAAAATTCATTTTAGAATTCCTC
ATAATAAATTGTAGAAGTAAAGCAGTCTGCCTCCTGTATTAAACAGTAGAAAAGCTTGAT
TTTAAAGAGCTATTTCTATTTTACTAGGATACAAAAAATCTGTGAGAGTTGATAACTTCT
TTAAGTAATGCTATGGGTTAAACTTATGGTTAGCTAGGAAATCTGTTGTAGGACAAAATC
AAATGAGATTGGTATTACATGTCTAATTCAAGGATGAGTTATTTAGGCAAACTGTCCATT
CAAGTTTAACTTGTCCTAAATATTTCATATGTACTCTTGATGTCTGTACATTCTCAATGA
ATTCAAAACCTTAGAGGTAGTCCCATGTGAGCAGTAACTTGTGAAATACATTCATAGTCT
AGTAATTTATTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGATCCGCCGCTCTTCTATGACAGGGAA
GATGCTAAGGATTTGGGAGTATACATACATCATTGCATTAGCTTAGTCAGTTTTTAGCTG
GCTGAATGATCCAAATTTGCAAATGAGATGTTTTCAGTGCATTGCACTAAGAACATGGCA
CCATTCCTGGACAGTAGGTTGGAGCTTGTAATCTCCATGGTATCACATAGAAATCCATAT
GTGAGAATGCTAAAGGGATAGAGTACGATAGGTTTAGAGTCTGATATATTTTGAGTACCT
TATGATGATATGGATCAATATTTAGGTGAGTGCCTTTCATTTACTTTTTAGCTTGTTTTA
TTTGTTTTATTCTCATTTGAATGAATCTGTGTAGTTTCATCTTTGAAACTCAAGTTTATA
TTGAATATACATTCTATTGTATATTTTATCATGAATATTGTTTTTACTAAACTGCACTTA
CTAGCTTATAATAGGAATCACACTTATGTACCCAATATCATTTTCTACCTTCTAGAAATT
TAGATATAATGAAGTACTCTTCATGGGTTTGGTTTTTCTGGGCAGAGAAAAATAAAAACC
CTTATAAAACTCCTGACATTGATTTTGTAGTCAATGGAAATGTTTTTGGGGGTGAAAATT
CTCACGCATATTCTATGTCATAGCTTATATCTACTCAACAAGAATTCTACCACATTTAGT
CGAATACTACTTATATGTAGGTAGTTAAAGATTTCTGTAGAAGAGGATGAGAGGTTTGGA
TAAGAACCAGATATTTAGCAGAGAAATCCCTTGATTCCTTAGATTTTTGACTCCTCAGTG
AAACATTTAATTACTTAGTGATCTGTGAATATCAGAATTCATCATTAAAAATCATGGTTC
ACCTTTTTTTATATAATATTATTATTTCTGATTCTCCAAAGATGAATTTATGGGATCTAT
CTATTTATATTTCATGTTAATTTGGATTAATTTTAAAAATTTAATTCAACAGAATTTTGC
TTATGACTGTTATTAAGTAACCTATTTAAATGACTCATTTTCTCTTTTTAATTAGTGAAT
ATTTATGTCAGGGCCAGGCTTTTGCAGAGATGAGCATTTATTTGGCTAAATTTGTCTTAT
TTGTAAAACAAAACAAGAACGTAGTTAATAGACTTAGTTTAAGCTGAATTTTCTCTGTGT
ATGATGAGCTAAGTAAATGCAGACCTTTTTTATTTGCTATTTTTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTCCATGGGGAGGAGGAATGGCCT
AATGGTTGTTGGATTTTAGACCATCCTTGAAATAAACAAAAAAGACTTATTAACATCTCT
TTAAACTTTCAATTATAAAATAATATCAAAGTAAACTTGCTTATTTTCTAAGGATTTTAA
TACTAATATTTCACTAAATTGATGATTATTGATAGCTTTTTTCTCATTACTTTTAAATAT
TTCCAGTAATAGTAATTACATAATTTTAATCAAATTCTAGATACAGTATGGAACACAGAG
CTTAATAAATGGTTATTACAGAAATGCCACATTATTTTCATTCTGGAAAAGTTGCCTGTT
ATTTTTAAACTCTGTAGATTGACCCAAAGCTGCATCTAGTCAAGAGTTTCTGTCTGTTTA
TTATATTTACCTTCCTACTTATCAGCTCTCATATTATTTTTGTTGTTGTTTGGGAAGATA
GTTGGGAAGTTTTCCCTGTTTATTCTGTTCCTTCTTGTTCAGAACTGTCCATTTGATATT
TACTGTAATTTTAAAGAAAACATAGGTAAGGCAGTTTATCTTAAAGGTTAGATCAGCATC
AAATAAACCTGCAATTAAATAAAAGCGTTGGTGGCAAATATCACAAATTAGATAAGAAAC
AACTTGATAGGTCTCTAAAATGTAAACTTCCATAATTGGGTTCCAGTGATGTGTCATTTG
GTGTTTATTACCATATGTAGGATATGGCATTGTCCCCTGCATAATAAGTTTATAGAATTT
TAATGTGAAATTTTAAAGTACTCTTTCCTGAAATCCAGGATCTTTTGATTTGTGTCAATG
GATTTTTGGGTAAGAAATGGTTGAGAATCTCAATTTAATTTAATTTATTTTTATTTTTGC
TAATATAAACACATTTGTCTCAGTGGTTTCTGTGCAGCTGTTCTCAGAGGTTCAGAACTA
GCCGCATGATCTCTCATCTTTTCCCCTATATTCCTGAAATTTGGGACTGGTATGCCATTA
ACCCTTCTATCCACACCATAAGCCACACCATGGAACCCTCCTATACAACCATCATCTACC
CTGTTACTAAGGCCTGTGGATGCTGCCTCCGACATCTTTTTTAATCTATTGGCTTCTTTC
CAATCCTAGAGCCAGTGCCTTTATTGAAAATGTCAATATTTCTTCCTTTGATTTCTGGAC
AGCCCCTTAAGTTAGTCGTCTGCTAGTTTCTTTCCTTTCCTCCCATTCTCATACCACTCT
CATGCATACGATCCTTCTAGGGACCCCTATGGTCCAATATAAAATTTATTTTGAATCTTT
TAATGACATGCGGACCCTTTATAATCTGGTCCCTGCTAACCAGTCCAGCCAATCTCTGCC
ACTTCTCCCACTGATGCCCTACGCTCCGGTCATGCTAAGCTGCTTGCAGTTCCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTATGATTCACACAGCATCAACTTAATTTTCTGGAAAACATTTTAGGAACCAC
AAATACATATTGTGCTTCGGACTTAGAATGTTTACTGCAGTGTGGTATGTGATTTTTCTT
TTGGAATACGTAATCTAAACATCTAGATAGAAATGGCTGATTTTGGCATATAGCATATTT
AACTATGAAACAAATACTGTCCTACAGTAGAATATCTTCATTCATATAAAACCTACTATC
TCTAACAAATAAAATTAATCAAGTAAGAAAGACATCCTGTTGGTAGCTCACTATCTCATT
TCGTGCTGATATGGAAATGAGGCTCTCCCTGGGGAGTATTTGGATAATCTAGGTATTAAT
TCTTTAGTCAAACGAAGACTTAATTAATATAAAAAGTAAATGTTTATAAAATGCTTGAGC
TACCTGGTAGAAATAAGCTAACTTTCCTCCCAGCTAAACCTCAATCTCTAACGTAAATAT
TAGGAACTTTCTCGGCTTTTTCTTCTAAACACTTTGGAATTATGGCTCTGATTCTTTAAA
AACTGAGTGGTGTAGTGGGTTTTTCAAACACTTGAAAATTGTAACAGGTATTTCACACTT
CCTTCTAATTAGGATGATTATTTTAAAGTCACTTTAGACTTAATGTAAAATCCAGGCAGA
AATGAGAAATTAGAATGGGTCTTCAGAAAAATGAAATATGCTTTTGAATATTATGGAGTC
ATAAATCAAATATTTGACCTTGTGTGGCTTCTCAAATGTCCATTTTCAAAATGATAGAAG
CAGTTAGAAGGAAAAGACTATGAATTTAGATTGAAGGCCAGAGGACAAAACACTTTAAAT
TACCTTGTTATAGACACATAGATAGCAAATGAGACATTTTGAAAATTTAAACCCTTGGAT
ATGATATCTCAGGCACAGATTAAGTTCTCTACACACACACACACACACACACCCAGACCT
GTGCACACACCCATATGCACATAATGAGGCTCTTATTGCCTACCAGCTGTGTTCCCATTT
CAGAAGATGACCTTCCTATAAGTTTCCTGTGTAACTCATAAAACACATGGCTCTGGAGAG
CAATTATCATGACAGGAGGCAGTGCTTTCTTGATTAGACAGTGGGGTCCTGGTTTCCACC
TCTGTTTGTGAAAGATATTAAAGGGAAGATTAAAGTGCTCCAGTGGTTCTGCTTGCCTGA
TTGTAGCAGTGAAGGAGACAAAATTGATTCTGGCTGGTGGCACAGAGTTCCAGTGCTCTG
CCGCAGCACCTGGTGGCTGGCAGCTGGTGGGGATTATTGCAGGTGTCTGTCAGGAGGTGG
TGGGCAACAAGAATAAATCAGATTTAAACTGGCTACTGGGGGGCTTTTCTTAAAAGATGT
GAAAGTCTTTTTACAGTTAAATATGTTAATTCTAAGCGGTGAACCAGAATGAACCTGTGC
ATGTCGAGACAAACTTGTATTTGCTGACTCTGAGTAATGATCACACGTGCTCAAAAGTGA
GGACCCTCCTCTCCCAGAAATACAGCACAATAGCCAGGCTCCCTAAGAAAGAACCGTGAT
ATGAAGGATAAGCTATAATGTAGTGTCTTTTTTCTCATTGGTTCAGGTGAAATGGAGGAT
ACAGCTCTGAGAATTGGAAACTCATATGGCAAACGGCCACATAAACAATGGATTTGAGGA
AATCAATTTCCACTCATCTGGAAAATTCTCTCCTCAAAAGAGAAGGGATTTTAAAACTTT
CTTGATGTATTTAAATTCAACATGTCGTTCTCCTACTTTGAATAGGGCAATAGTGACTCT
AAGGTCATTATGTGGATTGACTTTTCCCTTCCTAGAATGTAATGATTCAATTTACTAGTT
GAGGTAAACTAGGAAGAAACATTAGTGGGTGAATGGGGAGGAGAGAAATTTGGATTATTA
CTTTATTATTTGCCATGGCAATACATACTTCCACAATCTATCAAGCCCAGTTGTCTTGTC
TAAATATATCTTCTCCCTGAGGTAAAATTTTTTTTTAAATTCAGAAGTTACTTTGGGGAT
GTGTGTGTATTTATTGCACATACATATGTGTCTAAAATATGTATTCAAGGGTTCATTTTT
TCATATTTAAATTTTTATTCATGAGAAAAGCAGATTAAATTCCTTAATTCCCAATTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCCTTGCTCTTTTTGGTAACAGTGGGTAGTAAATGCAACATGAGATCTGCTGA
TTGTCCTCCTATTTAGAAGCCTAAGATGTGCCCACTCCCACCCCTTTTACATATTTATGA
AATTACTGTGACTTGTCCTTTATGTCTTTTCAAGCATTCCTATAATTAGGTTAGGCTCTA
CTTACTAGAGGTGAACTGCTCTTATTCTGTGCACAGGTGGCTGGGCCACCACTGAGTCTT
TTTTAAGCATTCAGGCTGAACAAAAGCAAGATCTTCCCAGATTGCTTTTCAAATCTTCCA
TTCTGAGAGCACCTGTTTCTCTTAGTGCTGTTTATTTCAGGACTGTTAGGGTCAGTAGGA
AATCTTTTCAACAAATTTGGTTTCTTTTTTTGAACAATTTTGGTAGTTTTTTCACCTGCG
CCTGGGAATTCATTTTAAGCAGTAAAGGGATGGAGATAATGGGTAAGTGGAATCTAAATG
TCCTGAGGCTCTTTTATCATACTAATTTTTATATATAAATCTTGCCTGGTTACACATAAA
AAACTGTGAGAAAAAGAGTTGGTTTAATGCTATTGGATGTGAAAAATGTATTGAAAGGGC
CACACATGTCACCAGGCTCTTTGCCTGCATCTTTGCCCTTTTGCTCTCTCCTATTCAGAA
CGCAATTGCCAAGTCTCAGGATTAATTTTAGTCATTTCATGCAATTCTATACTCTACCTT
GTCTTTCTGCAGAGCAAAGATAATGTTGTAGTTCAAAACTCGGCCATCCACAACCCTGAG
GGAATATGTTTTTATTATTTTTCAGCAAGGACATTTAAAATTTCCTTAACTATATTTTGC
AGTTGCCTGCATTCTAAAAAGAATATAGATGGTAATTTTACCTATTTTTGTGACTCATTT
ACCATTATTGTAATTGTAGTTGTAGTGTGCAGAGAGTGATAAACTATGCCCCGTCATTTT
GAACTGTTTTTATTTATGTGCAAAGAACCCCAAGCCCTATACAGTCTTTACCCTTAATTT
CCTTCTTCAAAACTACAGTAATTGGAAAGAAAAATTATTAAAATCTGTATAATATTTCAT
GAAATTAAAAGAATTCTGCTATGAATAAAGTCCACATTTATTTTTGCTGTTTTTGGCATG
CTTCTTTTTTGCTGGATATGGCCAGTTTAATTTTTACATGTCTCTCAAAAGTTATTGAAG
TTTTTTAGAAATAATGGATTTTTGTCTTAGAGGAAAGATGCTATACAAATGATGCAAATA
ATGCTAGCTCACAAAAGTACAAGAATATGCTGTATTGTATTTTTGGTTCATCAAGAATAA
ATGTTTGCTTGACAAAGTTAATTACATAGCTTATAAATGAAGTGCAATGAAGAGAAAATA
ATTTTAGAACCTACTGTGTTTGTTCTTCACTATTTATGTTTTTGCCCATGGCATATAGAC
TTTTAGATTTTTTATATTAGAATCAGTGGCACATACACCATTTATATGATACATATAAAA
TGTTAATTTTAAATAGATAAGTGCTGTAATATTCCCATTCCCTTCAACATAATCATATGA
CACTCATCCTTTGAAGATTGGCACAATTCCCATCTCTCCTTGAAACATTTTCAGTTGCCA
TCAGGCTATGGCATTAAATGCACTTTTAAAGTTAAAAGAATATGGGAAAATGTTAACTAT
TGAATCTAGATGGTGGGTATACAGTATTATTTGAAAAAGTCTTTAAAGTTTTCAGTGTGA
TCAAAATTTTTCATTTTAAAATTGGAAAAAGTAGAATAATGTGATAGCAAAGACTAGGTA
GCTGTTAAGAACCAATATAAGAAACTAGCATGGAATTTTGGAGAAGCTGAAAGAATGCTA
GTATGATGGAGCATAGAAAGTGAGGTATATAAGGCAGCCAAAGGGGTGCTGATGCAAAAT
ACCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGACTTGAGGTACTGTTTAGATTTACAAGTAGAGCTTGTATT
TACAAGTTGACTTGATATTTGGGTGTGTGGTTTGGTGTTCTTGAAGAAATGAGTACTACA
GTTGCTGACTTGTGAGTCTTTGACATGTAGATGCTGTCTAAAGGCACAGTACTGAGGTAA
AGGTGTTCATGTCACTGAGAAAGGAGGGGAAAAAGGAAGGAGTTCTTACCAAGTATGGAG
ATACCTCCACATTTAGTTGTTGGCAAAGGAGCAGGAAGCAAATTAGACCACTAAGGCATA
GCTTAAAAGTAGAAAAAAAACTAGGAGACTTTACTTAGTGGATGCAAAGAAAAGAAACTA
TAAACATAGAAGACATGGCTGACTATCCAATATTGTTAAGGGTTCAAATCATGCATGGTG
AGAACCCATACATGACCACTGTATTTCGGAAAATGGAGGTCATGAATACCAGACAAAAAG
ATTCTCTGTGGGGTTATGTGAAGGATTAGAGAAGGTTAAGAAAGGAATGGAAAAGGAGAA
AAACAGACAATTTTTTCAAGAAAATTATTTTCTCTGCAGGAGAGATGAGCAATAGGATAG
AATGCAAGAAAGAGAGGAACTAAGTAATTTTTTTTTTAAGGTTGTGCTTTGAGAACTGAT
GGGAATGACCCAACAGAATAGGGGAAATGTGATGATTCAGAGAAGTAGGGATAATTGCAG
GAGTAAAGTCCTTGAGGAAATGAAATGGTTATGATAGAGATTTGCAGACTATATGTGGAG
AGCTTGGCCTTTGACAGGAGGAGTATGGTTTCATCGATTGCAAGACGTAGGAGATAGAGT
GTAGATACCTGTAGGGTTGGTATAATGATGTTGCAAACACAACATGAGAAGGTTTCTGTC
TCATTGCTTCTTGTTCCTCAGTGGAGTATGAGGCAGGTCCAGCAATGAAGAATAAGGAAG
GGAAGAGGCGCATCTGGTAGATCTGAGGAGCAAAGAGAAGCAATGGATGCCTGTTTATAT
TCCACTGTTTTTTCTTATCTTGAGTTTAGATCCTTTACATTTTTTTTTCATCCTGGCCTG
GACACCCTAGCAACACCTGAAGCTGGGCTTGTCCCCTCTGTACTATTTCCAATTCACTTG
GCAGGTCTGGTTCTACATTTTACTCTTTCATACTTCATTCTTTATCCACACATATTTATT
CCATGTTAACTTATTGAGTACTGAGAACTGTATGTACTCATTCCAAGCTTTATTTTTTCA
CCATCCCCTTGTCCAGATTTCAGCTGAAATGTGAGAAGCCACATAAAAGTTGCCTTCAGA
TGGGGCATTAATTACACCATAGTTCTCTGAAGCTGTGCCTTCTCTGTACAAATCAGAAGA
GAGATGCCCTTCATTCTGTGTACACTGTGCTATATTGCCTTTAACTTTACTGAAGAACAT
CACCAAAGAGAAAAATATATATATATCCCTAGTTAGGTTTGGACTTCTAATTTTGGGGGT
TAAATATTCTTACTACATATTTACTTTGAATCCGATAGACACATATTCAGATCCCAGCTC
CCCTGCTTGCTAGGTACATGACCATGGGGAAATTAACCTCTCATCTTCAAAATGAGGAAT
ATAAAATCTAATTAATAGAGCTGATAACATGATTATGAAAAAGTAAGGATATAAAGGTTA
CGAAGTAATAAATGTTCAACATGGTCATTAGACTCTAACCAAGCATGTGTATATCAGATA
TTATATTCTAACAGGGAAGGCTATTTGGCCTTACTGCTTTGAAATACAAGTAAGAAACCT
ATTCAAATAAATTAAATAGAATTTATCCCAAAATAACCAAATTAGTGCTTCTCAAAATAA
CTGAGAATACTTTGGTTTGAAATTGAACTCAATATAGATCATTTATCGATATAAATGTAA
ATGTATACCAACTAAAGATACAAACTTAGATGTTAAGGAATTTTGGTATCTTATTTGGAG
GTACAAATTTGGAACGTAGATCCTGAGGCCAAATTATCATAATTAATCATGTAAAATCTC
CAAGTTTGTTTTTTTCCTTGAAAACACATATAGTACAATTTAGGCAGATCTGGATCATCA
AGGGCTTGCTTCTGAGATCTTGGAAGCCATGCTTCGCCATGTAAGGACTGGTGACACTAG
TCCTCAGGTTCTCTTCTTGAGGTGGTTCCCACAGTCCCACACTTTGTGTTTTCCAAAGCA
AATTATTGGAATATAGTGTTCCTTCCACCTGTGAAGAAGCAGAATAGAGTATAAATCTAG
ATAATTCTAGATAAACTATAATGACATGATTAACTTCTCTTTCATTTTAAAAAAATATGT
GAAAATGCTTATCTAAGAAAATAAAATGTATCTCTTAGAACAGATGTTTGCCTAATCATA
CATTTTTCTTTGGCATTTCTAGAAAGCAAGTTATGGAGTTTATGATAGGAAACAATTGGT
TGCACTGTTTAGCTCAGAAAATACTAAGATTTAGAAGGAACTAAGTATGTTATTCTTTCA
AATAAGTGACAAAATATTCATACTTTTCGAAGCTATTAAGGGTAAATGGAAGTTCATTAT
GCTATTCTATCTGCTTTTTAGTAGGTTAAAAACTGCCATGATTTTAAGAAGTCTAATACC
TTAGACCACTCTAGAATTTTAAACTTGTTCTATTTATTTACATATTTGTTTATTTATTTT
TTTGTTATGGGTGTTGAAGGAAAGTTCTAAATTTAAGAACTATAGCATTCCTCATTGCTC
CTAATCAAAGGGTTTCTTTTTTATGTAGCCTGCACTAGGAATTGGAGATAATGCATGTAA
AATATAGCTTTTTAACCTACCAGGTTGTTTATGCATCTTGGGTTTGCTTATTTTTACACT
CATGTGAATTTTAAAATCACCATTTGTATTTTGTGCTCTTCTAGGTTTTGGCTGTAGTGA
AAACTGTGGTTGGAGGCAGTGGGTTTTGTGATGTACAATATATAACCTTGCATCCAACTG
AGAAGAACCACCACTCTTGTGTGCTTCAATCAGCAGGAGGTTTTTTTTTTTAGTTTGTTT
AGAAGAACTAAGGTCTGTCATCTATGTGACAAACAATATTCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGATATCATTTACCCCAGTGTTAAAAATAAAACCAAAT
AAAGTTTTAAATTATTATGCATGACCAAGGCCATTATCTGAATACCAAACAGAGCCAAAT
AATTGACTATGATTCAGATTAGGCATACATTTTTTAAAAAAGTATGTGGTACTTGATTGG
AAAACACTTGGAATTATTTCTTGAAATTAATATATATGTACTATGTGGCCCTGCAATTCA
ACTTGGAGGCATATACCCAAGAAATGTGTGCACCTGTGCACAAAGACACATCCAGGAATG
CTTGTAGCAGCACAATTCTTAATGCCCTAATCTGGAAATAACCAAATGACATGAATGTTA
GCATGGTCAACTACATTGTGATATAGTCATGTGAGGGATACTGTAAAGCAATAAAAGTAA
ATAGCTTCTACAGAAAACAGTTTGAGTGAATCCTCAGATATAATGATTAGTGAAACAAAA
AATAGTTTATACGGCACTATTCCGTTTAAATAAAGTGAAAAACAGATACAACTCAACAAT
AATGTCAGTATAATAGTTATCTTTCGGAAAGGTGGAAAAAGGGATTGAAAGGAGGGATCC
TATATAGGTTTTTGTGATAATGCCTGGAGGTATAAATGTATTTGTGCGTGTTTCTAAACA
TGTATTATATGCCAATTTAAAAAGTGTTTTATGAAAAAGGAAAACACAGGAAATAAAAAT
ACCTGATATCCTCTTTATTGTATAATGTTAGTGTGTTTATTAAAATATGCTGAATAAGCA
ATTAAATGGCTTATTTAGACTTGCTTATGGATCACAAAGCCAATCTAGGTTTACTTACAT
ATTATTTATAAGCAGCCATATGATTTTTCTGAATAATATATCCTCAAGAATATTACTGTA
AACAAATTTATCATGAGTAATTATTTTAAAGGTTTTACAACTCAGGGGCTGTGGAATCCA
TCTTGATTTTCATCATCAAGTTCCACAATTCACTTAAATTTCATGTTCAAACACTTTATT
TTGCCTCTACTCTATGTGAGACACTATGGTTTTTATATAATAATTGTCTCAGATTCTGAT
TCCCAGTTGCAATATTTTGTTCACGAGAATATTGGATTCAGCAAGTAAGTAAAGAAAAAT
CATATATGTAAATCTATAGATTATTTACCTACTACTTAAAAAGTGTATTACGGAAGGTAA
AAGATCTACGTATATATCCCTAGCATCTGACAGCTGAACCTCAGTAACAGAAGACTTAGC
AAAATTTTATTATTCAAGTGTATAATACATTACTTTTCAGTAATTATTTTTAACAATTCC
TTGGGATGCTTCATCCAAGAGGATGAATCTATACCTTCCTTTTTCCTGGTTTACTTCCTC
ATTTTGCTGGGGAACACTCTTGAATAACTTCTTCAGAAAAGTTACATGATTAATAAACTT
TCTGAGTCCTTCTATGTTTAATGCACTGTATTATTTAAAAATGGTAGGCTTTTTAGCCTA
TATACGTATTACTTCATCTAAAAAGTAATTTCTTTGTGTTGTTATGCATTTTTTAAAGCA
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGATCCCCAGCACAAGAAGCAAAAATTTATACACCACCCCCCCCACACTGGCTGCTCT
TCCCCAAATCCCATTCACCCCTCAACCAGCAACAATCTATATTCAGTTTCCACCTTTCTA
TAAAACTGTTCACTTTAAGGTCATCCATAAGCCCTACATTTTTCAATCCAATGAAGATTT
TTCTCTACCTTTCTTGAATTCTTTGTGCCATTTACCACATCAAAGCACGCCCTCATTCTT
TGAGGACTCTCTTCCATTGACTTCTAAGACAACACATTCTTCTAATTCTCTTCTGTCCTC
TTAGGTTTGTCCTTCATAGGACCTTCATAGGATCCTCTGTATAATTCCTAAATACCATAA
TTGTTCTGAGTTCCGTTGTGCTCCTGTCTTTGAGTTCCATAGTCTCTCTGTGGATCTGCA
GGCACTTCCACAGTGTTCATTCCTTGTGTATACTAGAGACTCTCACCCAATCTGTTGCTC
TTTCTGTATCCAATACCTCAGAAACCTGGGTGTCATCTCTCAGTCCTCCTCTCTTACCTC
TACCTTTAATGAATAACCAATAATTTTTTTTTTGGTGAACGATGAATAAGTACAAGCTGA
CTTCTACTAAGCCAGATAATAGTGACCAAATGAGTAGTTAGGCATGGATAAGAGCTGAAG
TCATTAAATTTGGAGGGATTTCTGTCTTTTAGCAACTGTTTCAGTTCTCGGTCTTCTTGC
ATTTGTGAAAGTTGCATCACTTAGGGTAATTCAGTTCAACACAGAACTTAAGTGCAACCT
CCATGGCATCTGGTTAAGTACTATATTATATGTGGAATATATATGAATAAATCAAATGAA
ATTTGAAAAATATTTAGAAAATTTGATAAAACTATCTTTTAAATTTTAGAATGAATATAG
TATGTCCAAAGAACAGATTTAGCCCAATTACTGTATAGCTGTGGATCTACAAAATTATGT
TCACATTATATTATAATAGTAAAGATATACGCAAATATCATTCCAATCTTGATTAGGTGG
AAGTGTGCTTAAAGTCAGGCAAAATACAAAATTAAGGGCCATAAAACTACTTTCTTTTAT
CAGGCAAAATTAAAGGGCCATTAAAATACTTTCTTTTAACTTCAGAAAATTTAAAAGTTA
ATTTAGAGCTAAATAGATTTGGGGTCACTGTTTATAAAAAGTGAATCTTACAACAATAAT
TCCCTAGTACCATAGTGAGTGATCATATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGAGTCTTTCCTGTCATGGACTCTGGCAGATGCTGGTATAATTT
AATATTCGTGGAAGACAGAGCAAATATAGAATAGCATCAAATTGATTTTGCAGAGTTTTC
AAGCCAGATGTCCCGTGGCATTTACATGGGAGAAGTCTACTGTGTACCAAGTTGCATATT
TTTGTGTGCAAGTTCTCAGCCATGGTATGTAGTCATTGGTGTTTTGACAGCCATCTGCTC
AAACCTTACTTTTTTCGATTCAGCTGTAGCTAAAATTGAAAACCTTTCAAAATGGAAAAT
TCCAGGTAATTTTGATGATAAAAGAATCTAGTACTCAGCATTAAAAATAAAAAACAATAG
ATACCATATGCTTAGTTATAAGCCCTGAATTGAGTTTTTGCCTTGCAAATAGCTGTACAC
AATAATAAAAAAGCTGTTTGAGAAGAGAGGCCTCATCTTACTGATTCAGTTTGTTTTAAA
TGAGTGCAATGCTCTCAGCTAGACATGGAGGCTCTTGCAGAGCTGAGTAACTCTACAGTG
ACAATCCCAAGCCCAGCCTTTCTTTTATGTAACCAAGAACTCAGTAAATATTTGTTGAAT
GTTGAATGAATGAATGTTAGAATCCATATTTAATAGCTTGTCTAGTTATAGAAAAATTTG
CCCAACTACCTATAAGTTTTAATACATGAAGGGAGTGAGTGTGTGTGTGGTGTGTGTGTT
TATGTGCTCTAAGAGAATGAAAGTGAGTTTGATAAGAACTTTTGAATGCCGACTATGTAC
CTACTGATATGATAGACATTCTGGAGATTCAAAAGAGGTGAACAACATGGTTTCTAGCAG
CATGACTGCATCCATATGAAACACCAAGTAAGAGATTATGTTTAAAATGATAACATTCAT
GATATGGATTAATGGATAATGAATAGGAATTTTTTTTTTTTTTTTTTTTTTTTTACCAAG
AGAATGGATTTTGAGGTAAGTTTGACAAAAATACTAAATTTGACCTGTGGAGACTTTGTC
AGTTGGAGAAATTAACACAACCAAGGTGAGGTGGGTAGTGGAATGCTAAGGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTGAAGGGACCAGAAGTAGTTGGACTACCAAAACTCACCCTACAGGCCAGGAGGA
TGAGAGGCAGAGTTTTGTCCTCCTAAAAACAGGATGTCCAGCATCTCTCTTTCTTCTACC
CGTTTTTTTTTTTTCCTATAACTTAAACTGGAGGAAAAACTCTACTGAAACAAATTACTA
ATAGTGACAAATGTGTGTGGTTTGTTTTGATAAATATGTTAACCATTATGTATCCTCCAT
TTCTAATTTATATCTGTAACTACATTAATGTCTATGTCTGTCTATAGCTGTACGTACATC
AATAGCTACATAAGCACAGGACCTTGCAGATTAGAACCTTTACAACTTCATGTCCTCTGT
CAGGCACTCAACTTGGTGTAAGCTTTCAGGCTGAGTCCATAACGCAGGCTGTTTCCTCTG
CTTTTTCCTTTGCGCGTTTTCTTTACCCAATAAATTTCTATTTATCCTTTAAGATTCAGC
TTGATATTACTTCCCACAATAAACCCATCTTAAAAACCTATCATCCTTACTCCTTTTACT
GTATCTAGTACATTGAGCATGTTGAGAGCATATTTGATGATATGATAATTGTATAGTTGA
ATGCACAAGTGATGAACAGCAGGAGAGAGACAGATATACAGACGGGACTCTGTTAATTTA
AGTCATGTATTATATAGCAATTTAGAGAGTACAGGGTCTAAGTTTGGAGAGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTGAACCACATCTG
CTCCCATAATTGCCTTTTAAAATATACAACCATGACACATTGTTTCTGGACCAAACATCT
TCATTTCCTTATCTTTTTTCAGGTTTATTCCCTGCTGTGCTGAATCTTGCTTCTAGTGCT
CTCATCACAACCAATGCAACATGTGGAGAAAGAGGGCCAGAAATGTACTGCAAATTGGTA
GAGCATGTCCCTGGGCAGCCGGTGAGGAACCCCCAGTGTCGAATCTGCAATCAAAACATC
TGTATTCCATACCGTATGTATCTTAGCACGTATTTGTATGACATTGGGTGGGATGTATAA
CTGAGCGATTTTGAGGCCAAGCTATATTAAAAACCAAAGGGCTTGGGATCCCAAGAATTT
CTGGAACTTTTTCTTCCACTTTGCCCTTTTTATGGCCCCTCACAGTTGTTCAAGGCTGGA
AGAGAAGAAGGAATGCCAGGATCGAATAAGACAGAAAAACTTGTTCAGGAAACAACATGT
AGTTAGGAATGGCTGGAGCTGATAGCATCAAAGGGCAGGATGCAGAGATGAGTCTGGTGC
AGAAAGGCTCGAACCAGGCTATGAAGGTTCTAAATAACCATAGGAGGAATGATTTAAATA
GAGGCACCACATAAGGCCCACTTACAGGTATCCATAAGTCATGCTGATATCCATGTATTT
ATTTAACACATATATGGACACCTACTACTAGTAGGGCATTACACAAGAATAAAATGTGAA
ATTCTATATAGTGCATGACTTAAGAAACTTAGAGGGGAGGTAAATGCTAAGGAAACATAT
AGAGAGGTCATCTAAAGATTCCTTGGAGAAAGTGGTTCATGTACAGATTTGAATCTAGCT
TAGAAAGTATGAGTTAATAAGATGAGGAGGAAAAGTATTATAAAAGGAAAAGCACATGTA
AATCTTGAAGGTATGAAATGGACAACTATAAGTTACTGATTTAATGGATAAAGAATCTGT
GGAATAGGGGAGAATGATAGGGCTTACTTCTAGATATGGAGGTTGATATAGAAATAGATG
TTGACAAATCATCAAATATATTTATGTATAGGGGAGGTTAATAAAGTGAATATTGAATGC
CAGTTGAGGTGTTATATTGGGGAAAAACATTCACAAATAAATGATTTTTAAATTTTTTCA
GTTTTCCTTCTCTTTTTTTGTAGTTATGAAACTTTAAAAATGGAAAGAGCTTTCTCCTAC
AATTTGCTTTTTTTTATTTCAAAAGGAAAGTTGAGATGCATTTTGCCATTCTTCCTTTTA
GCCAGTTAAAGGAAAAGCAAGTTCCCTTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTTAACCACA
GTCTATAAAGAATATTTGGGCAGATGTTTGGGGAGGGTTGGCTGTGATATTTATTTTTCT
TCAGTAACAATGCCAGTAATATTTCATTTATGGCAATGATTGCTCATGTGCTAATTTCAG
TAGCATCCACTCATGCCACCAGGGGCATCTGTTTGATATTTAGTTATGCTTCTGGTATTT
TCTGTCATTATAAAGTCCTAACACTTTTCTTAGCTTCAACAGAACAATTTAACTAGTGAT
AATTATTAAATATATTCAGCCATTTTACTTTCCGTTAATGAGACAGGATGCTGCACTTCA
GTGGACAGCTAATGTGATAAGACTTGGTACGAAACAAAGTCCATCCTGCTGCTTAGTTGA
ATTAAACAACATGCCAATAAAAATGGAATATTTTTGTCCTGCCCTATATACTTTTATCAT
GAGTAGGTCAAAGAAAAAAGCCTTTGTGATTTCAGTTAAATAGGAGACTCTACTTATAAT
AACATTAATATGTAATTAAAATAAATGTTCACAATCTGAAAAGTGGCAAATTTAATCACT
ATTCACTCTACTAATTTTTCTTCTGAAGGTGATTGAACTTTACTGTCAGACTACACTGTA
TTAAGGACATATTTTGCTTGATTTTAATTTAAAAAGCTTTTTTTAATTCAATGCAATTTT
GTCTTTGAATTTCAGAATAGTGTGCATTTTGGACAGATGTATCTTTTTGTTTATGTATTT
GCATTATAATTAAACTATTAATAGTTGCAATGTTCTTCTTCCTAGTAAACCTGTGTTCAA
GAGTTCTCATTCATTTTCACTGGTCCCTGGCAAAATGAGAAAATCAGAACAACATTCCAG
TTTTGTGAAAATAAAATTTATGTATTTAAAAAGATTGTCCTTTATTTTGATATTTCTTTT
GAACTTTTGTTGGTTTTTGAATGTTTTTTATGCTATAAAATAATGGAGATATTATATTAA
ATGACAGTAAAATGGATGGGAGGCTATTATTATTTATAATTTGAGTATTTTCACTTGGAA
AAATAAAAAGCTAGAATGTCTTTGTCATTTTCCAAAATCTCTCTCTCTCATTTAAAAAAA
AAATTTACTTTCCCTGAAATTCAAGATTAGGGAAACTACTGCCCTAAGTGGAGTTTTGCT
ATCTCTATTTCAAAGGCAACACAAAGAGTTTAAGTGGCTTGCCTGTGGTCAGTCAGGACT
AAATGGTGGAAGAGGGACACAAATATCTAGCTTTTCATATTCTAGACCTTTACATTCCAA
ATCTCCTGCTGTCTCATCACCATTATTATTAATAGAATAAATGTTTAGATTGCTAACATC
AGGTAAGCAATTGAGTGTCCACCGTGGTTCCTCAGAATGAGTGATTTGTTCACTATTTGA
GGTATTTTGTAAGTTCCTATTTACAAAAGAGCTGTGTTCTAATTTAAAAGGCTCCTATAA
CCCATTCATTTGAAACATCTTCCCAGAGAATGAGTGCTATAAATGTCCACAAGACTGACA
CCCCAAAACAGACTTAATCCTTAATGAACAGGTAAGTACCAGGGAAGTCAAACAATCCAC
TTGGTTTATGTCTACAGGCAAATATACTCACTTCCAAATGGGATGTTAGGGGCGTTAACC
CTTACTGCAGCTCTGGGCATAGATTTAGGGTCGTCTCCAACAACCTTCCCACCCCTGCCA
ACCTCAGGGCTGGCTGAGCTGGGCCTGTGTAGAGGAGGAAGAAAGAGACAGAGCAAACCA
ATGACTTGGAACTAGAAGGAAGCAAGGACTTTGCCCACACATGGGTATTGGTTAGCGTTT
TGAGACGTGGAGCTAAACTGAAGAAGATGAGAAATCTGGGAGGTTTGAGGATTGTAAGAA
TTACGGGGCCAGAGGAAGGGAATGTGGGGTGGCAATGATTGGACCACATCTCCACTTCCT
GGTTCCAATCCCTCTTTCAATTCTCACACAGCTTCTGTGTCCTCTCTCTGGAATAAAGGA
GAAGGAGATCAGCATTTGGTTGGCAGGGTAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAACCCAGTTAATTATTAGATTGCCTCAAG
ACCTTTGGTAATAAGAGAATAGTCATAGGGACACATCTTGAAGTACCTTTCAACCACCTT
TAAAGGATTTGTTTGCCTTAAAGTTGATGGCACACGAGAACTGCCTCAAACAGTAGACTT
TTTGCTTCTTTGAATGATTGACACATCAATTAGATTTCAGTATTATTTTTTCACACTGAA
TTTCTGTAGTTATCTTTAAAATTGCCCCATTTTAGTTGATGGTCAGCGTGCTAAGCAGCT
TCTTCTCTGGGAGTCCTAGCATTTAACCATTTCCCACTACCTTGCATAGTGCAATGAACA
ATTGATATCCAATAAATTCTGTTGAAGATATGAATTGCTTCTTTTTTATATTATTTAATG
CTTTAAGCCAGGTGATGCTAGTTTTAACCTATTTTGACTTTTTTTTTTTAAGAAACAACT
GTAAATTTTAGTTATATGATCTTTTCTCTTCCTTTCACATGCTGCTGTTGATTCAATAGA
GAGACACCCGATTACAAATGCTATTGATGGAAAGAACACTTGGTGGCAGAGTCCCAGTAT
TAAGAATGGAATCAAATACCATTATGTGACAATCACTATAGATTTGCAGCAGGTATAGTG
CCTCTTTCTTATCATTTCCTACTTATGAAATTGTATGTTGGATTTGCTATTGTTTGGTTA
GTAGTTCTTGGATAACTCTTTTTTAATTAGTAGAAAGAACACTGTATCTCATCACCCTCC
ATTATTTGCCTGTGACAATGAAAAGGGGGCCTACTTTTTGGTATATTGTCATTTAAAAAT
ACTTGGCATTTATTTCTAATGCATAACTAAAACCCACATGAAGGGTTTAAGTACTGAATT
AGGAACTGACTCGGCCTTTATTCATTGGAGTCAATGATGAAAATACGGATCAACAAAATT
TCACATAAAGGAAATATAAGGCCATTAAAAATCTTTGAAAAGAATACAATGCTCCCAATC
TGCTGATGGTGTGAGTACTTAACGGTTTTGGAATAACAAGGTCCTTGAGTAATTGCCTCT
CATTATTGAGAGTTGAGCAAGCTGTGACACTTGAATCTTAAATTAAACTAGGGTACTAAA
TGAGTTAACAAACCTTGTAGTTGTACAAAATTAACATTGGAAGTGAGAGTTTGTGTTGCA
TAGTCCTGGTTGCCTTCTGAGACTTAAGTTCTTTTTCCTGCTCACAATATTTAGGTCAGG
CTGAAGTTATTAATCAAGAATCACCACCACCTCCAAATTATTTTGGCTTGCAAATAGGAA
GGAATTGGGAAAATGTTCCCTTGTTTTGCTCTTATTACAAAAACAAAGGCTTATTTAATT
GAGTGACGCCTGAAACTAGAGGTTTCACTTTCTGGAATCAGCATAGGAAAGACCCCAGCC
ACTCCTCTGTGGCCCTTGTGGACACAGGGCAGCAAGGGAGTTTGGAGTTAAGCAGGGTAG
ATGGTAAAGATAGTTAACACTGTCTGTACCTATTGAGGTCCTGGTTGCCACAGATGGCCA
AAGTGTGGGGAAGAACCAGGAGTGGAAGGTAGTCCCATTCTTTGGGGGTCAGGTAGGCAC
CAAACATTTCCTTAATGGATTCCATTCCCATCTCCTTCCTAAGAGTACCACCACTGTCCT
CCGGGGTTGGGGCCCATGTTGGCAAGGGATGCACTCATTCAGGACCTGCAAAGGACAGGC
AGCCTCTCCTCAGAACTTTGTGACAGCAGGAGCTTACTACTCCATCTGAAAATACCATCA
ACTGGCATGGGTCCATTCTGCCCTCCAGGTGTATAGCAGCTGAATGTGAGCCCTGAGTTA
ATGATCCTTTCCAGCTAGTCTCAGAACACTGTGTGGGACTGGCAGGGCATGCTGCTGTGG
TGATAAATCATGCTGTAGGTCAATTATGTCCTGTGCATGGACTCCCCAGCCATCCCAGCC
GTGAATGGGGCTCATCCTCTCCTAATGAAGATGACACAGTCCTTTATCACTTGCAGCTAT
TCTCCCCATTCCAGGTGATCACTGAAAGTCTGCCTTCCCAATCCGGAGTGAATCTGCTGT
CAAACCAGAGGGAATCAGTAAACAAGAATGATTGATTGCTCTGGATTACTCACCACTTAT
TCTTTTAGACCACTCAGGGGCAAAAGGTGTCAGTTACTACTACAACTTGCACAAATCACT
TGTACTACTCTTTGGTCCTAACCACTATCTTATTTTACTTATTATCAAGCATAGCAGCTT
GTCCCCCTTCTAACATACATTTGGCTGGTGCAATCACAAGTTTTTTACTACATCATTCCT
ATGAGCCCACCTATCATCATTAATTCAGCAGGTCTAAGAGTTTGCTGAGAGGCTCATACA
TAAATGAAGCCATTTGTATTCTCCTAAGTTTACTTTGAACCCCGACTCATCCATTCCTAC
ACAGTCTGTTAAGAGTCATATGAATTCATTTCTCCAGTTCTCACAGCACGCATTTAGTTT
AATAGCTTAAGAAGAGTGACTGCTTTTAAGACAACTGTTACAGTTTCATCTTTATAACGA
GTGGTAGTACTCTGTTTATAACCCAGGCTTACCCGACTCCAAAGTCTGGAATGTACCATG
TGAACATGGCCCAGAGGAGACATCCTCAAACTGCCCCACCTTCTAGAGTGGTTCCCCCCT
CTATCCTTATCTGCCCTCAGGCCTGTCCTACTTCCTGCAAATAAACTTACTTTGTTCAAG
GGAAGGTGGTAAAGGTAATCTATAAAATGGAAGAAATCCTTATTTCTATTTGACTTAAGA
TTTTAATTCAGCCAGTGATGTTAGTGATATAAAAAGTGAAAATGGCTTTGTAATCAGGTT
TTATGATATAATTCTTCAGCCCACTCAGTCTTTGTAGTAACTGTGGAACATCTACATAGC
ACATACTCATTTTCAGCTAAGGAGCAAAGCTGCAGGAAGGCATATTTCAAAGCATTGTCA
ACAGAGAGAGAGCACACCCTTATTTCATTTACTTCCCATCATAATCCTGTAAGGCAGTGA
GTATTATTGTCCCTAATTAACAGTTGAGGAACACTGAGACTTAGAAAAGTAAAATGCCTC
AGCCCACTTTACACAGCTTTTTGTACAGGTAGGATTTCAACCAGAATAGTCTGAATCCAG
ACTCCAAAATCCAGACTCCAAAGTCTTAACCACTACACCAGTATTTCTTAAACTGGGATC
TGAGGACTTAGTTAGGGAGCTCATGAGAATTTTTTGTATATATTTTCAAGGGGGGCCATA
CGTTGTTCAGGTTCAAGAAACATCACACTGTCTTCTACTGGCTTTTGTGGGAGAATATAG
CCAACATCTGTTCTGTCATAAAATAAAGGACTAGATCTTCCCCTAGTACATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCTAATGGCGTAACTTTTGGATAAAG
GATTAATAGGTTTTCAACACAATATGACACATTATCCTAATGGCAGTCAAAGGCAGTAGT
TATAATGAATAGGTGACCTCCACTAAATGTTTGCCATTGATTTGGCAAGAGGTTTGACCA
TTTATTATTTCTCTTCTTTTACTGTGAGATGTATGAATTTCAACAAGTACCATCATTTTT
GTTGATATATACTTGACTTCTCTGTGAAACACTTTTAATAAATTACAATTTTATGTGTAA
ATAGCAACTATTGGTTTCCTTTATTAAATCATTACAGACTGCACTGGGAAATTTCTTCTA
CATTTTAACATTAAAGATAAGTACTAGAAAAATGTAACAATTTATTTAGAAGAAAACAGC
TACTTATTTTATAAGTATATTATTTTTAGAGTTTATTACTAAGGGATTATTAACTTTTCC
CAATTCTGCTATTTACTCATAGCATATCTTGAGTAAATGACTTAATCGTGCTGTGCCCCA
ACTTCTAGATTAGCAAAATAAATATTATAATATCATGACAAGAAATGTGAAATAATGATA
ATAGCATTATAACAACTAAACTCCATCTGGTAATTATGGCTATTATAAGAACCTAGTATC
AGAATAGACTTTGAAAGAAGCTTAACTATGTGCAGTAAAAAGTATGTAAAAAACCCAGTA
TGACAGCAAATGAAAATATATAGTAATTCTTAAAAAAAAAAAAATAGGAATCTGAAGGTT
AATGGGGTGTACAAAATACTCCATTTTAGACCCTTTCCAACCAGAGTTTCACCAAAGCAT
GATGCCTGACCTTATTTTATGGTTTTTAAAATTCTGGCCACTTTCTTAGGACTCCCTTTG
ATTGGAGAAAGGTGATTGGAAGAGGGGCAGCTTTTATTTAATTAAAGAAGTTGAAGGTTT
ACAGAAAAATCATGCAGAAAACAGAGTTCCCATGTCCCACAGTTTTTCCTAATATTAACA
AACAGCATTAGTATGGTAGCTTTTTTATAATTGATGAAAGAATATTATTATAACTGCACT
ATTAACTATAGTCAATAGTGTTCACCGTGCTATTTAGTCCTATGTTGTTGGTTGTTTTTT
CTTTTTTAGTTTTTATTCCAGTAACATATATACAACCTAAAATTGAGAGGGGCATCTTTA
ATAGACTTTGTCAATATATATTGAGGTCATAGTCCTTCCTGGATAATCTCGGTAGGCTAT
TGTCTTAGTTTGCCTGAGTTGAGATCACAAATATTACAAAGTGGAATTGATTGCATCACC
ATTTTTTGAAGCTAAAAGGCATGCTTCCTCTGGGCCTGGTGGTATTCTGGCTGGCTGGCA
ATCCTTGGGTTCCTTGGCTCTCCCATCACATGGCGAGGTCAGTTTTCTCTCCTATCTTCC
CATTTACCTCCTGCTTCTGGCTCCTTCCTGTGGCTTTCTCTTAAGACTTCCAGAAATAGT
TTTAAGGCCTACTGTCATTCAGTTGGTCACATCTTAACTAAAAATAGCATCTTCAAAGGG
GCCTCTTTTCAATGGCTTCACACCCACAGGAATACAGATTGAGATTAAGAACATGTCTTA
AAAGGGGTCCATTATTCAGTCTACCACAGCCATGGAATTAGTTATGATCACACGTCTCCT
TCAACTCAAGAAACAATTCACATTTCCTTTTCTTGGTCTATCCCACAAAACTAAAAATGA
ATTTATCAAGAAAGATTGTCTTAAAGCTACAGGATCTCATCCCACAGGTTCTTGCCCAAA
GATATTTTATTCACTGACCATATGGGGACATTTTCCCTTTACCGTTTTAACAATTTTACA
CACGAGTTATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATTT
GTGTAATGTTACTATACTTTTAAAATCTATGGGGATAGCATAGAAAAAACTTTTCCTGAA
GGACTGAACTCTTAATATAATGATTTAACCTTATGTAATAATAGAAGAACTTCTTGTATT
CATTTTTTCATTCAAATATAAAAACGGTGATCAAATTTCAGTATTGAAGTAAGATTTTTA
TTCTTTCATATCAACCCTTATACTGTCTTCTTACTTATTCTTATTAAAAAGTTTTGTTGT
TCTATAGATCTGAGAGCATTATTAATTCCACCTATTAAAGATTGGGAAAAAATGAGATAG
GTGCAATCCATAATTAATTATTCCACCAGTAAAAAGGATATAAACACTATCCCTACCTCG
AATGTTACACAAGAAAAGAAGACATATACAGGTAAAGTATTAAAAAGCCATATAAAATTT
AAACAGCTTTTGTTGAATATGCTTCAGTTCAACACAGTCTCTTTTATGTGATTTTCTTCC
TGGAGACAGAGCTGTATGAAGGCACTAGTCTGTGCATGGCGATGAGATACTTGTTTCTCA
GTATTCCCATTGGATTGTGAGTTCTCGAAGGCAGAGAGAGGTCCCTGACCATTTTTATGC
TCAGCAGTCAGCAGGGGAACTCAGCAGGCTTAGTGAAGGAATGATCCGTGGCTACTCTTC
AAAATCCAGAGTCCACAATGATCTCTGAGATTTGTTCATAGCATTTTTTGGGTCACTGCT
AAATCGATAGATACAAAACTAACCACAGAGATTATAATCTATGCTTTCAAAATGGCCTGC
ACCATTACACCTTGCTTATTATAGCATAATATAAATAGAATCATAACTCTTTTAGCAGCT
TTAATGTTTTTTTTAAGATCACTGATTCAAGTAGGTTCTGTGGTTAATTAGTAAGTGTAT
ATTCCCTCTAAATGAATTTGTGCTGACCTCTTAATCATTAATAAAGGTGACAACTAATGT
CAGTGTGTATATCGTTGCAGAACATTAGTTCTTACTAGTTCCACTTGTCTTGTTAGAACC
TAGGTCTGATCATGTGACTCCTCCACTAAAACTCTCCCACGTCTGCCTCCTATATTCAGC
AGGCAAAGCAGAGCCTAATGACCCAGCGGCTTTCTCTTCAGCAGTCTTCTCTTCAGATCC
TTTCTTCTCTGGCCTCATCTCATCTCCTACTGCTTTACCCTTCTCAGTTGTCCTACTGGC
TGGCTTGATGAGTATCTGAAACATGGCGGCCAGTCTCCTTCAGGGCCTTTGCATTTGCTA
TTCCTTCTGTATGAAATTTATTTCCCCCATTTTCCAAATAGCCTGCTTTCCCCTCTCCTC
TGGGTTTTTATTTTACTTACCACCACCTTATTTGAAATTGCATCCCCTTCCCCACTTCCT
AATTTACTTCCCTCCTTTTTTTTCCTCCCTAGAATATATCACCATTTAACTTCTAAACAC
ATTTTACTTATCGATTCCATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCAAATTTCATGAAAGAGGAGCTATTGTCCTTTTTTTTTCAAGTGCCACATTCTAA
GTACTTAGCACAGTCCTCAGCACATAGGAGACACTCAATAGATATTTATTACATGATTGA
ATGAATATACAATACAAAACATCAATTAATAATTTAAGATTTTCATTAAAGCTGAGAATT
GAACAAAAAAATAATCTCGTTTCTTATATATAAAAGGCTTTCATAAATTTATGGAATTTC
CTTTAAGTATCTGGTTGAATAATATTAAGTAAATTTTCTCTCTAATCTTTCTAAACATGT
TCTAAACCACTCACATTTGTCACTATTCATGATTACCTCATTTGCAGGTTTATTTGGGGC
TAAAAAGAGGTCTTATTCAATTTATCTTTTTTTTTATCAGAGAAGTCTGGGTCCATAGTT
TTTTTTTTTACCTGATGTTATAAAATTTTTTCCCTAGTGAGAGGAAATGTAGGTGTAACA
AAGGGGAAATAAATGCCATCATGGTGCTGTTTAAACGATAGTGTAGACATGGAATATCAA
GTATTTGAATATACAATGTTGATAAACTAAATTCTAGCAATATCATGAAAATATAAACAT
TGTGAAGATGCAACTGTTATTTCAAATAGAATAAAGAAATAGAGTAAAGAAAAAGCCAGG
GAATAAATTAGAGACTTACCTCTTTGAAAACAGAAACAGTAATACATAAGGAAGAATCTG
TGAAAAATCTGTGGTAAGGATCCGTTAAAATTTTAGAAAGTCTGAACAGAACTGCCTAAA
ATAGGATGAATGTAGACAATTTTTCACAGCTGTCTGATGCTTTCCACACAAACAACTGCA
TTTCATTTATTTTGGTGGATATAGTGTATTCCCACATTTTATTCTGGAGCCTAAGTTATA
ACTGTGTGTGTGTGTGTATACACATACATTTTTTTCCTAGGAAATTGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGTTTTACAGTAGATTTACTAAGATGCTCCACATCTGTACTGTCCAGTACAATAGCT
ATTAGCTCTCTGTGGGCTATTTAAATTTAAATTAATGAAAATTAAGACAAATCCTCAGTT
GCACTAGCCACATTTCAAGTGCTTGGTAGCTACTTGTGGCTAGCAACTACCATATTGGGC
TGCACAGAATAGAATATTTTCATCATTGCAGAACTTGGTATTGGATAGCTCTACTCTAGG
TTATGCCCTTTTACTATCTTTATTTAGATTTGTTTGCTTTGTTGTATCTGTAGAATGTCT
TTTTTTAGTTCCAGGGTTATTTCAACCATTATCTTTTCAGATATTGCTACTGCCTATTCT
GTCTATAACTCCAATTAAAAATATTTTGGAACTTTTCATTGTATACACTATGTATCTTAC
TTTCCTTTCTGTAGTTTCCATCCTATTGGTGTTCTGTCCTTAAGTCTAGATATTTTTTTT
CTGGCCTACTTTCAATTCACTAATTCTCTCTTCAGCTATGTTAAATCTGCTGTTGAAATT
ATTCTTCAGATTCTTAATTTCATTTATAAAATGTTTTCAGTTTTACAACTTCTCTTTGGT
TCATTTCTAAAAAGAAGTTTAGAGTTTCCAGTTTTATGTTGAAATTCTCAGTCTTTTCTA
TTTCCTTAAGTATAAAATATTAATGATTTTAGAGTTCTTGTTTGAGAATTCTAATATTGA
CCTTTGTGTATAAGTTTATATGTTTCTTCTGTTGAATCTTCCTTATGCTCTCTTACACCC
ACATATGCTTATCTTTTTATGCCAAAAGATGTATTTTAAAGAGTATTTATAGATACAACT
TTAGGTTAAGGATGATATTTTCAACCTGTGAGAATATTCCTATGCTTCTGTCAGGCAATA
GCAGTCTGAATAATCTCAATCCAATATAAAGGATTCCAGTTTCTGGAACACTATTGGTAA
TTGAATCATGTCCCCCACAAAAGGCATGTTCAGGTCCCAATCCTGGTCCTGTAGGTCTGA
ACCCATTTGTAAATAAGATGTTTAAAGATATTACTAGTTAAGGTATGCCCAATCTGAATG
TGGGTGGGCCTTACTCCAATAGAGCTGAAGTCCTTGTAAACAAAGAAAATTGGATTCAGA
AAGAGAGAAGTCATAGGGAACAGCCAGAAGGTGGAAGTCAACAGAATCAGAGGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGCTTCTTCCTGGGTTCAGGGTT
CCTTTCTTCCTGGGGCTTGCGGTCGCTTTCCTCTGTGAGCTTACTTCCCAGGGCTTCAGC
ATTAAGATCCGACATCAAAACTCCAGCATCAAAAACCCTCAACTCTGTCGTTTGCCATGC
CTTTTTATCTGTGAGTCCCTGTCCGCCAAGGGGTAGGGTCTTAACACCCTAATGATATGT
CCCAATCAAAGCCCTAATCATAATTTTAATCATGCCTAGGTACAAACCAGATTACAAACA
TATTCCAATATCTATTTTTGGAATTCATAACTTTATCAAACTGCTATAAACTGTATGCCA
AGAAATTAGTCAATATAGATGAAATAGAGAAATTACTAGAAATACATAAATTTCCTATAC
TAATCTAGAAGAAATAGAAAATCTCAACAGACCAATCAGAATTAAAAACATTGAATCAGT
CGCCACAAACCTCCCAACAAAGAAAAGCCCAGGCCACCATGGTATCACAGGTGAATTCTA
CCAGTCGTTCCCTGAAGAATTAATACCCATCCCTGTTCAAACTCATCCTAAAAATTGAAG
AAGAAAGGATGCTACATAACTCATTTTATGAGTCCAACATCACCCCTAATACCAAATCCA
GAAATTGATACTTAAGAAAATTTTTCTTCAGAATATAGATGCAAAAATCCTCAGTAAAAC
ACTTGCAGTTAGAATAAAACAGCATATTGAAAGAATTATATATCATGATCAGAAAGCTTT
TATCCCACGTATGCAAGCATGCTTCAACATAATAAAATCAATAAATGCAATAAACCACAT
TAACAAAGCAACTAGAAAAAATGAAACAAAACATATGATCATCTCTGTTGACACTGAAAA
AGCATTGACAGAGTCCAAGATCCTTTCTTGATAAAAACACTTTGATAACCAGGAAAAGAA
TGAAACTTCCTCAGTATGGTAAATGGTATATATGAAAAAACACACAGCTGACATCATCTT
AATAAGGAAAGACTGAAATCTTTCCCTCTAAGATCTAGAACAAGACAAGGCTGCCCACTG
TCAACACTGTTATTCATCATTGTACTGGAAATTCTAGTTAGAGCAGTTTGGCATGAAGAA
AAAAGGCATTCAAATTAGAAAGGAAGAAATAAACTTTATTTGCAGATGACATAATCCTGT
ATATAGAAAATCCCCCAAAAATCTACAAGAAAACTATTAGGGCTAATAAATTCAGTAAAG
TGGAGGTATCCCACATCAACATTCAAAAATCAGTAGTGTTTCAATATACTAGCAAAAATC
AATCTTAGGAGGAAATCCAAGGAAAGAATTTCATTTACAAGAGAAACTAAAAAATTGAAA
TATCTAGGAATAAATTTAACCACGGATGGGAAAAATACACTAAATGTAAACTATGGACGA
TAGTTAATAGTACTATTTTAATAATATATCATCAAGTATAACAAAAGTAACTACTGTTAA
AAAAAAGTACAACTGTAAAAAATGCTAACATCAATTGTAACAAATGTTGCATACAAATGC
AAGGTGTTGTTGGTGGGGTGGTGTATGGGAATTCTGTATTTTATGTATGATTGTTGTTTA
AAATTTCTCTAATTAAAAAAAATATTAACACATGACTCCTCTTACATCGGTTCTTTACTT
TCAGCTGACTAACCCCATTTTATTTTGAAGCAAATTCCATACATATCACTTTCTCCATAA
ATATTTCCTTATGTACATCTGAAGGATAAGGCTTTTTTTTTTTTTGGTAAGCAACAGCAA
CAAAACATTGTCACACCTAAAAATTACTGCTATTACAACAACTTAATATTGACAGATATC
CAGTTGGTATTCTAATTTCTCCTGATTGCTACCAATTTTTTTTTTTTTTTTTATGATTGA
GGGGAGTGGTTATAGCTCAAGTGGTTGAGTTCCTGCCTCATATGCTCATATGTACAAGGT
CCCAGGTCCTGGGTTTGATCCCTGGTATCTCCCAGAAACAAAACAAACAAGTAAAGGAAA
AGGGTCATCTCTCACTGGGGAGCAGATGTAGCTTAGTGGAGAGCACCTGGTTGCCATATA
CAGGTCTTGTGTTCAATTGCTGGTACCTCCTTAAAACCCAAGAGTGATTGAATCCATTGT
ACTAGAATAAAATGTGCGATATACATTCAAAGACCTATTATACACCCATAATCTATGACC
TCCTGATGCTTGGTACCTCATGAATTAACCTTGAGGACATCCCGTGGAGTGAAACAAGCC
ACACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATACTTCATAG
ATGGTACCATGTGCTCCATCATAATGCAGAAAATGTCCTAGTGTCTCTTTTGGGGTGTTA
CTGGCTACTGATGACTATTGCCTATGGCCATCATTTCAACAGGGAACCCCTTCTTAGTAA
TTGGTAGGGTAGCATTCTTTATAAAACCATACTTTTCTCTACATTGTTGTGTTTTTTTTT
TTCATTTAACATGATATCCATTCATTGCTAGCTCTTCATTTAACATGATATCTCTCCATT
CATTGTTGCCTATTCATGCCTGACTATTCTTGCTTGTTAATTCTTCCAAATCAACTTTAA
AATCAATTTGTCTAACTCTAGAGAACTAAAATAATAGTTGTAAAGAAATTACATTACCTT
TATGTATTAAATTAGGAAGAGCTAGTTACTTTTCAGTGCCAAGCCCTGAGATTTGCTTTA
GAGAAGTCCTTCACTTTCCCTTGAAGATTTAGGCTTTATGGAAAACAGTTTTGAGAAACA
ATTTCAACACATACATTTTCTGCAAAGGATTATCATTCATCATTCAGTTTCATTTTTGTT
TCTTAGAAATTCTGTGGGTGCTGGACTAATTTTTTTCAAGTGTATAAACTTTACGTGAGT
CGAATGTGAGTATAAGAAAATATTTTAATTGGGGGCAGTGTTTCTGTTTCTCTGGCAACA
GGGAAGCCAGTTACCTGAGGTGAAATGGCACCCTTGTTTACAGGCAAGTTCACACTCAAG
AATTGTAATATTCACAGGGAGCTGCACATTATAACTGAGTGAGAATTGCTAGTCATATCG
GTATGGAAAATCCTTTTAAATGAATTTGCCTGAAGATAGAAAGTGCCCGCAGGAAAGGGG
CTGTTCCTTCCAAGTTCCCCACTAACTATTCTATTTTATCTAAGTAAGTGTAAATTTACA
TGGGGATGCAAAACTTACCCAGAAAGTAAATCTTAGACATATTTCCAGATGATTGTTTTA
ATTATAAAGCATCACTTGTTGGAGCTTGGCTTAAACTGATACCCAGTTACAGTAGTATCA
AAATCTGTACAGAAAATTGTTAAGATTATGAGCAAGTAATTTTCTGAGGTTGCTTGGAAA
CCTTGGGTGGGAAGTCGGAATCTGGTTACCAATGGCTTAGGTGGGAGTGGGGCTTTCAGT
GACTCCTCGATTATATCTAGATTTTGAATTAATTTTCCATATTCAACTCTACCGCTGATC
CCTGCTTCCAGTCATATCTGCCTCTGTGAGATTCTCCTGGACTTCAGCCTGGCTTATAGT
CACCCTGAGTGCTTTCATTTCATCACCTTCATTAGCCAATTCTCATAGACCTTTCAGAAG
AATGCTGAACTCCCTCATCATCTTCTTTTTTTTTTGTTGTTTTTTGTTACTCATTTCTAC
TTTATTTCTTTACTCCCTCTTTAAAGGTCACAAGTGGAAGAGCGGATAATTGCATGAATT
ATATTCATTAATTCAAACAGAGGTGTTATCTGCTTTTCCACAAAGCTTTCCAGGTTACTC
CAATGGACGCTAAATATGAGATCTCCTGGACTAGATGGTTTATATGATCTTGTTCTGATT
TTTTGTTCCTTTCATCAGTTTCTGAAAGCTGGCATGCCTATATGGAGAAATAAGATTATT
TGGCATACGTACTATTAGAAGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGATGAGCTTTCATATATAATAGAGATGGCATCACAGCATATGGCCGTGTAGTTAA
AATGCACAACATGGGGAGAGCAAGTACTAGAATATGGCAGAGCCTCTTTCAAAATAAGCA
GTTTTGGTGCATTTAAAACTATTTGCCCTAGGAACTTCAGAAATGGACACAGGCACCAGA
GACATGGGGAAGAGCTCAACATTAAGCAGAAATTAGATGACACTATGCCAGAAATGGAAG
ACAGTGAATTATTCAGGTCAAGTCCCATAAGAAGGATGAGAAAAAAGGGTAGAAAGTGGG
CTTCCCTGAAATTTTTATAATTTTCAAGGGGTTCAGTCTATAGGAAACAGAGGTCCCATG
TCATAAAAGAGTCAGACATTGGTCTACCTTAACACCATTGACGTTCAAAATCTCATTAAA
ATGTCTGAAACACAACCCCTTGGTAGCATTATCCTAGATCTGTGATTTTCTGAGGACAAA
GGAACTGGGAAGAAGTGGATTCCTTAGATTCATAGCAGAGAATAGTATTTTTAAAAAATC
CCAGCACAGCAATGCATTCCCTGGAGATGTGTTCCATATGTCAGCTTTACCCACATGGGT
TTTAGGCAAAATGAGCTCATGGCCTCCTTTTACCCAAGTACTGTGTAAATCTCATTGCAT
CTCAGCCAAGAAGTGAAGAAGGTTGGACAGTGTCACTCCTGTGATGGTCATTGCATGTTA
CTTGCTAATTTGGGAATGAAGGATTACTTCAGGAAGACCCTATTCTCCAATTCCACCCCT
AAATGAGATCAAATTCTTAATACTCTGCTTATTATAGAATACACATCCCCATTATTGCTT
CCTCAGTGAAGTAATTCCATGCGATTGTGTTAGGTGGCATGCAAATAAGTAACAAGTGGA
ATATGAAGTAGAATTTCCTTTTGGTATAGTAAAATGTAACACTTTCGGTATTCAGAAGTT
ATTTTGGATTTAAATTCAGACACCAAGTTTGTAAAAAGTGGCCTCCAACAGAAAAATGTT
GGGGCATTATTTGCTGTTTCTTAGGATCATTGAAGCCTAACAGGAATAGCATTTTAGTAG
TTCTTATAATGGGATGTTTACTTGCCTCATTGCACACCATTAGAAGTCAGGATTTTATTC
ACTTAGAAATAAGGTTTTAAAACTACTGCCTCTGAAAAGTCTTCACGCCAAATGCACAAG
ACATAGTTAAGATAAGTAACATAAATACATTAGAGAATTAAAGTTAAGTAACAGATAAAT
TTGATCTAGAGAATTATTCTCAGTACTATTACAATTTTGGAGTACTTAGAAAAATCAGTT
AAAATTTTCAGTCATTCTCTGAAGTCTTCAAACAGCACTTCTACTATTCATTGTGTTTCC
CAGTAACACTGTTTACCATATTTTTTAAAGTTTATTCAAAATACTCTGTGCCAGCTAATT
AATTTTGCATGGGATGTGAAAGAATCCATAGAAAGTAAGCATAAGAGAGAGATTGTTTTG
AAATGGGATTCTTCTATTATACTCTAAGGCAGTGACTACTTTTCCATGTCACCTAATGCT
AGCTGACATACTGAATTATAGAAAGCATCTGTGTGATTTCTAGTAGAATTTTATTTCATT
GATTTTTATCTATTATTCCAGAGCCAACACAGAAGCTCCTAAGTCATAAATCCGCATTGT
AGCTCCAAGAGAATTTGGCCTCTTCCAATATTTACTTGCTGAGCTGATTTCTAAACAATA
TTCTTTACCCATAACATCAGGGTATCTTTATTTTTCTTATTGGGTAACTGTGATTTCTAA
GTATGCTTTGCCACTTCTCTTTTTGTTTTCTATCTTTAAAAATATCGCTATGATTTTTTT
TCTGGAAGAAATGATGCTAATTTAAAATATTTTTTATGGTTTCCCTCTTCCAAAGAGCAG
GCAATCTTTTAAATTCATTATCTCATTGTCTCTTCTATAATTTTGTCTTTGGAAAATGAA
AGATTGGGAAGCAGAAGGTAAAAGAGTTTAAGTGACTTTCTCAGCTCATAAAGACATAAT
AGGACAGGCACCCAAGAATTGTATGTCTTATTTCCTGCAAATGACAAAGTACTCTTGAGA
GTTGCAAATAGGCTGGTGTTGACTGAGATTTAAGCTTTAACAATCAGAAAAGATCTGTGT
TAAATCAATAGAAGTAACATAAAAGCTTGATACAATGAAGATTTGGTTATTCAAGTAAAT
GTAATAAATATTAAATGCTCACTATTTTAAAAGAATTGTAATAAGAATTATAGTGCCTTT
GAGGATGTAAAGCTATAGACTCTGCTCTGTAGGATCTCACAATATAGTTATTAGTATTCT
TTATCATTTTATAGAGCTTTTCTGTAATACTTTAGGATTACCTGCAATTAGGACCAAAGT
GTTTCATATTTTTACTAGACACAACTCTTTGTGTTCTATTAGATTAATCAACTCCTATTT
TCCTCAGCAAATTTCCTTATCAATAAGGTCCATGTGCATGAGAAAATCACAGCAGTTGTT
GACTATGAACTATCTAAAATAAATAATTCCTAAAAACTCCTAAAAATGTGGCAATAGCCA
ATATTTTGAATAATGATGGTTGATGGAGTATGTTCCATCTTACTCATACTCTTGCCCTTT
GTTCATACATATTTTCATTTAATTGTCCCTTATTTAAAATACTATTTTGATAATATAAAA
TTTTGATAATATAAAATTTGAAAAAATGATTAAAAATTAAGACACCATCTATATAATATA
GTATGAAAAGTAAAATCCCTCCTCCTCCTCTACTTGACTTCTAATTCCCAAACCCCAGAG
GTAACAGCTGTAATACTTTCATGTTTGTTCTTCCCAAAATGCCTAACATAGTCAAACATT
TATATGCACAGCCATAGGCATGTGTATATAACTGCAGTTACACTTATCTGTATCCCTCTG
TAAATATAAATTCATGTTTCCCACCTGAAGTGATAAAACTGAATGGCTGAAGCCCACATT
AATCAGAACAAATGTCTTGGCTGATCCATGCTATGCAGGGGTTTCAGCTGGTCTTAGGGG
AGAGGGGCATTTGGAAGGCTTGGCAGCTGTGATTGGCCAACCACTACAGAAGAATTACAG
TATTTTCATCACTGGTTCTTCCACACCTGTGCCTATAATGCAACTACAAGTTCAGTTTTC
TGTCACTCAGTGGCTCATGGTTTGCCCTCACTGCATACAAGTGTGCCTGTATTCTAGCAA
AGTTTACAAAGGACCAAAATTGGAACCATCTGTGTTAGGCCCCTTGTAGGCCAGTTTTTC
TTATTTCTATATTCAGTCCCTTAGAGTGTGCCAGAGACTCAACACCCCTATTGGTGATGA
TCCCATATAAAAACTATGAAGCAGGTACAATTTATTTTTAACACCTTCTTTTCCTAATTT
TCTCAGGGGCTCAGCAGGCCCTTTGATCACATAGTAATGGGTCTACTCTCCCACTTGTGC
CCTTCCCCTGACTCCACCAACCAAGGGCTTACAGCTGTCTGTCTCCCTGTATCTTATTCA
TTTTCTAACCAAAACATGTCATCTTGCTTTCCATTGGTTTACTTGTTGTGTTTCTCATTA
TTCCAATACGTTATCAACCCATGAAGGACAGGAACTGTAATTCAAACCAATTTCTATCTA
TTTTCTCACATGGATATATACACACATGTCATTCAATAATAGTTGTGCATTATTCTTGGT
CTATTGACTTTTGATCTGCCATGGATAAAGACACATGAATGCACTATCACTAAACATCCA
GAACATTCTTTTTTTACATCTTCTATGTAGATTTTAACATAGAGGATTGCCCCATCCCCT
GTCCCCCTATTGTCACTCCACTGATTTACAGTAACTTCCTGCTCCTTTCTCATTTCCCCT
TTCTTTATACACGTTTACCTTTTAGCTGGTACAAAACAAAAACCCTTCATTTAACATATT
CCTGTTTCAAACAGTTGTCTGCTAGTCATTGGAATTGCTTTCTCCATTTTTTTCTATCTG
GGGAGTAGGGTATGACATTTATTATTTACTGCTAAGGTCTGTACCAAGTCCTCTGCATTT
ATTTTCTCATTTAATCCAAACTCTCTGAGGTATACTTTTATTATTGACCTTAATTCGTAG
AAAAGGAAGCTATGAGTTGGAAAATTAAAATAATCCACCCCTAGTTACATAAGTGCTGGA
ACCACAAGTTGAACACAAGACTGTCCCTCCAAAGCCCCTGCTACTTTGCCGCAGCAAACT
AACTCCATCTAAACATCACAATTTTTCGGAAGATTAAGTGATATAAGTAAAAGTGTTTTC
TAAACTATCAAGCATATCCACACATGGAATTTCCAATTCAATTTTATCATCCCTACCACA
GTAAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAGATTGAAGTCATTTTGAGACATATAGGGTTGGTGT
AGATAAAATCTGAACTAAAAGGGACTGTGGCATTTAGCCTATGTTGATGCAAAATGGCAA
GAATACTTTGGAATGAAAAGTTATGTTGTTGTCATTGCTCTACCCAGGTGTTCCAGATTG
CATATGTGATTGTGAAAGCAGCTAACTCCCCTCGGCCTGGAAACTGGATTTTGGAACGCT
CACTTGATGGTGTTGAGTACAAGCCATGGCAGTACCATGCTGTGACAGACACGGAGTGCC
TGACCCGCTACAATATTTATCCCCGCACCGGACCCCCCTCATACTCCAAAGACGACGAGG
TCATCTGCACCTCATTTTATTCCAAGATACACCCCTTAGAAAATGGAGAGGTAAGCTGAG
AACACTTACCATGAGTACATTTACGATGGCAAAATAGGCCTGTCAGAAAAACTGGGATAT
ATCTGTAATTAATGTCAGGGAGATTTTTTTAAAGGGATTTAGCAGAAGTACATTTAAAGG
AGTTATTAAATAAAAAAGAAAAACCCAAGGTGATGAGAATTTTAACTACCATCATCAAGA
ATGTGTCTTCCATCTCCAATAAAGATCAGACACAAGGAAATGGATTTAATTTGGAAAGTC
AGTGATTAATTTTACATAGAAAGAGAATTTCCTGACAGTGAGGATTGTGGATGATTAGAG
AATGATGGAGAACTTAAAGGGAGCCTTAGACATATGTGTACTCTGATCTGAAGATGGATG
ACAGGGGTGACTTTGTGAAGAAATGTAATCCTCACAAAAGACCCAAATAATGGTTACTTC
AAGGGAATTCTGCTGTCACCACAAAGAACGATGGTGGGGTTCTTTTGCCTTTGAGTCAGG
TTTTGCTGAATGGTAATGTGAAAGTAATCGTAAAGTCACAATTACATGCAAGTGAAGTCA
TAATCTAAGTGTGTTCTGTTTCTCTGTATTGTCTTTTATTCTTGGTTAAGATTTTAGATT
CATTTGTTGATTCATTCACAGATTCAAACCCTGAATTTATCTCTAATAGCTGTGATCTTG
ATCCAGGATGTAAATTTTCTGTGCCCCTGTTCCCTTTTCCATAAACTGGAAACACTGATA
ATAGTTCTTATCTCATTTGATTGTAAAGAAAATTAAAAGGATTATTATATTGAAAGCATT
TAGAGCAGGGCTGGCATGCACATACTACATGCTTTAGTATTAACTATTTTGTTGATGTTG
CTCTTATTATCGTTATTCTCCTCCAAGATATGCAAACCTTAACTCAATGAATCTCTTGGC
TTCCCTAATACCTATTTATTGTATTTCCCTAAACTTCCAACTTTTTGTCCATGTGGTCTG
GTTCATTTCATCCTACCTGCTATGCCTACCAGCTTTTAAACTCCAGTCTGAACCATACCT
TCCTTACCTGGCTCATACCTCTGAAGCTGGTATCCTCTTTTTATGTTAATGTTTTCAGAA
AATTGATATTCACAGTCTTTCATGTCCACTTTAACCCATCTAGACTTATTTCTTTAGACT
TTCTGGGGAAAAGTTTTTCATGTAAATCTATCAGACTCCCTGTTCTATATTTCAAATTTC
ACATGTGAAAACAACCTTACGGAAAAAAGTCCAAATGGCATTCTCGGCAGTTATCTCAAT
CTGCCCAATGACAAGGAATCAAAGGGCAGTTCAACCTGCTTTGTGCCCAGAGGCATCCAA
TCCTGGCCATTATGGATTGGGTGTAGCCGGGGAGCATAGAGAGAATATATTTGAGTTGAT
TTTTAAAATTATTATTTTCCTCTTTGTTCCAGTGTTTATCCAGGACTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CAGAATTGCATTTTGATCTTCAGGCAAAGACGTCGAAGGACAAATGTGTGTTGAAATAAT
TGAATGAATGACCTGAAACAATTCCATAACATCAGCCTGGAAAAGAATGCTTGTGTTAAG
GAGGTGGTTATGATCAAATGGAAAGCATTGGAAGGAAAAGAAATAAATAAAAGCAAGGTT
TGATTTCTCAATTCTGTCACTTATAGTCTCCCAGTCTCATGGCCTCTCCTTTCTCTGAAA
GATGTGCCTTTCTGGATGTGCAGTTATTGTTTTTAATCAGTAAGTTGGTTTACGTATCCT
GTTTCTTCTACTGTCCAACTTTAAGTGATACCAAATAAGATACTGGATGTGCATGCCTGT
TGTACAATCTATATTAACCTACAAATGCACAGTATTCACACATACTTTGCATAGACGAGA
GAAATTCATCCAATTAATATAAAAGTGGTACCAAGTTATTTTGGTAAAAGGACAAGTAGC
TGAGCTGTAGGCCCATTTCATATTTAAAATTGGAATTTCATCTGTTGTCAATCTGTTAAC
TACTCAGATACTGTCTTTGAGGAAACTTTAATAGAGTGGGATCTATGAGATATATAAAAT
CAAAAACTCTCTAAGAATCAAAGGCTGAAGAGAAACCTCTGCAAGCTGTGAAAAGGGTTT
TACTGTTTTTAACTGCTTCCGTAAAGAATGAAAGTGAAGCAGGAACCATAGATGGGCTGG
TTGCTCCTTATGGGTGATATGATAGTGAGGTGCTCAGTCTAAAAATTCCTTAAGGGAATG
AAAAGTGGTATAGCATATTTAAAGTTTTGTTTTATATTTTAAAAATACCAATAAAAATAG
TGTACAAAATTATATAGAGAGAATCACATTGTAGTCAGCAGGCCAAGGTGAAGCAGAGTC
CTCTTTTCTCTCCATGTTGTGTCCATTGCTAACAACTCTTAACAGTTTATATGCATGCTT
CCAGATATTTTCTATAAATAATATAAGCACATATGTATAAAATTATATATATTTTTTACA
CAAATCGAATTCTACTCTTCATGATATTTATGGCTTTCTTTTGCACTTATGATGTTGTAG
GCAATTTTTTCCCCATTTCATTGCTGATAGATTTACCATGGTTTTTAGATTTAAGTGTTG
CATAGTATTCCACTGAAATATAAGTATGTAATCATGTCCCCACTCATGGCCTTTTCAGTT
TTTTCCAAAGTTTTCATTATTATAAATACTACTGCAATGGACACCTTGTACAAAAATATT
TATGCCTCTCTATGTATATATCTGCAAATAAGTCTGGTAAGAGGACTTGCTAGATGAAAG
GATGTATACACACTTTAATTTTGATGTGCATTAGCATAGAATTGATATATATCCAAGGAA
TATAGAAGTGATATTGTTTTAAAAAAGTTATCACATATACTGCCCGTATTAGTCAGTCAA
AGGGGGGCTGATGTAAAACACTCAAAATCTGCTGGGTGTTATAAAGGGCATTTATTTGGG
GTAGCAGCTTACAGTTATCAGATCATAAGCATAAGTTACTTGCCTCACCAAAGTCTATTT
CACGTGTTGGAGCAAGATGGCTGCCGATGTCTGTGAGGGTTTAGGCTTCTGGGGTTCCTC
TATTCCCAGGGCTCATTTCTCTCCAGGCTCAGCTGCTCTGCTCTCTCCACAAGGCCCAGC
TGTAAATTGTCAGGCTAATGGCTCATCTCTCTTCATGGGGCCTCTGTCGTGTCTAATGGA
GCCTTCTCTTTTCCTGACGTATCTGCTTCTCTGTGTATTTACTTCCCAGGCTCCAGGATT
AAAACTCCAACCTACCTTCTCTGCAGTGTGATTTCTCTGTGAGTCTTGCCCACCGAGGGG
GTGGGGACTCAATGTCCTACTGACGTGGCCCAATCAAAGCCTTAATCATTATTTAATCAA
GTAAAGTGAAACCTCTGAATCCAATATAATCTAAAATGCCCAAAGAGACCAGTTTACAAG
CAGAATCCAGTATCTATTTTTGGAATTCATAAATAATATCAAACTGCTACAGGTCCCAAC
CCCTGGTCGTGAACATAATCCATTTGTCAAAGCACCTTCGAAGACATTATCAGTTAAGGA
GTGCCCAAGCTGAATGAGGGTGGGTCTTAAACTAATATGGCTGAAGACTTTATAGCAAAG
GAAATTGGACATGGAAGAGGAAGCCACTGGGAGAGGCCAGAAGCTGGAAGTCAATGGAAC
CCAGAAGAGAGAGGAGAATATGCTTCCATGTGCATTGCCATGTGATGCCAAGAAACCCCA
ACAATTGCAGGCCAGCCAGAACATATCAACCCTGGAAAGAAGCAAGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAACAAAAAATTGCTTCCGAATAAATTGCAAGGCATATTTTTAAGCCACGTGA
CTCAGTATGCCCCTTCAGCTGGTCTTATCAAGGAGGCTTTTGGAATGCTGAAATGTTTAA
CAATATCTGACACTGAATTGCATGAAACTCTGTGGCGTGGTAGTAGTGGGTGGAAATGCA
TATTAATTAACCTAGAAGCCCCTCTTGTGCGCAAGTCAAATACCTCATTCCCATTGTCAC
TCACTGATGGTGGCCCTGGGATATATTTTCAGAAATAATTGTTTGCAGAGCACTTATAAA
AACAAATGAATCATCCTCATCACTATTCTTGTTCTATTTTAGAATGTTTGTCTACCAGAC
TGGTAAATTGGATATTTAGCAATTTAATAAAAATAATATTTACTATTTCTTTGAGGACCT
CAGAGTCTTCTGCAAATACACTTTCCATTTTTATTACAAACCCTCTTGATGCTGCTGTTT
ACCACTGTATTTTTACTTAATGTGATTATTTTAATTCAGTCTGAGTCATTCCTGTGGATT
AGCTGCTTTGCTTTCTAATTATATGTAGTCATATCTTCTGTCATCCTGTGTTATCAACAG
TGTCGCTTCTCCTCCAGAGAGCTCCTATATCTTTACACATTAGAACTGGCAAAGTTTCAT
GACACCTGCAGTAAAAGCTGGAAGCTACAGAAGGAGGGGGCAACAAATAATCTCAATTCT
GGAAATTGCATACGTTAGAAATAAAAGTCATCTTGTTAGTGAAGCTCTAGATTAGTCTTT
CTAATATCATTCTAAGTGGGTTTTAAGAAATTAATTATATTGGCAGCCTCTGAAAAGTAT
GGAAAAGGTGTGGCTCAAAGAAATGATAAGGCATTAACAAATTATAAACAATATGTTTTG
CCATTATGATTAAAATTAACCAGAGTCAGTTTTTCTGAAGCACTGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTTTCCGTGAGGCGTCAGAAGATGAAATGAGTAAAGGATGAGTCCG
TGGATTTTGGCTGAGCCACTGAAGCACTGAGTTGCCATTGAATACCTTGGAGGAGACTGC
AGACTGTGGGTGTAGCATGTTTTGAAAGGGAAGAACAGGGTTCCATTGCGAATGGGTTCA
GCTTGAGATGTCTGTTCGACATTATGGAGAGGTTAATAGACTGTTGTGTAGAGTAGTCTG
GAGTTCGGGTGAGAAATAGTGCTTAAAGATATGAATTTGGGAATATTTGGCATAAAGATT
TTACTTAAAGCCACGAGAGTGTGTGCGATCACCAAAAAAATGCAGGGAAACGAAGAGGAG
AAAGAGTCCTAGAACTAGACCATGGGGCACTCCAACCTTTAGATGTCAGAGCAGTGAGAC
AGAATGAGTGAAATCAAAGAACGAATGTACACAGTTCTGAACAAAAGTTATTTCTTGCAA
GACCAATTGCAATGATTATATATTCTGTTTGTTGCGGGATGTGAAAGTAATCTTTTGGGA
AATGTCACTCACTCAGCTCTTGATATAATTTATACAACAAGCAATCGACAATTTGCTAAT
CCCATTTGTTTCCTAGGGGGAAAAATGTCTAATTAAATGAACAGGGTCAGGAAAAGGGAC
TCAAGCATAGAGAGAGGAACTTGAGGGATTTTCAGGAAAGGTATAGGGAAGACTAAGCTT
TGGTATACTTTAAACAAAAGCAGCCCAACTAGTGCTTACTGTTTCATCTGCCTTAGGATC
TGTAGTCCCAATTGTCACATCACATCTTAAATATCGTATAACCAAAGATAAATCACCATT
TGTATCAATCAATTACAGTTTTGAGATAAGATCTGAAGGGTAAACTCTGAGTCTAGAGAC
TTGTTCTGAAGAAATTGTATGATGTAAGAAAGCATATTATATCCCATTTCTGATATTCTC
CTTTACAACTGGCTATTCAAAATTAGGTTTTAATTCTGACTTTTGGCTGTATTTGTGAAA
TTAAAAGACATTTATTTTTAGTACAATCTCATTGAAGATATTTTTTCAACCCTTGCGAGG
GGAGTTTTATATATTGGAAAAAAAAGTGAAACACCCACCACTTCCTTCAGATTAGTTTCC
TCTCCAATATAATGTGCCAGAAATCAGGATTTTATTTTTAAATAAAAGTAAGGTAGTATC
TCATGTGATGCCAAACATCTGGGTAAATCTGAAAAAAATATAGTTAGTCATCAATGTTTA
TTACTATCTGGATATTTGATGTCATGGAAATGATTAGTTATGATAAGCTTTTCAGTTTGT
CAAGCAGATGTTCACTGAAAGACAAACACAATCTTATTCCACAAGCTGAAAGGACATTTT
AGATGACCCACTTAAGTATAATTGTACTTCTGTCCCTTAAAGTTAAAGAGAAACAAATTT
TTTAATGTTATCTGTTCAATCATGTGTAAAGACAGTGTATGCTTCTTTATAAATGTAAGA
TTTCATACTAGAATGATAATGTGTTGCAATTTAACCTTTTGTGTTTTTAATGATATTAAG
GACTAAAAGCAGCCACAGACAGAATTATAAATTATATTTAAGGTTCAAGCATTTTGCAGG
CTTTTGCCAGTTATTTAAAACTCTAAGTTTTTTGTGCATTTTTTTTTTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCATACCTTTTTCTTT
CAAGGAACTGCGCTGGAGGGGTTTTAAAATGACAAAAGCAGCGTTGGATAATCTTGACAA
ATGCTTGTTTTCAATTTTTTGCAGTTGTCACTGTTATGAAATATCTCAATGAAGAGATCA
ATAGTAGCTCCTTATTTTGGAGAAGCATGGTGAGAGAAAGAAGAAATGAGACAGTATTTT
TGCCATCTCTCATCAGAGGCAGTTTATAATAAAAATAAACAAACGAACAAAAAAACCCAA
CGTAACCCCAACATCTGGATTCATAACTATTTCCCCAATTAAACTCCTTTTCCTTTTGCT
AAGGAGGAATACTTGTATTTTTGCATTAATAGAAAAGGGAATGGTGCTGAAACAGGTTAT
TACACATTCCTCTGGGAAAGCATATTACAAGTAATTGAAAACAAACCTGATTCTGTGAAC
TTGGCAGCCAATGTATAACAGAAAGCAATTTGGCCCTGGCCCCGGGATGATTGATTAAAT
GTCTTATTCTCTTTACCTTTCATTGACACCATGTTTGCCAAGAGGAAAGGGGAAGGGAAC
ATTCTGAAGCAAAGTCCATTTTAGACAAATAACTTGCACTAATGATCAATGACCTCCAAT
CAGCTGTTTATTCATTTGCTCTCGAGGTTTTTTTTCATTTTTTTATTATTTTTTTTATGT
TTCTTAGCTATTCTGTTTGGCTTCCTGCTGAAAAAGAGGCTCTGAATTTCCGCAAGCTCC
TTCCCCTCTGCCAGCTCACCAGCAGCGCGTGAGCTGTCTCTGAGTTTTCTTGATGGCACA
GCCCTGCAGCTTCCTGTGGCCGGTTATTAGTCAGAATCCAGCAAAGGAACAAGAACAGCA
TGTGCTCAGTCAGTCTGCTGAAGGCTTTATCTTCTGGTTGTGTGGGAGGAGAGGTCCCTT
TGTACACACTGCTCCTTTGAAAGGACTGGAGAGCTGCTGCAGCTGTACAGATGTCAGGGG
TGCACAGAGCCAGCATCCTACAAGGCTGGTCAATAAATGATGACGAGCCAGCCCTGAGCA
GAATAATGGTGGGAACCTGCATATAGAATATCGTTGACATATATCACGTGTTTTGTTGTT
GTTCTATAAAATGTGTGCAATGAACACCAAACCTCCTCAGTGAAACCTGTCCTTAAAAAC
TTGATACTGTTGAAAGATATCTAGCCATCTGGGCATATCACATGAGGAACTGCAAAGCTG
GTGGTGCCAACAAAATGTGAAGTATGACGTCAGAATTACAGAGGGCCCCTTCTGACATCA
CTTCATTTTTCATTTTTCATATTTCTTCTCTTACAAACTATTGCCTGGATGTTGGTAATT
GTACCTCTTCGTCCTGCAGTCCTTGTGTTGACACTTGGTCATCTCCACTGACCTCAGTCC
CAAAAGCCATGGTGACAGGGCTTGGGAATATAGGCCATCCCCGGAACAACAGCCAGCACT
GAGACCAGGAAGTCCTCCGGCCCTCCTTGTTTCAGTTGCTGGTGTGGAAATGGGATAACT
GGATAGAGAAAAGAGAGTAAATTCAGGCACGTGTCCTGCTCTCCTTGGTGCATAGGCTCT
CACTGTTGCTCACCCTTTAGCGTGTCCCTAATCGCCTCTGCATCGTGGATGGGAACTTCG
CCCCTGCTCCTCTGTCTGAGGCTGTCCAGGTTGGTAAAACCTTGAGGGTGCCTTGCAGCA
CACTTTGCTTAACAGAGAGATGGGCAGTCATTTGTATCATTTTTCTGATTCTCCCAAGAA
TAACAACAAACTGACTCTTAATCGTTTTCCTGACTGCTAGTCATTTGTCTAATCATTTCA
CATGAATTATCTTTTTTAATCCACCAAACATCCCTATAAGGTAGGTATTATCTTGCCTTT
TTCAAAGGAAACTGAGGCACAGAGAGATTATGTAAATTTGCCAAGGTACAATTTACATAG
TGAGTGGCATAGCCAGAATTTGAACCCAGTCAGTCTGTCTCCTAAGTGTATGCTCTTAAA
CATGGATTACCTGTCTGGACACACACAGAAACACATACAAACACACACATAGTTATAAGT
TTTTAAGCACAGAGAAAAATCAGGGAAAGTCAAAATCAGAAAAAAAACACATAAATGTAC
AAACATTCCCACAGGTTTATACGTAAACTCAGATTTATAAACTCGATTATAAATAATTTA
TTACACAGATTTATAAAACCCACCGAAAATGAAAACTCATCCANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGAATAAATTAGAGGGAAAGGTGGCAAAGGAAGGG
GGCACTCAGTGGAATGAATTTTCCCAGAGTTGGCAAGCAGATGGTATTGGTAAGCAAGTA
TCAGAGGCTGGGGGATGCAGGCAGGCACCTATGGACTCCAGTTCGCCAACCTATACATGA
CGTTACGGGTAGTAGAGGTAGAGCTAGTCTGTGGAATGCGCTCTGTGTGTGGAGCTTGTG
TCTATGATCAGAGTCTTCTCTAACTATTAGTATGGCTCCATAACTGAACATCTCTGACAT
GTTGGTGTTTGAGATTGAAACTTTATGAACATCGCATGAGTTGAGATTGCCAAGAGTCAC
CCAAAATGCTGTTTCTATACAAATGGAAAAAAACTTCAAGTAATGTATTTACACAGCTTT
TCATTTATTTGCTTGGAAAACACACACACATGCGCACTTGCACGCACACACACTTTTCTC
TCTGAGGAAACCTTGAGACAGAGAGTGAGAATGAGTGTGCTTCTCTTTCAAGTTCTCATC
TAGGTTTAGTTCCAATTTAATGACGCAGGATCTGGCACTGCCTTTAGACCTTCTGCTCCA
AGATTTTATTTTAATTTTAAACAAGTGTTCCCACACAGGGACTGAGAACAAAACTGGAAA
ATGTTGCTTAAGTTTTCCTTTGTGCTGCTATTATATGTCTTTCAAGTGTACTGATTGTTC
TGTCCTACCAATGTAGGTCATAAGTACTCTCAGCTGCTGCTCCCCCCTACCCCCCCAAAC
AGGAGTTTTTCTAATGGCTTTCTCATATTAGGCAAGATCATGCTATTTCACACACATTTA
TTTTTGGTATTAACATATTATTCCCCCCCTTTCTCTAATTTGGGTTTTAATAGTTCCTTC
TTAATAGAATTTACCACAAACTGCAAATTAATTTTGTTTTTGCTCAGCTGTGAAAGGTTT
TTACTTACTAAAATACTTAGGTATGAATGCTGTTAGTAACCAATTTCATTTGTTTTTCAG
TATATATATTTATTAGAGAAGCTGTGTGCTTACAAAATTTTGTTTTGAAGTTAGTAAGGC
TTTAGGCATTGTTGGGTCTTTCCTACCTAATGAAAGTGTTTGCCCTTAACTCGTAGACAT
GTCCTGGCTCTGGCTTCTCAGTCAGGTGGGCTTTGCCTTGATTCACCAGGAGGGTCTCCA
CTGATACGGATCAGTGCTGGGAGGTTTTATTGGGTTGGGGACTATCCCTTGGTTTAGTGA
TCCTTAGTGCTCTAACCTGCCTCATCCCTGCTCTTTCCCGTGACCTCTGGGTGTCTGTCT
GACCCAGTGGCTGGTCTGGAGAAGTGACTTGGGGCATAGTAAACACTCTCCCCCAGCAAG
TCTAGGATGGCCAGAATGAATAGGTTACATCTGACCCAAAAGCATAAAGAAAAGCCAGGA
ACTGAGGAATTCAAACACTAAAGATAAATTCAGAGGAGCAGGAGCAGGATGATGAGGAGA
AAATGGAAGTAAAATAGCCACAGAATTCGTAGCATTGGAATGAAAGCACATCAGGAGAAA
GAATGGAGGAAGGGGTGCATGGACCAGGCTCTCTCACCCGCTGTGAGCTTACTGCCTTCA
AATAGTGTCTGTATGCCCATTCAGCACAGGCAGACCACACCCATGCACTGTGAGGCGGTA
TAGTGATGCAGTGAGGTACACAGCCAACCAGGTCAGACTAGGTTTGGAACACAGCCTGGC
TCTATTACCTTAGCCACATTTCTTAAAATCCAGAAATGCCATAATCTCATGTCTTGCACT
CCCAAAACCAGATTTGAGATTGAAATCTCGTCTGTCTTCTTGAAAAAATGGGCTTAATAT
AAGACCTCATGCATGAGGGTATATTAAGCATTAAATTAGTTTGTACTATATGAGTTAGTA
CATACAGATCACCTGCAAGAGTGTCTGTGACCCAGTAGGTACACACTAACAAAAGTTCTT
GTTTTCACCTGCAAGAACTGGGTACTCCAAAGAGTTTTATAAAAGAGCTATGAAGTTTGA
ATAGATGGCTAATGGTTCTTTTGTCTTTGGAGTGCACCCAAAACCAATTTGGAGCACTGC
AAATGTCTGAGAGGAATGAGAAAACATCCCTTCTGGTGATTTGCCTCATGGCCTGCCCTG
AAGCTGCTTCTCTTAGATTCTTTTCTTGCTGAGAATTTCAGGTGATGGGCTTTATTCTTA
TGCATTCGTAGCATGACAGCTCAAAGATTCAGCAATGACATCTGCATTTGATAAAATTTA
AATGAGAAACTCCCAAAAGAGATGGTGAAAACCTATTTTGACACCTCTTCTTTATGGCAT
GCAGTATTGGTATATTTAACTGGGAAAAAAGAAAAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGTAAAGATGGACC
ATACAAATTTTGAGACTTTGAGGAAAGTAGAACTCCTAAAGCAGCTGAGACTTTACTTCA
ATTTTCAGATCTTTCAAAAAAGTCTGTGTTGAGTGGTTTCATAAGAATAAGAAAGACTGT
CACCTCTCTATTGGTATAAAGAATGATGCAACTAACTTTGGTGCAACATAAAAGACAGAC
AGAGGGAGAGGGAGCATCTTAAATTAGAATTTATATGCATGCTAGCCGATTAGGACTTTG
ACCAGCAAAAAAATTTCACAAACCTTTGGGGTACAATATTTTTAACTGGATTCACTAAGG
AGGGAAGAAAAATAAAAACTTAAGATGACAAATATTCTTTGAAGAGAACTAATTTTCTTT
TTATGCTACAATTTATTAATGACTATTACTTTGACAGTGAAGAATCTGTTTAAATATTTC
ATGGAAAGCAAAGCTGTCATGCAGGGACGACAAATGCAAGAATTGTAATTCTAAAGAATA
GGGGAAAAAAAGCAATTTAAGTTTCAGGGACAATTGGAACCCAGTAGGTGTCAAAGCAAA
ATATTGTCTTATGGGAGTGTGAAAGACCTGTTAAGACTAAGCTAGGTGGTTTAGTTGTCA
ATGATATAGTCATATTTGCTAAAAGGTTCATTAAGCTGACATTTCCCTGTATTCTTGAAA
TAGGTTAGTTAAAGAAGTTGAAGACACAGTCCTTGACATTTTATGCATTAAAGCATTACT
TTTCAAGCAGCTCAGTGCTCATCAACTATATGCATGTAGCTGCTTTGGTTGGGCTTTGTA
AACTCCTAATGACAGTGGGATATTTAGTAAAGACCTTCCAAACTCTATTTCAGGGCACTA
TACTCTACATGACAAAACAGTATTTCCATACCTATCTAGTAAGAATATTGAGGCACCTGA
AGGGACGTATCTGTTTATACAAGTGCACTACTTTATTTTCCTCATAAGTGGCTCTTCTGG
TTTCTTAAATAATTTTTAGTTGCTTTATCCAAATGTTGGGACTTTATGGAGACCTGTATA
GTGTCCTTTCATAGGTAGCTGACTATTGTGACTGTAGAAAGATTTATAAGATCATGCTAA
ATAAGATGTGCTAAATTCATAATATATTCAATAAATAGAATTAAGGATATAGGTAAAATA
TAGTAAAAATATATACAAAATCAACTTTTAAATGATAAACACAATCCACAAAGTGTGAAT
GTTTAATTGAGGAAGGAGTTACTTCATTGGGACTCCTACCACAGTCTATAATATTTAGGC
ACTGATATTGATTTATTCTTACATCAAATACTTACTGATGGTCTTCTATGAGACTATACT
GTAAATTAGACAAAGAAGACCCCACTCTCACTGCACTTACAGTCTAGAGAGAAGCAGGCA
CAAGCCAGTAAACAGGCAGTGATAATAGGGGCGACTTGGGGTGCCTGGAGAATTCCTTAG
AGCCACGCATAGACAGGACCTGAAAGTAACTGGACCAGGAAGAAACTGCCATCTCAGCTG
AAACCTGAATGATATGTTGAGTCTATTCTTTATAATGGGGAGGAGAGAGGAGCCCCAGAG
ATGAGATAGACTATGGCACTGAAAAGGAATGTAGTTGGAATCCAATAAATAATTTTCTTT
GAATGGGTGACTGAATGAATGAGACATATTTAAGGGTGAAGAGGGGGCAAGAGGATGAAC
ATGTTTTAGACCATCGAGTACCATATTTTCTAGATATGAAAATGATCCACGTTTGAATTG
ATAAAAATAATAATGAAAAGGAGAGCTGTTAGTTGGAGGAAATGACAAAACATGGGGGAA
AGGAAAGTGGAAAGTGGATCTCAAGTAAACTGTACTTGATATAACTGGAATTGATGAACC
AGGAAAAGATTGATTACATAATTCTCCATTTACTCATTAATACCCTAAAGAATTTGGAAG
ACAGAGAAATCTCTAGTCTTAAATGTTTAAATATTTTATTACCCTGTAGTATAAATGACA
TGTAATGTCACTTTTTTTTCTTTTAAAGATTTATTTATTTCTCTCCCCTCCCCGCCCCAC
CCCAGTTGTCTGTTCTCTGTGTCTATTTGCTGCGTGTTCTTCCTTGTCCCTTCTGTTGTT
GTCAGCGGCACGGGAATCTGTGTTTCTTTTTGTAGCATCATCTTGTTGTCAGTTCTCTGT
GTGTGTGGCGCCATTCTTGGGTAGGCTACCCTTTCTTTCGCCCTGGGCGGCTCTCCTTAT
GGGGCGCACTCCTTGCGCGTGGGGCTCCCCTCCGCGGGGACACCCCTGCGTGGCAGGGCA
CTCCTTGTGCGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGG
GCTTGAACCGCGGACCTCCCATGTGGTAGATGGACACCCTAACCACTGGGCCAAGTCTGC
TTCCCTGTAATGTCACTTTTATTATTTACTTATTCATTGTCCCATATATTCATTTATTTT
CTCTTTTTATAACATTTAAAAATATCCCAATATGGCATTAATCTGAAAAGGTTTTACAAA
TTACAGTGAAATCTTGCTGATAAGGTAAGATTGTTTTTCAATGACTATTTAGTTATATAT
AACAAAGCTAATGACAATCCATAAATATGACAATATACTTATTAAAGACTTTTCCTCTAG
GAGAAAGTTACTTTGTAATTGTTAATTAATCATTCAGATGGTTATTGAATGACAGAGTAT
AGCAAATCTGTGTTATAATTATATTTTATTGTTTTTTTCATTGACCCTTTTGTAAATAAT
AATATGTCAAACTTACTAGTGGATAATGAAGTAACCAAAGCATAATTTGCTCAAAGAAAA
AAACCAACAAGTGGTCAGGGTCCACTCTGCTGTGGTTCACAAAATTAAATTGAATGGTAC
TAATGTTCAAATGCAAGGCCTTATGCCTCAGAAAACACGTTTCTGTAGTTCTTCCTAGCT
GAAAATAGTCTGTGTAATGAGCCTTTGGTGAAATAGATAATAGAGTTACCTAATGATTAA
TATTAGCAAATACTGTGGACTTAAATGTAAGGAAATCATGGCGCAAAGCTGTTAATTTCT
TAATTTTCTCTAAATCAACTTGACTCAAAATGCATGGGTGGAAAAATGGTATGAAGGATG
ACTGACTTTAATTTCATTTTGAGGAAATAGCACACTCACAGTTAATTTATGATAACAGAA
AAAAGTGATCATTGATTCTATGAAATTGTGTTTTAGATAGAAAGGTAAATGAATTTTGCT
AAATATTTAGGAATTGCATATTTCATGTATTCAAAAATTTTACTTAGCACTTACTTTTCA
CTAGATACTATCTTGGATCCTGGAGCTTCTATCAATTACCAAAGCAGATAAAATTCCCTG
AACTCCTGGGCCTTATATTCTATGGGTAGAAGGAAATATAAACAAGGTAAATATGTAAGG
CCTAGACATGGTTTGACAGAAGATGAGTGGTACGAGAAAAAATGAAGCAGGTAGGGAATA
GTGAGGGCCGGGTGGAGTTTGCACTGTAAATAGATGGACATGGAGAGGCTACCTGCATGG
GCCTCACCTGAGCCGGGCTTGAAGGAGGTGAGGAAGCAAGCACTGTGCTATCTGGGCGGC
ACTTGGCGGTCTGGCCAGAGCAATGTGAATGAGGGGCGGGTTAGGAAAAGAGGTCAGAAA
AGTAATCGTTTTCTCTTTGACATTGGTGGAAGGGAGGGGGTTGCAGATCATATAGGGTAT
CATTGTTCATTGTAAAGATTTTAGCTTTTATTTGGAGAAAAGCATTGGAAAGTTTTAAGG
AAAAGAGTGACATAACCTGAATTCGATTTTAAAAGGAATATTTAGCTGCTATTTCTAAAA
TAGACTCTAGGGAGGTAAAGGTAGACATAGGAAGGCCTGTTTGGAGATATTGTAGAGACC
CAGGTAGAAGATGAGCAAAGTTAGGGCCAAGACAGAACTAGTGGAGGTTATGAGAAGTGG
ATGGAAGCTGAATATATTTTGAAGTTAGAGCCAACGGGATCTGCAGACAGATTGCATGCA
GGATGAAAGAAATTAAGAGGAGTCAGGAATGACCCCAACTTTTTAGCCCTGACTTTCTAG
AACAATGCGATTCTATTAAGTGGGATTGGGAAGACTGTGGGAGTGAAGGCTGGAGCTCAG
TTAGAGATACCTATTAGAGAGCCAAGTAAAGTTATCAAGTAGAGAGCAGGATTTTGCATT
TTCACCTTCAGAGGAGAGCTGAGGTCTATGGATATGAGTGTGGGTGACCTTAGTATATAT
AGATGGTGTTTAAAGCTGTCAGCTTTGATAGGATCACTCTGTGAGTAAGGGTGGAAACAG
CACATATTGTAACATTAGAGAAGAGAAGAGGGAGAAGTCAAGGAGATTGAGAAGAGATAG
CAAAGGCAGGGACAGTTACCGGACATTGTATGTCCTCCCATGGCCCACTGGGTGGACTGT
GGGAGAGTGTGGGCTATGATGTGCACCATTGACCAGGAGGTGCAGCAGTGCTCAGAGATG
TATTCACCAAGTGCAATGGATGTCTCATGATGATGGAGGAGGTTGTTTGTTATGGGGGGA
GGAGTGGGGTGAGGGAGGTGGGAGGTATATGGGGACCTCATATTTTTTTAATGTAACGTT
ACCAAAAAGACAAAAAAAAGAGAGAGATAGCGAAGGAGGCAGGGGGAAACCAACCTGGTT
GGTTTCCAGGCTTCAAATGCTGCTAATAGAACAAGTGAGGACCGAGAATTGGTCATTTTT
GTTAGTAACATGAAGGACTTTGGTGATCCTCCCCAGACAGATCTCAGTGCAATTATAGGA
GCAGAGCAAAGGAGTATGAGCCAGGGCCAGAGTCTTTGCCCTGTGCTACAAACACAATAG
CAAACTCACCCTGTCCCCGCTTCCCAAGCTTCACACAGCTCATCCCCTTTCTCCTAATAA
ATCGTTTTTCACACAGGGTAAAATAAAAATGATGAGGTTTAGTTTTCAAAGTTATCATAG
TCCAACTCTATCACCCTGAAATAACATCATATTAAGGATGATTGGATTTAAGAGATTCCC
AGGTGTCGCATTCACTTATTTATATACAAGTTCTTTGGCCCCACTTGTAGATGGATAATC
TCATCCTACATGTATGGATTTTATTGTTCTATTCCCTGGGGTCACCTTAACTTCAAATTG
TTGGACCTCTTTCATTTGAACATTCTTAGAGATTAATANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTGTTAA
AATAGTTTAGCATTCTCTTTACTTCCTTTGCTTCAGCCTCTTGAGGGCATTTTTATATTC
CCTCCAACACCTTGTAGAACTATGCATGAGTAATATATAGAATAAAGGAATAATGAGGAA
TAAAGGAAATGTAGTAATGTGCAGAGCATTTATTAATAATTTGATATTGATAGGAAAATA
GATTAAATTGCTCAGAGAGCTCACTCATAAAGCAGATGATTTGCTCTCAAGTTGGGTATC
AAAATTTAAATCCTGAACCGTTCATATCAAGAATCTCTTCCAAGAATGAATCAGGAGTGC
AATTAGGAATTGATTCATGGATGAAAGTGGTTGATGGCTCAGAGAGGTTTCTGAAAAGCA
GTTAGGCACCTGGGAAAGCAAAGAAACAGCTGCGACCCAGCCTGCCAAAATCAGGTGTAT
TAGCAAACTAATAGAAGTGGATAACCTGAGTTTCTATGATGTATACAAAAGGTCTGGAGC
ACCATACATCTGAATTAAGTTATACTATTCTAAAAAAAAAACATATTGAAAGTCAAACTG
TGATGTTCTCTATTATTCACTGTTGTAAAACTAATATTTTAAAAATAAAATTCAGGAAAC
ACAGTCCTCTAAATATAAAATTGAATAGATATGTATTTAGTTATGTTCTCTCTCAAAGGA
GGCTGGAAAAGAAAAAGGCAAGTGGAACCTTATCTGACTAGTACATGTGGAGACATATCT
AGAAAGCAGAGACTTCCCACTGACCTCAGAGGCCCTTATAACTAGACCATAAGGACAGAT
GTATAAGCAGATACTATATATTCCATATTTACTACTTAGTGGTATCTTAATATATTAGTC
CATCGAGGAGCCTAAGAAAATTCAGAACCCAGCACTCTTGTTTGAAAGAATCCATCTCAA
GCTGTCTCGGGACTACCACTTTCTACGAAAGTAGGGTACGACCTCTGGGCGAAAAAGTCA
GACTCCAGTGACTTAAAATTGTGGTATTAAGCTGATATGCTGCTCAAACATAAGGACGAT
GAAAATGTCCTAAGAGATGATAATTTGTGACAAGGGATGAAATAAATTGGACATGAGGGG
TAGAACAGAATGAGGTTGATAACCAGTAACAGTCTAAATTATTTTTTCAAAGATTTGACA
AAATATGCAAAGCAAACTATTATACCACTTAGTTACTCTCTTCCTATAGGTGTAGGCATC
CTATCATGGTTACTGTGAGATTCTTTTCTTCTAGTCTCCCACATTTCATGGGCATTTTAC
CTGCTATAATTACCTCAGGTACAGGGTTGATTTGTCTCTTGCTGAGTAAACTTTAATGAT
TTGTCAGTTTCTAAGGGTAAGATACCCTATATCGTAGGGTAGCTGTAAAGGTTCATTTTG
ATCTTTAAGTGATAAGTGAAGTTAGTTTGGATCTTTAGTTCTTTGGATCTTCAAGTACTA
AGTGAAGTTCCTAAAATCTAAGAAATATAGGAAGTATTCAATATGTATTTTTGAAAGAAT
AAATAATCCATGACCCCTCCACTTTATGAATTATTTCTTGATTTCAATATCTTTGCTAAC
ATGGGTCCCTCATTTTATCTTAGCCAGCAGGTCAAATTTTTATCCATTGTTTCAAGGATT
TAGGTCAAACTCCACTCCTGTCTTAAAGCTGCCCCACACCTCCTCCTCTGTGTTCCCATG
ATTTACATTATTTCTGAAATGCACTTATCATATTCCTCCTTGCCTCGTGGTTGGTTGTAC
CTTTTCCCCCACCTAGATGTTGGCTTTTAAAGACAGAGACCTTGACTACCCATCTTTATG
TTCCCTAGAATTCCAGCCCTAATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATTCTTAGAGATTAATAATTCAAGAGGGATTTTGAGGTGTTTTAAAGGAGCATA
CCACACATCAAGCTGTCAACTCCATTCACTTTCACTACTCATATCAAAGTTTCTAATATT
TATTAATGAACTTTAAGCAGCCTTCATTCTTCCATCCATCCATCCATCCTTCCATCCATC
CATCCATCCACTCAATAAATTTGTATCACTAGAGTAGGTATTAGGACCATAGCTCTTCCA
GAAATCAAAAGCCAATCTAATAATAAAAATAAAAAGGTACAATAATACTGTACAAATGTT
TACATATAAGTCTGATTGTTGCATAAACTATTTTAAAATTATATTCTAATCATGAGGAAA
ATACGACAGTGACAGATCTTTTCTGTCTATAAAGGAAACATGGCTTATATAGTGTACTTA
CACTAATAAAACAATTATTTGGATGGGTGCAGTATACATTGATTTAGTCATTTGTTCATG
GGAAGGGATCTTTTTCACGAGATATTTTCTTTATTTGTCTGTGAAAAGCAATTCAAAGGA
CAGTGTAATTAAAAAAATTTTTAAAAAGCAATCGACTACCTTAAACTGATATTTCCAGTT
GGAATGATTTCCTGTGGATGTGGGAACATGCACCCACCAACATGGCAGTAATAGAAATCA
TGTCAGAAGACATCAGACTGCCTCAGATCTCCCAGGGGCTCACAGCAAGAAGGGACCAGC
CTGGGGACAGGTAGCTTTCGTCTTCCTTGAAGATAGATAAGCCCCTATTGTCAACCCATG
GGATATCAAGGACCAGTGGATTTGGGAATCACATGTGCCAGTGAGAAGAACTTGTTTACT
GTAGGATTTATTTGATGGAGAGTGAAAAGAAAACGGAGAGAGAAGAGGGAAGGAAGCTGT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTAAAATTTTCTGCTCTTGTG
AAATCCTTATAAAGGTTTGTTGACTTGGTGGTCCTTTGAAGGATAATGTGACAAATTGGC
ACATTTTTTTCGCATAGAAAGCAATATGATTAAATTTCATCTCTTCTTTTGTCAATTTTG
CTAGATTATTTTCCTACAAATTTTCAACATTCTATACATATTTTATTTTGTTTTCATAGT
GTGTGTTTTTCATAGAGTAAGTTATATCCTTAGTAAATTTTGGTTTTATTAATCTATCAA
TTGCTAAAATAAAATGTTAAAATCTCTCACTATGGCTGTAGATGTGTCTAGTTTTCCTTG
TAATTCTGGGAATTTTTTCTCTTTATGTTTCAAGGCTATATAATTAGATGTTTTCAGATT
CAAAATTGTTTTTAAGTTCCTGATAGTTTCATGTTTTTTGTCTGATATTTTTAGTACTTT
CTTTTATCAAGTCTTATGATTTCCCATAGCTATCTACCAGATTCTTAAATAATTTAGGGT
ATAATTATTTTTAAAAAGAATGATTGATTTCATTTACAAGAATCCTAGGAAAGTGAAGTT
GATACAAGTGCCTTGGAACTCATGAATATAGGTAATTGTAGTATATAGACAATACCTGAG
ACACAAACATATGAATTGCATGTACATGTATTCAAAGATCAATAAAATACCCAATTATTT
TATTCTATTCCAGGGAGGAAACATGAGCCTGCATCTGCTTACCTAACACAGAGAAGGGAA
CCTATTAGCCTTTTAAAAGCAAACAAAATCTGATAAGTAATCTTATATTTTTGATACACT
TTAATTGTTCAATTATTTTTCACATTGTTTAGATTCACATCTCTTTGATCAATGGAAGAC
CAAGTGCTGATGACCCTTCTCCTGAACTGCTGGAATTTACTTCCGCCCGCTATATTCGCC
TGAGATTTCAGAGGATCCGTACCTTGAATGCTGATTTGATGATGTTCGCCCACAAAGATC
CAAGAGAAATTGACCCCATTGTCACAAGAAGAGTAAGTAATGATGAATCATTTTGGCACC
TGTGAATGATATTGTGCCAATCTTTTTAAATTGTCTGTTAAAGAACTTAAAAAGAAATCT
TTTGATAATTTATAGGAGTGATTATTATAGAAGACTTCAGATTAGACAGACCTTGGTTCA
AATCCAAGCTCTGCCATTTATTAGATATGCAACATTTATCAAACCTTTCAACCTTTTTAA
ACCTTAATTTCCTCTTTTGAAAATGAAGATCCTCATGCTTAGTTCAATATTTTATTTTAG
AGGACTAAATTATGTAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CACACACACACACACAACAACAATACATCTTAAATTTTATTGTTCATGGAACCATCTGGT
GATCTTGTGGAAATGCAGATTCTAACTCAGTAGGTGTAGGGCAGGGCTGATATTCTGTAA
TTCTAGCAAGTTCCTAGGTGATGAAAATGCTGCTGGTCTGTGGACCATATAGTTTTATGG
CCTATTGAAGAATCACAGCCCCTGGTTTAAATACAAACAAACAAACAAACAAACAAAACC
CAACACTTCTTTAAAGGAAAACTGATTTCATTTATTGTTCTATGTTCCTTTAAAAATAGA
ATATTGGTTGGGGGGGAGGAGATTGAAGCATCTTTTTCAGCAGATCTTTGAACACGTGGA
GCTGATAGAAGTTCTGTTTTCTAGTGGTACACTGAAATTTGTGAGATTATGATATAGCTG
GTTAGCCCTGGTTGCTATAAGCAATAATGATGTGTCTTTCTGTCTACCCCATTCACTAGT
TTATGACACCTTCCTTACATTCTGCTGCACCACCACGACATTGTTACCAAGTGACTCAAT
CCAACCACAAAGCCATAAAGCCGACTGTATGATGGACTAAAGGTGCAGGTGGGAAGGAAG
ATGGTAGGGAAGAAACTAAGATGGTGGGACAGAACACTTAGGGGCAGTAGGGTTCTACCA
CTGCCACCAACTGCCAAATTGCTGAACCAGGAGGCTGAGTATAGAGGGGCAACTTTTTTG
CAGTTCCTGAATACCCCTCAACATGTTTCCTCTCTTATTAACTCCTCCACACCTAACCTC
TCCATTATTACAAAAGAGCTTTAATGTTTTAGTTACCCCTTACATTTGTCAGATGTTTTA
CTGCCTTGAATTTTCAAATCCTGAAAAAAATCTTAAACTATTATATTCAGCATATTGTCA
TTTGTCTCATGCACAAGTAATTATTATTTTGTTGCAGTTCTGAATTCTCTACTTCACTTG
TTAAGGAATCATTTTTAATCCTAATTTTGGCATGACTTAAAAATGTACACTAAGTAAGCC
AAATAATATCGAAGTAAAATTTATCTTTCCTGACAGCATATCTATCAGAGAAAAAAAAAT
CAATGAAAATAAATTACTGTTCCTTTTATCATCTTTTGCAAAAGGTAGAGATGGGAGTTG
GGATACACATCTATTATATATAAGTGCTTTATACAGGAGTCCTTAAATTAGTGCAGTAAA
TTTCAACATATAAAAATTTTTTGATAGTACTCCAATAGATATTATATATAAGTTTAAATA
TATAAATAGAGGGATATTGATTATTCAGCTCCTCTTCATGACTGATAAGCAAAACATTAT
GCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGC
TAGATTTCCGTTAGAGGTCAGAGAAAAATAAAAGATAATAAGTTGGTTTTTTTTCCCCAA
TTCAAGCTCAGGGACCCCAGGTTAAGAACCTCTGAATTAGAGGCACTCTTTCTTTGGGCT
ATGATTAGAATTCTAGGAGTTACTTGATCAATTTTATGAGCCCTCAGTTGTCTTCCAAGC
ACACAAACTTGCTTCCAAGGATAAAAACAGAAAGTAAAGTTGTTAACTGAGTGTTCTCCT
GTGTTACTTGAACATTGCAGTCATCTTAACAGGATTTCTCTCTGCCTTGCTTCTGCAGTA
TTACTACTCTGTCAAGGACATTTCAGTTGGCGGGATGTGCATCTGCTATGGTCATGCCAG
CGCTTGTCCACTTGATCCAGCAACAAATGTATGTATATTTACAGGCTGCTTAGATGAAAT
GAAGCCCTGAACTGTGAAATGCTTCATGAGAGACTTTGCTGACAGGAAATGCTGTGAATG
GGTGTCAGGTCCCCACGTAGACGGTGTAACCAAAAGCCGTGCCAGGGTGAAATAGAGCTG
GCAGTTAGGATGATAGACTTTGAAGTCAGTCATCACAGTATCTGAAAACAGATTAGGTTT
TTTTTTTCCAAAAAGGCTCCAAACTGGTTTCTTTTGAAACCTCTCTAGCTATAACAGCCT
GCCACATGATTTAGCACTGGAGAATGCCTGCCGTCAATCAACCTGCACAATTCTTTTAAA
TTTTTTAATTAGAAAAATTAATGGCAACAAATAAAAACATGCATGGAATTAAAGACATAA
TGGCCATGGGACAGGGTGCTGGGGTTGAGCAGGGGCAGCAGGGAGTGGGGTACAAGAGAA
TATTCAAGAGAAGGCTGAAATTGTCAGGCTAGAAAATATAGGAAGGCTTTGGGTAGAATT
TTTCATTAATGTCTATGTATTAAGTGATCATAACATAAAGAAGAAGATGAATGGGCATCT
GATTTTCTCAGTCATAAATAAATTGGAGAAATACAAAATCATCTACTGTGCATATAAGGA
AGAAGTATATGGACTAGTAAGATCAGCCGATATAAATAGGGCAATGGGATATTTTTTCCT
ACTAAAAGTGTAATATGAATGATATTATTTGGAAAGCTTGTTTTCTGGCTAACAGATCAC
ACTGTTATCTCCTTGAGAAGGTTCAAATACTGGGCCTACTTTTCAGATGAGGTTGTAGTG
CTTTCTGCAGGGTGTGGATACTCTTGATGGGATGCATTGGTGCACTCTGTTTTCCACGCT
TTCAGGGTGCACAGGACAGCTTTGACGACCACTTTCCTGGGGTAACTTGACACTGTACTA
GTAGAGCACACGAAGAAGAAGATGAGACCTTGAGAATGCTAGATTTCTAGTCTACCTATG
CCACTAGATGTCTAGAAACCCCTTCCCCTCTTCTCATTCCTTAAAATGTTCATAGTACTT
GAGGGCAACCTTCATATAAACCTCCAATTCTGAGGCATCAAAGAATTCATTCTTCAAGAC
AGCTCCCAATCAGGGCTCCCTTCTCAGTGCCAGTGAGAAGGCCAGTGACTCCGGAACCAG
CTTGGGTCCCCCTAATCTGGTGTCATTTGAATATACCAGCTCCAAGGCTGGCTCTGCCTC
CTTCCCAGATGGGCTGGAGTTTTGCACTTTTGTACATAGTCTAGACATTTTCTCTCTTCT
TTGTACTACCTTTCAGGGAAAGCCCATCATGCATGGTTCTATTAATGCTCAAAGTATGCT
TTCTCCCCTCTTTTCACCAGAAATCCCGCTGTGAATGTGAGCATAATACTTGTGGGGATA
GCTGTGATCAGTGCTGTCCAGGATTCCATCAGAAGCCTTGGCAAGCTGGGACTTTTCTAA
CTAAAACTGAATGTGAAGGTATGCTCTTCCAACTTGCTTGAAGACGTTTTCTAAAACTAT
GAAAGCTCATATTTCTGCTTTATGTAATTTATCTAAGGCAATGGCTGGTAAATTCTTTTA
ACCTGTTACCTTATTACTCCATGTTTCAGGTGTTCTGTTTTGTTTTTTTCAATTTGGCAA
ATATTTACCAAACACCTATCACTATGGCAATGTGTGAAGGATTATGAGATATAGATAAAG
GCATAGGGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CTTTTCTTTCGATTGTGTCTCCTGCTGTAAGATATTTGATTTGAACTCTCTCATCCTTCT
TGGGAGGGGTATGGAAAATGAGCTGTCAGTACCTTCTGTTCTGGAGAACCACAGGAGGTC
CAGGCTTTGTTTCCTTCCACTCCCCACCCTATTCCTGCCAGTCTCACAGGTACTCAAAAG
CCTCTCCCATAGAGAGAATATATTTGTTCCAAAGGTGTATTTAAATCAAATGATACCCAA
ACCTCTTCAAATTTTAATTAAATTTCTTTTCTGTTTGTGGAATATCAAAGTCTTGAATGG
GAGAAGCATTTGAGATTAGGGGTTCTTCCTGTTGTTTCTGATATTTCCTTCACAGTTATA
ACTTTGATTACATGTGTAAGTGGATCTGAAAATCCTTTACCATTCTCCACTGGCAAATGC
ATGTTTAAACACAGAAAACAAAAGGACAGATGAAACTTTTGGCATCAGGGGTAACTAAGA
AGTGAGAGGAGATTCTCATTTGCTACTACATTCATTTTAAAAATAGTGAGATTATTTTAA
AAAATTTTGCTTTGTGAAGCAGATGCAAGGTTTTATTTCCAAATTAAGAAAATAAACATT
AACAAAGTAATTAAAGATGGCTTTAACCATAAAGATTTATATAAATACAGTGCTTTGGGT
AAATGCATGCATTTCAAAAACCTTCTACAAAAATTGTTTTTTCCAAGTTGGATCACACTC
CAATCACCTTAATATTTAGAAAAATCCTCTGTGACATGCCAGATCCCTCTGTAAAATGAA
TAATCACCTTCTAATTCCTTATAGTTTAACTTGGAATTTCACCAGTCTGGCTTTTTTAAG
GTGAGGTTTATCTCTAAAGAGCAAAGAATATTAACCACAGCGCTACTCCTTTACTAAAGA
ATAGTTTTTTTATCATGTGTCTTGGGCATTCTGTGGAATAGTAAGCTGCTGATGAGACAG
CAAAAAAGGGTCTATGTGAGCAGGTGCCCTCGGTCTATGTCCTGTGAGACTATAGATATA
GAGCTGTGCAGCATGCATGGCTCTGGACTATAACCAGGAATGCCGGGAAAGATCCTTGCC
GCTGGGAGTGCGAAAAGGACTGCTCCAACCTCTGTGTTTTAGCTATGTTAGCTCATGGTT
AGATACCACCAGTAATACTCTAAATGTGAGAATAATTTCGTATTCATCTGTACTTCTCTC
TACTTATATCAGCAGTAGAAATCTTGGCTCTTTCTTGAAATACATTTTTTAAACAGTGTC
TTAGTTTCCCAGGTACTGAAACCAGTGCTATACAATGGGTTGGCTGAAAGAGTGAGGATT
TATATTGGCTCAATATTTTGAGGCTAGGAGAAGTCCAAAGTCAGGCATCACCAAGGCATT
GCTTTCTCCCTAAAGACTGTGGAGTACTGGCTGGCTGCTGGCAATCCTTGGTCCTTTCAC
TGTTCTCTCATACGGGGTGTCACATGGCACTTGGAAATGTCTTCTGCTTTCTCTTCCGGT
TTCTCTTGACTTCCAGCTTCTTGCTTCTTCTCTCTGTGGTTTTCTCTTTCTTTGGTCTTC
TCTAGGGCCTGCAGTGATAGGATTAAAACCCATCCTGCTTCAGTTGGACACTTTAATTAA
AAATAACATCTTTTAAATGTCTTATTTACAATGAATTCACAGAAATGGATACATAATTCA
ACCTACCACACAACAGGGATTTTAAGAATTCTTGTATATTGTACTACAGGTATAAATCTG
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAAAGATAG
AGCATGAGGGAGAATGGCAATTGGTCAGCAGTGAAGACTCTGGACCTTGATTTCAGAGTT
TGGTTGCCAATCCTGAGCATACCTTGTACAAGTTGCTTCATTTTGTATGTTATATATTAG
ATTCCTAATATATAAAGAGGTTAATAATAGGACCTAACTCATAAAGTGATTTTTAGCTAT
CAAAGCAGTAGGAAAAAACACAAAACACTTGGAAAAGAGCCTGGCATTTGAAAAATACTA
AATAAGTTTTAGTCATTATTAGTAGTCAAAGAAAGGACTAATAGATAGATAGATATACTG
TGTACCTGTTTTCACCCTTAAGTTCTAATGCAAATAGTTGCGTATAGTAATTTTTCATTA
CAGATTACATGGTTTTTAATCATTCAGGGCCAGCCTTCTTTAATTTATTAAGTTTGTCAT
AATAGGAAATTACAGGTTGAACCATATGAAATTGTAATTTTATAAGTCAAAATTCTTTAA
ATACCAGAAATTTCATATGGTTCAGCTTAATTTATATGTTTAAAATATCAATTTCCATTA
AAAATTTGATTTTAGTCATACCTCCACTAAATCTGAATACTTTCTAGAGTTCTTTGTACT
GATTTATATCATACACACACACTAAGTATAATATAATTTTCTATGTTGTACAAAAATCTT
ATTCATGTATAACTGAAAATGTTTTATAATATATCTAAAATCTGAATTTAATGTTTAATA
ATTTATTTTTCCCTGGTATAGCTTGCAATTGTCATGGGAAAGCTGAAGAATGCTATTACG
ATGAAAATGTTGCTGGAAGAAATCTGAGTTTAAATATCCAGGGAAGGTACATTGGAGGGG
GCGTGTGCATTAATTGTACCCAAAACACTGCTGGTATAAATTGTGAGACATGCCTTGATG
GCTTCTTCAGACCCAAAGGGGTAAAGTATGCTTTTTCTTTTATGAAATGTTATTTTGACT
TTATTTATGCTGAGATGTATTATTCAGAAAAATAAATTGTTTCTCTGAAAAGTTGAACTT
CAAATTCAAAAAAAAGACATAAATTGATTTTCTTGTTAATGTGGTAAATCTTCACTGATA
AACTTTTAAAATATTAAACTTTGCATGCCTTGGATAAACCCCACTTAGTAATGAGATATT
ATCTTTTGTATATATTGGATGATTTGGTTTGCTAATATTTGGTTAAGAATTTTTGCAACT
ACTCATGAGGGATATTGGTCTGTGATTTTGTTTCCTTGCAATGTGTTTGCCATGCTTATA
TAGCAGGGCATGCTGGCCTCAAAAGAAGAGTTGGGAAATGTTCCCTCTTCCTGTTTCCCA
AAGAATTTGTGTAACATTAGAATTAATTTTTTAAAAAACGCTTAATAGAATTCTCCAGTG
CAACTGTCTAGGCTTTTAGCTCTTTTTATGGGAAAGACTTTGATAATGGATTCCACTTTG
TTAATAGATCTAGAGCTAAATAGGTTTTGCATTTTCCCTTGGGTCAATTTTGATGCAATG
GGTTTTTCAATGAGTTTGTTCATTTCGCCTAATTTGTCAAAATTTATTGCCATAAAAGTT
TTTCTGACATTCTGTTGTTAACCTTTTAAGGACTACAGTCTCAGTACTGGTATCTCTTCT
TCATCCTAAAATCATTCACTTTTTTTTTCTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGCTTCTATGGTTTCTAATGTGA
AATGGCAGCATACATTGAAAGGTGTGTGTTTTAGTGAGAAGAGGAGGTAGAGGTGATCAA
AGAAGGATTACAAGATGTAAATAATACTATAGAAAGGAGAAAATGTATGCAAAGGACTGA
AAAAGATAATAACCATGAGCTAAGGAAGGGAAAGAGACTGACACTAATTTAAACCAAACA
CTTGCTTTGAGGCATGAAATTCACAATGAACTCCAAACATTGAGGAATCAAATGCCAACA
TAACTCCTTGATGTATAACATTCAGGAGCTACTTTCAGGGCAGTTGCTTGCCAAGTTTAA
GTACAAAATTCATAGAATGTATCTGGAACAGTTACTTTCTATCTCTAGAACTGGATTCTT
CTTTTCTGTGGAAAGGCTAAAAATAGATCACTGCTACAATATAGGTATTTTCCCCTCAGT
GAATTTAGAGCTAAAAGACTGGCAATGTTTCTTGGGCACATTTTAGCTTACCTTCTTTCT
TTATAAAACTGTAGAATTATCATTTTGAGCATTACAGTCTTAAATCTTGAAAATTTTAAA
AAACTGATATATATCAATATTTAAATTTGAATAATTGGGATCGTATATAATTTTGAGGAT
CCCTTTCCTTCTTTTAATTTTTAATTTTTAGTTAAGTCTTTTTTTTAAACATACATAGAT
CACAAAAAATGTTACATTAAAAAATGTAAGAGGTTCCCTTATACCCCATACCACACCTGC
CCCACTTCACCCACATCAACAACTTCTGTCATCATTGAGGCACATTCATTGCATTTGGTG
AATACGTTTTGGAGCACTGCTACACTGCATGGATTATAGTTTACATTGTAGCTTACACTC
TTCCCCAGTCCATTCGATGGGTTATGGTAGGGTATATAATGTCCAGCATCTGTCCCTGCA
GTATTATTCAGGATAACTCCAGGTCCCAAAAATACCCCCATTCACACCTCTTCTTCCTTC
TCCCTGCCCTCAGCAACTCCTGTGGCCACTATATCCACATTGATGATACAGTTTCTTCCA
TTGCTAGAGTCACAATAGTTCTATAGTAGAACACCAGTAAGTCCACTCAAATCCATATTT
TATTCCTCCATCCTGAGGACCCTCGGATGGTGATGTCCACTCCACCTCTAAATCAAGAGG
GGGCTTAGATTCCACATGACTGATGGATGCAATTCTCTTGCTTGCAGTTGTAGATACTCT
TGGTTCTCTGGTGTGGTGGTTGACCATCTTCACCTCCCTGTTAGCTGAGATCCCTTTCCT
TTTTATAGGAAAAACTGAACTACAATGCTATTTTCAAGAGTATCATTTAGCTCCTCCTTC
AATTGATAAATATATTACCAATGAAAATTTAGAGAAATAGAAAGGTAGAAAAATGAATAT
AAAATGCAGTGATAATTGAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACCATCGAGCCCAATCACATCAC
TGCAGCACTATCACCCCCATCCACTGCCCAACCACCCCTATCATAGGTTTGCCCATATTA
AGCATTGGCTCACCACACTCTGCTCCCTTTCTGTCTCCTGATAATGTGTCTTCCAGACTC
AAGCTCTGTGAGTCTGCTCAGTTTACTTAATTCATATCAGTGAGGTCATGTAATATTTGT
CCTTCAGTGACTGGCTAACTTCACTCAACATAAGGTCTTCAAGATTCGCCCATGTTATCC
CATGTGTTAATACTGTAGTCCTTTGCACAGCTGAGTAATATTCCATGGTATGTGTATACC
ACAATTTGCTTATTCATTCATCTGTTGATGGACACGTGGGTTGCTTCCCACTCAAAGTTT
ATTTTTATTAAAACCTTAAGAATGGATAATTTATTCGTTGTAAAACTGTTATGTGACTCA
TCTTTCCTTAGGTTTGGCACCTGGATCCTGCCACTGTAAAACTGGCTTTGGAGGAGTGAG
CTGCAATCGGTGTTCCAGGGGCTACATTGGCTACCCAGACTGCAAAGCTTGTAACTGCAG
TGGCATTGGAAGCACAAATGAGGACCCTTGCTTTGGTCCTTGTAACTGCAAGGTACATTG
TTTGGTCTAGAAATGTCCCACTATCAAGACAGAAAGTCATTTTCCTTTACTTTTCTGTCT
GCTGGCATTAAGCAGTTGTTAACATCTTCTCCTGCAAATACCCACTATCTGTTTTGTATG
TGGCAGTCCTGGACATATCTATTAAATGGCTACCAGCTTTGCTGCAGTGAGACATGCATA
AGTCACTTGCTCTTTTTCTGAACATCTGCATGCACACAGAAGATAAGTCACCTATAGGGT
CGGTGTCATTTTATAGCAAAAGCACTTATTCCTCATTACCCATGTAGCCTATTAATTTTT
AAATATAGCACTAAAAATAGCAACTTTTGGAACTACATTATACTCAAATCTATAGTTTTG
CATCTACTTCTGAAAATAATTCTGCCAAGTGAATCCAGATTGGTTTTAAAATACCTGTCA
TCTTCAAATTCTTCTGTTTAATTACCAACAATGTAAGATGCCTTAGAAGAATTGATTAAA
GGCTCAATATTTCCTCCCAAGAGTATGTTTAGAAATGCAACTTTATTTGTTGTACATGCT
TAGCTAATAGCTCATCATTTTAGTACCACGGGATGCATTACACCTGCAGTTTATACACAT
AGAAAAAACAAGTCTAAAATGACAAGACTAATTTCCTTTAGCTATAGTAAAGCGGTTCTA
TAATATTAACTGAGAGAATGAACAATTCATTTAAGATGTTAACATGCCACAATTATAGAA
AATAAATGTTATTTTCTTTTCTTCATTCTATTATAAGTAGAGAATAATGGTGGATGAAAT
TTTCTTGAGCCTTTTCTTTATTATTTCATTGATCTTATCTAGGCAGCTATAAAATATTAT
AGGTTTACAGTTGTTATTTGTGTATAGATGTGTGTATATAGAAATATTAAGCTATAACAC
CAGTAGTAAATATTAATATATTCAGTTTGTATTTATGGGGACAAAAATGTCTAAAATTCA
ATAATTATAAAAGGTTTATAGTACATTGGGTTAATTTTGGTATCTACCTTAGAATACTGA
AATAATAAAACTGTCTACACAGAAGAAATTCTACAATGCCATGGATAAAGAGTTGTCATG
TGCTGGAATATAGTAAAATTTTCTAGATCTAGTAATTTAATTTCAATATTATCTAAAATG
ACAAACTGTTCTCTACTAGCCATTCTGTGAGTGATTGCCTGGTGAAGGACACTTCCTCTT
GCCATCCTCCAGGTCTTTAATGTATCTTTTTTTCCCTCTCCCCTCCCTGTCCCCCACCCC
CACCCCCCAGTTATCTGCTCTCTATGTCCCTTTGCTGTGTGTTCTTCTGTGTCTGCTTGC
ATTCTTGTCAGCGGCACCTGGGATCTATATCTCTATTTGTTGCATCATCTTTCTGCATCA
GCTCTCCATGTGCGGCGCTATCCCTGGGAAGGCTGCACTTTTTTCGTGATGGGCGGCTCT
CCTTACGGGGTGTCTTTAATGTATCTTAATATATTTCTCTAATATTTACCAAAACATAGC
CTGTGTATGCTAACCTCCGTCTCCAGAAGTCCACAGAAGTTGCTAACCTTTACCACTTGT
TCCAACGAGAGACAGACAAAGCTGAGTTTAATTTGAAAGAGAGACTGAGTCTCTAGAATA
AAGTAAATCAAACTAAATTAAAAAGTTTTCATACACGTGCCATTTATAGAATGGGAACAC
CTGATATTTGCAAGAAAGAAACAACATTTGAGAGAGAGAGGCAGACCTAATTTTGTTTAT
TTTCATTGAGAAAACTAGTGAGAAAGGCGAGAACAGGGGAGCCTCGGTCATTAGCAGAGC
TCCAAGGGAAAGCTCCCTGAGCTAATGCCTGCTCTCTACCTGACTCAATATTGTAGAGAG
TGATTATAATCCCAGTAAGAAAAATGCCACCTACAGAGACATTTCAAGCTCTACACAGAC
AATTAAACCACAACAATAAACAGCAATTAAGAAACCATAAAAGAGAATGAAAAATGAAAT
AAATAGCATCATTAAAAGAGCTGCCTTTCAGCTATGTGATATTCTAAATCAATGTTTATA
AACTTAGAAACTAAATGATTTTTGAGAGTGAAGAAGTAGAAATCAAGTTTCACTCAACAT
GTACATAATTATAAATATCACATTATATACATATGGCATATAAATTATATCACAATCTGT
GTGCATACAAGTTACTAAAATTAAGTACCTGTAACCTCTTATTTATAAGAATAATAAAAG
CCCAGTATTCAACAAAATATGGATACATTTTAAATATTGAAAAGGCATTTATAAATATAG
AGAAATTTGACAATTCATTCTGTTTAACAAACAACATTGTTTCACAGGTATTTTAAATGA
CTGTTAAAAACAAGTTGGATCAAAACGCTATCTAAAATGTACAATGTTATTGAAAGGTTA
AGATACTATAGACTTAATTTCAAATAACAAGGTAGATTTTTACCTGGATAGAAAGAATAT
ATACATACATGTCCATATCTTCATATCAAAGTTAATAACTGAATAATTATGTATTCATAA
ATAGAATATAAATTACCTGTAAAATAATGTCTACGTATGTGTTCATCTCCAAAATGTATG
TTAACAAATGAATATTTGCATACTTATTCCCTTAAACTAAAATACATAATGGGTTTTTAT
GATTTTCATGAGAAAGAAATATCTCATTTACTGAAGTATAATGAACATTTTAAGGAAGCC
CTTTTTAATGAAGTCTTGGGCCTTAATTATTTTCTATTGTAAATTTTAAATGACTGACAT
TCTGGTAAAATGTAACCTGAGCTACTGTGGACACCACTTTTCCCATTTCTCACCTTTTAA
ATACATAGATATCCTGGATAAAACATAGCAAATAGGGGAAGCGGATGTGGCTCAAGTGAT
AGGGCTTCCGCCTATCATGTGGGAGAACTGGTTTTTATCCCTGGTACCTCCTGGTGAAAA
AAGAAAAAGAGAACGTATGCCTGTGTGGTGAGTCAGTGCCCACAAGGTGAGCCATTGCCC
GCATGGCAACCCAGTGCCTGTGTGGCGAGCCAGTGCCTGCACAAGTGAGTCACCCAGCAA
GATGATGATGCAACAAAAGAGAGACGAAGGGGAGAGTCAAGGTGAATTGCAGCAGAAACC
AGGAACAGAGGTGGTGCAGCTGACAGGGAACCTCTCTCCACATCCAAGGTTCCCAGGATC
AAATCCTAGTGAATCCTAGAGGAAAAAAAAAAAAAATAGAGAGAGACCAAAAAGAGAAAT
AGATACAGATCACATGGTGAATGAATACAGACAGCAAAAAAAGCAGGATCGGGGGAGGGG
GAAGGAAAGAGGGGAAATAAAATAAATAATAAATTTTTTAAATTAAGAAAACAATAATAA
TAAAAATAATAAGTCCACTAATCCCATCACATTAAGCTAACTGCTAGATGTGATTATCTT
ATATTAATGTTGATATTTTTGTATATGCCTCTGGGAAGGGTTCAATGAATATGTACTTTT
AATATTATGTTATACATAGTGATTTGTAAATTTGTTTCACTAATCAGCATGCCATGAATT
CGTTGTTATATTAATAAAAATACTTCTTATATTGTGAGAGTTGCATACTATTGCATTGTA
TGAGTACTACAAAATTATTATAGTAATTTATCAATAATATATAGAAGTTTCAGCTTTAGT
AGATAATTAGATTCTGTTGTATTTTTTTTTCCTTTTGGATACAACAATATAAAGAACATA
TGTCTTTGTACTCTTATTTGATTACTTTTTAGGATAAGTTAATAAAAGCAGAATAAATGT
CTATGAAATGAATTAAAATCACTTATTAATTACTAATTTATATGCTTAATTTACTTGTTT
TATTGCATTATCTGCCTCCCACCATCTAGAATATAAGGTTCTTGAGGGCAGTTATTTTGT
CCTGCTCAGTGGTGTCTCCGTAATCATAGAAAACACAGGGCTAGTGAATATTAAATATTT
GTTGAATGCATGAATGAGTGAAGCTCAATTGGCATAAAAGTGTTAGAGCCATAAGGTCAA
GAACAAGAAGAACAAGCATGTACACACTTCACATGGATTATCAGGACATGGACCTTGCCA
TCACAATAAAAATATGTGCATAAATAATACATGAGACTGAGTAAAAGAAAAAAAAAAATG
AAGGGGATATAAAGTCTATATGCCATTCTTTTTGGACAAAATTGAATTATCCCTTTTGCA
GACTTGTGGCTGAGGCAAGAACTCAGCTGAACCTCTACAGCAGGAATTTTATGGGCTATT
TTTGGTAACTTCACTTAAGATTAAACATTGACATCTAAAGATAATGTTACTCAAAAGATG
GATGGGGTTATTGCTGTATTTTCTCTCTTCTGTCTAGTCCTAGAAAGATATGAAATGCCA
ACAATCCTCTCATTTTGGGGATAACTTGACTATGTAGTGGTCTAATCCAAAGCCTTCAGT
TTATCTTTTGTTTTCATGCAAAAGTTTTATTTTTAAATAATTTTGAACATATACATAAGT
TACAAGTACAGCAAAAAGACTTTCTTATTTTTTCTAAACAATTTGAGAATAATGTTACCA
ACTCATCACCCCCAAAAACTTTTAATGTTATTCCCATAAACAAATATAATTGTCCATAAA
AACCACAGTCAATCAGAAATAAGCATTGAAACCTGGCACCTACCTTTCTATTTTCCAGGT
CTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAAAGAGACAAAAATCAAATTGTTGCATTTAGTACTTGCAGTCCGACCTTTTCCAAA
GAACTATTAAGTGCTGTACTTTAGTAAAAAGATTGAACTTAAGAGAGAGTTTCACTACAT
AGTGAGCTACAAGGATCAATTTATAAAAAGCAACCAGGGACAACCAATTTTAAAAAGTAA
TAAAAGTATGTAAATAGTAACAAAAACTGATTTTTGGCAATAAATGTTGCCAAAATGGAG
ATCATTTAAAAAGATTATTGAAGAACATAAAATAAACTTTTTAAATGGGGATATAATGGA
TAATACCGTGTACTAGTGAGAATCTGGGGATATGGAAATGTTTACTATTGCTATTTTTAG
CTTAATGTAACACCACAACTTAGAAGGACAATATGGCATTATTTCCTGTCATTGAAGATG
CCAAAACAATGTAAATCTAGGGTAAATCTAGACATTTACCCTAAAGAAACTCTCTCAATA
TTCAAAAGACACTTATAAAAGATGTTCAGCATAGACTCACTTGTTCAAACCTAAATACCC
ATAAATAAATAAGAAATAAATTGTAATTTTTGTATATGATCTGATAGAAGAAACAGCATG
AATGAAATAGGCCCATGTATTCAAACATTCACTTTCATAAACTTAAAGTGGAACAAAAAC
GCAAATGCCATTATGTTACCACTTGTGTAAAGTTTTAAAACATTAAAAAATTCTATATTG
TTTGTGGATATGCACATATATAATACAATTTTAAAATATATTGAAACATTTTGTACTAAT
TTCAGGATAATGGTTAATTCTAGAGAAAAGCAAGAAAATATAATGAAAGTGAAGGAAGAT
TCAATTGTGTCTATTATTTCTGTAAAAATGTATCTGAAGCAATCATGAAAGAATTATTTT
TTACATCTAGTTTTTGGAGAATGGATTGTACTTACTATGCTTTGAATAAGTATGTGTACT
TAACTATGCTTTGAAATAATTCCATCACAGTATGTGTACCTACTATGCATTGAAATAATT
CCTAATTTAAAATTTCTTTAATTGGAGGAAACTGTTTCTGGGATTAAAAGAAGTGAATGA
AATTCTTCTGTAACTTAATACAGTATCAACTACACCATCACTTATATTTTTCATATGGTT
TTCTATTATGTCCTTGCTTAGACAGGATATTAATGAGCACTATCCTCATTATAATTCAAA
ATATGATAAACATTGCTTACTCAAGACACAAAAATGTTTATAAATCTTAATACAATCACT
AACATATAAAAAAATCTTCTTATGAATCATAAGAAGCAAGTTAATTTCAAATACAGAGCA
AATAAATGCTCTTTTGATTCTTTGGTATTTGTTTATTTTATGGACCACATACTAGAAACT
GGATCTTTTACAGTTTGGTGTGATAATATCTATTCAAAGTCAGTTGGGTTGCAGGGCTCT
GATTTTAAAAAAACAGAGAGAGATAAATAGACCTTGACCTAGGTAGGAACAAGTTCTTTT
TTTTTTTTTAATTGAAATCTTATACATAGAAAAATCCTAGTGAAATAAAAAGACTGGAAC
TCTGTACAAAATACAGAAGTCTGTTTTTTTCATCTTCATTTGTTTTGCTTTTTGTTGTAC
CTTACTGCCCATAAAGTTGTGAGTTTGGCTCAGCTTATCTCTCCAGAATGTTCTTTAGAT
TCAGTCACTGTCTTCCAGACTTGCTTAAATTCTTTGAGTCACCATGCTCTTTCTAACTCT
GGAATTTTATAGGTTCTATTCAATTCATTTGAAAGACTTCATCTCTAGCTTCTTCCTTTG
CTTAGCTAGGGTGTAGCTTTTTTTTTTTTTTTTCAGGGTACAGCTTAACTTCCACTTTTC
CAGAAATCACTTGTCACATTCTTGTCTTTTGCTTTATTCTCTTTTCACAATTTGCAATCC
CATGTAATGCTTGTCTCACTTCAGTGATAACACGAATTTTTTAAAAATTTTCTCCATCAT
TGCACTATAAGAGGTTAACACTGGGACATGCGTAAGAGTATACAACTAAAAAGTTGTGAT
GCTTTTGCAGTTGCTTGACCTTCCTGATTTGTGTTCTTTGACTATGACATGGTGATATTG
TCTTTTCTGCCTAATTCTTAATAGCTATAATTATAGTATTGAAGCCTTCTATAAATATAA
AGCACAAGCATAAATACTTTCTGGTTTACGTTGTTTTGTTTACATTGCTTTGCACAAGTA
GCAATAAGTTTCCATTCTTTTTCACAACTGGATTTTTATGCTGTGCACCAATATTTATTT
GGTTTTAAGTGTTCTCTTTGCTTTTCCATTTGTGTTCAAGACTGTTCATGTCATTACAGT
TAGGTTTTAACCTGGGGCATTTCTAAAAAGGGCCTTCAATTTATATGTTTGATAGTGAAT
CAAAATTACAGATGTCAAAGTTTTGGCATAAGAAGGTCACCCAGGAATTTGCCTCATGCA
AGAGCTACAGATGTTCTAATATTGTGGTAACTGACACTTTGTATTGACCTTTAAGTTTGT
GAAAAATGGGAGCAAATTTTCTTTTATTTTGTTTTCTCCCTCTCTTCCTTAACCCAGCAA
CTCTCTATTATCTAGCCTGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCCATTCTTTAATGTTAATGATGTGGACTTTTATTTCCTT
TTTAAAGGGAGAAGTTAGGTCTACATTCTTTCCTACTTTAACTGCCTGTGTACAGTCTTA
CTGAAAATTTTCTTCTGAGGAGCCAGTAGATATTAAATTTTGTTTTTTAGGTATTTTCAG
TTTTTCTTCATTTTGCATAGAGGTTTATAGCAAATTTTGGTGTCAGACAAACTTGAATTC
AGTTCTGGCTATGCCACTTCTTAGGTCTGTGATCCTAAGTAATTTAACTACTCTATACTT
TAGTTTTCTCTTCCGTAACATGGGATAATAAAAGATACCAAACACCTAGGATTGCTGTAA
GAATAAAATGAGATAATGCAGATAAAATGCCTAACATGATGACTAGCACATAGTAAGTGT
TCATTATATGTTCTCATTGGTATTATTATTCTCTACCGTATAGTCATCTCTTTACAACTC
TCCCTGCATCTTGAAGTTCTTTCTTTTCTTCTTTATACTAGGACTTAATTTGAAAAAACC
CTTTATTCTGCTATGACTGCTTTCTTTGTTTTTCCGAGCTGCTTTCACAAATACAGTACG
TTGGCTTAAACAACAGACATTACTGACTCATGGTTTCAGAGGCCAGATGTCCAGCAGCAG
GATATTAACAAGACTTTTTATCTCCCCAAAGATTGTAGTGTTCTGGTGCTGGCTGCTAGA
GATCCTTGGGGTTCCTTGGCTTTTCCATCACATGTCTTCTCTTTTCTCTTCCTGGTTCCC
TGCTGACTTCCAGCTTGTGGCAATTTATATAAGGCCTCCAGTAATCCTGATTTAAGACTC
ACCCTCATTCATTTGGGCCACACCTGAATTAAAAATACTATCTTACAAGAGTCTTATTTA
CAATGAGTTCACACCCATGGAAATCGTATTAAGATAAATAAAATGTTGGGGAGCATGTGT
AGCCAGTGGATGAGTGCCTGCTTCTCATGTACAAGGTCCTGAGTTCAATCCCCAGTACCT
CCTAAAGAAAAAAAAAGACTAAAAAATGTCCATGTTGGGGTACATAATTCAATTTACCAC
ATAAGGAAATATTAATCTCTGTGGAATGGAAGTCTGGAGAATTCTGAAAATTACTCTGTT
TCATAGGTTTATGAGTGAAATTACCATAAAATTTGTATTTTTAAAGAGTCACTAATGGGC
TCTCACCAAAGTATTAAATTGAATTTACTGGATTACAGGAGTTTCCCAGTGGAAATACTG
AGAGGAAATAGATTAAATCCCATTTTGTTTAGATACCTAAAACAACTTTTTAAACATTTG
TTGAATTATATGTTGATAAGGCTTTTAACATTAATCTGTACAAAGAAATAATATAATAAC
AGCAAAAGGAAATAGAAATCTCGTAATGAATAAAATAATACTCAGGCTGGAAATTGCAAA
TTCTCATCATAATTATTAGCTGTTTGGGATCAATGATATTTACATCTAAGTTTTAGAGAC
TGAGTTGGATGGTGACAAGGTACAAGATATGGTCTCTGCCCTTGAGGAGCTTATTATATA
AATGGTAAGAAAAAAAAACCCAAAATGATGGTTTTACTGTTTATGTAATTTATTTCAAGA
AATGACCTTTAATAAGTATTCTTATATGGAAATATTACACACCAGAGGACATTGCTGGAG
TAGCTGATTTTAATTCTTTTGTTAAACTTCTGGGATACATCTTTTTCTCTCAACCCTGTG
GCTTTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCTCCCCTGCCTGCCTGTGTACTCTTCCAAAGAGGCTTTCACCTTCAGTACTTTGAGTA
TTTGTCACCAGATGTCTGAAATTAGTGTAATTTGCTTTGCTGAAATATACCATCTCAAAC
TATCTGAAATCTACCTTAAAAATAAAAACTAGCAGGAACATTATTGGAAATACTTCAGCT
TGTGTAGTTATTAGGATGCTAAAGCTTAACAAATGAGCCAGCGTTAGAGACACCACCTTG
TTGAGGCTTCCATCAGTGTAGAAGTGGTTGAGGTTATAAAATTCATCATAGAAATTGAGT
CAACCTGTTCATTACAACAAATTGTCCCCTCGGATACATAGATAAATGCTTGCTTTCTTT
GTTCTAACAAATCTCTTATTTTTTCATGCAATTTTCTCTCCTATTTTCCCCTAAATGTTC
TCCTATTTTATCATCCCTCTCATTTGCCACTATTGGTTCACTCAAAAATATTTTTATTAA
ATAGCTTCTATGTGCATTGCACTTAGCTATGTTTGAAAAACATGGCCACTAGGAGATGCA
TTTAAATTTAATAAAATGTTATAAAGTGAGTGCTCATTACTGTGGCAAGAACACTGGTTA
GAGTTTTGGGGACTATAAAGATAAGTAGATAAGGTTCCTACCTCTGAGTTGATTGTGGTA
TAGCTCGAGTGGCAAAGTTTAGGAGAAATAGCTATGGTTTTTTGTGGTTATAATAGGGAA
ATGTGAAAGGGCTACAGGAACACAGTTGAGAGAGCAGTTAGTTCTCTGAGGAAAAGAAAA
GCTTCAGAATTGAGGCAATAAGGGGATTCAAGGGAGGAGGGAAATGACGAACAAGTGCAT
GTTTATGAATATTGAGCATCTGTTTCCTGGAAAGTAGGGAGCTTTCATTTGGATGTTATT
AGATGAGATTAGTCATATTTAAATTGAGAAATTACACCCTTCTCAATTTTTCCTTAGAGA
ATCAGCTTTCACTAGCCTTAGTCCACATTATACGCACACCTACAAATAATTTTTCTGTGT
GCTGTGACTAGACTTAATGAAACCAGTCTGAAGAGCAGTTATCAAATGAGAATTATATTT
TTTTCAATAATATTGCTATATGATTAATTAACCGTACTACTATGTTGAAGAAAGCACTGG
AAAGTACAACCAAGGAAAATGTAGGATGTGCAATGAATATTTTCCTTATGCAGAAATAGG
TATAGAAAATCTTAACGTTGAAGGGCACCTCTGTTTATCCTAATANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGACTTCATAGAAAACCATGAATGGGAGTCTAGATCTAACGTCCCTCATTGGTTCAA
GAGGTCCCACTCCACCCTAGAGCGTGCTATATTAATATTTCCAATTTCATTACCAAGAAG
GTGAAAGAGCTGACACTCAGGTCTTGGGTTTCCATAATGAAGTGTGCGTCAATAAATAGT
CTGGAAAGAACGGTCTCTGAAACTCACAGGAGGGATTTAGAGTACCTGAAGGGTAAAACC
TGCGAAGGGAAGAGGAAGGGAGGGAGTATATTACTTATTACCCAGCTATCCAACAAGATG
TTTATGAGAGAAAATTATCAGAGTGATTTATAACCCTACCCCATTCTCTGGCTCTCTTCC
TTTTAACCTGGTTTCTATTTCTTTTCTGGGGACAGTCCCAGTGATTCCATATGATTTGGG
GACATGTAGACACAAATAACCTCTGCACATCACCAATTGTCTAGTGACATTTGCTAGCCA
ATAGTATTTATCATGTGCTAATTTATAAAATAAAATTAAAAGCTGAGGATGGTTTATGTT
GCCTTTACTTTCTATCTTAAATCTTTATTACTTTAAATTGTCATAAAATCAGAATCCCAG
ATATTGGAAGATTAAAAAAAAACTTTTTTTTCCTATTTTCTATGGAAGATTTACTTTCTG
CATATTTTTTCATATCAAAGTTTAACTTTAGCCATATCTACTAAAGAAGACATTTTCGAA
GCAGTGCAGCCACGTATTGTCATCATTACCATTCTGCTCCTACCACCCACAATACCCAGC
ATTCACACCTATCTAATACACCCCTGCTAGCTACAAACTTCACTGACCAGTGTTTTGTCC
TAACCAGGTGGCACGGTTTCAAATTAGAATGATAACTATGTGCCCGCCCTTGCTGGAGTA
TGAAGGTGGAAGAATGAATCATTACGGATTCTCTTATTCCTCCTTTTTTATTTTTATTTT
AAAAATTTTTCTCCCCTTCCCCCACCCCAGTTGTCTGCTCTCTGTATCCATTTGCTGTGT
GTTCTTCTGTGACCGCTTCTATCCTTATCAGCTGCACCAGGAATCTGTGTTTCTTTTTGC
TGCGTCATCTTGTTCTGTTTCTCTGCATGGGTGGCACCATTCCTGGGCAGGCTGCACTTT
CTTTTGCGCTGGGCGGCTCTCCTTACGGGGCACACTCCTTGTGTGCGGGGCTCCCCTATG
CAGGGGACACCCCTGCATGGCACGGCACTCCTTGCGCTCATCAGCACTGCGCAGTGGGCC
AGCTCCACACGGGTCAAGGAGGCCTGGGGTTTGTACCAAGGACCTCCCATGTGGTGGACG
GATGCCCTAACCACTGGGCCAAGTCCGCCGCCCTCAAGTGTGTTTTTTATCTCACCTGCT
GTGTCTTTCATTCCCATGAGCTCTGTTACTTTTCTGTTCAGGAGTTAAAAATCTTCTTGG
CTCTCACTGAATGTCTTCTTGATGTCATTTATCTCTTTGCCCATACTGTCTTTCAACTCC
TTAATTTGATTTTGGAAATTTGTGCTCATCTCACTGATGAGTTTTCTCAAATTCTGCATC
TTTTCTGGGGCTTTGATATATTCCTTTTCTTGGGCCATGTCTTGTATTTTCTTAGTATGG
CTCATGATTTTTTGCTGATATATAGTCATCTGATTAGTATTTAGTTTACTCAGATGTTCA
ATTTCTTTCTCTTTTGTAGGGATTTAGTGGCACAAGACTGTTTGTTACCACTGCTCTTTG
ATTCTTGGCCTGACCTGGATTGTTAGGATTATCTTGCTTTTTGGTCAGAACTGGGCACTG
GACCCAGTAATTGGTTGTAGAGTCACTTCTTAAGGCCTTGGGAAGAAAGGCTATAGAGGC
CTGAAAAAGCCTCTCCTACCTATTTTTTATTTTCGTGTATGTACTTCCTTGGTTTGCTAG
TAGATGGTGCTCTTTGGCAGTTCTCAGTTCAGTGCCTGGTCGGAGTATATTTGTTGCAAC
ACAGGTGAAATCAATGTGATTGAGTTTCCTGTCTGGAAGCTATAAGCCTTGTAATTCAAA
CTTTCTCTGAGACAGTTCTCCAGCCTTCTCTGGCAGCCCCCTCCCTTTTCCCAGTTCGGA
AATATTTCCACTCCCCTCCGAGTCCTCAACTCTGAGTCACAGTTAGTAGAGGGGGAGATT
GGGAGGATTGTATATCTATATTCCTTTGCAGGCTCCAAGGCAAACAATGGTGCAGCTCCA
CCCGGCCTGGAATGGCTCCTGGGACACAGCAAACCATATTTATGGGTTAGAAGCTGAATC
ATCATCAGACTGTGTTATTATCTTTCCCATTTCCTGGAGTGGTAGTTCCCCGGAGCCCCC
TTAGTCTGCAGTCACAGGCATAGAGGCCTTAGAGTTCTAAAGTGTCTTTAGTGTGGGAGG
TGGAGGCAGCAACAGCAGCTGCTGATTTCAACTCACAGTTCTGTCGTTGCAATTTCCCTC
CTTTGTTCCTCTCTCCTCTTGGTGGTGTTTAGCCTTCACCTGGTGTCCTAAATCCTAGAA
GATCTTTTTCTAGCCTGTTGCTGCCTGTTCTCTAGCTATTTTTCTGGAGAAGAGAGTCCT
CTCTCTTTCCAGTCCGCTATCTTTCCAGAAGTCTCCCCACAATTCAGTTTTTTTTTTTTA
CAGAGCTGTTCTTTTTTTTTTTTTTTTTAAGATTTATTTATTTATTTAATTCCCCTCCCT
CCCCCGGTTGTCTGTTCTCTTTGTCTATTTGCTGCATCTTGTTTCTTTGTCCGCTTCTGT
TGTCATCAGTGGCACGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCACTTTCTTTC
GCGCTGGGCGGCTCTCCTTACGGGGCGCACTCCTTGTGCGTGGGGCTCCCCTACGCGGGG
GACACCCCTGCATGGCAGGGCACTCCTTGCGCACATCAGCACTGTTCATGGGCCAGCTCC
ACACGGGTCAAGGAGGCCCGGGGTTTGAACTGCGGACCTCCCATGTGGTAGACGGACGCC
CTAACCACTGGGCCAAGTCTGTTTCCCCCTTTTTTTTTTTTTAAGATTTACTTTTTATTT
ATTTTTCTCCCCTTCCACCCCTCAGTCCCATTGTCTGCTCTCTGTGTCCATTCACTGTGT
TCTTCTGTGTCTGCTTGCATTCTTGTCAGCGGCACCAGGAATCTGTGTCTCTTTTTGTTG
CATCATCTTGCTGCGTCAGCTCTCCCTGTGTGGCGCCACTCCTGGGCAGGCCGCACTTTT
TTTGTGCAGGGCAGCTCTTCTTACAGGGCGTACTCTTTGTGCATGGGGCTCCCCTACACA
GGGGACACCCCTGCATGGCACAGCACTCCTTGAGCGTATCAGCACTGCGTGGGCCAGCTC
ATCACACATGGGTCAGGAGGCCCTGGGTTTGGACCCTGGACCTCCCATGTGGTAGGTGGA
CTCACTATCAGTTGAGCCAAATCTGCTTCCCCTAACAATTCATTTTTAAGACAGTATTTG
ACTTCAAATTTCTAAAACTCATACACAGTGTGTAATTTTTCTTTTTCTTCAAAATGTATA
TAGGTTGATTCAAGTTTAAGGAGCTTCAGTTTGAGGCTCAAGTTTTGCCTTTTGAATTAA
AATAATTATCTTCATTTTAGTTGTATCAGCTTTGAGACCTTGTCTTCCTAATATCCACAC
AAATACTTCCAATGCAATATTTTCACTTGTTTATGAAATAAGGACAGTATAGTATTTTAA
AATTAAGAAATCAGACACTGCTAAATAGAGATAAGTTATTGAAATTTAACCTATTTCTGA
CAGCACCATAGAATTAGTATTTGAAATATTTATTTTTCAGCCATCGTATGAAATTCTGAA
TTCAAAGTATAAAATGTAGCTTTGAAGGGGGAGTTAAAGTATAAAGCATAATATTTCTAG
TAATTGGAAAGTCAAATGTAATGAAGCTAAGAATTTCCGAGGAAAAATTCCAGCTATCTT
AAAAATTTACTGGGAAGCAGCTGTGACTCAAGCAATTGGGCTCCTGCTTACCATATGGAG
GGTCTTGGGTTTGATTTCTAGGGCCTCCTAGTGAAAAAGCAAGCTGGCCCACGCAGTACA
GAAAGCTGGCTGGCCCGCATGGTGTGGAGAACTGGCACAACAAGATGTCACAACAAAAAG
AGACACAGAGTAGAGACAGTGAGGGACACAACAAACCAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTTATCATCTTTTAAAAAGAATGTGTTCTTTGAAGGCAGTGACTATCAATTGCT
TGCATATTCTGGTAGGGGAATAGAACTGAAATTTATTGAGCACTTACTGTGTGCATAAGG
TGCTGTATTAGGTACTTTACCTATGTAATCCCAACAGTCCTTCAGGGTAGGTAGGCTCTT
CTTCATTTACACATGAAAACTTGAGATATAGAAAGGTTAAGTAATTCGTGTAGAACTAGG
AAAGTGGTAGATGTTGGATTTCAACTCAAATTATACTGTGCTATGTTTTTTCCAGGGATT
GCAAACTACAGCCCATGGGCCAACTGATCCCCTGCTTGTTTTCATAAATAAAAATTTATT
GAAACATAGCTATGTCCATTCTTTAATGTATTGCCTTTAGCTTTAAAGCTATAACAGCAG
AGTTGAGTAGCTGCAATAGAGACAAAGCCTAACATATTTACTATCTGACTTTTTACAGAA
AAAGTTTGCCGACCTCTGTGTTAAGCCATACATTGCTTAGAGGTGCTGTAAACTGAGTGC
ACATTCAGTAATGTAAATTTCAAAATCACTGAAGCCTTAGAATTAGAAGAGACCAATGAA
GGAGATTCTCAATAATCTAATGAGAAAGGCAAAGTAATGACTAACAACAAGCCATGAATG
TTCAAAAGCGTTTGTATGAAATTTGAAAAGTTTGACTGGGAAAATTTAAATGTCTTTTCC
ATTCCTATGATTTTTTTTTTTTAGAAGTTGTGGGTTCACAGAAAAACCATGCATAGAATA
TAAGATTATCCTATAACACCCTATTAATTAACGCCCTTGAATTAGTGTAGCACCTTTGTT
ATACTTGATGAAAGCACATTTTTTATGATTGTACTATTAGCTATTGTCCATAGTTGAACT
TAGGGTTCACGTGTTGTGCAGTTCCATGGATTTAAAAAGAACTTTTATTCTAGTAACATA
TACAGCCTAAAATTTCCCCTTTTAAACCACATTCAGATATGTAATTCATTGCGATTAATT
GCATTCACAATATTATCCTACCATCACCACCATCCATTACCAAACTTTTCCATTGTCTCA
AATAGAAACTACATTTTAAGCCTTAACTCTTTAAGCCATTCTGTATCCCCACCCCTGTCC
TCTGGTAATAACCTTTATTCTAGATTCTAACTCTCTAAGTTTGTTTATTCTAATTATTTC
TTATGAATGAGATCATACAATTCTTATCTTTTTGTGTCTGCCTTATTTTGCCAACATGAT
GTCTTCAAGGTCCATCCACATGTTCGCATTGCATTTGCAGAATTTCATTCCTTTTTATGG
CTTAATATTATTCCAGTGCATGTATATTCCTATGATTTTATGTATTATACTTTATTTAAA
ATTCAATACAAAGTTTGCTTTTGAGGGTAAGTTTAAATTGCCTTTTTTTAGCCTTATTTT
TTTTATGTTCAAATACAAAGTGAATATTTCAGTAGTGTATTATGATCATTTAAGCTATAG
CAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGCATGAGAGGAAACTAATTGGGAATGGGAGAGTTTATGATACAATAGCTT
TGGATCTGTTGGTAAAGCAAGAGTCTTGAATTAGAGTTTGAAGGGCAGGCTGTTAGTCTT
GTAATTAAGTTAGTTTAGTTGGATCACAGTCTTAACTTTCAAAAACAAGGCTTTCCTGGA
GAAAGCATCTAAGTTATTTTTCAGATAAAGTTTGTGTTCATATCTAATACTAATTGTGCT
CTTGATCAGATACTTTTGACACTACATTGGAAGCAACGGGGATCAGGCCACTGTTTCAGA
GGCATCTGGAGTCTTTATTAAAAATAGAGATTCATTCCATCAGAACATCTGGGAGAATGT
GTGGAACTCTGCATTTTCCGCATGCTTCCCAAGTGATTCTTCACATATAAAAATTTGAGG
CCAACTCTTTTATGATTACTTTTAAGAATTACCCAAGATCAATTAAGTTTCCATGGATGA
TTACCAAGACCTATACTTTCCAGAGCTTAAAAAAAAAAGCCTGCAGGATTCTTTAGTCTG
AATTCAAAGATTGACATTCTTATCCAGTAGTTGAGCCTGTACAAGGAAACTCTAAAATGA
CCCCTCTGTCTACCACAAAAAGACCATGTAAATCCGAATCTATTAATCTCATTAAAAATA
GAAACACATACAAACACATTCATGGACACACCACACACAAGAACACATGTTCACATGCAA
AATTAATCTTAGAAAGCAGCTGTTTTATTTTTTAACAGGAAGTCTAAAGTGCACTGCCAT
TAGCATATAGAATGAGGAAGAAAGGAAACTTGGCAGGGACTGAATCTTGCATGGGGGAGG
GGCAGTCAATTTCCGATTCTACATGAGGGTCCAGTTATTCCTGAATATGCTTTCACAACT
CTGCGATTGGAGCTCTGTTACCAGACTAGCCACATATAAACCCCTAACTTCTCTGGACCT
CAATTCCTTATCTGTCATAATTTCTTAGCTATGGAACCTGTTTTTCAAACAAAGTCTTAT
CAGAACACCAAAATACAAGAACAATGGTTCAAGTAGGTGACAGAGCAGGTGCTTGTGACA
GAGGGAGACAAGGCTGGTTGTCTTTGGAGGCAGAGAAGCATCTGGTGCTGGTTACAGTGG
AAGACAGGGCTCGAAGCTCTGTCTGCATTCTATCCCATGGCCTTGCTGTGTTTTCCCATA
GAAAACTAGGTTTGGCAGAACATGGTTTAAAAAGTAACTTTGGCAGTTTGAGATTGTTTT
ACGAATCCCAGAAAAAGAAAGATTATATTTGTAAACTAATCTGTTCCTCAGGGTGTGATA
CCCTTTGATTACATTGAATTCGGTGGATTAGATGACTTGGTAAGATCCATTTAGGGCTTC
TGATTGGACTATGTCAGTGGGACTTGACTCGGGGTGAGTCTCCACCCCCTTACTGGATCT
GATATAAATGGGCTCACACGGACAGACACAGAAAAAAGGAAAACTGCCATGTTTGATTCT
GCCATGTGCGAGAAAAGACTCCACTTTTGCCCATAGTAGCTGCAAGGAGAGAAGCCCCAA
GAGACAAGCCCTGTGCCTGGTTGCTCACAGCTGAGCTCCAAGAGACAGTAGATTCTGGAG
CGGAAGGCAGGGACCTCAGCGGAGATCTGCAGCCCTCTTGCTTTGCCACGTGACAACATG
CCAGGATCTACGGTAACTGACTTTGGTGAGAAAGCATCTCTGCTGATGCTTCAATTTGGA
TATTTCATGGCCTTGGATTTATAAGCTTTTATCCCAAATAAATCCCCATTATAAAGGCCA
TACCGTTTTCTGTTACTCTGCATTGGCAGCCCTACGGCAAACTGAAAGAGTAAGAATCAA
AAGGACTTAGAAAGCCTTTTATGGATTTAAACTTTTATGGTTCTAACACAGAATGGAATC
ATACAATCACCTGACTACTAACAGTGAAATAATCCTAAATGAAAAATCCAAAATAGTGTG
AAGTGACTACATGACGTCAATTGAAAAGAAAAAGTTTTCCTCAGCTAGGCTGCTTTCCAT
CCAGATGCTTTGCTGACACATAGCCCAGCTAAAGAACATGTGGGGAGTGTCAGAGCAAAG
CAACTGAAGTGAGTCAAGGCCCTGAACAGTTGGTGTTCAGGCCCCATCATTTCTTACCTA
GATTACAGAAAAAGCCCTCTAACTCTCTTTCTGTGCCTAGCATCTCTAATATTTCATTCA
CATACCTGATGGAGGAGGATCTTTATAAACCTCAAATTTGAATACCTCAGTCCCTATTTG
AAATGCAGTTAAAACTTTGGAACCATTTCATTGGTAGTTCCCTGGCCTCATTTCCCACCT
CAGGAAGGAGGCTTGTGCTCCAGCCATTAAATGCCTGTAGAGATCTTGGCTCTTCATGCT
TTCCTGTCTCCTTCTCTCTGGAACTCTTATATCCAGTGATCCTTTCTCTGGGCTTCCCCT
CTACTTTTTCCCAGAGTGATTAATTTCTAGTCATTCCTTCAAAACACAGACCAGCATTGA
CTTCTCTAGGAAAGTTTTCTGACACGCCATCTCTCAGCAATGGCTGCGTTAGGACTTCCT
TGTGCCTGAGCCTGCCCACCCTCCACCAGGCAGAAACATTCTTCTTTGACACTCTTGCTA
AACTGTGGGTTCTTAGAGGGATGCAGCAGGATTCTGTTCATCTTTGTACCCCTACAACCT
AGCGGATCGCTTGAACAGAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGATCGCTTTGACAGAGTTGAACTTAATAAATCCCTTGTTGGGAAGCGGATTTGGCTC
AACAGATAGAGCATCCGCCTACCATGTGCGAGGTCCAAGGTTCAAACCCAGGGCCTCCTG
ACCTGTGTGATGAGCAGGCCTATACTCAGTGCTGAAGAATGCAAGGAGTGCCATGCCATG
CAGGGGTGTCCCCGTATAGGTGAGCCCCATATGCAAGGAGTGAGCCCGATAAGGAGAGCC
ACCCAGCATGAAAAAGGTGCAGCCTGCCCAGGAGTGGTGCCGCACACAGAAAGCTGACAC
AGCAAGATGACACAACAAAAAGAGACACATTCCCGGTGCTGCTGACAAGAATGCAAGTGG
ACACAGATGAACACACAGTGAATGGACACAGAGAGCAGGCAACATGGGAGGTGCAGCAGG
GAAGGGGAGAGAAATAAATAAAAATAAATCTTAAAAAAAAAAAATCCCTTGTTACCTAAA
TGAATGGATGCTCTGTGTAAACAGTAATTATTTCTGTTTCCATGAAAGATAACCAAGAGG
AAATATAGGTAGAATTCTCCTAAATAGACATTTTTTGAAATCTTAGAAAAAATACTTGGT
TAGAATTTCTACAGAAGTGCCTGTCTGGGTTTTCTAAATATTAAAAAAAGAAGAAAGAAA
AAAATCCTGGGATCATTTAAGGCCACTTGTGTTCAGAGCCAGGAGGAAGAGCTAAATCGT
CTGCCAAATTCTTCTCCAGCTTTATAATTTTATGTGCCTGAGCAACATTGTTTGAGTAAA
AGCTGTGTTCTTTGTGGTTTAGGAGGAAGCTAAGATGTTTTGGATATTTACATAGAAACA
AAGAATTTCAAAACTGGAAAGAACTTGAACAATATTCTATGTACCGATGTTTTTCATACT
GTGTCCTGTGTGGTCCTCATGTGCTAGAGTAGGAGATCCTTCCCCTCTTAAACCAGGGTG
TTGTTTTGCATGTTGGAGAGTCCATGAAATGGAATTTGGAAACGAAGCAGAGACTTACAG
CTTCTCCTGAGATCAGACTGACACTAGATTTATGACTTGACTTCCACTGCAGATCCCTTT
CCATTTTTCTATACAAGACGTAAAAAAATAATAGACTATTTATTTTATGGCCAAGGCAGG
TTAAAACCGTGTTACTTGTTTTCAAACACCAATTTAGAGTTTAAGCCATCAAATTTAAGA
AGTTAGTTAGCTAAGCTTAATTTGCTTTCACTTAGGAAGCAGCTGCCCTTCAAGATAATA
AAATAAACACATACAATAATATTTGGTCAGCTGTGGCTTTTAATTTAAATATTTGATTTA
GTGCTGTTTAGTCTGCTGAATTCCAAAGTATTCTCTGTGAGAGAAGCTTACACATTTTGA
AGCATTTTAAATGTTTATTGTGATATCCTAGGTCTGGATATTCCTCCTGGGTCTTTCTAT
TTCTCTACATCCTCAGCTGATCCATGATCTGACACTGCTTTGGCAACACATATTTTCCAA
TAGACACAATATGTTCAGAATCTGAAAATTTTTCTAAGTAACAAAGACAAGATAGGCCAT
TTCCTTCTTTAGACAGAGAGAATCAAGTCACCTATAAATTGACTTTTTTGTTCTTGGCAT
CTCCAGGATATGGAGATCCATATCCCAAATGGATCCAAAACCCCATGTAATGCTTATCAT
CCAAGAGGCTGAATAGGGCCTAAGGTGATTAATCAATATCAGAGTTTTGGATTCCCAAAA
AATGCATGAAAGGATATATAGAGTATGTTAGCTGCCTTTCTAACCCAGTGAGAATAATGA
GGGATGCTGCTTTGCCACCATGAAACAATAATGCATTTCTGGAGAATGCCAGGAGGCTGA
GGGATATATATATATTTCTTAAGTCTAACCAGTGACAACTGTGTGTATTATAACAAGAAC
TATGAAGTAAAATAGCCCTGATTTTGTTTCTAGAACCTAACCCTCAACTAGCTGTGAGAT
CTTAGAGAATTTTCTTGAACTCAGTCACTTGATCCATAAAATGTAGGTTGTAAAAGCTAC
TTCATAGAGTTATGAAGATATAATTAAATCAGATACATAAAAAATCTGGTATGTAATATG
AACCCTCTTGTTTTTCCTTGCTATATCCAGAAAAAGTAACTTGTTTCAGTGATTATATGA
TTGATTCCAGTAGATTAATTGAATCTGGGGGGAGAAGGTGTTCTTTTTTATTTTTTATTT
ATTTTTTTTAAAGATTTATTTATTTATTTATTTCTCTCCCCTCCACCCCTCCTCACCACC
GGTTGTCTGTTCTCTGTGTCTATTTGCTTCGTCTTCTTTGTCCACTTCTGTTCTTGTCAG
TGGCACAGGAATCTGTTTCTTTTGGTTGCGTCATCTTGTTGCGTTAGCTCTCCATGTGTG
CGGTACCATTCCTGGGCAGGCTGCACTTTCTTTCACGCTGGGCAGCTCTCCTTATGGGGC
ACACTCCTTGCGTGTGGGTCTCCCCTACGCGGGGGACACCCCTGCGTGGCACGGCACTCC
TTGCACGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTT
GAACCACGGACCTCCCATGTGGTAGACGGACACCCTGACCACTGGATCAAGTCTGCCGCC
CAAGGTGTTCTTTATTAAAAAGTATCCATGGAAATAGAATCAATGGCTATAAACAAATTG
CTGCTAACTCATTTAGTAGAAGAATAATGATTGACTATGGAGGACAAAATTAAACTTTAC
ATGTGTTAGAAATCATGAATCAAAAGAGCAAATTCTGTTTTACAAATGATAGATAGATAA
TCACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTCATTATGATAAATA
CTAGTCAGTTTTGAATCATGGAGAGATAGATGATATCCATTTTCATTCTAAATAGAAATT
TTTTCATTTTATTAATGTGTGAATATTAACTGAATAAATAATAAAAGAGCACTAAAAGTA
TAATCTCAATATGCTATTAATAATGTATGATTTTTTTTTCACAATTAGAAAATGCTTGAA
AATTATTGAGATTACTTGGAAGGGTTATAATTATCAAAAATACCTATTAGACCTAAACAT
GTCTTAAGACCTTTGTTTTGAAATTAGATTTTGTTGCAGGAAAGGATAATTATGTTCTTA
AAATACAGGGAAGTGTAGGGAGTGTGTTTTGAATACAAAATGTATAATTTTACAATCTCA
AGTCTAAAGTAATTATTTTTTTTCATATACAAGTTGAAAATTCTGTTCTGGATAACTAGT
TGATGTCTATTAGCTTTGTAATTATGTTAATTATGTAAATGTACTTGAATACCAAAAGGT
TTGGTCAGTCTTCAAAATCTTTTTGGCAATTATCTACTCTCCTTGGGGTCAAATTCAGCC
TGCCCTTCAAATCAGAGAAAAGACTGCCAAGGGCTGCTTTCAGTAAGCTCACCATAGTAG
TCTGGAGAGTTATCCACTGCTAAAGATGTTTCTCCTAAAAAGTTCCCAAAATTCTTCCTG
TGGAGATCATCTATTGCCAAGTTAATAGTAAATTCAAATCTATTCACTTTGGAAAACTGC
TCCAAAAGGGTAGAGACACTTTTGGGTATTTTTCGTAGCGAAAAATGGAGGAAATTTTGA
AACAAATGTCAGATTTTCTGGGGAACATCAGGATGTAATCTACTCTATGCTGTCATTTAT
GGATGGACAAAGACAGCTTCCTATTACAATAGGCCTGGGACAGTTCAGTCTCTATAACTG
GAAGATACAGTTCTGAATTTCAGAAATGAAAGACTTTTGTGAAAGTTCTCAAAATGTTTC
TTAAAGGTCCTTAAGGAAGATGACGTCAGCCAGTAGCCAGTTATTTGGGATGTATTCCAG
AGATTCCATGTGGACATTGTGCAGTCAAGAAATGTCTCTCTCTTTTTACTTCTTAGAAGT
GCATGGAGGAGGAGATAGTAGTCACTTTTAGGTTACTCCAGTGCTATCTCAAAGCCAAAT
GCCCTGGCTCACATTGCAAGAATCCATCTGAATCCAGCCTTTCTTCAAAAACCTCTTCTT
TTTCCTCAAGGTTATGACATATTTTAAGTATAAGTGCAGGACCTGTGAGTACTGTGAGCA
CTGTAACAAGATTGTTTTTTTTTTTTAAGATGTGTTTATTTATTTATTTATTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTACATTGCTCTTTCTAAAAAATGGAGTAATATATTATTA
ACGATTTTTGTAACAATAATTACAATATTTTAAAGTATTTTGTTTTTTATTTTTAAATCT
TTATCTTTATGTTTTAACAAATATATATTAATATTGTAGCAATATTTATAATATATAAGT
AAATATATATAGAAATTGTGTGCATATCCTGTAGGAAGTTTATGTCTAGTTTACATATAT
ATTCATTGTATATATATAGTATATAGTACATATATATTTTTTCTCAAAACATTTTTAATA
ATCAGATTATAAAACCTAAAATCTAGGGAGCCCTCCCCTCTTATTCCAGGTAATTGAGTA
GTGCAGTAAATCCAGCCCTAAGAAAAATCTATGAAATATATAAAATTTATCGTTCATGCA
CAATTAATATCTTCCTCCAGCTGCTGCTTTTACCCTCCTAGCAGTCATCTAGGATTCTGC
TCTTGCTCTCAATCAATCTATTATAAAGTTTTCAATGCTCAAGACAGACACTTAAGGGAA
TAATCATTGAAAGAGAAATTACATTTTAATGTAATATTATTACAAAGTCAATAAAAAAAA
TCACAAAAAAAAAGAAAAAGAAAAAAAAAATAAAGTTTATGAAACCATTAAAAAAAAAAA
AAGAAATTACATTTTAAGAAGGACATTTGATTGACTGATTTATTTATCCATTTATTCCAC
AAAATACATCAGTCAACACCAACTATTAGCCAGGAACTGCTGTAGTCTTTGAACAGTGAA
CAGAACAAACAAAAACCCTACCCTCAAGGAGTTTACATTCTAGTTGGAGGAAAGAAAATT
AATTAGATAAAGAAGTAAAATGTATAGTATGCTGTTTGGTGATAAATGCTAAGAAGAAAA
ATAAAGCTTTGAAGGGACTAGGAAGAGTCATTGTGGGAAGAAGGTACTGTAATTTTAGAT
ACAGTATTTAAAGAACTGAAGGGGATATCAGAGAAGACTGGCTATCTGGGAGAAGAGACA
CAAAGCATGAGGAAAGCAAATGCAAAGGCTCTTAGACACAAATTTACATGGTATGTTCAA
AGAACATTAAACAGGATGTGTGAAGGAAAGAGTGGAAAGAGATGGGGAGGGGCAGATATT
GTAGGCCTTTGGATCATTGTGTCTACATTTTTCTTGCAGTAAAATGGGAAACCACTGGAT
GGTTTTGAGCAGATGAGTATAATGATCTGACTTATGTTTTAACAGGATCAATATGATTGT
TATGTTGAGAATAGACTGAAAGAAGGGAACTTTAATATAAAGTTTACATTCTTTATTCCA
AATTTTCTTATTCCCAATAATCTTCTTTTGACTTTATTTCTCTTCTATTCCTAGATCCTA
TCCAGAATCAAATATTAGATTTAATTATCATTACCTTTATAGTTTCTTTCTTCCTTCTTT
TTCAAATTGTGGAAGCATTTATACAACATAAATCTTCCCATCCAAACACACTTCAAAGCA
TACCATTCAGTGGAATTAATCACATTCACAATGTTGCGGTACCCTTACCACCAAGCATTA
CTATAACTTTCCCTTCACCCCAAACAGAAACCCTACACTCATTTTACGTTAACTCCCCAT
TGCCCCTACCCCTACCCCTGTGACCAGCACTCTACTTTCAGTCTCTGTGAGTTCTCATGT
TGTCTGATATTTTCTTTGAGATTACTACAAGGCTTAAATTTAACATCCTAAATCTGTCAC
AGTCTTGTTTGCTTTGATGCCAACTTAAATTCAATAGCATACATAAATGAGGTTCCTATA
CTCCTCCCACTTTGACATAGCTCTTGTCACACATTACATATTTACACAAGATGAGTTCAA
AACCATTGATTTATCATGACATTTTATGCATTTGCTCTTAGATCCTGTAGGAAGTAAAAG
GTGGAATTATTAACTAAAAATACAGCAGTACTGGTGTTTATATTTACCCATGTTCATTAT
CTTTACCAGAGATCATTATTTCTTCACATGGCTTCAGTAAACTGTCTGGTGTCCTTTCCT
TTCAACCTGCAGGATTCCCTGTGTGATTTCTTATATGGCTGGTCTAGTGGTGACAGAGTC
CCTCAGCTTTTGCTTATCTGGGAATGCCTGAATCCCTCTCTCATTTTTGAAAGAGAGTTT
TGCTGGATATAGAATTCTTGGTTGACAAATTTTTGCTTTCAGTACATTAAATATGTCATC
CACACTGCCTTCTTTCTTCCTTGGTTTCCAATGAGATATCAGCCCTTAATCTTATTGAGG
CTCCTTTATTTAGGGGTATGTGACACTGCTTCTCTCTTGCAGCTTTGAGAATCCCCTCTT
TATCCTTGGTTTTCAACAGATTATAATTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCAACTACCACCAGACAGAT
TGGGCCAGACATACGTGCTCCTAGTATATGCTTGGGGCTTACTCTACTACCTCTAAAACT
GGGACCAGGGATCCATACTGGCCAACTCTGTGCTCAGCTGATGAAGGGTTGGGATAGGCC
AGCTAGTAGGCCATGAATTCTTACAGATTTTAAGTAGCCTTTTTCTCTGTTTGGCACTCA
CCCTATTACTCACCAGTCCTTTAACTGTTTTCTGGAGCTTTGAGAAATATATTCCTCACA
ATTTTTTGCTGGTTGTCCAGTGCTTCTGTGGGGGGATGGATCCCTGAAACTTTCACTCCA
TGATCTTGATTGCGGCAGGTTCAACTCTTACTTTTGACATGATTTATATTTGAAGGATAA
CTCAGCTTCTTCCTGCTTGAAACTTAGCAAAATGACATTGGCTAGATGGAGAAAGTTTTG
TGCTCTTATTATGATACCGTTTGCCAGAGCTATAATTCTGTTGTTAAAAGCCTGTCAGAA
TTTTCAATGTAAGCCTTCCTTGTTGGCTGTTAATGATTTAATCTGCTCACTTCGATTACT
CCCTTCCTGTTTCTTAGAAGAAAATCTATAAATGAAAACTCCTGCTACTTTCTCCATACT
TACCCTCCCCAAAATCTTTTAATTTTAATACTTCCAAATTATAATCACAGCAACTAATTC
CTAATTGGAATTCTGGGTCTAACAGTTTCCAGAACTAATAACTTGTGATCCCGTTAAAAC
TTTCTTTATATTGGTTGATATATATAGTAGGCTAAACAATGGCTCTGCAAGGGTAGCCAT
GTCCTAATCCCCAGTGCAAGTAAATATGCTACCTAATGGCCAAAGAGCTTTTGCAGATGT
GAGTAAATTAAAAATATTGAGATGGGCAGATTATCTTGGATTATCTAGGTGGGCCCGATC
TAATCACATGTGTGCTTAAAAGTGGAAGAGAGGAACTGAGATGGAGGGCAGAGAGATATG
ACAGTGGAAGAAGAACCAGGAGAGATTCAAAGCATGAAAGAGACTCAGACCAACTTACTG
TCTTTGAAGAAGGAAGTGGGTGGCTTCTAGAAGCTGGGAACAGGCCTCAGCTGACAACCA
ACAAGGAAACGAGAACCTCAGTTCTATAACTGCAAAGAAGCAAACTCTGCCTACAATCTG
AATGATCAGGGAAACATATTCTCCCCTACAGTTTCCAAAAAAGGATGTGGCACAGCCAAC
AGCATGACTTTAGCCCATTGAGACCTGTGTGGGACTCTGACCTACAGAATTGTGAGATAG
TAACTTTGTGTTGTTTTAAGCTGCTGCATTTGAGTTCATTTTTTATAGCAGCAATAAGAA
ACTAACACAATATATATGAGGGCTTTCCTCTTTGGATAGAAGTTGGTAGGAGGTACTTTT
TACACAAACAAGGAGGAAATAATGGGATGGAAAAAAATAATGGAGAATGCCTATTCCCAC
CCCACCCCGCTTTCCTTGAGAATCTGAAAAACTGGTTGGAAACCTTACCACCATACAGAA
AGGTGCAAGACAGGACGCAAAGGAGCTATTTTCATGAAAAAAAAATGTTGTGAGACAAAT
TGTCACACAGCTTGGAGGAAAGGTTGGTTTCCCCCCAGCTCTGAGCAGGAGCAGGTTTGG
CCTGAGAGTTAAGGGCCTGGAGCTGGTTCCCACTGGGAGCACCCACAGCTAAGCAGTGGA
GAGGGCTTGAGGAGGGGCCAGAACAAGTTTCCTTCAGAGATTTAAAGGGGTCTAAGGATT
GTCTTTATTAGTCACCAGTGTCGTTGAGACTTAACTTCTATCATAGGTTTGTGAGGCCTG
GCAATAAGTGGATTATGAAAAAACACTATATAATCAGAGAAACCTCAAGTTATTAAAGAG
TGAGTATTAATGTCTGAATAGTCACTGTTTTAAATGATGCCTACAAAAATGCCACACATA
GATGAAAATCCAATAAGTGAATCATTCATCATGATGCTTCTTCCAATCTAGGTCTTTGTT
GTTATGTAGAAGTCCGTCATAGGATACCTGCTTTTGCTGATTTTTGTGAGTTATTCAGTT
ATAGCAGAGTCAGGATGGTTAAAGTAGAACAAAAACAGGATGTAAGTTGAAAAAAGAATG
TGATAATGGCATTTTCCTTTCCCATGCACATGTTATATTGGAGCTATTTTTTGTAATAGG
AAATCCATTAGCATAAACATAGTTTGAATTGAATACGTAAATTTTATTAGCACAGCAAAA
TGTTTATTTAGGGGTACATTTTATGAAGAACTGTAAAATCAAAACTGCATTTTTCGAATT
AAGGCTTATCGATGGAAATAAGTCAAAGTTAATGTGTTCATTGTTAATTGTGTATGTACT
GTTTGTGCTATTTGGAAAATCAATTACATGGATGGTGTTTTAAATATTCAGTAGATAAAC
CACATAGGTAATATACTAGGGGACATAAAGTAGATCATCTTCTCTGTGTGTTTATGAAGC
TACATAAAAGAAAGAAAAATTTGTCTGAGTTCACCTCAGTAGCCAATTACAAATCTAGGT
CACTGAGTCTCAGTAAATGAAATACAATGGATTAAGTTAAAATGATCTTAGTTTAATTTA
TTTTAGACATAAGAGTATAGTTTTAAAGAGCTGGAAAAGAAATATCAAACATATTTCTGA
AATACTACAAATGGTAATTTCACAATTCAAACATTTACGCAAACTTGGTTGGCCCAGCTG
AGCATTTTTTACTTTTACTATTGAATGTGCACATTGATTTGAGTGACGAGCAAAAAACTT
CTAGGGATGGAAATTATTGGAAACCAACTGAACTACAACAAAATAAACATCAGATACTCA
GTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCTGTGCTCA
CTTGCTCGGCATGGTCAAGCACCTCTCCAAAAAAGGCAAATTTTGCTTCCCCAGGTGAAT
TGTCACCTCTTCCATCACTTGACAGAGTCACCAGGCTTTTTTATATTTCTATCTTGTTAT
AAAAAAGGGGAATTTTATTTTTGTGAATTACACCTAAAGAAATACATTGATTCTCTTTAC
AATATTCTTAAATTTATATTTGGCTTTGCATAGGGTTAAACTTAACGCCAAGCCATACAC
AAAATATACTTATTGAATTACCTAATATTAACTAAAACCATAGCAACCTTATTTGGTCCA
GAAAAATGATAAAATTTTCTTGAATGTCAGATGTATAAAACAAGATATTAGCAAAAGTTA
GTAACATGATATATGTGCTTGCAGAATGGTTATGATACACATTAACATTTCTTCAGTTCT
CATTAGCCAAATATAATGTAACTCCAATAATGTCTATAATGGCATTAATTTGCTAAAATT
GTATTATGTTCCTTACCTTGCATAAAGAATATGTTGCCTAGATGTTCTTTTAGCTCTCAT
TTTTTGACTTTTTAAAATGAATTTAAAGCATGTTCTTAGATTTGATCTCCTTTTTAGAAC
TAATGAGATTCCTTGTTTTATATTGTTTAATTATTTGATTCTTAATTTATTTTAAATAAA
TAAATTACATGATTATATAAGGAGACAGTCTTTTCATTTTAGGATAGTTTGCTAGAATTA
ACTGCTAATTAGAAATACTTCTAATTTTGTCTTGTACCTATGAAACTATCCAAACCATTA
GTTTTCTCAGCACTTCTTGTAATAATTAAAAGCTATAGCAATATATTACAAATTTTTTCT
TGTGTTTGAACAATACTCACTTCATATTCTTTGGTACTTTATTGTTGATATACAAGCATT
GGTTTTAACAAGGGTAGGCTTTAATACATGACATGATTTGATCTTTGAAAAGTCAGGAAA
GAGGATGTAAAATTTAGCAAATAAAACTTATAGAATATTAAAATAGTGGGGGAAAATAAT
GTTTATTAGAGCTATGTTAATTTTATTTCCATAACCAGGGTGGATATACTCCTATGCCTA
TGTAATATTTATTAAAATTGTCTCATGGTAGCACACACACACAAACATACAATTACACAT
GTATGCCCACAACCTCTAAAAATCCTAAAATCAGAAAATGTTCAGGTTTCATTCTCTGAC
CATGATGGAACAAGTACAAATTAAAATATAGATAAAGTAACCATTTAATATCATAAAAAT
ATGCTCTAAAATAACTATGCTGGCAACAATAAGTTATATATGTAAATAATATACAAAATA
AAAATTATTATAAAGCATAATCTCTGATGTGTGGCCAAAAGCAGTATTCAGAAGTTAACC
TCCTCAATGCTTTCATTATAAAGGAGGAAGAGCAGTAACAAGTTGGAGGAAGAGGAAAAG
GAGGAGAAATAAATTAAGAATTCAACACAAGAATCTAGAAAAAAAAGACACATAATACTT
ATCATACTTCTTATAACCATTGACCAGTCTCTCTCTGTGTCTTCTAGAGATCAGTTATTT
CATTCTGTTCATCTCTATTTTTGAAGCCTGTTCAAATTTTAAACATGAATTATTTTTTAA
ATAAATGTTTAGTGAATAACTGAAATGAAATAAATATTAACAAAATTTTTAGCTAAGGCA
AAGCCACTCTATTCTTTCCTTATTAAAAATAATATATGAAAAGACTGAATAATTATATGT
CCCAAGGAATCATCATTTTTAAGAAAAGTAAATCTATGGAGGCGCATAACTCTAAAATGG
ATGGAAGCTGAACATACCAAGTAAGCTAGGATACTCGACATCATTTGGGAGAAAAATTAA
TCCTGAGAATGGTCCAGTTACTTATTGCTGAGTGACAAACTGCCTCAAATTAGCAGTGTA
AAGCAACAATTTTAATATGCTCACAAAGTCTGGGGATTAGGAATTTGGACAGGGCATTAC
AAAAATCCGTTATATATGTAGTCACAACCTTGTAGACTTGAATGACTATGGGAGAATAGA
ATGGTTTGGGGCTTCTTCACTGCCATGTCTGGCGACCAGATCACAATAACTCAAATCTGG
GCTCAGCTGGGGCTGACAACCAGAGTATCCTCACAGGGCCTATCTATGTAGCTCAAGCTT
CCTCAAAGCATGGTGGCTTCAGGATAGTTGGACTCCTTCAAGCAGTTCAAGGCTCCGATA
AAACATACTTCCAGAAAACAAGGTAAAACTACTTGGTCTTTTACAACCTTACCTCAGAAG
TGGCAAAACATCACTTCCACAATATTCTATTGGTCAAACCAGGCACAAGCTCACCCAGAT
TCAAGAGCGGGTACAAAGTTCCAGTTATACTCACTGGGGTGAGTGTCAAAGAATTCATAC
TCATGTTTTAAAACCACCATAACAAAATAAAATAGAACCAAGAACATGATGTGCCAAGCA
GACAGCACCTATGAACACAAGTAGAGGCACTGGACTGGAAGCCAAGACACAGATTTTCTG
CATTATTTGCACTTTGTCCTTGGAATGATCACATGTTTTCTCTGGGTCTATGTTTTCTTA
ATGATAGAATAAGTATGTAGGGGCTAAAGAAAAACAAAAAACAAAAAAGAAAAATGCTAC
AGTGCTTTGATAGGTAAAAAAATAAATGTAATCAGTAAGAATTTTAGTCAACTTCCTGCT
ACATTATTTTTAGCAATACCTAGAGTAATATTCTGCAGTTAACTCTAAAGTGATGAAAGG
TTGTTTATATTATTAATACATTGCAAATTTTTCATTGAATAAATGACTGCTAAAGATCAG
ATGATGGTATAAATGTTTTCTTTATTACTCAATGAATTTCTAAGGAATTCCTACTATTAT
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTGCTCAGAAGTCATGGAGTTTTCCTT
TTGCAGTAATGAAAATGTTCTAAACTTGATTGTGATGATGAATGCACAACTCTGTGATTA
TACTAAAAACCATTGATTTGTACACTTTAGATGGATTCTGTGGTATGTGAATATATCTCA
GTAAAACTGCTTAAAAACGATGCTGTCCCAAACACTTCTCTATATATGTTCTAAATCCTC
CTTAAGACAAAGTTTTCTTCCTATAATACATGATCAACCTTAAAACGCTTGGAAGAAACA
ATTGTGTTTTCCCTAAGTCTTCTCTTTTTAAGGTTAAATACTCAAACTTCCTTTCTAACC
CTCTGGTTCAGCTTTTGAAGCCATCAGCTTCCTTGTCACACCTCTTTGGTTGAACTCCAA
TTTGTCAACTACTCCTAAATAGTGGTGTCAAGAATTGATCACAGTAGTCTGGATGTGCTC
AGACTAGCTTTGATTGCAGATGGATCATTCTTCCTATAATCCCTACACACTAGGTGTCTT
CTTAATACAGAGTGTGTTTGTTGAGTCTGCCAGTATAGCAAAACATTTTGAAAATGTATT
TATGATTTATAAAACATGAGTTAGTGGGTACTGGAATTTACCCTATTATCCTAGCAGGCA
GAAGCCGACAAGAAGTAATGCCATGTTGTTGATTTATATGTGTAAATGTCTAACTTACTT
AAATTTTGATTTTCCCCCTTCAACTACAGATCAAACTTCTCAAATGTTAAAATTCCTTAT
TTTAAGGCAAATGCATTTGTAATTGGCCAGTTAGCTTCTATAGTACAGTAAGCTCCTATA
GTCAGCTCAAATCACAGGAAAACTCAAATAGACATAACTCCTTTGGTTTTGGATTTTAGG
ACTGATAACAAGAAGAATAGAGTAACAAAGATATATTTTTTAAAACAACAGAAAGATATC
TCATAGGGGCAGTACACATTTGTCCTAGCTTTTTATACCTTCTACAACTGTAATACATTG
AAATGATACATGATGTTGAATTTGATTAAAATTTAGGAGATATTTATGCGGAATCCAAGA
TGATTATGCAAAGTACCATAGGGAAACATAAAAACAAGAATAACATCTAAACCTTGCCTT
CACTATGATCTCTCCCAGAAATGTACTATGATTCTTAAAGTATATTAAGAATCATAAAGT
AAATGTCATTGTAATTAGGTTTCTCGTGTGAAGTGTTTATGGCCTTTTAATTTTGAAAAC
TATCCTTATTAAAACAGTATGACTGAGAACATTTATTGAATACCTACCATGTGGCAAGTA
ACAGGTAGCGAGTCTTATATATATTTTCTCATTTCATTCTAGAACAGACTTGGGGTAGGT
GTAATTCAGTTCATTTTAGTGAAAATTACCTGAAGGCTCTGAGAGCATAAATTACTTTTC
CAAGGGCTATACAGCCTTTAAAGATAGAGTCTGAATCCAAAATCAGTATGGAAAACCTCC
GGGAATGGGCTTGATCTCTTCTATGTTTTGAAAATGTCTCCAATATTAATGGGCACACCA
GATAGATGAAACAGCACTTTACCTGTTCATTCTGGAAGAAGATTCTTGAATGTATTTTAT
TAGCCTGTTGATTCTCCTCTGAAGTATGACTTAGTTTACATTGTACCTCTGAGAGTCCTA
GCTTCTAAAATTCACAACCAACTTCAGTGCTGTAATAAAGAATCACTTGCAGAGTTCGTG
AATGATAGAAGAGAGGAAAGGGAATGATGGAAGATCAATAACATTTAACATCTAACAAAA
ATATTATTCCTAAAGGCTGATATACTGGCTTCAGCTTTTGGAGAAAATAAGTTGGCTGTT
AGTCAAAATACCATCCATCTTAATAATATAACCTGAAATTAATTGAGCTCATTTTAAACA
TGTAGCACTTTAGTCTGTATTCAGTGGGCCATGATCAATTAAGGATTGTGTATGGATAAG
ATGAAAACTCCAATTTTTAATACTCTTACTCTTTTTTATCAATAAAAAGGAAAACATTAT
AAAATAGCCACATATTCTCCAAGATGATGAATATTGTTAGAAGACACTCTTAAAACAGGG
AAAGGTTATTTAACTTCTCATTCAAATAGAAAATAGGAGTGTTTTTTTTTTTTACAGCAT
TCCCGTAAATTTCCACAAGAACCATGTATTTTGTTTATATGCATGTGTCGTTATTGTGAA
AATATTAAGTCTGTTTCTCTTTAACTTAATGGAACTTGGATTAAAATGTGTCCTGTTATT
GTAATCAGCACCAATGTCATATGTGATGAACATGCAGATTTCCATCTTGGCAGAGAACTT
GTTGAAAACATTCTAAGTCTTATTCAGAAAGAAACCTATGTATATATATAACCATAATTT
ATGGCTTATTTGATTAGATAAATGTTTGCTTATATGTCACATGTATATTTTTGTTGTACT
GTATATTTCTACATAAATTAACCCAGTCCATAGCAAGAGTACTAATAGGACATCTCATCT
AAACATCAGTAAACAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTGTTCAGTTATATTGTCCTCAATAGGTCA
CTTGTCCATTACCCTTCTGTTCATAGGTCTTCAGATTGGAGAAAAAGTAGAGGTTAGAAC
CCAAGTATCTTATGCTATATTGTTTTGTACAACTTAGTTTATAAATTACCTTTAACCTTT
TCCACTCATGAGGGAAAACTTTCCTGCCTCATTAAATCTTTATTGCAATGCGCTGAATGC
ACACTACATTAATATGGGTGACATTAGGTTATATATTGCATAGTAACTATAATGCTCCCT
GCAAACAAGCTGTTCCTTTCCCCTGAAGGTAAAATTAAAGCAGGAACTCATGGGTAACAG
CTACTTGGGATGAATTTGAAGAGCAGGAGACTGAGGAGCTTAGCATAGAACCTTCTACAG
GAAGGGATGGGTGCTCCTCCTTTTCCTGCCAGTCCTTTCTCAGTGTGACATCTGAATCTC
CCGGAAGAGAATTTCCCCTAATACAGATGGAGTAAGAGGTAAAAGGCTGGGACTTTTGGG
ACCCTATTAGACTAGACCATTTTCACTAAATTCATTTTCTCTATGTATTGAAAAGAAATA
CAACTTTCATCTCTAGTAAATATTATCTAATCCTTCCAGTAAATACAAGAATTGCCCCAA
AGTGAACTGAGATTATACCCTCTTCTACCACTGAAAACTGTGTTTCTCTATCCAATGAAT
GATGACATTTTAGTTCCTAAATAGCAGCAGCAAATGAAATGTTCTACTGGCTGTATGTAC
AATGCTCTGTAAAATGACAGAAATCAATATTTTCACTCCAATAGATTGATTTTAAAGTTT
CAAAGGTAAAATTAATAAATTAAGTCTAAAAAGCCCAAGGTTCTGGAAAATTATGGTTAT
ACACTGAAAATTAAATTTGTAGGCCATCAATATCATGTTATGTGTTTTTAAAATCCAACT
TATTTAATTCTAATGGATGAATTTGTTTATCCAAAACTCTACCTATTACAATTCATTAGC
TCTCTTATTTGTTCTAGTTGTCATTGACTCCTCATCAGACTTCAAGGATTTCACTTAAAA
ACATTGACTGGTGAGAAGTTGCTAAATAAAGAAAGAAAATCAGGGTTTGAATGGTTGGAG
AATTATAGAGATGAGGATTCCAGCAGGAAATTTTAGTCTGAGAAAATCTAAGTAGCAGAA
TGGAGAGAAATAGTCTAGATCAGAACTTTCCAAACTTCACAGGTTTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCCTTTATTTGT
TCAGTGGACCCAGCAACCATGTTCCCCACTTAGCATATGGTCTATGTAAAAGTGCATGTC
AAAATGGAAATGATGTCTTTGCCCAAAAGCATATCAAGCCCCATAGAGAGTCAGTGACCC
TCAGGGATGGCCCAGAAATCTCCCCAAATATGACACAGACACTTTCTCTGTTTGGAAACT
GTAAAACTCAAACTAGCGACTCAGAAGATGACAGGAAGTGCTGTGTCTGGTTTCATGGAA
CTTAACCTATTCCAGCAAGCCTGCAATACTGGGGAAAATAATACTGAATTTATGTTTGTG
TCAGGCTTGCACTTGATGGGTAAGGTTCCTGTAACGGTTACTTCTAAAGAAATGTCTGTC
ATTCCCACTTTATATTCCTGTGATTTCTGCATCTTGCAAATAAATGCTATCCTTTTAAAC
AGTAAAAGGATTTTAAAATAGTAAGTAAAATACTCCTGCCTCCTGTCCTGTAGTAACTAC
ACATCTCTTTTGTAGCTCACAGCAGTTGGAGGACAATTGACATTTACCATATCATATGAC
CTTGAAGAAGAGGATGAAGATACAGAACGCGTACTTCAACTTATGATTATCTTGGAGGTA
GAGTATGGAGAATGTCATTGTGTTCAACCATTTTATACCTTGATGTGGTCTGAGGATACT
CATGCTAGTTTTGACTTGGTTGATTGGATATTAATCCCTTTACTACTAAAGAAAGAGATT
ATAACTAAGGGATGTTTTATTTTATTTTATGCCAAGCTTTTTGTTTCATGCTGAGACATA
TCTAGAAGACTTTCAATCGTTCACTGGGTTCCAATGATAAAGGAGACCTTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGAATGCTAAAAGCATGAGAAGCATT
CTGATTTACATAGTTACATTTTTGCTGCCTTCCCTCACTTCCAGGCAGATTTGATTGCTT
ACTTCCTTGTTTATATTGACCAAAGTAAATGAAAAAGGAAACTTTTTTATTCAGGGTAGT
TAAATCTTGACTTCAGAAATCCTAATTTAGGTAAGAAAGATATAGGAGAAACTGCTTTCA
GGATCCGGACAGCTGTAGGCAATTCGGCAATGCCGGGAGCCTAAAGTTTCCTTCCAAGTG
GTCTCCCACCCTTTCCTGTGCCCTTCCTTTCCCTTCAGGCATGCTCCCACCCACCCCCAC
CCCCACTCCCACACCCACAGGCACACACAAAGGCCCATTTATGGTTCCAAGTCGGTAGGT
GCGGATTTGGCTCCCTGTTATTCTTTTGTCTTGAGCCTTTTGTGCTTGTGAATCAGAGAC
AAAATTCTTGCCTCAAAATGAATATTTTTCATTATTTTGGATGAAGTGGTCTTGAAGATA
TATATGGAGAGCCATATATATATATATATCAGCATATGTATAGGTTTGAAAGTAGTATAT
CTTGGAATTCCTTTGAGATTAAAGGGCTCCCTAAATGTAAAATATTGAGAACTTACATAT
ATTAAAATGAATGAGCTAGGAGAAGAAGGATAACCTAAATTTCATAGATCAGTCATTGCA
TTATACTTTATGATGATGCCATTATCCTATAGTGAATATTAGAATGCAGGGCTTTCTTTC
TTGTTAGCTTGTTTGTTGTCCCATTGAAAAACTATAGAAAAATCATTTAAAATAATAGTT
TAATACACTGTTGTACATTTTCTTCCCTATTGTACTATATACCATAATACACTAGACCTG
AAATACACACTACCTACTATGTAAAATCGAGGTACTTGTAATCACATCTATGTTCATGAA
TGCCAGTTATCTGTTATCTTAGTTAATTGGAAAGTAAAGGCATGCATAACTGAAAAGCAT
ATACTTTGTAATGGATCTAGTTATAGCTAATATTTAAATTGCAAGCCTTTCCTTCGTATA
TACCAGAAAAATACTGAATGACAGGGGAAACCAATCTGGAATTTAAAAGCTGCTGAAAAT
AATCCACGGGATGGAAAATCCAAATGCAGATACCTAGAAGCTTGCTGTATAAGGTACTAA
TGCTTTCACCCTTCCGTGCCCTCTTTTTACAGTTTTACCCTTTTATACTTTCTTTCACCC
TACAGGGAAATGGCTTGCGTATCAGCACGACTCAAGATGAGGTGTACCTGCAACCATATG
AAGAACATATTAATGTATTGTCACTCAGAGAGGACTTGTTTACCAGACATGGCACATGGT
TTCCAGTCAGTAGAAAAGAATTTATGACCGTGCTTGCCAATTTGAAGAGACTCCTCATTC
AGGCCACATACAGCCTTGGGATGAATGCCATCTTCAGGTAAAATCAAGAACTGCACCTAC
ACATTTACCTTGGGTGACTGAGCAGGTGCTAGAAAAGTTGAGTTTGAAGACCTACAGTGT
TTTATTGTCTTCAAATAGGAGATTAGGATGTAGCACTAGTTTTCCGAAAGGTGCTTCTAC
TAAAACTTTGGAATTTTTATAGCCCAAATAACTTTGTTTTAATCCTTTGTCAGTATGGAT
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATTTTTTTTTTAAGATTTATTTATTTTTAAAATGTATTTCTCTT
CACTTCCTCCCCTCCCCCCTGTTGTCTGCTCTCTGTGTCCATTCGCAGTGTGTTTTTCTG
TGTCCACTTGCATTCTTGTCTGTGGCACCGGGAATCTGTGTCTCTTTTTTGTTGTGTCAT
CTTGCTGTGTCAGCTCTCCATGTGGGCCTTGCCACTCCTGGGCAGGTTGCGCTTTTTTCG
CTCAGGGCAGCTCTCCTTATGGGGCGCACTCCTTGTGCGTGGGGCTCCCCTACCAGGGGG
ACACCCCTGTGTGGCACATCAGCACTGTGCATGGGCCAGCTCACCACATGGGTCAGGAGG
CCCTGGGTTTGGACCCTGGACCTCCCACGTGGTAGGCAGATGCTCTATCAGTTGAGCCAA
ATCTGCTTCCCAGGTCAAGGATTTTGGCTTCTGTTTTCAACTCAGCTCTGTAATAGTTGT
GAACATAAGTAAGGTTTTGACTTATTTGGATTCCAATGGCCTCATCTGTAAAATGAGGAT
GAGGACACCTGCCCTGCTGACCTTGAAAAGTCACTGTGAGAATGAAATTAGAAGAATGCA
GAAAACACTTGCTAATGGCAAATCAAGACACAAATGTGTAGCATTTCTATCTGACCTGCA
TCACTGCAAGAAATAACATTTCCAAGTAACATTAAGAGTTGGAGGCATCTATAATAAGGT
ATATACAGATAGCCCCAAAATTGTGACAGTATTTGCTGTCATTCTTTGCCCAGAATGCTG
AAAGTCACATACCATTAGATTAATTGATATCTTTCTCACTGTCCCCATTAGTCGAACGAA
GATAGAAATAGAAAACTTTCCATTTTCCTTTTAAGAAATGTGGAATGCAAAATAAATTTA
ACCTAATTGCACATGCTTCTCCTTTAAATTCTCCAAACCTTAGATTTAGTAGCATCCTTG
ATCTTTAACTCAAGCAAAGAGCCTATTCAGCTTTTCTTAAGAACCTATTGGATATAGAAC
TTTACAAGAAATATATATTTTCTTCCACCTGATAGCAGACATTATACAGCTGACCAAATT
TGCAATGACCAAGATATTGTATTTCCCTAATCCTTGAGGGTAGATATGCTCATGTGACTT
GCTTTGGCCAATGAAATGTGAACAGAAGTACTGTATTCTTTTCCTTGGGAAAAAGCATTG
GATTGCCAGTATGAGATTCTCTGGAGCTTTGTCAACTACCAGAAGATCAAAATAGCCTGG
AATGCTGACAACAAATGGAGGTCAACTATCCAGACCTGCAGATTTCACAGGAGTAAACTT
TTGCTTTCTCTTACACCACTAGAATCTGATGTTGCTTGTTACCACAGTTCAACCAAGCCC
ATCTTGACTTTTACCTCTTTGTCATAATGCATACCATGTGTCTTTATTGCTTGAAATAAA
TACAGAATATTTTCAACAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCCTTATTGAGTTTATATTGAAATC
TTTGGACTATATCTTTGTGCAGTTGACCAGTCTACTGTTTAGTAAATTGTGGCAGTCTGT
TGTATAATTAACTAGTACATCAACCATGAAATTATCTAATTCTGCAATTAAAATGATCAG
AAATATAGGTTCATAATGTGGCAGCCCATTAATTCCAGGCGGTTAGATGTTACAGTACAT
TCAGGTGAGTCTGGCCTCTGTTGTCAAGTCCTAACTCTGTAACATTTTTCCATTTATTTT
CTGTGTCAGATCAAACAAGCGATTTGTCGATCTGATTTTATTTATCTGAAATGGGGATGC
TAGGCTTTAGTGTATCATGGAGTATGTTAGCCATTGTTTGTAGCATAATTACATTTCATC
TTCCATTCATTCATTTATTCATCTGTTTGTTCATTTATCTATTTATTCATTTGTAAGTCA
ATCTTGAATCCAACCATCTACCTATTCTTCTATCTACCCATTCAACAAAAGTACATTGAG
CAAGTATTGCTATGATCTTGCTAGGTATATAGATGACATGACAGGTCTCTGTTCCCAATG
ACTAGCTCTTAAGCCCACGTCAGCATAAGCAAGTGTTATTCTTAGTTGAGCAATTCTTTC
AAGTCCTATGTTGTGTTAAGAATTGCCAGGCTCAGCAATTCTCCCCCATATATATTTCCC
AAACAGTTGAAAACAAGTACACAAACAAATACTTTTACATGAGTGTTCATAGCATCACTA
TTCCCAATAGTCAAAAGGTGGAAATAACCTATACGTCCACCAGTAGATGAATGGTTACAC
AAAACATGGTTTGTGCATACAATGGCATATTTACCCAGCCCTAAAAAAGAATGAAGTATT
GCTACACATGAATAAACCTTGAAAATATGCTAAGTGAGTAAGCCAAAGGAAAAAAGGTCA
ATATTATATTATTCCATGTATTATGAAATATCCAAAATTGCAGCCAATTTACCTTTGTGT
TCTTAGAATTTACATAGTAGTTTATTTTAATGTAATTAAATGGAAAACCAGCTAGATTTC
AAGGGATACATAAGTGTTTCCTGGAACTTTACAAATTTATTTTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTTT
GTTTTTGTTTTGTTTTAGTATCTAAAGTTTGAGATATTTATCAGCATCCCAATATTCTAA
ATTTATAATAAGATTAATGTTTCTTCCTTAATACCACATTGTGTCATTGTAGGGTAATAG
TTTTTGCTTACTTCTGTGTGTTTTCTTTTGGATAGCTTGAAAATTAGTTTTACTTGAAAC
CTGGTCAAAAAATGTAAACAGCATTTCCCCGATAGAGGATATGCCTTACAGATAAATAGG
AGCTTAAATTTTTCACTAATAGTGCCTTTAAGGAATCATTTAAGTGTACCAAGATGTTCT
GCTTCAGAACACTACCATACGATGCCATTTATAGAAATTCTCTAGGCATTGCTTTGTCAG
TTCTCTATACTTTAAAGATAATGCATGCTTCCAGAGAATTACACAGGGCGAAGAGTCATG
TTCATGACAAATGTGTTTTCTTTAACTGGGCTCAGAGTCACCAATTTAGAAGGAAAGCTA
AATGTAATTCATTGAAGTGCTTGCTTTTCCAAAATTCTTGCAGAAAAGAGAAACTTAATA
GTGGACATGAATTAGCTATGTCAACACAAATTTGATTTTACTTGTCATGCCATATTTGAT
GAAGCCAGTTCTTTTATTACAAGCCTTGCGGTTTTGATTTCAAACCAGAGAGCTCCCTTT
GAACCTTTAAGTTCCTATCTCAATTGGAATAATAAATACCTTGATTTTATTATTGCCTTA
ATACTTATTCCCACATTGGTTATTCTCAGTCTTCTTCATCATCTTTTATACAAGTTCCAA
ATGCGCATTGAATATAAAATTGTCTAAATATCATTTAATTGGATATCCTGATTTGTTTAT
TTCTTCCTTCAAAAATTTATTAATGTGGTTTGATTAATTCTGCACTAGATGCTGAGGGGA
TTATCAAGAAGTATATGTCATAATCCCTGTTCTTAAAGAGCTAACAATCTGTTTAGGGAG
ATAGAACAAATACCTATGAAAAATTGGATCATGGCACTACATAATTAAGAGATCAGTAAG
TGGTACAGAACAGAAGTGTTGTAATCATTCAAAGAAGTAAGCTATTCCAGTGGAGAGACA
TGTCATGGAGAGTAGCCTGGAGTGGCAAAATCTCAAATTGGATGCTAAATAATGGGAACA
GTTAGATAGGAGCTAGTAAGAGAAAAGCATGCAAGTGTAGAAAAGAATCAGAACAAAGAA
GCAGAGGAGAGATAATAAAAGCTTTTGGTGCCGGTCACAAAATAATTGTTTGATAAATAA
AGTTGCTCTGAAATCCATGAAAGAACTTAGTTGAATCAGGAAACAATGAATTCTGGAACT
CTGGAGTGTCTCCTTGATTTCTTCATTTAGTTTACTCTCTTGTAATGCCTTCTTTGACTT
ATCAAAATGTTCTGTCTCTAGACCAGCTATTCTCTAGTCCTGTCCTTTCCTGATAGCATT
TGCTTGTTTATTGATCTTGGTTCACAGGGCCAGTCATTCTAGCTTTGTTCTCAAAAATAT
CCTATGATCCCTTAAAAGCTGAGTAAGCGTCAATATACCATTAATGTCTTAATTCTAGGT
TGCTTATAACATCTACTTAAAAACAGTTCACACAACTCCAATGTAAAATCATTTTCTTTA
ACTTCATTGGGGCTCCAGTGCTGATTCAAAATCCTATTCCTCATTTCTACTTGACATCTT
ATACATCTCTCCACAGTTAATCTTTCAAATATTTTCTTACTTTATAGTACCATCATAATT
TATTTCACTTGACAGGTGAGATAGGTGGGGAAGTTAAAGCAAAATGAGATACTAATAAAA
GAGTTTCAATCTAAATATCAGTTTCCACTTCTTTATGTTGGAAATTATATTAACCACCTC
AGAAAAATGATCATACCTTCATTTAGCTAAAAGTTCTACGACAAATATCTATTTTGATGC
AATTAAGATTCCAGACAAGGAGGATAATGTCATGAACTATATAGATATGATACCTGCCCA
CAAGGACATTATATTCAGTTGTGGGCTAGAATATTCCAGAAAGTAAGTTTAAAGAAATGT
GATAGAAGCCATGAAGAAAATAAACAGGGCGCCATGATAGAGGAACTGAGCACTGGCATG
GGGAGATGGGATGGAAGGACTTGCATTATAAAATGTTGTCAGGGAAGGCCTCTCTGAGGG
GATGGCATCTAAGAGGAGTATTGAAGGGTCAGCTATGTAAAGAGAGCTGGTGAGGAAGTA
CAATCGAGCTTGAAGGATATAAGGACCTGAGGCAAGGCAATTATGGGCCAGAGCTTGTAA
GCAAGAGGAGAGTGGCACAGGAAGTGGTTGGAAAAGCAGGTCATTCAGAACCTTGACTGT
ATGCTAAAGCTTTATTTCTAAGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAGCAGTTTGAACAGAGTAATGGTGAAGTCAGCTAGGTTAGAAATGGAAATGA
ACCGTGAATGGCAAGTGAGAAAGGAAAAGAACACGTATAGGCAACTCTTTAGAAATAGTT
TTACTGAAAAGAAAAATAGGTTGGGACTAGAAAGTTATGTAATGTTAAGGGAGTAGTTTT
CTTGCTTTTGTTATTTATTAGTTAATTTTGGATAGTTGATACTAGATCGTATTTTTGTGT
TGATGACAATGATCCAATAGAAAAAAAAGCTATTACTAATGCAGCAGAGGAAAGGAATAT
AGGAAAAACAACACAGAAAGAAATTCAGATTGCCTGGTGAGTGAGTTCCCTTTGAGAGGA
GGAAGCAGTCTGTAGGTCTCCTCTTACCCTCCCCACCTGTAGTCCCATTGCTTCATAGGG
GAATGTGGCAGAGATTCATGGAGATACTTGGATGTTTGTGAACTTGGGAGAGGAAAGATG
GAACTTGCCTTCTGATGGCTTATATTTTCTCTGTAACTAAGATGAAATCACTGGCTAAGG
CTAAGAGAAGTGTAAGGAGTTGGGAAGTTTGAGGAAAGAGGGTGCATTATGTACTGTTGT
CTTGGAGAGTATAAAAATTTTATTATGGAAAACTTCATGAGTATCTTTCCTGACCATAGG
AAATCAGTTCTCTGCCTATTTTCAGCATCAGTAATTTGTACCCCTTTCTGGGATTTCATG
AGTTTTTAGATCTATCTATTGCAGAAGGAAATCATTTCTGTCATGAATTTATGGGGGCAA
AAATTTTAATGGGAAAAATTATCAGAAGAGTTAGAATTAACACCTTTTTTTTTGTACTGC
CAAAATTAAGAGGAAAGCTGCTTTTTCTTTCTGTTAAGATAGGAAGTATCAACAAATCCC
TTTTTTATGTGTTTGTTATCGATGTTCAAATATGAGTCTTCATATCCTGAGGCAGAAGGT
ACATTTCCAACAATACACAACACAATACTACACATTTTATTATTTCAGTGGTTTCTCTCT
TGTTTCTGTTTTCAACTAGAAATAATAGCTTTTTCATGATATGTTATGTTGTATTTAACA
GTCCAGAAATATAGTTAATAATGTACAAAATACAGTTCTAACTTCAGGGATTTCATAAAC
TCCTAGAGGACAGCAATATTTACCTTAGATTTACTTTGCATCTCATTCTAGTTTGCAGTA
ATCCACACATAAAAGAAAGTTAGTTAAGAGTGATGGTGAATTTGCAGCAGGCACTAACAC
ACAGGTTATCTAAAACACAAACATTCTGTTGTAACCAGAACTCTGTTCATAAAAGACAGT
GTTTCACATTTTAAAAAAGGAATAGAGACAAAGTTGTAACAATGACAGACGACCAAATTT
TAAGCTAAAATATGGTAAATAAGTCAAACAATTTTGTGAAAATTTGAGCAAGCATAATAG
TATGGTAAGAATTTAGAATGCAATAAATGAATTATGTATGCTTGAAAATTTTAGCTGTTT
ATATGATCAAGCATAAAAGCAAGGTGCTTCCTTTCTCCCAAATGACTTTGAAGATTTTCT
GAAAGTGAAGGAATAAAGGACAGTTCTTGTCTTAGAAAGGTAGTACATTCCAGAAAATCA
AAATTGTGCAGGATGATGTTGGGTGCTCTCTTGGCTAAGATTTTCTGAAGCGTCCTTCTG
TATCTCCTGCTTTTTCAGTATGTTTCCTATTTTCTTGTCTTTGCTTTTTACTTTGAGACT
GTCATATTTCAGTTCTTTATATCTCTGCTTTATTTTACCATTTCAGAAGAGAAACCAAGC
TAATGCTTCTTCTAATCTCATACCTGCCAGTAATGCTAAGGTCAGTACCAAGTACAATGT
GAGGAGGGATAGCTGTGTAGCAGTGTTTCAATAATGTCAATTCTTTGACATGCCCATTTG
CTGAATTTGCTAGCAAAGTTATTTTCTTTTATCCAAAAAGATACTTATAATTAACTCCCA
AAGACTGACAGAAACATTATCTTCCTTTCAGTCTTGTTGGCCCAGATACCGACGAGTTAA
CAGCACTATTTTTGGTGGCATCTGTGAACCATGCCAGTGCTTTGGTCATGCAGAATCCTG
TGATGACATCACCGGCGTGTGCCAGGTAAGTGCCTCTGCCTCCCAGGACGCTGATTGACA
AGGCTGAAATCAGCTCAGTAGACCCTGCAATTCAGTTACTACCTTTGGGACCCAAACACT
TGAGTCAAGAAATAATTTGACAGAGATCTTTATATTGAACTGAGTGGGAAGCTGAGAATG
CCCTTTCATATTTGGTCATCCTGACTAGCAACGATTAGGAAGTGTTTATTCATATTAGTC
TAAGAATTGACTTAAGATCACATATCATTATAAAGCAAAACTAATAACTGAAAAGCAGAT
CTACCATGAGTATATATGGTTTCATAGCTTTCCATAAATCTACCAAAAATAGACTCTACC
TCTAAATTAGGAAATGATTTGTTTCCCCATGACATGAAAAGTATAAAATATAAGCTTTGT
AATAGACATAATTCAGTTTTATTCACATTGAAAATGAGAACAAATAGTTTTAAAATTTTC
GACATTTAACTAAATGCAAAGCTTCATAAGTAGAATAAAAAATAATTAATATATACAGTA
ACATGTTCACAGAGCTGTGTACTCTTCAACAATTAAGTCTGTACTTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAT
ACTGAACTTACAATGTTCCCAATGGTAATATTTACTTTGAATTCATTAGAGTGGACTCAA
GTCATGCTGATGATGCATTTGGGTGTGTGATATTTCTAAGAACAGAAACCAATTTTCTAA
GAACAGAAACCAATAAAATAGTTTCTCTCGGGATAATCTGAAGAAAGCAGGGAGGCAGCA
GTGATATCTGTGACCTTCTGCTAATGAACTCTAGGGTATTACTTGAGTTCATGGACAGGG
AGATAGGAGTCTACCTCTAAGTAACTGAGGGAATCTTTGGAAAGCAGTAGAGACCTTGAT
GATAGAGACAGAATCTGGTGTGTCCTGGACTTTCCAGTGTAGCTAGTAAATAGGTGATCA
TGCCGCATATTTTATGATAACTTTCCAATGCCTTTAGTCTAAAATGGTATTGATAGCTAA
ATACTGATATTCAATCTCAAGCCTAATGGTTCTGATATGACCCTCAAAAAGGAAAAAACG
TTTGACCATTGCACATCTAGGATATTCTTACTGTTCAGTTGACCATCATTTCAACTTCTG
TTTATTATTCATGTTTTCCCCCTAGTATTAAGCAGATAGACTGTGTTTTGGCCTGGCTTG
GCTTAAAAACCTGATTCTAAAAAACTGAGCTATATTTTTTTATGTTGGATCAAAATCCAT
ACTTGTTGCTGCAGTGTGGGCCTATATAAAAAAGTCACTTTAACTTGAAAAATCTCAGGG
AACATTCAAAGCCACATATGAAGATTACATAATTGCTCAGTGAAGAGAGAGCGTTTGAAT
AGCACTTTTGTAGCTGGACACCTGTGAAAATAACCAACTCATCAGAGTGAACCTTTTATT
ATTTCTGTTTGGGACTTCTTTATAATGGTTGTCTAATGCTGTTCTATAGCTTCAGTTACA
AAAAACATTTGAGTTTCAAGATTATTTTTATTATTTCCATTTAGTGGAACATGACATTCA
AAAAATGTAAGAAGCTTCAAAATGTTATTTCACTTTTTAAATCAATAGTTAAAGACAAAC
TGGACCTCTGAGTGACAAGATTTTTCAGATGAGTTTTACAAATACCTTTTTCAACATGGT
TAGGTATAATCAGTTTATGATCCTATTTTTAAATTTCCAAGTCTTTGAAGATATATTTTT
TATTTTGTCAGTATGATAAAATACAAAGATGTATCTTCAAAGATGTATTTTTTATTTTGT
CAGTAATACAAAATACAAAAAGTAAACCATTTTTGGTGCTTGCTTACTTTGGCTAAACTT
GAAAACTGAAAGGGAGCAATATGAAGATCAAATCAAAGGGGAAAACATTCTTCAAATTGA
CCTGCATTTCAATGTCCTATCCCAGTATGCTTTATTATATAGACATGTGTTAAAAGTGAA
TTGAGCCTTTATGATATCTTTAAATAAAAAGACGTGCTAAATAAATTGGAGGAAGAATTT
AACATAAAAAACTCTGTCAACTATCATCAGATACTGTAGAATTACAAGTTCATTTATTGT
TGATGAAATTGCCATGAAAATTCAGGCATGAAAACTTTATAAATCATTACCTTTAGCTCC
CTCGTTTTATAGAATGTAAATCAGAGACTCAGAGAGTTAAATTATTTGGTTATAGTTGAA
GTAACTTATACTCAATAACTTCCCCCCCAAGATCTTTAATAAACTATATTTAAAAATAAA
AAATATATGTTTATTTCCTTGTGTTTGTTTTTTAATTAAATCCATTAAACAAAGTGTATT
TTCATCGATTTAGGTCGGTCATGTCAAACGAAAACCAGATTAATAAATATTTACTCCATG
TTTAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGTTTTTTTTAAAGATTTATTTTATCGTCCCCCCTTGTCGCTTGCTGT
CTACTCTGTGTGCATTCGCTGCACATTCTTCTGCGTCTGCTTGTCTCCCTTTTGTTGCAT
CATCTTGCTGCGCCAGCTCTCCGTGGGCATGGGCCATCAGGTCTCCACAGGCACGGGCCT
CCCATATGATAGATGGAAGCCCAATCAGTTGAGCCACATCCACTTCCCTTGGTCTAGTTT
TAGTGATTTAATATCTAAAAGAGAACTCAAATACAATTTCTAAACCAACCCCAAAGAGCA
GATATATTTTATATAAACTCATACAACTTTATGATGTAATAAAAACACAATTAGATATAT
ATTAGTTTATCTTTAATATAGTCATAATGGCAAGCATTATATGTTATATATGAGTATTGA
GGTATAGATGGTAATTTCCATCTTAATTTACATAAACATGTTGAAACTGTTTAATGCAAA
CTTCATGCACTTTTTCTCATAATCCAGTTTTCTTCTTTCTTTTCTTTCTAATTACTCACC
GGGGAACAGTAATCTTTTAGAATAGACAAAACAAAAATAAAGCAAAAACACCACTTTGCC
TTTTCTGTTTGCCTTTTATGGTTGCTCTATCCTAGCTGTTTTATTTTACCTTCCCTAAGG
GCAGCCATCCCTAAATATGTAACTAAACAAGACCTTGAAACCAAAAATGGTTATTTTAAT
AGAGCATATTTTATTGAACCAAAATCAACATTTTTACTAGTAAGCAACTGTAAATAATTA
TAACTTTAAGCAAAAGGGATATTTTTCTTCTTCTGAGAATCCTCTTAATCTTAATGGTGG
GTATTGAATCATGTCTGCCAGAAAGACATGTGCCCTTGCATCTGAATACTCATTTGCATC
GTATCTACTTCTTGGCCAAAAGTTCATAGATATTAGCACAGCTGTCTATCCAGCAGAATT
GGCCATTCATTTTAACTTGTGAATTCTATCCTAGCTAACATACTTTTAGAACTATGTAAT
TGATTGAAGAGGCAGAAATTATGGATTTACTTTCAAGTCTGACCAACATTGGTATATATG
CAGAAGAGCTGTCAGGGAGAAAAATTTACATAGGTAATTATGAATATTCATTACCCATCA
TTTTCTCTATATTTATGGTACTTCCACTTTGATAATTGGTTCTAATTGGGTCAACAAGCA
TTGAAACATCATCAAGGAGTGGCAAAGGGACTGGGTAACCTGTGTCCAATGATGGTATGT
CCTAAAATACACGCCTTATTGGTTTGTTATAATTATGCTCATCTTGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAATGTTTTGTAATTTACCATATATATCAATTCCAATTGTTTTC
ATTCTTTTGTGTACATCCAAATTTCCATGTTGTATCATTTTCTTTCTTCAATTTAACTAC
CTTCCTAATTTTTATTGTCGTTTCTAATATTCATGTCTGCTGAAAATGAGTTTTTACATT
TTTTTATTATAAAAGTCTTTATTTTTCCTTCATTTTTTCCAAAGATATTTTTATATTTTT
GCTGGTTATAGAATCTTAAGTTCATTCATTTCAGCACTTTGGTTATGCTCTTTTTTTTTT
AGTTTTCCTGTACTTATTCTGCATGAGCACAAGGTTAGTTGAATCTGTTGCATCTGTGGG
TTAGAGTTTTCATCAAACTGAGGAATTTTTCAGCCATTGTATCTTCATATGTTTTTCTTT
TCCTTACCCCCATTTTCTCCTGGGACTCATTAAATGTATGTTGGACTATTTGATATTTCT
CACAGCTCACTGAGGTTCTCTTCATTTTTTCAGTCTCTTTTCTCTATATTCTTCATTTTT
TATAGTTTCTATCATTCAGTATTCAGGTTCACTGATCTTTATTGTCTTCAGTGTTTCATC
TGTTGTTAAGTCAATCCACTGGTTTTTTTAATTTCAAATATTTTTCACCTTTAAAATTCC
TTTTGGATTTCATTTTTTATCATTTTGTGCCTTTAATTTCACTGTTCGTTGTTTTTACTT
TTTCCATTACATCCGTGAGCATATTTATAATATTGATAATAGCTCCTTTATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACT
AGAATTAAAAGTGCCATACTCCTGAAATCACTTGAAGTCAACTCTGATCTCACAATTTCT
TCTTGCTGTCACAGAACTGTTAGTTTTATGTTTTATGCAAATTCGGAGTCAGGTTGCTGT
ATTTTCCAGTCCAAATTTGGTAGACAGTTTTCATTGTACATGTTTGTTTCTTATTCTGAT
TTCATTTTTGCTTATAATTACCTTCTGCCATAAGTATAACTGCAATTTCAACTATAAGGA
AGTGAATCCTCAGTCTATTTGGTTTAAAGAATCTTGAAGACAAATATATATTTTATGAAG
AGATTTTATTTAGATGCAAGTATTGATATTACTAGGAGTGTAGCTTAATTCTTGCTAGTA
GGTCTGATTGACAGTTGGTTATAGGAAGAGTGTCAAAATGGAATCAGAAGTCCTGGATCC
TGTGCTAAATTCTCCTGGAAATGATGCCAGCCTCAACCAGCTCATAAAATTAATGTGAAA
ATGAGATGAAATTATTTGTAAAAATACTCTGAAACTGGAAATAGTCAAATCTAATATATT
CTTATTGCCTATTTTTTCTCTGAAAAAGTGTTGACTTTTGTCAGAGAGGCACATTTTACT
TTATTTCTGTCAGTTTTAGCTGACTCGTGAATGTATTTAAGAAATTCCAATTCTACTTTA
GAAATAGTTTTTAAGTGTCAGGAGCCTTGCCAACCACATTTGACATGACTTATGGAAAAT
TGATTTAGAGTTTTAAAAATAATTGGTCTGGTTTTCTTTCAGTCATGTTAGTCCCTCTGC
AGTGAGAAACCCAGTGCGTCTAGTTGGAGTCACTGTCTCTGTAGATGATGAGATAGTTAT
GGAATGCCAGTTTTTAAAGAAAGCACACCTACACTAGAGATTTTTAAAAATGTTTATTAA
ATCCAGAACTCTCTTTTGTGTCTGAAAAGAATAGCAAATCACTGGGTGAGGACGGGAGAA
AATCCTTTTTCCATCCATATTTACTTGCGACTTTTCTTTTCATTGAATCTGCTACTACCA
GCAGAATCAGCCATGGTAGGTTTGCTCTGTCTCATAAAGTGCACAGGCACAGGCTGTCCT
CTAAAAGAAGGTTTTCCTATCATAAAGCACAGACCACGTATGTTGGTTCTGCCACTTAAT
TGCAGCCACCAGAACCCCAGAATGTTGAACCTTTTATCTGAAAAATATTTGAAAATTCAG
ATTACCTCAAGAAAGGCTTTTTTAGCCTTTGCCGTGCCGGGTTATGTAGAGTTTCCACTG
AGTTGAATTGTTTTAAATAATGGAACTACTTGTTTCTAATAGCTTTCTACTATTAAAACG
TAGTCATTATTATTGGGAATGCAAAATGGTACAGCCACTGTGGAGAGTAGTATGGCAGTT
CCTCAAAAAAATTAAACATAGAATTACCTTGTGAACTGGCAATTCCTTTCCTAGCTATCT
TCCCAAAGACAGATACTTGAATTCAATGTTCATAACAGCATTATTCACAAGAGCCAAAAG
GTAGAAGCCCCCCAAGTGTCCAGCAACAGATAAATGAATAAACAAAATGTGGTACATGTA
CACAACAGAATATCTTTGTCTGTCAGAAGGAGTGAGGTTCCGAGACATGCTACAACATGG
ATGAACCTTGAAAACATCATGCTGATGAAAGAAGCCAGGCACATAAGGACATAGTCTGTA
TGATTTCACTTGTATGAAATATCTAGAAATAGCACATTTATAGAGACAGAAAGTAGATTA
GAGGTTGCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAACA
TGCCCAAAGGTGTAATATAGCAACCTCTCTGGTTGTTGTTCAGGTTAGACCTCTCTGCAC
ACTGCTGTCTGTGAAGGCTTTGTGAGATTCCCTGTGTGTGAGCAGTGTCCCTGGGAATAC
ACATTGGCAGCAGCCTGCACACTCAGGGCCCTGCTTATTGGGATGTACCCCTGCCCACCC
CACAACCACCGAGCCAGCCAACATCTCTAACAAATTGCTCTGGGTTACTTTGACTTCAGA
GGGATTTGGCTAGAGAGAAACTATGCGAGGCTATGTCTTGCCAAGCCCAGGAAATCCCTA
AAAAGCAGCTGAAGATTCCCACTTGTTACTGATGACCACAAACCCAGAGCAGTCAAATCA
GCTAATAACCTGTCACAGGGACCCGCCTCTCCACAGGGCTCTATTCACGTCAACAGAAAT
AGCAATGTCATGTCATCCGCACTTGGCCAGACCTGAGTCTCCGCGAGATGCCCTCTTGTC
ATAGCACTACTGGTGAGAGAGCCATGAGAGATGAGAGGATGTCTCTAATGACTGTGTTTG
TGTGCTTCTTTCTTGTCCCGGTCATCGCCCAACATCAACCTAGCTTTAGCCCGACGTGCC
ATTTAGACCGGAGTCTCGGACTGACCTGTGACGAGTGCCCCGTTGGATACGCCGGCCTGC
GTTGTGAGCGGTAAGCATGGGCTACACCATCTTTCAAAATGATTTCCCCCTTGGGACTTA
TGAAACCACAGGCATCATGGTCCTTCTCACTATCCCCGAAAAGCTGCCACCCTCAAAGAG
GCGAACTCAAGTTTCTCACCACACTTGTCAAACAAATGCATTGTATGTGGATAGCTTATT
TATTCTCTAAAAATTGCTCTATAAATCTCCATTTACTCCAAGAATATCTGATTACTTTTT
TTATCTTAGAGATTAAGCATTCGTCTAAATCTTTCTGGAAAGTATTGCTCGAATGAAAGC
CAGGCACTTGAAGATTTATTTTACCGCCTACCTTGGCACCATTTATTTTTCATAACCAGC
TTTTTGCCTTTAACATGTGGACTCAATGTGTAGTTTGTAGTTCAACACGTGGTCTACAAT
TTACTTTAAATATATTTGAAAATACAAACGAATTTTACCTTATGAGGATCATTTATATCC
TCTTGTAATTACTCCTAAGCCAATATTTTAATCCCTGTTGAACCATGGATATTATTTTAT
ATAATTTGTGTGATTAATTTTCTTCCTGAATTGTTTTTGGCAACGAAGTTCTTCTGTATA
AAGGTTGTTTTGGAGAAAAGGTTCTCAAGTATAAAGATGCTACTACCTGCACCTTTGATG
TCACTGCCAAGCATGACTCCTGTTCTCTGGTTTCAGCACTGACAGTAGCCCCCTTTGCTG
CCGTCACTGCGGGTCAGAGGAACAATCTGCTTTCGCTTGTCATCACCAAGGCTCACCCTT
CTGAGGGCTATTTCTGCCATATCCTTCCCTGTCTCCTGGCAGAAGTCACTCCTGTTTCAG
TCAGAGTGCCTAACTAAGGAGGCAGGAGCCACCCAGAGAGAATTCAGCAAGCAGCTAGCA
ATTGTGGACAGAGCACCAGTGACAGCTCCTAGCAGCAATAAGACGTATTTGGGAGCAGGG
CAGCATCTGTAAATTAGTAATGGAAGAGCAGGACTGGACTAAGTAGAGTTTACTTTCCGT
GAAACACATAGAGAAACTGAAGGTCTTTAATTGTGTTTAGAAAAAAAAGTGCATGTGTTT
ATTACTTACTGTAATTTGCCAAGAGAGATTTCCATCAAAAGTCTGACACCCCCCCAGCTT
ACTACAGGCAACCTTCTTTTTCACAACTAGAAAATGATAGCTGGTCTGTCACACAGGGCC
ACTAGACCCACTTATCTAGGAGAGAAAGTCTCTGATGTATTTACATTGCATTGCTTCATG
CCCTATTATTTTCTATACAGTTCAAGTTAGAAAATAGTTTCTGAACCATCTACAATTTTA
AATCCTGCACTTAATTTAGCAACCATGTTTTGCAACTATTATGTATCAGGCATGGACCTA
GACTTTGGATATAAACAGATACATTATACCATTCTTTCCCTCAAGCCACTCATCCTTTTT
TTTTTTAAGATTTATTTTTTATCTATTTCTCTCCCCTTTCCCTCCACCCAATTGTTGTCC
ATTCCCTGTGTGTTCTTCTGTGACTGCTTCTATCCTCATCAGAGGCACCAGGAATCTGTG
TTTTTTCTTTTTGTTGCGTTATCTTGTTGTGTCAGCTCTCTGTGTGTGCGGCACCATTCC
TGGGTAGGCTGCACTTTCTTTTGCTCTGGGTGGCTCTCCTTACAGGGCGCACTCCCAGCC
CCACGTGGGGGACACCTCTGCGTGGCACGGCACTCCCTGCGCACATCAGCACTGTGCGTG
GGCCAGCTCCACACGGGTCAGGAAGGCCCTGGGTTTGAACTGTGGACCTTCCATGTGGTA
GGCAGATGCCCTATCCATTGGGCCAAGTCCGCTTCCCTCACATCTTTATTTTACATGGGT
AAGAATGGGTGTGAGCACCCTGGAGAGAATCTTAGACTGAATAATAAAAATCACAAAAGT
AAGAAATACTTGGCAGTAAACATGATTTATTACCTAAAATCTTTATTAATCTGATTTAAA
AGATAGAAATATGCATATGTAGTTTAGCAAATGGTATATCTTATCTCCAATTCTTCAGTC
AAAAATAATCTTAAACTTTTGTCATATAGAAGATGAGATACCGTATTTTTCTAGCCAGAG
CTTGGATGAAAGTTTTCCAGGAATATTTAGGATTTCTCATTTCTCTGTGTTTATTTGAGC
CAAAAAGTCCATTAGATGCATTAGAAATATTAGGAGAAACATTTTTTGAGCTCTGCACAT
GCAAGTAGAAGAGAGACCAGTGTCAGGGTAAGGAAGAGAAAGTGGCTACAATGAAACTAT
GTATGCAACACCATCCTGTAAGTGATTTATGAAATCAGTTTATACACAAGGAATCATCAT
TTAAAAACCAAGGCAGTGTTTTCCAACTGTAGACATTCCTGTAATAAAGACTTCTGTGAG
CACATCAGTTTGGGAAACCCTCATTAGCATATTAAAAGATCTGAGATGCCCTTTTAGTAA
AGAGGTCTGTTCAATTTGTTTAACACAGCATTTTCTAAACCTGTGACCATAAAATCTCCT
GCTTTTGTTTTGTAGCAGACATGTATCTCAGACTGCAGTTAGGTGGACAAGAGTTATGAC
TCATCTCTTTATCTCACTTTAATTTCCCTTTTGAGACCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTAGAACCCGA
AGTCCAGATGATCATTATGTTTTTGCTCTCTTCCCTGTCAGATCCCTTTCCTAGGCCCTT
GGCACAAAATGGCCTTGCTGCTTGAACTGAGGAAGTGGAGAAGAGTAGTGAACTAAAGGA
TAGCAAAAAAGATACAATAAAATATTGATTGATGTCCTGTCCCAGATAGAACAGTGGTTA
CAGTTTGGAAATTTTTGCTAGGGGCCAAAGCCCCTGTTCCTTTCAGGTATCACTGTTTCC
TGGGAATGGGGGATGTTTTAAACAAAAGAAAAAGAAAAGTTCTGGGCAGTAGAGTAGGTG
ATATTCATCATGGCTCTTTATTGAGATACTAGGATTTATCACCTGGACAAGGGGAAGAAC
AAAGAGACGGGGCATTTTGAGGGGTAAAAAAGGGATGAAGTAAGTGTTACAACATCTAAA
GGAATTTTTTAAAAAACATGGAGGAAAAAAATGAAAAACTGATGACATCTGCTCTGCCGA
ACACTGAGTGACTTCCTCAATGAGGCGGTAGCCTCAGCAAGATGTCATATGTCATGGAGA
AAGACACGTGAGAAGACTGTGGCTAGTTTACCCAGTGGGATCCAAGAGAACGCATGAAAC
GCTGTGGGATACAAAGACCCCTTACAGCCCACCTCCTCCCTTGCTAACAACTTTTTAACA
ACTCCTCAGATAAGGAGAGAGATCAGAGGTCAGGACTAATTTCACATTTGCCACTGAAAA
TGCAGAAGGGATTTGAATCTAATTGTCTAATAATTCAAAACATCACTTACAATTTTATTC
ATATGATGCATATTAGAGATAAAAAATTCCTTGATGTTTTAAAATTCCAAGCCCAATATG
CTATTTACCTATTCTCTGCTTCAGAAATATCTGAATCTGAATCAAGCCTATTCGTCATCT
GATCACTCTGCTGGCAAGCCTTCCTACCCATGTCTGAGCCTACTTGAACCCTGATATTTT
GGATGCAGAGAATGGAGTTACAGAAGGAACAGAAGAGAGAGAGTTATACCTAATTGGTCG
TACCTGTAGCAGAACTGAGACTCCAACTAAATTTCAAAACGATATCCGTGTGTGGTTGTA
CGGTTTGTACACTGCACAAAGACACTCAGCCAAGGTGGTGAGTGGGGGCTGAAATCCAGC
CTGCCCTCTTCTTGCCAGTACACCTGCCATGCAGTGACCAGGTGCCTGGCCTTGTCCACT
ATCCCCTCACTTTTTCTGCTTATGCACAAAGAGGGTACCTTTGTTTAATTTGTGGAAGGG
CATTATATAACAGGCACCTTCCCTCAGTCTTTAGCTGAGTTCATCAAGTGGGAAGTTGTG
AGAATTCAATGGTATACAAGCAACTCCCAATCTCATACTTTATTCTCCAGCTGCCCAACT
TTGCCTTTTCCAATATAGTCCCTTCTACCTGAAAGACCGCAGCTCCCTTCTGCTCCTGAG
GCGAACCCTCTTCTGCTGTAAAGGTTCAGCTCAATCATCCTGAAAGCATCCGTGATGAAT
CCCAGTCTGAGTTGGTTGCCCTGTTCTATGCTTCTGCAATAGTGTGTGCGTCCCTCAAGT
GGTTTCACTGCTATGTTTTTTCATGTCTTTCTTCCCCATGGCTGTAATATAGAAATGTGC
CTTATTTATCCTAGTATCAGTGAAAGTGCCCAGTAGATGTTTAAGGAAGGGAGAGAGAGG
GTTAAAAAGCAAGAGCTTTTCTAATTTGCCTATAGAGATTGAAGTTAGCATTCTATTGTT
TAGAGCCTATAAACACTGGGAAAGTAGGTCAGAGATTTTAGCCATAGTCGCTGAACAAAT
GATGGAACTGAGTGAGATAAAGCCCCATTAATGCTGTTGCTTTATTTTCTTCTTCTTATG
TTTCCCTCTATTTCTGCTTTTTTTCTTGCTTGTTATCTCTCTTCTTCTAATATTTTTCCT
GAGTTATCAGTAGCAGCAACCATACTACGTAACTTCACATTATCCAGAGTCACATTTGTG
TGTAAGGTGTCCCTTTCTAAAATATTGCAATTTGATTTGAAAAGTTAACCAATGTGGAAA
GGAGTAGTGACTGTTTTTTCACGAATCCAATAAACTCTCTGTTAAGAATATCTTCATTCT
GTCTAACTTACCAAATGAAAGGGCTTGAGATTTCAAATTACAATCAGTTTCAATAGAGTG
GAAAGGTCAAAAGGATTGTGATTTATGCTAATTTTAATTAGACAATTCCAACCTGATCAG
ATGATGAAATTCTGTTATCGTTAATGACAAAGTTATATGATTGGCAGTACTGTATTCATT
GACCCTAGAATTATTTTTTAAATTCTTAATGGACAAAATTTTATTAGTCTCCAAGAGTTC
TATTCTATATATAGAAACACACTCATACACATATAGCAGGAAAAAAATCTGAATGCAACA
GCAGAAAGTGGTGCTACTTTCAGAAAAGTGGCATATAAATTATCTATCATGTATATTTCC
AAAATTTCCTTTCATATCCTTTAACAACAAGAAAGGACAGGTGCTTCTTCAGCTATTCTA
GTTAATTATAGTCATTTTCTCCTTGGACTGAGTTGTTTTTTGTTTTGTGAGAATTTTGGA
CTGTATTAATTGGTATCTCTGTTAAGAAAAATTCCCCGACCTGGTTATATAATGCCATCT
CTCCTGAGGCATTAAGTCATTTGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGTACATATAATGTGTTGTACTACAAAGGCTTTCCAACATGTACTCAGGATTCCTCTAG
GGTGCCAGGAGCAGATTTCTCATTATGCTTTTGTCTTGTCTTCAATGCCAGTGACAAGAT
TTTTTTTTTTCTGGCTGAAACCTAATTACTAGAGGGGCTGCCAGGATTTCATCTTGTAGC
TACATTGGAGTTACACGAACCATTCTTTAAATCACCTAGTATTTGAGAAAAGGAGCACTT
ACAAGAAAAATTTACCATCTTGGAAGATGGGTAGCATGAAAAATATGTAAACATTGGCTG
GGATGGGTTTCATGAGTTATCCTCAAATACTTCCTGATGAAATTTTTTCACCTTAGGTGT
GCTGAGGGCTATTTTGGACAACCTTCTGTACCTGGAGGATCGTGTCAGCCATGCCAATGC
AATGACAACCTTGACTTCTCCATCCCGGGCAGCTGTGACAGCTTGTCTGGCTCCTGTCTG
ATATGTAAGCCTGGTACAACAGGCCGGTATTGTGAGCTTTGTGCTGATGGATATTTTGGA
GATGCAGTTGATGCAAAGAACTGTCAGCGTAAGTCCTGAACTATTGATGCCCCTGACAGA
AGTGATGCATTGTACCTCAAAGTAGCTGAGGAGTTCTGGAGTGGGGACTGAACAGTAGGA
AATTACATGCAATACATATAGGCCAAATGCATGACATTACATTTCATTTAGAATTTACTT
TCTACCTATTCTACAATATTTCTTTGCAGTAACTAGGAGACAAAATCCTTTGAAAATGTC
TGCATTGTTGAAGTATTGTTTTTCAAATGCTATATATGTTTCTGTTTAATGTGGAATGAA
GATTTTAAAATGACCTGATGTCCATAGCAAGGAAAAAGAATTTAGAAATTAGGTATACCC
TATTTATCCTTTTTTGTTTATCTCAAATCTAATCATTGGTTGGCAATAAATTTGTCTGCC
CATATTATTTCATTTGCGGCTGTCAGGTGTTAATCAGTTACACTTTTATATGTGAACTTC
ACGTTCTTGCATTTCATAATAAGTGCAAACACTCTGGCAACATTTTTATATATTGGCATT
TATAATTGTTGACTGATTCCTCTTCACCTTCAGACTGTTCATAGAATGCTATTTCTGTGC
TTTCCTTCCATAATATAAGCCACTGTAGTGTTTCATCTCTATTAGGGCATCCTTCATCTC
ATCTTCACCTCCTTAGCTGTAGTGTTCAGTGTTGCATAGAATTTACAAATGCCTTGTATT
AGAATAATAAAATATGCAAGAAGATCTTGTTGTGGAAAGTCAAAGAGAATGTGAGCCCAC
TTTAGCAGCTGAGTGCTTTATGCTACCACTATCAGTTTCATCGCTGTCATAGTCTCTAGA
CAGAGCAATTTATGAAATCAGCTCACTTCTGCCAGACTCATTATGTAAGAAAGGACTCTA
GAAATTATCCAGTTGGGTCCCTACAAAAGTTCCTGCCATAAGCACCAAAAACTGGGTAGA
GCACCTCATTCCGATAAGAAATGTGTCTCTCTCCTCATAGGTTTGGAATATGAGTATCAG
ATTTTGAATATTAAAACTGATGATTGGTGGAATCAAAACCAAAACACTCAGTGTTTGTGC
TCAGCCACAGGCTGGAACAATTATAACCTATTGATATCACCTGTAAATCAATAAATTCTT
CAGGTAAAATTGCCAACAGGTTCAGAAGTTCCTTTTGAGCACTGTGGGCTTTACAGCATC
TGTGTAGAATCATAGGAAGCTTAAGACATTCTTCTGTTCGAACAGGTCATCTAAAATTAG
TACTTTCTAGTTCGGTGACTCTAGGGCAAGTCTTTAGAACTCATTAAAATGCAGTTTCCT
CATCTACAAAAAGGGCAATCAAATTTCTGTGAGGATNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGAGGTCTTAGAAAAACATAGAAGAATGTGGGAATAAAAACATTTTTGAACTGTCACC
AATTTTTGTACCACTTGCTATGAAGTATGGACATGATTATGATTTTAATGCTTTTCAATG
TGTAATTAAGATGAAAAATATAAGAAACATTTTCTCTATTTTGATAATTTTCATGGGTAT
AATAGCTCTTCTACGCAAGGTGGTAAACCCTCACAGAAAAGAAAGTGCATGATAATAAAA
TGTTATTATTTTAATTGGCTCCAGATGAAATATATTTGCTTAATCAATTTATGAATTGGT
TTAAATGTCATACTTTTCAGAAAACTACTTCAGAAAGTTCTCTATTTTGTCATCTTTAAG
ATAGAATTAATTAATTACCATATTCATGATGAATTTAAGTTTTTATTTTCTATTCTAAGA
GAAAGTAGCTTCTACATACTAAATTATCTGAGATTTTATAAAATGTATATGAGAAATTTA
TATAAAGAAATTAAAAATATGTCAACAATTCTAGTTTCCAAATAAAATGGATATTTTAAA
GAAAACTATCTTTTTCTTCAGCATTTTCTTACAGCCCAGTTATTGACTACTCCTGAGGAA
AGTGCTGATGGGCAAGTTTCTCAATGGCCACCCCTTGGCCTCCAGTTAGCAGACATTGAA
AGCTAAACTTGCTGGAAGAAATAGCAAACAGTTTTTTAGAAAAGCAGTAAAAGGAAGTAG
AACCTAGAGCCACATGAAAAGAATAAGAGGATAGGCTGATGGGGTAGCTATTTATAGTAT
ATTTATAAACTGCTGAAATTAAAGTATTCGAAGGCATTATACAAGAGTTACCAAAACCAT
ATACCTAAATCTGTAGGTCATCTGTCTCTCACATTTTCATTCTGGTATCAGTGTAACTAT
ATGTACCATTAAAAATATACTTGTAGAATACAGAGTAAGTCATTAATTACATTTCTTTTT
TATGTAAAGGCCACTATGTTTTAGTGAGATCTATTTATTAGATGTTTCAGAATAACATCA
GGCCAATTTCATATCACAAAAAATGACAAAAGATTACTTAAACCAAAAATATATTCTATC
TTCGGCAATAGTATATGAATTGTAAAATAAAAGTAATTTTTTTTTCTCCACGTTATAGTG
CTATACTCCCAATACACTTGAAACTAAGTGCTTCTGTTATCCTAAATACTCTTTCAGTCT
TAAATGTATGCATATTTATTTCACCACAGTCTCATTTTGTGAATTTAACGCAAATACTGG
CACAGAATAGACAGCCATTAAATTGAAAAATTAATTAAAATGCTACTTGATTAATTATGA
CACTAATATTATGTCATGGTTGCTATTAATTTTGATCATTCCCTAAAAGTATTTTAGTCC
TGAAGTCAGAATGGATTACTTGCAATATAGTTATAATATTTTGAATTTTCACGAAGAAGG
CAAGTAGGTTGAGGAGTGATAGATATAACCCTGGACTTGGGCTCAAGTGGCGTGGGCCCT
GGACTGGCTCTATCACCAACTCACTGTGTGACCTCGGATAACTTATGGCTTCTTTGAACA
TCAGCATCCTCATTCTCAAAATTGGAATAATAATAATGACAGCAATATTTAAAGAGCACA
TGATGTGCCAGGCACTGTGCTTAAACCTCTCCATGAATTATCTCTACAGCCAGGAGGGCT
GTTGCAAGATCAAATGGTAAGATGCATAACAAGCACTGGCACATCAGAAAACATTCCATT
ATAAAACGCAGGTGTCAGTGTTATATTTGGGGTATACTATTATTTAACAATCTGTTGAGA
CAATTGGGAAGTTCTTCCTGACCACAGACCTCTCTACTCCTGGCAGCCTGTCGCTGTAAC
ATCAACGGTTCCCTCTCGGAGAGCTGCCACCCTCGAACAGGGCAGTGTGAATGCAGGCCC
AACGTGCAGGGGCGGCGCTGTGACGAGTGCCAGGTAAGGAGCAGGAGCTAGTTCCTCCTG
GGAAACTTCCATTGGCTTTCAAGGACCTGTTTTCTACACTTTAGCACATTGAAAGAAAAG
TTTGGGATTATTTAACTCTATATGTAAAATTCCTGCGACCAGAGACATGTTTCCTCAAAC
TAAAACAAAATTTGCTGTACATTGACAGTAGACTTTCAACCCACATTGCCTTGGCAGTGA
ATGTGTATCCTGTTTGTTTTGATTCTGATGTTCTTGAAATGAAAAACATTGAGATTTAAT
CCCATTCCGGGAAGAGTAAAACAGTTTCCTTTGCCTCCGTTTTTGGCAGAATGAAATGTA
TCATTACATTTGGATTTAACCTCTTTTTCTAGTTCCATCATGTAAAAGTTGTTTCCAGTG
CATACTTCAGAAGTCTTCAGTAAAGAAGCTAAGCAAGGTAGTTCTAGATAGATCGTTCTG
CTAAAATAAAATATTTTATTAAAATATGTTGCCCTCTGATCTGAACATATTTCCAGGCCG
TTAGTGTGGCTGCAGTTTCAGCGTCGTCCATGAGAGAAGATGGATTTGCACTCATTCTTT
CACATAAACCTCTTTGACTGGTGATGAAATTAGTTCAGCAAAAGCAAGCACTTCTCAGAG
GTCAAACGGATTTGCCTGTAGGAACATCTGAAAATATGATACGCCTCTATCCCTTGAAAA
CTATTTTATACTCTTTTTCTTTTTTCCATTTTCTTTTTCCATTGGCTTTTTAAAGCCCAG
TACGCGGTGGGACCCAGAGAAGCGATTCTGTGTGTTATGTGACTGCAGTCCTGTTGGCTC
TGTGTCACCGCAATGTGACCCGACAGGAAGATGTGCCTGTAAAGCAGGCTTCCTGGGTAA
ACAGTGCAGCCTCGGCCGGCGGGCGCACCGGCAGCAGGAGCAGCGCCGGCGAGCTCAGCG
GGTCCTGGGCGCCCCGCGGAGGGGGGCCCTCGGCAGCTCCAGCGGGTGCCCTCGGGGAGC
GCATCGAGCGCCGCCGGCTCGGGTAACGGCGGGGGCGCTGCATGGCGCGGCCTCCGCGGC
GTGTGCTGAGTGCTGCGGCCGACCTTCCCCGGTGGCGCTGTCCCCAGGGATAGCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCTTTCACATCGTAATTTGTTCCCGGTATTCAACAACACAAGAA
ACACACTTCTAAACAAAATAAATGTACAACGTACACAGGGTGAGGAAGGTTGCTTTCTAC
CACAAGAAAAAGGAGCTAGGACACTAAACGTTTGGCACTTTGACACTTTCTCACAAGGCA
GAATTAAAATGCTTAGAGGGAGAGAGAGGAAAAAAGAGGAAGGAGGGAGAAATACATATA
TGATGTGTAATTAGGGACAAACCTTGCCATTGTAGATTCAGAGCCTGTGAGGAGTTGAGG
GTGGTAGGGGGTAGAAGAAGGGAAGGATGAATAAAAATGTAAAGGGGAAGTAAAGGAAAA
AGACATATCCATGTTCTCATTTCTTGGCTCAAAATGATACTTTTTAAGAAATGAATTTTG
GCTATCAGACTTCTTAGATCAGCTCCCAGCTTGACCACTTCCTAGTTGTAAGGCCAATTC
CTTAGGTCTTCCTGTAATACAGCTTCCTCTGTAGTATGACCCACTTCAAAGACTGTGTTT
CTGGCTTGAGTCCTCCATTAAGCCAATGCCAAGAGATTTACTGGGGGAAAAGTTTATGAG
GGCAACAGCAAGCCATGAGAACCTTCTGTCTGCAATGCAGGTCCCATCCCTGTGCAAGGA
GAGGAGGAAGGAAAGTCAGGGGAGGAAAAGCCTCTTACAGTGCATTCTGCCAAAATCTCA
AAATTGTGGCCAGGCCAGTGGGAAATGCCCAAGAACATTCTGCCCATTAGAGGAGTCCAC
ATTGGGCAGGAAGGTTCTAGCACCTGCTCGTAATTAGTCATTGGCCAGGAAGTTGCCTGG
GAAAAGTATAGGCTCTGAAGAGGTGGAAGCTGGAGGTTGTCCATTGGCTACACTCCCCAC
AGCACGTTCTCTTATAGGGAGATCCATTGAGGCACCTCTGTGACTGTCTCAGAGTAGGAG
TGTTCTTAATAAATATTAACTATTATTATCGGTCATGATTAACACTTATCATCATTATTT
TTATTATTGTATTGAGGAAATCTAGAGAGACTTTCTCAAAAAACAATACATACATTTAAA
ATAAAAGTATACAGGAAGCAGACCTGGCTCAATGGATAGAGCATCAGCCTACCACACGGG
AGGTCCAAAGTTCAAACCCAAGGCCTCCTGACCCGTGTGATGAGCTGGCTCATGCGCAGC
ACTGATGCGCGCAAGGAATACCCTGCCACGCAGGGGTGTCCCTGTGTAGGGGAGCCCCAC
ACACAAGGATGGTGCTCCATGAGGACAGCTGCCCAGCATGAAAAAGTGCAGCCTGCCCAG
GGTGGCACTATACACACAGAGAGCTGACAAAGCAAATGACGGAACAAAAAGGGACACAGA
TTCCCGGTGCTGCTAACAAGAATAGAGGCGAACACAAAAGAACACACAGTGAATGGACAC
AGAGAGCAGACAACTGGGGGAGGTGGGCCAGAAAGGGGAGAGAAATTTTAAATATATATA
TATATATAAAATAAAATTTAAAAAACGTATAAGGAGTGGATGTGACTCAAGTGGTTGAGT
ATCCGCCTCCCACATGGGAGGTCCCAGGTTTGGTTCCTGGTGCCTCCTGAAAAAACAAAT
ACAAACAACAAGCAAAACAAACAAAAGCCAATTTGCCTCAATGGTTGAGTGCTGGCTTCC
CACACACAAGGTCCTGGGTTCAGCCCCCAGTACCTCAAAAAAAAAAAAAGGTGGGGGGGG
GGACAATAACTAATCTCAAAATGTCTCCAAAATGTAAAGTTACCTTGACACTGAAGGATT
TGGAAAACTGACTCCACAGTTGGCACTTAATTACCCTTTCTGTGCCTCAGTTTCACCATT
CTGTGAAACAGTGATGATGAGTATACCCATCTCTCAAGATTGTCTTGTAAAGGGGTTTAG
AACAGTGCTTGCCACACAGCAAGCACAAGATGTAAGTGCTATTGTTGTATGCTGAGTGAG
AAGAATTTATGGGAGTCCATCACCGTTCTCACTGAGATTTGACTAGTACTCTCTCCCATA
TTTGATTTACTTCATTAGTCTCAGTTACTGACTAGGGATGTTTGTCTCTTCAATATGTTT
ACTAGGTGAGTTTTCCTTAGCTTCTGAAATAAATTTTGAAGACCATATTTATTAAAATTT
TACTACTGAATGTTGGTGGTATTTAATTTATTGTAACCTAGCCTCTAAAATTACATTATT
TAAACATTTGAAAAATACATTAGAGCCACTTCTTGCATATTTTGTTACATAATCTACAAT
GGAAGTTTTTAAATGACAACTGTGCTATGGAAATTTCTGTAACATTTTAGTAATTTATGC
ATTGAAGGTTTTATATACGTTAAGTGAAGAAAATTTAGGAAAAAAAACAAGGGTAAAGTA
CTATTTCTACATTCCAGGTTTTCTTAGAAAATGTTTTAATATATTGTAGGTTTGTTCTAT
GTATGTATGTTTTCATTTGTGTGCGTCTGTGTGGTATGTGTCTTTATGAGTATGTAGTTA
GAATAAGTGCAAACATAATTTTATATCCTGCTTTTACTAAGAATATTCATATCATTAAAA
CTGCTTTAAGTCAGTATTTTAATGATTGCATCTCATTTCATAGCATGAATGCTATCGTAA
CTATTCAGCTACTCTCTAACATAGAACAACTGAGTGTCCCTACAGTCGATCATTTTAATA
AATAATATTGTAGTGGGCATGCTCATGCATTAAGCTTTTTGTGATTATTCTAATTATTTT
GATTGTCCCAATTTCTAATTATTTCCCTAGGCCAGGTATCTAAAATTTTTCATTGGCTTA
TTTATATGAATAAGAAAAGTATTGTATGGTTTAATTTTGCCTTACAAAGTTTAATTAAAT
TTCAAAACCATGTATTAGTTCATTTGCTAGAACAGTTACACACATTATTCTTTTATCATA
ATAAAATCTGGATTAAAATTAGAAATAAAAATAAAGCCAGCATTAAATATAAAGCTTAAA
GCTATTATCAGAATCAACCCATTTTACATTAAAAAATAAAACCTTAACTACTGTCATTTT
AAAAGATTGATTTCAGTGTGATTTTGTTTTCTGGAATTATTTTTGATTCAGTTGACAATA
ATGCCAAAAATATATAATAATGCTTATTCATTTCTTTTTGGGGGTGGCTTATTTTAAGTG
GCATAATTTATTTTTACCGAGAAGTAATTATTAAGTCTAATTTTCAAAAGTAATTTACAA
AGAAATAATTACTAAGAATAATTTTGTAGATTAAAATATAATATTATGACACTTTATATA
AAAAAGACAGTTCTGATATACTTTAAGCAAGATACGTGCGCTTTACTTTTCTAGTAGGAG
TGGATTTTAATCCATCAGCATTTTCTAAAATAGTTATTCCAGGCTTGGTGGCATGCATTT
CAAGAAAACCAGCCAAAGCTAGTAATACAGAGTTTACCCTTTGAAGATTGTTACAAATAG
ATAAGCTATGCATATGAATAACCCAAAAGGAAATGAAAGGTTCCTTTCACCTACCTCAGT
CTGCTGATTAGGTACACAATCTCACAGATGAATATAAATTGTTAAAAATAACACCTAAGG
AGCTAGATGTTTGTCTAACCGATTATTTTGTCAGTATAGGCATAATCTGTGAGTTACATT
TATTACATGAGTACTATAGTGATGAGTGGAAGTATCTATGGATATATGACCTAATGTAGA
TGAAATATTGGGGGGGGCGGAGCTTTACTTTAACTAAACATTGTTGGTCAATAATACTGA
AAGTGCTTTTATCAAATAGGAGATCCTAGGATCTGAAAGTCCTATTAGGAATTCAACTAG
TAAATTTTTCAATTAAAACTGGAAATAACACCACTGCTTATTTCCAGATAGCTGTTAGAA
CCTTGGTAAGTATAGAAAAAGGCTGGTGGAAATGTAACAGGCAGAAAGATAATGCCCTCT
GTGACCATTAGTCTTAATGGGATTTTAAAATAATTGAACCTTTCTCTTCGGAGATGGTAG
GAAAAGGTCCATTAGATTAAATGACACCCCAGTTGTCATAATGTCAATGAAGAACCCTGA
GAGTTTCCCCTTCTCCAGCCTAATCTTTGGGTAGTGCGTGTCTTGTTTCATTGCTTATTA
ATTCATTTAAATTAAAATGTTTTCCTTCCTCTTTTATGCCAGCCTGAAACCTTCGGCCTA
CAATCAGCAAAGGGGTGTGTACCCTGCAACTGCAATTCCTTTGGGTCTAAATCTTTTGAC
TGTGAAGAGAGTGGACAGTGTTGGTGTCAACCTGGTGTAACAGGAAAGAAATGTGACCAC
TGTGCCCATGGCTACTTCAACTTCCAGGAAGGGGGATGCACAGGTCTGTGAAAAAGACGA
GTCCTACCTACTCAGCCTCGGGTTTTGGTCTCAGCTTCTTTAACAGTTTGTTCTTCAGGG
TGCCCAGAGATCAAACAAAATGTACATTGAGAACAAATTTTATGATATAAAATATGTAGC
CTAAGTAATGTATATTCATTTAATTAACATAAATTAACAAATGAAATACATTGTAGTTCA
AAACACTGCCTTAGAAATGACTGGTTGCAAGCACTCAACAAACTGATAAAAATCCATCAG
CAGATCCCAGTTCTTGTTGTGTCCCTCCCTATCTTTGACCTCATTTCAGCCAGTCATGCC
GTGGCGGTTTTAGCTTGAAAGTCAAATGTTCCTTTTTTCTTGGTTTCATAAGTTAGCTTA
GTTTAAACTCTACTCCCAAGCTAATGCACTTCAACTTTTCCTTTCATTTTACAAAAGGAA
CAGGGAAGTTAATAATTTTTTATCTGGTAGAAAAATATGCTTTCATCTACTTTCAGGTGC
CTTGAAATCTGTGATGTTCTGAGAGAAAAGCAGGTTGACTCTAGATAGTTATTAAAAATA
TAGACGGGGTCTTTAACCATGGCTCCCCCAATCAGTTTTTTTCAGGTGTCCAGCTAAAGC
CTTCCCATGAATTACAAATTAAGAAAACAGGAAAAAATACCTTACAGATAGAAGTAAAAA
TTGAACATTAGCCTTAATTGATAGGCCACTAATTTATAATTGGTCGTTATTCCAATGACG
GCTAAGTTGAATATTATCTTTGCTTAGTAAATGCTTTATTTCAATATTGATGACATTTCT
AGCTCTCAGCACCATGATAAACACATTGTAAGATTTTAAGATATGATTGTTGACTATTGT
AGCAAATGTATGCAGGAAGCCACATGAAAATATTTGAAGTTATATAGATATCAAATACCT
TTCAGACATTCTCAAGCAATTTAGATATACATTCTTATCATAAATTAAGTCAAATTGCAA
ATTATTCTAAATGTTATCCTCATAAATCCATAAGAATCCATATATGATCTGTGTCAATAT
TTGTACATACGAAATAATTATAAACTGCAATGCAAAATATTCACTGTTCTTTAAATCAGT
CTTATTCTATTTTAACTTAATATGAATTCATTAGATATTACATATATTCAACTATATCCA
CTATCAAAAATTATTAATAAGGCCAAGAGTATTATTTTAAATTATGAAATGGTGATGACA
TTTTAGAAATGTGTTTTACTAAGTATTCTAACCTAGAGAAATATAATGGAAAAAGAGCAT
TGGACAAGCAGATAACCTCGTGGTTGAAAACATTACTTGAGCCAGACGACCTAGATTTGT
CTAGTGGACTACCAAGCAAGTAGTTATATGATCTTGCAGTCCCTCTGCAGTATTCATGTG
TTAAGTGGAGATAAACCATTATCAGTACCATGAGATTTTTGTGAGAATTGGTTGAGTTAA
TGCCTGTAAAAATATTTAGAGTAGTATCTGGTATATAAGGGCCATGTAAGTGTTTATTTA
TTATTATCATATTCATCATTATTTTTCTTTTAGTATTAATTGTACTAAAATTTCTGTCTT
TCATCAGGGAAAACTAATTACTCAGGGTTTTTTCCCTATACAATGTAATGACGCCACTGA
ACAACTGTTTAGAGAATTTCTATTTCTAAGTGATGATTTGAACTGACTAAGACATTTTAG
AAGATAAAATTAAATGTGATGTTAACTATTCTTCTTCTTAATGAATGGCACATGTAAAAT
AAATCCTTGGGCTTAAAATTAGCAACCACAATAATAACAAAAAAAACACAACAACAATGT
CTAACAGCTATTTAGCACTTGCTATTTGTCCAGCATGGTACTAAGCATTTTTCACAGCTG
GTATGGAATGAGGTGGGTAGTGATAATTGTGATCCCTTAAAAAGTGAACTTAAATATCCT
AGATCTATATAGTTAAAAGATTTAATCATTGTATGACCAATTAAAAGATTTCTTATAACA
TTGCTCTTCTATTTAAATCCAAGTATTTTGTGTTTCATCTCTTGCTTTCACTTCTTGATA
TGAAAGACTGTGCTGAAATATACTTTCTTTGTAGCTGGGTCAATTATAGCTATTAAATGG
AAGGCACTCCTTGTCTTGGATGGCTTTGAAGATCTTCTTAAACCTACCTTTGCATTCTTT
GAGAAAGTGCTATATGGGCAGGGATGAATTTTGCTCTCCTATATATCACGTATTTTGAAG
AAAATAGAGAAACTATTGAAAAAATAATAAGGTGTTCAATAAAACTCAAAAGATATTTTC
ATTTAAAGGCTGTGCTCACAATTTGGTGATTTTTTAAATATTTGCACGACTGGCATATCC
TATTGTGTACCATTTATAACTATGTGTATCATGTACAGTAATTTAAGAAGTTTATTAAGC
TTATTGGTTTTTATTGCAAGTCAAGGTTATTGACAAGGATAGAAAATTTAGTAATGAACT
TAAAAGAAATATGGAAACAAAATTTTAAACTTTATAGTATTCAGATAGAAAGCAATACAG
TTAATATGGAATATGATCACCAGTTCTTTCTTTCTTTAAACTTAGCCAAAAAGCTGAAAA
TGCTTTAACTTTTGAATTAAATACAACCTATATTTATTGACCAACTTCTCTGTGAAATGT
GCTGTGTACTTTGACATAGAAGATTTATAAAGTAAGTTTTTTTTTTTAAGGATCCTTAAA
CATGGTATGGAAAATAAAACAACACAAATTACCACAGCGTCAAACTCAGGGCTTTATGTC
AAATTTTACTATTTTTTTTTTTTTCTCTTTGTCCTTTATTCCTCCCTCTCCTATCACCTG
TGAAGCTTGTGACTGTTCCCATCTGGGTAATAATTGTGACCCGCAAACTGGTCAATGCAT
TTGCCCTCCCAATACCATTGGAGAGAAATGTTCTAAATGTGCACCCAATACCTGGGGCCA
CAGCATTGTCAGTGGTTGTAAGGTAAGTGAGTCATTTTGTTTAATCTGATAATTTTTTTT
AAGTTCTCTTGTTTGGGTAGAGTTCTACAGTAGGGAATTCGAAGCCAATATTATATTACA
AAACAAAATAGAATTATGACTACAGTGTGATTGCAGATATTAAATCAGTATCTTAACTTT
TATTTGTGGGAAAGATTATGGAATTAAGTACATATTTTTATTGGTTATGCCATAATACCT
ACCAGAGAAACCCTACAAAATTTCCAACAGGGAACTAATATAGAAAAGGAAATGACATCT
GACTTAAAACCAGGAAACAGCCATAAACGCATACCTAGACACAATGAAATCTACCTACAA
ATTTCCAGTAAATCAGGAACTAATTAAAGAAATTTGCCAAAAATCGACGGGAATTGCCAC
CAATTATGAGCAAATTGCCACTTTTCCGAAATAGTTGAGGTGATTCTGAAGTCATTATAA
CAACCTTTAACTTGGAAAAAGTCTCCTTGTTTTCCATGAATGGGACCAGAAAAAGTGGCT
TGACCAGACTCTTGTTTATAGAAATCTATCCAGCAGCAACATGGAAGGCAAATGGAAGGC
GGGATCCTTATGAGAGCGCTGGTGATCATTAGAAAGCTGTGGCAGAAATAGTGAGCAATN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGA
TACTACACTTTTTCTGACTTAATGAAGGCTGATTATTGAATAAGCATTTATGTCGATGGT
GTTGAATAAAATGTATTGATTACTTTGAACCACTTTTGAGAGTATCGATTTCTGAATAAC
TAGACCCTTCACCATTATGAACAGTATAAAAAAATGCCATGATGCTCTCACACATATGTG
TCTATGAGCTTGTATTCTGCTATTTACAAACTTCAATGACTAGGAAGTAAGTAAACAGTG
ATTTGAGATTTATAGCTTCCCTTCGTGTCATGGATAATTTCCCTGTGCTGAAGTGTAGGC
ACACACATCGTTTGAGCTTTTATTGGAGTAGAATACAAAGCCTGCCATCCTTCCCTAGGA
GGGGAGTAGTGCATAAATTCTCTATTGCTGAACAAACATTACATCTAATTATGATTTAAG
TTCTGATGATGCCTACAGTGCTATCTAAACATATGGTTAATGGTCTCATTTATTCTCCAC
TATAACTTCCTGTGCATTTTTCCAGTTTGGAAAAATCCCAGTGTCTGTCTGTTCATTCTT
TAAGAATCAGTGCTTTGGTCTTATACAATAAATTTGGTAGCATACATTTCAAATTTTAGT
TATTTAAAGGATGCCTCCAAAGAAATTTTTATTATCTTATTATAGTTTTCATAATATATC
ATAGTTTTCTTTTCCTCTTTATGGCCCATTTTGTTTAATTGATCCAATATACACTCAAAG
TAATTGGCAAGAAAAAATTATTTACGTGAATAAGTAAATCATTCTAATTTTGAAATTTCA
TTCTACATCTGATGTTCAATAAGGACAGGTTACTCAGTGTCATGGCAGTGGTTTATTCTA
TACTTTGAATGCTATGTCCATGTAATATAATAAATAACTGAAATAATTAAAATTATAAAT
AGTAATAATATAATAAATAGCATTTTTATCCTTGAATTTATAATAATTTCTAGCTAGCAC
ATCCTACTGCAGACTTTCTACTAGATAGCACTGAAGACATTGAAAAATATTTAATCACAA
GAACACAAAAAACAAGTCCTGACAACTATTTTAAAATCAGAATCAAGAAGATGTTTCACC
AGACATTTGGGCAGGAAAGAGAAGATAGAGGAGAAACAGGTGGTTGTGCATCCCATCCTA
GAAAGAGTAGTTCCATAAGCAGAAGAGAAGTGGCAGAAGCAAAAGCAGGAGTTAAACACT
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTAAGGCTAATATCTGCTATCTGCCACAGAGAGATGTTT
CTAGGGCCCAGGTAAAATATCACAAGGCAGGGCAAAGTAAGGTGAATTTAGAACTAGGAG
GCAATAAATTGATAACTGACATAGCTGGCCTCTGGAAATTTTTTATTTCAAGATCCTTAA
TGAAATTTTAGAAATCCACCTGGCCTTTTCAGTACATGTCAAGATTATATGAGCCCTGTA
GCCCAAGAGCAAAAGAGTCTTAAAAGGAAAATATAAAATGAAACCAAGAGAATGAGCTCT
AATTCAAGATGAGTGAGGAAAATTAAGAAACAGATTGAAAAGGAACCAAAAATGCAATTG
TGTAATTAAAAATAAACATTGGTGGTATGTACACATAAGAGATTTTCACTGTGAAAACAG
AAGTTGTAAATGGAGAAAGAAATTGAGAGGTGAATAAAATAAGAAGGGTAAAGCAAAGGA
AAATAATTATAATGGACGTGGGCTATTACAGATTTGGCAGACAGACAAGAGTGAACTTTA
AGAATTACGGTTGTTTCTGAAGAAGAAAATTGATAAATTAGAACATGAATAAAAATTAAA
GGCAGGTTTGGAGAAACAGCAATGAATGAAAAACCAATTATGTTCCCAAACCAAGAGAAC
TTATCATGTTCCAGTAAATAAATGGGAAAAAAGATGCAAATTTTTTAAAATTCTAACAAA
ATTTTTGCTAGAAGAAGAATCAAGGTTGCCAGCACAGCATCCATTCCAGTTTGTCTGCCA
ACCTAAATGCCCAAAGATAACATACAGGGCATCACTTCTCTAGGTCACCCCTGGCTTCCT
ACATCTGGTTTGCTTCTATGTCTTCATAGCATTTTGCGTTTCTACTATCATACATATCAT
ATAGTGCTTATTACATCACATCAGATTTACATATTCACTTTTTTCCCTCAACTAGACTCT
AAGATGTGCCTCTATACAGCTTAAATGGAATAATAATGAAACAAGAAGGGAAAATTGACT
GTCTAAGGTTTAATCTTTGAAATTGAAAAGTTTGAGGATAACCTATACCTCACTCCTCCC
TACCTAAAAAAAAAAGACAGAAAGAAAGCACAATGCTTTATTCACATACCATTATGGTTT
CTGGACAATCATATATTTTAGTAAATGCAGGAAGCAATTTTTAGGTTATGCTCACTGATG
TTTCTCAAGCTACTAGACTAGAACAAGGCCAAATATGCTGTAGACACATAAATATTTCTT
TAATGGAAGCATAGGAACACTAGAATTAAAAAATTAAGGTATTTCCAGTGAAAGCGTGTT
CATAGTTGTTGATTTTATCTCCTCTCTAGGCTTGTAACTGCAGTGTGGTGGGATCGCTGG
ATTTCCAATGCAACGTGAACACGGGTCAATGCAACTGCCGTCCGAAATTTTCCGGTGCAA
AATGTACAGAGTGCAATCTAGGCCACTGGAATTACCCTCACTGCAATCTCTGTGACTGTT
TCCTGCCTGGGACTGATGAGGCGACTTGTGATTCAGAGGCCAAAAAGTGCTCATGCAATG
ATCACACTGGGCAGTGTACCTGTAAGGTGCGTGCTGCCAGAATACAGCAAGGAAAAACCC
TACTTAATGCCATTTCCATCACCTAGTTTTCACTTCATTCCATGTTTGGTGCTCGTTATC
CCTGCTGCAGTAAGCTAACCAAAGAGATACACTAAAAATCATTGTCAGACATGGAGTTCT
CATTGATACATGTCCACTGGCATACAGATAAGCACTGTTTTCTGAGAAGTTGTTTTCAAC
CAAAACCCAGCTTTTTTTTCTCATTTGTAGAGATGACAATGTTAAAATGGAAAGATTTCT
CTTTATATATTCACTTTGCTTAAACAAAAACAACCTGAAAGACAATTCTTGTGTCCTCAG
AGAAAATCATTAGCTAAATAATGTCTTATAAAAATTGTTTCTCCTAAAATTAATCCGCAA
TTACTATACACTGAAAAATATATTTACTGTTGTGGAAGTTCAGTATCATCCAGTATCATC
CTGTATAAACGCTGACATTACAAACAGTGACTATCTGCCCTTATTAATATTGTTAAGTGA
TGTAGAAAAAACAGCCAATTAAAAAGTAAAAGAGGGATCTTCCCCCTAAGATATTTCAGA
AAAAAAATCAATCCTGGGATAAATGCAGCTATGACCATCAGAAGTCACTTTTTAAGAAAA
AGTCAAAGCAAAAAAAGAAAGAGGAAACATGAGGATGAAATCCAGGCAGTGGTAATTAAT
ACAGTCTTGAGAATTTAGGAGAATGGCAGCTTCGATCATCCAGGAAAGGTCCTCCTCCTA
ATATCAAGTATAATACTGGATTATTACATATTATAATTACAGTTAAACATTATAGGTTAT
ATATGTATATACATATATATATTATTTAACCGTAATTAAATGCAGGTACATTTTAATGCC
CATATATTTTTTTTGCAAGTTTGCATCTTATTCACTGTTTTGGAATCAGTATTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
GCCTCCGTGCTCCACTGATCCAGCTGCTGTTTTTTTTGTCTCTGCTTTTAGTCCTCCACT
TATGAAGGACTCCAGTAAGACCCACCTTGAGTCCCACAATCTAATCAAAGGCCCTTAACT
GAAGCCATCTAATCGAAAGTGATCTCATCAAAAGGTCTCTCATTCAACAGGTTTACATGC
ACAGGAAAGGGTTAGCTTAAGAACCTGATTTTCTGGGGTCCACTAGAGATCAAACCAGCA
CAGCTGGGAAGAAGCTGCATTCTGAAAAGTGGGTGACATCAGAACATGAATGTTGAATGA
GCAAAGAATCGCAGACCTTGCACATTTATTGTGCCAACCTCAAGGAGTCATCGATATTTG
GGAGGGGGGACCATGCTAATTTTTGTTCTGCATTTTATTATTGTAAAAGATGCCACTTTT
CACAGCTGTTGTGGTTTTCACTATGCAGACAAGTCAGAAAGACTTAGCCCCTCTTTCACA
TGCCCACAACACCCAAGTTCGGCTTCTTATGAGAACAGTTCCTCGGCGTGGGAAGACGGG
TGACTGCAGACAGCCATGCAGTCCATAACTTAGTTTTTTTGTTTCTGTTTTTTTGTTTTT
TATTTATGACACCCCACTCCCTTGTTGTTTGTACTTGCTGTGTCTGTTTGTCTTCTTTAT
TTCTTTAAGAGACACCGGGAACCGAACCCAGGACCTCCAATGTGGGAGGTGCCTAATCAT
TTGAACCACCTCTGCTCCCTGATTTGTTGTGTCTGTCACTATGTATTTCTTCTTGTGTTT
CTTGTTGCACCATCTTGTTACGTCATGCCAGCTCGCTGTCTTCTTTAGGAGTCACCAGAA
ACGAACCAAGGACCTCCCATGTGGTAGGCAGGAGCTCAATTGCTTGAGCCACATCTGCTT
CCTCCGTAACTTAGTTTTAAAGGAGTGCCCAAAAGACTTGAAATCAGTCCTCTGCTTTGA
TTCCTTCCCATCAGGTGACATTGACACCTAAGCAGACCATTCTGCCCCTGGTAGATGAGG
CACTGCAGCACACAACTACCAAAGGCATCGCCTTCCAGCATCCAGAGATCGTGGCACACA
TGGATCTTGTGAGACAAGATCTCCACTTGGAACCTTTTTATTGGAAACTTCCAGAACAGT
TTGAGGGAAAAAAGGTGAGAACAAGAACTTTAAAATCAAATGGGAACAAAGTAAAATATG
TTTCTGGGATCCTGATTTACCTAACTAATGACTGCTCATTTTATTTTGTTAGTTGATGGC
CTATGGAGGCAAACTCAAGTATGCAATCTATTTTGAGGCTCGGGAAGAGACAGGTTTCTC
TACATATAACCCTCAAGTTATCATTCGGGGTGGGACTCCTACTCATGCCAGAATTATCAT
CCGGCATATGGCTGCTCCTCTAATTGGCCAATTGACAAGACATGAAATTGAAATGACAGA
GGTAAGATTATTATTTTTTGATACAAGGATGCCAGCAGCTGTGTATTCAGTTTTGTCAAA
GTAGGTTTCTTTTTTTATTTTCTTAACAGAAAGAGTGGAAGTATTATGGTGATGATCCCC
GAATCAGCAGGACTGTAACCCGTGAAGATTTCTTGGATATCCTCTATGACATTCATTATA
TTCTCATTAAGGCCACTTATGGAAATGTCATGCGACAAAGCAGGTAATCTATAGCAGATT
CTCATTGGAGAGTTTATAGGGAAGATCAGTAAGAAATGAGATAAGAAAGAGTTTCACCTG
GTTGGTTTTGTAATGATTTGTAATGATAGAAGGCAAGTCAAGGATGGTTCCCAGGTTATC
TGGTGGAAGTCGAGGCATTCACCAGAAGAGGACAACACAAGCACTAGAAGCAACGATAGC
TGTGTCAGTGAATTATACCTAAAGCCCAGATTTTGTCTCTACCATATTCTGTTAGAAGGA
ATCAGGACACATGGACATTGAATCTGGGATAGGAAATATGCCGGAAAACTGGAGACATCT
TACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGGCCACCTGTAGACTATGAGGTTCTCTAGACTTTGCCTTTC
TCCACAAGGTCAGCTGTAGACTATTAGGCGACCAGCTTGTTTCTCTTCCCAGGACCTTCT
CTCTTTCCTCATGACCAAGCTCCTCTGTGTGCTGACTTCCCAGGGCTTCAGCTCAAGACT
CCAGCATTAAAACTCCAACTCTGCCTTTGCTATGTCTTTTATCTTTGAATCCCCACCCAC
TAAGGGGCGGGGACTCAACACCATACTGACTGCGGCCCAATCAAAGTCCTAATCGTAATT
TTATCATGTCCAGGTACAGGCCAGTTTGCAAACATAATCCAATATCTATTTTTGGAATTC
ATGAAACATATCAAACTGCTACAGCATCCAAGATATAGAAATCTTTCCTAAAAGTTAATT
TCTATACAAGAGAAAATGTCTACTCTTTCAAAGAAGGCAGGAAAGGTCATATGAAAGTTT
GTCAAAAAATTGCAAAAATATTGTGATTTATGTATTGTGTTTGAACTTACCAGGATATAT
GACTCAGTTAACCAAGTTTAGTATGTCAGTAATCCTGTGAAGTACTGGCTGTCCTAAGAA
GGTTAAAACATTTTGTTTGCTCTGTGAAGAAATTATGTAGGATTGCAGGTATAAGAGCAA
CAAAACCATAGTTTTTAATCTTTATATTTTTAGTAATGATCGACATTATTCTTAAGTATT
TTGATTCAGTTATTAACATTATATTTAGGCTGGACAAAACAATTCATTATTCTATAATTT
TATTTTAAAAGCAAAATGCTGATTGTTGTTTTCTGAGATCCTGTGCATTTGAGGCACATA
CTCATTTCTATAACTGCGTAAAAATGTTCTTAAAACATTCCTCAGTTAACACTTAGTCAT
CATTTGACACCTCGCTGGATGATTTGAGGCTGAAATTCATAGATGATTATTTTATCTTGG
AACCATTGTATCTCACAAAGCTACTATTACATATGGAATGGCTGTTTTATTGCTGATATA
TGGCAGTTCCTTTGGAGAGTTGAATAAGGAAGGATTATGGAGGGTACTTAGTGTAATATC
AAAATACAACAAATCATCTTGCTCTGCTAACCACTCTTCTGTACTTACTGGACGTGAAAT
TGGCCGTATTCATTTTAAGAAGCCTGCCCAAGTTCACCTGCACTGCCTAGACCTTGCATT
CATTGACTCAGTTATTCAAAATAGTTATTGACTTCCTGCAATGCTTAAGTCACTGTACTG
AGCTAGAAGGAGCATCTACCTCAGCCTTAGGGCATCAAGAGATGTTACCAGAAAAAGTGG
CATTTAAAATGTGAACCAAAATGGGTAGGTGTTAGCCAAGTAGGAGGAGGAAAATCATTC
CAGGTCAAAGAAATTGCATATGAAAAGTCCCAGAGGTGGGAGACACTATTGCCTAGTTTG
GGAATTTCACGTGGCCTCGTAAGGGTGTGCAAAGGAGACAGTGGCAGGAATAAGCCTGGA
GAGTAAACAAGGCGCCAAATTTTGGGGGCCTCCACGCCCTGCCAGGGAGTTTGTCATTTA
TCCTGAGGGCATTCCTGGAGAATGACATGCGCTGTGAAATGATCACCCTAATTGAAATGT
GTCAAAATTGCTGCAAGAGAAAAATTGGAAGCAGAAGCCTTAGTTAGCTAAGAGGCTGTT
ATAGTAATTCAGATAAAATATGATGGGGGCCAGATAGAAATAGGAGCATCCCTGAAATAA
AGAAGCCTGGTAGAACCATTGACTGAGTGGTGGAATGGATGGCTGGTATGTGAGAGGCCC
CTAGGGAGCTGGCTTGGACAACTGGGTGGATGGTGTAACACTGAATGAAATGGAAGATAC
AGGAGTATTAGCAGGTCGGAAGGGAGATGATTCTAATGTTTGACATTTCAAAATCAAGGT
GTTTTTGTGATAGAAAATACGATATATAGCCAAGAAGCAATTAGATATGTAAGTTTAAAG
CTCATTAGAAATATCTAGTCTGACTTTATTCAATTTAGAGATTTGGGTACATAAGTGACA
ACTGAAGTCATAGCAATGGATGAAATCATCAAGTTAGCACATGCAAAACAAAAAAGTGAC
AAGAGCCAAGTTTACAATCACAGACACTAACATTTACTGAATTGAAAAGGAAAGAAGGTT
TCATGAAGGAGAATGAGAAAGAGTAGCTATAGAGGAGGAGAAATCAACAGAGTGCTATCA
GAGAAGCAACAGAAAGAGAAAATTTCAAAGAATGTGGCTAGAGATGTCAGCTGCTACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTAAATTCTTAAATATTCAATGCCAGCCAAAGGAAGGAAAGATTGAAG
ATGCCAGGAGACCAGGAGGGAAGCAGAGAGCAGGTGACCAGGAAGACCAGGTGGGAAAAG
CCCACCCCCTTTGTAAAGGACGGGTATAAAATGTTAAAAGGGATGGGAAGTAGTGCAGGC
AAGATGGTGAATGGCTTGCCAGGAAAGTGGAGGAGCACCCAGATGAGGGCCTTCTTTTCT
CTAAAGTAGGTAGCTTTCTTCACTGAGAGCAAGGCAGAGACTTAGAAGGTTTTAGATAGG
TACCCCTGTCACACCAGGAAACTGGATCCATTTTTCACTAAGTTATAAAATGCATCTGTA
GATGACACAATATATTTTCTAATATAGAAATAGAAATGTTAAAAAAAAGTTCTAAAATTC
ATCATGGCAACATCATATTTTCATCCCAGATAATGTCATCAAATCTCAAAAAGAGTTACA
AGAATTTTTAAATAGAAAAAAATAAATAAAATCTGTGGTGTGTCTATGGTGGAAATGACT
TCACTTATAGTTTGTCATGAAAAACACAGGTACCATCCCCAACATTGTCTGGCCATCAGA
AAATACATGAAACATAGCTACATACTTCTTGACTGAATGAATGAAACAAAGGACCGGTAC
ATGGAATGCCTTTCTAATGTGTTCATTAGAAAACCTGTAGAGGTCAGCGGAAAATAAACA
TCCCAGCTGACCCAGTGATCAGTTCACTGACATGTACATCTAATTGGTTACTTTTTTGCT
TTTCAACTTTTCTTTTGATGTTACTTAGAAGAAGTAAGTCACCCTTCTGACCTTTCCAAA
TCCTGTCTTATAAAATCAAGCTTAAATCTAACTTCAAATTCCCTCTATTTTCTCTCTCTC
AACACTCAAAGCCAAGGGTCACTTCTCCGCTCAACAGTATTCAGTATTGTACTCTTGCTT
CTTATTTGTCAACTTTTTTTTACCTAACATGGAAATAAATTCCTACAATGTAGGATGTTA
TTTTACCTTTTCTAACCCCTCTTAATTCTTCCATTGCCTATTTCAACGGCTTGCATATGG
TGGCTCATAATTCCTTATTGTAGTAATGATTACTATGTATTAAATGTCATTCTACTCTAC
GAGAATTTTGATTTCAAAACTCTATACATACTGTCTTGAAACTATCCTCACTTCTTTATA
TAAATGTCCTAAAGTAATATGGCCCAAGAATCTATTGTTATCCAACTAGGGAAAATAAAG
CAATGTCCTGAGACTGCTAATTTCAGACTGTTCTCTGTAGTTATTAAATTAAGATCCTCA
ATGTGTAACTAGCTTGAACTTTTTTGGCTGTTGTTGTGCCTTAAAACGGTTATCCTTTCC
ACATGGTTTGACTTCAAAAACTGCTGAGATCCCACTATTTCTTGCACTTTTTCTAGCACC
TTATAAAGCTAAAACCTGGGAAGAAAAGAAACAGAACCTTTCAGAGGATATAATAAAGTA
TAAACATTCTTGAACTCTATTTCCCCAATCTAGAGTAAGAGGAAAATTTACAGAGACTGC
TGTAGAGAAAAGAGAAAACTTTTATTGTCAGGGTAGCTACAATGACATCGTACTAGTTTC
TCTAGTGAAAAAGCTTCTTAAAAATATTTATATCAAGAACTGAGTTCTCAGTCCCTGATA
AAATTTGTGTGTCTCTGTGTGTATTCACACACATGCACACACACTCAGAGGTGGGGTGCT
GCATGGAAAATCATACTCTACTGTCCTTGAAAAACAACCACCACCTTTTTTTCCCTTTTC
CTTTGTAGAATTGTCAACACCACACTGCTGGTGACTTCTGTGAACGATGTGCTCTCGGAT
ACTATGGAATTGTCAAGGGACTGCCGAGTGACTGTCAGCGATGTGCTTGCCCTCGAATTT
CTTCCAGCAACAAGTAAGATTGAGAAATATAACCATATTTCCCAATCAGTAGTGCCATCT
GTCTATACTTGGGCTGTCTCTGATTTGGCTATTTTTTTCCAAAGAGACAACATTTCAATT
TAAGATACAGATTTTTCAGTAACATAATAAGATGGCAGAAGTGAGAACATAAAATACTCT
ATGGTAAAACTCTGTCCTAAGTCAACAGCACTTGTTAATTAAAATGTATTTATAAGATAT
TATAACAGAAAATGTGTTTATAAGATAAATGATATCTGTATAAATGTCTATAATTTCATA
AAAATATATATAGGTCTACAGTTCACATGCAATTCTGCCATAAATCCAGGTATGAAGGAT
TGTTGGGTGCATATTATATCACTTTTGTGACTGTTTCTACATATTATGTGTGTTTGATAG
AACATTGGTAAAAAATTATCAAGAAAATAAATGAAAAAGAGTGGGATTAAAGCAATGTAC
TTCATTGTTATGTTCCAAATTAGAGTAGGCTCTCACAGAATCAGAGACCCCTTTCTATTA
AGATCACCTGAGCTTTGTACCATGAAAACACAGCCATAAGGGGAAACAAAAGCTGGAATA
TTTTATAGCAGTGCTGTCTGAACATTCTGCATTGGTTTATATACTGATGAACACCCCTAA
GTGTTTTCATTTACCTCTTCACTAAGCTGTTTACACTTTCTTTTTAGGGAGTTATAAACT
TTAGTCTCTAGATGGTAAGGCATCTTTTCAGAGTGTGTGGCTTTTGAATTCGCTTTTGAA
AAGAGTGTGTGGCTGTTTGCTCAGTATTAGAATCCTAGACACCTAACCTTCAATATAAAC
GAGCCACCAAGTAATCCCAATACAGGGACCTGTCTGTCTGCATCTACTCGGTTGTCTTCT
TTGCTTTTGGCTTTGTATACATTCTGAAAACATTTTAGACTAAATTATCTTCCTTTCCTC
TCCTAACCTCCTCTTTCTGTTGGTCAGAATCACATGCTTTTTATAGGGTGTCAAATGTAA
ATTTTTAGGTAACTTGAATATTGCTGAGGAAAATATGCCTGGTCCCAATATTCTTGCAAG
CACTAAGTGGCAGGTATATGAAGAAGAATTTTTTTTTAATCTTATTTTCCCTAATCTACA
GCTGATGTCCAGGCTTCAGTAAGAGACAACTATTATTATTTTTAATTAAATATTGAAGCA
TTTGGGTTACAAAAGACTGATAGTTAATTAATAATTCCCTGATGAGTGCAAGGCTACAAA
AGATATAAAAAAGAACAGACCATTTCTTGGAGAAGCTCACTCTAAAGCATGTGTCTTAAG
AAAATTCAACTTAAAATGTAGAGACTCCAAAGGCACAAAATAAAACAATTTAGAAAGATT
CAAAGACATATTAAAAGAAGTAGTGTATTTATAATAGATCATAAACAATGGGTTGAAGAA
TTTTTACTGGTAGAGAAAATAGGAAATTATATGAGCACAAGTTTAAAGAACAGAAAATAC
AATGTGTGTGTCTTAGTCAGTCAAAGGGGTGCTGATGCAAAATACTAGAAATTGGTCGGT
TTTTATTAAGGGTATTTACTTGGGGTAGGAGCTTACAGATACCAGGCCATAAAGCATAAG
TTACTTTCCTCACAAAGTCTATTTTCATGTGTTGGAGCAAGATGGCTGCCAATGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNACAGAGCCCATTTGCATGATAGTTGACAGCTGACATTGTGAGAG
AGGCAAAGCCGTAGGCATCGTCATAGTCCACAAGCTGACCTTGTGGAGAAACAGAGGACC
TGAGTCCAGGGAGAAGCAGGACCTGGGAAGAGAGGAACCCCGGAAGCCTGAGCCCTGGCA
GACATCTGCAGCCATTTTGCTCCAACACATGGAAATAGACTTTGGTGAGGGAAGTACCCT
ATGCTTTATGCTCTGGTATCTGTAAGCTCCTACCCCAAATAAATACCCTTTATAAAAACC
AACCAATTTCTGTTATTTTGCATCAGCACCCCTTTGGCTGACTAATACAGAGAGCACATG
GAAAGAAGGAAAGGCAGGGCTCACGAATTTTGGAAGTCAGAAAGAAGAGCCAAGCGAGGG
GCAGTTGGGGAGGCAAGAGAACCAAGGCCACACGGAGTCACAGATACCACAGGCAAGAGG
AGTGGCCATGAGCAAGCATGCAGTCCTGCACAGAGGTCAAGGGAGATGGAGCAACTCTGG
TGGCAATTAAATAGCAGGGTGAATTGGTCAATTTTGACAATCAATAGTGAAAGCAGCCAT
TAGACTGCAAGGGTGTGAGTTGATGGTTTTAAGACATTTCTAGATTAAAAAGAAAGAGTA
TTATCTTGATTGGTTAGCAATAATGAAAGCATGTATTCTCACTTTTGTTTTATATGATTT
TTGTAATCTAAATATATTTTTATGCAAAGGATGCTGTAAAAATCAAAATATCCAGGACTC
AAATCAAAGGGGCTAGTTCAGTGATTTTCAATCTTTATGGAGCGCAAACCATTATAAGAA
ATACCTTTTTACATAATGACCTAGTACACAAAAAGCTGTGTGCGTCTATCTGTCTGATTC
ATACATCATAGTTAGATAACTATCCATTCATATATATGTGCTATATGTAATACAATTAGA
TAGATAGAATTGCAACAAATTTTTCAGGGAATAAACTTTTACATTATGCAAATTTAGTTA
CTCTTACTTAATTTTTTCTCATATATATGTATTTAAATTTAAATCACAACTCACTAAATT
GATTTCATGACCCTCTAATGCCACTTAAAGCCTGCAACATATTGGTCTAATTAACAAAGG
AAAGGGCTCTGTCTAGTGGAAAGGAAGAAACTAACCAGAGCCAAGAAAAGAGACACTCCT
TCCTGAGATATAAAAGTAAATTCTGAGGTATAGTGGGGGAGGCTGAGATATTTTACTTCA
GTGACTTCAATCTGTACAGTCGAGTAAAGTAAGAGGTAAGGAGTGGTGCTTAGTAACTTG
CTTCCAACGCATTACTTCAAGTCTTCATTATCTCTCACCAAAGCAAATATGGTCAACATC
TTTAAACTGTGGAAGTGCAGTATTGCTCACATACTCAGGGGTTTTCCACTGCCTGTGAAG
GAAAGGTCAAGTATTTTAGCAGAGAATAAGAGACCCACAGCAATCTGACGCCTACCGTCC
TTTCCAGGCACACGGCCCTCTACGACTTTCTACAGTGAGTTTGGAGCTACTTGCTCTTCT
CCAAAAGAGCTCAGCCATCTTTGCTTTTGTTATTCCTTGACCAAAATCTCTATGAAACCC
ATCAATTTTAAAGGTCCAATTCTGCCACAAAATCTTCCCAAGTGTAGCTTAATTTTTTTC
TACTTTTAGTATAATAATAACACACTTTACATCTTTATTTCAAACAAATGCTATTTCAGA
AATTGAACATTTACTCACTAGTGGATCCCAATACTGTAAACCAAAGAAAAAGCACAGATA
TCTATCTCATCCTATATTTGTATGTTTCTATCTCACATAGAAAATTGTAAATTCTTTGAA
GTTTAAGATGTTATTTATTCCTTTATCCAATAACTATTTCAAGAGAGCTCAAACCTATGC
CAGCCATGGTTCTTCATTCTGGGAATATACAAGGAAACAAAACAGTCCAAGGTTTCCGCC
CTCCCAGAGCTTATATTTTGAATAAGGAAGTCAGATGTTAAATAGATATATACTATAATG
TCAGGTAGTGACCAATGCTACCAGGAAAAATAGAGGAGGCTAAGTGTATTTGGAGTGACC
CGGGTACCATTTTAGATGGGGTGATCAAGGAATATCTCCACAAACAGGCAGAGTCTTGAA
TGAGGTCATGGGGCAAGCATGTGAATTTCCAGAGGAAGAGCAGCCCAGCCGAAGGGAACA
CCAAGTGCATTGGCCCAAGACAAGCCCATGCTTGGCCAACAACCAAAGGCCAGGTGGCTA
GAGAAGAGTGAGTGAGGGGAAGGTGGCATGAGATGAGGTCAAGGAAGCTCCAGTGGATAA
GCCAGGTCCTGGAGACTAGATATAATAGGAAGCCATTGGAAGATTTCCAGCCAGAAGCCA
GATAATAGTGATGGAATCCAACTTATTTCTTTAAAGGCTCACTCTGGCTGCTGTACTGAA
AGTAAACTGAAAGGGTACAAGGCAAGAGACGGTGGCAACTTGGTTCACCAAGTTGGTTCA
CTAACAGCATTGTAATGCAATGCTGTTAGTGAAGGTTGGCAGAATATATGCTGAGCGTGA
GAGAAAGGAGACAAATTTGACTCCATGGTTTCTTTTGGTAGAGCTAACGGAAGGAGGCTT
TGGCCATTGACTGGGATGGGGGAAACGAAAGAAGGGGTAGGGGTGTTTTTTGGAGGGAAG
GGGAGGTTATTTGGAACTCAGATTTAGATCTAATTTTGAAATGCTTACTATTTATTGGTG
TAGAAATGCTAAGTATTCAATTAGATTTAAACCTGGAACTCGGCAAGAGAAAGATTGGAG
ATATAATTGAATGAGTTATCAAGATAGCTGTGATATTAATATGTAAATCCTATAAGACTG
AAGGAGGTCATTTAGAAGAGAGAGAAGAGGGGAGGAAGGAAAGGGGGGAGGAGGGAAAGA
GAGAAGAGGTTCAAAAATAGTACATTCTGTATTTCTTAATTATGTTGACTCTAGAGTTTC
ACTTGAAATGTCTAAAATCTGTTTCCAAGTGCCTATACATATATGTGTGTGTGTGTGAGT
GTGTGTGTGTGTATACACAGGCACTTAGCATCACGCTTTAAATCAGAGTTAAAAACTTGG
CAGAATTTGTCAATTATATGTTTGGGGGTCTATTTTTGTGAAGGCAAAAAATAAATTTCT
TGGATAATGAGTTTGTGAGTAGTAGATCAATTTGTTCACATATTTCCCAAAGATTAGAGT
TGATTACTCATTCAGTGCTTTATTAGTTTTACACATTAGAAGAGAGTTAAAATCGTGGCC
TAAACGGCACCTGACTGATAGAAGTTCTGGCTCTGGCCAATCCACCTTATAGTCTTTTCA
AGCATCAGCTGATCAAGCAGGCCCAGCAACCTGTATAATGGTGTTTGTAATATTACACCC
ATTTTGCAACCAATATGTAATGTTTTTTTCCCTCCTAAGTTTCCAGTACACCATGCAGTT
TTATCTAGTGGAAATGCAGCACTGCTTACATTTGAGAGGAGTTTATAACAAGCCAAAACC
ACAGGATAGTATAGATTAATCTATACATCTTCTCAAGTCTATATTTTGTAGAATGAAATA
ATCAGAAATCCTGGGGCAAGGCACACTTATGGCCTACCAGCCTTGTAGTGAAAGCACAGG
GCATGTTATATGAGAAAAGATCATAAGATAGTCAACAATTCTTATCCATTTTCATTTTAA
AAGCTTCCTTTTCTTTCCTCACACAAAGTCATATTGCTTCGTGTTTAAAGTAAAATGTAG
TCTGAAATCTGGATGTTAATTAGAAAAAGCACTCTTTAATTTAAATGAAACATTATTCAT
ACTTCATGTATTGACCTGCCAGTGGCAATTTGGGCTGAATTTTCAGAAAAAAAAGTATAT
AGTTTTATACCTTTTTTATTGCCTGAAATATGTTCAGTAATACTTATTCAACCATCAGAC
ATGGGTACATGAATTTTAGTCAAGTTTTTTTTTTGATGAGTGAAAAATTAGATGTTTAGT
GTGATACATCATTCAACAAATATTTCTATATATACTGTTACTGAAAACATTTAATTGTGA
TATGCTTCCCTTGAATAAGAACTTCATGAGTGGTTATACATATAGCATTTATGGTCACCC
AAGAAGAGGTCCCAGGCACCTTGGTAATGGGTAGAAGAAGCTATTCCATAAATGAATAAA
TTAAAAGATTCTTTGCCATCTTTCTTTTTCTAATTCAGCTTCAGCCCTTCTTGTGTGATG
GAAGGACCCAATGACTACCGCTGCACAGCTTGTCCACAGGGATACGAAGGTCAATACTGC
GAAAGGTAAGAAGGGCAACGATTCATAGATAGCATACAGTAAAGGGTCGCATTAGAAAAG
TGTTCTTTACTTTCATTATTTCATGTTCTCTGCATGCCAAACTATTTTTATATCTGTAGA
CTTCCCCCACCAAAAACTGTTCTTTACATCCATCTTATATTTTGACTTTCTCGAAGAATC
CAAATCGGTTCACAACTATTGATATCTAATATGTGGTTCATAAGAACAAATAAATCAAAT
TTATTTCCAAAAGCTTAATCAGTAGTTATCAAAAATAATAAAGAGCTGATTACATAAGAT
TATTTTAATTGATTGAAAAATATTGTCCAGCAATAACTGCATGCAAGTCACTGTTAGAAC
ACTAAAGCACTATACGAGAAAATGTATAGATAATTCAAAATATAACCAGTTGTAGGCATT
TTTAATTAGTACAACCCAAAGTATTTGCTGTTCAGTTATCCTCTTCAGCAGGCAAATGAT
ATTATTTGAGTACTTCCTCCTATCATATTTCTTACAATATCTGATAATGCATGTATTAGT
TATTAAAATGAAAAGTGCATTAACACAAATGGAAAATGAAGGAATGCAAGTCCAAATTTA
CTGTCTAGCAGAGTTTAATTAATACCTTCCTGATCCATGTTTTCTGTAAGATACAGCATC
CTGGGTATTCAAATTTATTGCCATCCATTTTTAATACTTTTTAAGATATTATCTAACCCA
CATAACAGAAAAGTATTAACATTATAAACACATGATAATTATTAGCATAATAGCAGTATA
AAACTTTTTTCAAGGTCCATGAACATAACCTAGTTCCACAAACTTAGCTGGGTTCAATCT
TTCCATCCATAATCCCCAGAATAGCTGGTGCTCCACTACTTAACAATATCATTGTCAAGA
TCAAGTGTGTAAAGGACACTGTTGGTACCCTGCCCGGGCACCAGTACACAGCCCCCTCTC
CCATAGGAGGGTCACAATACCTGAGCATTTACACCTCTCCTCTGGTGGCTCATAGTCCGA
CTAACTGGTGGGAAGTACAAAAGCCCCATTCCTTTGCCCCAAAGCAGGACAAACTCAAAA
ATGTTATTTGTTCTCAAGAACTCTCTATGGAATCAGACTAGGAGGCTGGAATTCACCTTA
AAATTTCCCCTTGCTTGGCTTCTCTCTTTGCCGTGCCCTGCTTCACCCGCTCTTCTATTA
GATTCTCTGGGAACATTTCCTTAGATTATGAATCCCTTTGCAAATGTAAACCAATATTAA
TTAATTTTATCATCATTCACTTTAGAATCTTCCTTTAAGATACTCACCAATGGCTATATG
AATATTGGCACTAATGAAGTAAATAGAATTTTTAAAATTCTGATGTCATCATAGGCTCTG
TATGGACATGGCCTCTTTAAGTTTGCAAAATATATTTCAAAAGATATCTGAATGTGGGAA
CTCTAAGCACAGTCTGACATATATATGAATATAACAGTGAAATCACATTAGCAGCAATTA
AATAAGCCAAAGCAAAAAGAAATCCAAAAATATTTCCATTTGTATTGCATATAATATGCT
TTTGTATTTGTGCTTCAGCTAAATATTCATTTCATGCCCTTGTAAACACTAGTAGGAGAT
GACTAAATACATCCCTGGGCATCAAGGGAATTAGCTGCTCTAATTTATGGGGGGAAAAAG
TTTGATAGTATAGCTACATAAATAAATTGGATTTACCACTATGAAAGAAAGCATGTATAT
TTGAGAAAAGACTGAAAGGTTACACTGAAATGACAGTTACTGTCTAAAGGCAGGGTGATT
ACATGAAATGCATCTTGTTGACTGTCCGTTAATATGTAATCAAGAGTTGATAGTTTATGT
AACGTAGAGATGAGCTGGGACCATTCCCTAACAGATATGAATGGCTTGAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTCTTTTCTAACCAGCA
CAGGATGATTTACTTTCACAATCAGCCATGCAACTTGCCACAATCCTAGGTCAGCAAACC
TGTCCAGGATTATCTGGCTGATGTTTATAACTTTTGATCCCAATCCCCCAACTTCCTCCC
ACAGTCACCTTCTGAACAAAATTTTGACTGTTAGTCTTCTATAGGCTGTCCAATCTGGGA
TGCTGCTGAGAAAGACAGGAAATGTTTTTAGTAATTAAATCAGAGCAGCAGAAAACTGGG
ACTGTCCTGGGCAAACCAGAGTAGGTGGCCATGCTAGCTAGTATCTCATGAGTTAACAAA
CTTCTGGGGCCATAACCCATAAGAGCGTACACTTAAATGAATGGAGGGGTGGATGAGTCT
AAGAGTAGAGTACATTTTGGCTTATCCAAAGGGATGTCCTCTGTAATTTTTCTAATTGCT
GTCATACTACATTTAGTTCCATAACATTAACCATCTTCCATGGCCACACAACGAAAAATT
CATTTTGAGGAAGATATGGCAGAAAGAAAAAACCAATAAGATTAAATGGAAAATGTAATT
ATCTTATTATCACTTCATTTGCCTCTTTTTCCTCATTAATAAATTAGTAGGTTGTATTTT
TTGGTCATTTTGATTTCCAAAATGCATGAGTCTAGGAAAGCCCAGAAGCTAGTATGTAAT
TTTATTCATCTCTGTTTTTTTTTTTAAAGGACTTTAAAAGAAAAGTTTTTGACCTGGAGC
AAAGTTTTGACTAGGGTCCATGGTCCAAATTCGGTCCATGGCCTGATCTTATGTGGCACA
CTGGCTAAGAACAGATTTTACAAATAAACATTTACAATCAATTTGATAGGAATACTTACT
TTGAACACCAGTTAAGTATAATATGATATTGCAAAAAAAAAGAATTCCATTCTTCTCATT
AGTGGATCAGTATTGAAAAATAATTTACCCTCAACAATTATGTTTGAATTCCATCAATAA
AAAATGTGTGAGAATTTGTTTTTCTCCTGTTACATGTAAGTACCTACACAAAGCCTCAGT
TTTGCCTCTTGGTCTGCAAAGCCCAAAATATTCACTCTCTGGCCCTTTACAGAAAAAGTT
TGCTGACCCCTGATCTAACAACTCTTGATGCCAGCTTTGTTTCATTGAAAACAAGCACAC
ACATGTACACACACACACATTACTGAGAGACATGATTTGTTATTAACCCTGTTGCTTTGT
CTGTTCAAATCCAGGTGTGCCCCTGGCTACACTGGCAGTCCAACTAGCCCTGGAGGTTCC
TGCCAAGAATGTGAGTGTGACCCCCATGGCTCGCTTCCTGTCCCTTGTGACCCTGTCACA
GGGTCCTGCACGTGCCGGCCCGGAGCCACGGGGCAGAAGTGTGACGGCTGCCAGCACTGG
CATGCGCGGGAAGGCATAGGTTGCGTTTGTACGTATGCTAACAGCGTTAATTCTGGGGGG
TCTCAGCTCCCTGTCTGTCTCATTTAAAATGAGAAACACTGACTTTTTTTCCTTCTTCAT
TAGATAGTGCTGCTCTTCCTTCTGGCACTCTCTCCACCTTCTGCTGTTCACCTGTTGTTC
TTATCTCCATGCAGCTGCGCCAAACACAGCCGAGAAAATTCCCAGCATGCTTCAGTCAGG
TTACTGGAGAACTACAACAAATTTCCTATTTATTTATTTTTATTTTTTATTTTTCCCAAC
TCAGGGCTTTCAGTTTCATCCAGAGTTGGCATTGCCTTTGTGATAGATTAAAGATCCAGC
TATATTAAATGTTTTAGAATCTTCCTCAATTTATAATCAGCTGGACAACTTATGCCCGAA
TTACAATTTATTTGTCTTGCCCCGGCTCTTATAGAAATCCATGGGCATACTGCTTCATTA
CTTTCTCTTGAACTACCAAACCTGGAAGCAGTGAAAATGAACTCAAGTGGCTTTACTCAC
ATGTAGAATAAATGGAGAGCCGTTTGCTCATGTTTTTTAACTACTTCTGGATTCAGTGCT
GTCATACTGAAAGTACATCAGATATCCACAGTGAAATATAATTATTGGATATTCTATAAA
TCTTAATCTAAAATAGGTTATTTATAAATTTAGGGAGAAAGAATTAACTATATTATTTTT
TTCCTTAAGGGAATTTACATTAGCAATCTTAATTATTTTTTTTAAGGAGGTGCCCGGGAT
TGAACCTAGGACCTTGTACATGAGCAGTAGGTGCTCAACCACTGAGCTATATCCACTCTC
CAATGGGAGTTGTTTTTTTGTTGTTGTTTATTTTTAGGAGGTACCGGGGATTGAGCCCAG
GACTTCATATGTGGGAAGCAGGCACTCAACCACTTGAGCTACTCCCGCTCCCCCTTAAGT
CTTTGTAAAAAATAGAAATCTAAAACATTTTAATATCTTTTAATTCCCTATTTTAATATA
TTAATAGATGTTGTATTTCTGGTTTTAACATCCTAATATGTTTGTATATATTAACAACAT
TTTAATTAGAAGAATCCTTGCTTGTGCTCTATTTTTTTTTATGAGTTAACTGAAAAGCTA
AGGCTGACTAAAGAAATTTGCCAAAAAGTTAGGACTGGGAATATTTGGGGAAGTAGGGTT
TATAAATTTATTTTAATTTTAATCACCTTTAATGATACTATATTTTATTAAAATAAATGC
GCAGGATGATGGGTAAGGAGAGATTAAATGTAATATAAAATATTCATTTCCATTTTCATA
TTCTGCTCTTGGTATATACATATTTACGTTTCCCCCAAGTACAATGGCATATTTTCTTAA
TAATTAAAGAGGTGTACTTTAGAGTAATCCCAACTGGTTTTAATGTTATTTTCATGTTTA
ATTATTAACATGTGTATACTTAACTAGATAATATATAGATATTCCTAATTTACACACAAA
TAATAATAAACCATCCGCTAATTTTTAAATCATTAATTTATTAATTATTTAGAAACAAAT
TTAAAAAAAGAAGATCCATGTTTAGTATGAAGTATAAAAATTAAAGAATGACACATCAAA
ATCTGGGAAAGGTAAATGATGGGATTGTTTTCTGAATATTCCTCCAAAGGGAATAATCAT
TCTGCATATCAATGTTAACTTTTTAAAAAATATCACTGATGACACTGTTCTTCCTATTGA
TTGCCAATCTTTATATTCATTTTAAATACGTTTATAACAAGAAAACAAAGCTTTTTCCCC
CTGTCTCATCTGTGAAATTCTAATCTCCAAGTGTACCATGTGATATTAACAAAAGTGCTA
ATTCTCCAGTTGGGGTGCTATAACCAGCCTGGTAAGTGTCGCTGCATTATTCTTCTCCCA
TAGGGAAATGTACTTCCAACTGCCATGCCCCCTATCCAATTCAGGTGCCATGTGCTCAAA
ATTTTAATATTCTTCTGGAGGATTAAATAGTGATTTTTAATCTACCAAAAGTGTTAAACT
ACAGGGTTGCTTTTGATACCTAGACTCTCTTTCCAAAGTGCTATAATTATTTTGTAATTA
TGCTGTATAGATTTTCCTCACACTGCTCTTAAGCTTTAGTGATTTCCACTTCTAGGAATG
TTTTCACTTTACCTTTCATTAGGTTAAATATAAGAATTATTACTCAGAATATCTTAATAT
TGTCTTCTTTTTTTATCTTTTAAAATTTCTGCTGTTGTGGAAAAATATGCCATGGGTCTA
TTGAGTTGGCCTTTCTGAAGATTCAGTTTCTGCTCCTGGTTTTGAAACACGGTAGCAAAA
CAAGACTCAATGAAGTGAAGACGTAACTCTAATCTAGCCTTAATCCTCTTTTAAATGCAT
TTCTCTAGTCTTCAGCTAAATCAAAGTAAGAATGGATTCACCTGCACATTTGAGCGTCAA
GGCCTGTTTTTATCACATGTGATCCTAGTGGAATTTTGTAAGGCCTGGGGCGGGAGTGGG
GGCAGGTAGCTTCGCTCAGCTTCTTGCAGGACACAGGTATTTCTTGTACATGAGGTTTCT
ATTACTATAGTGAAGAATATACACAAATAATCTCTGCCCTTAATAATTTACACTCAATAG
ACTCTCATAGTTGATCAGCCAAATTCAACTCCACTAAGGGCATCTTTATCTCAGGAAGCA
GAGTCAGTGCCTGTTGTCCATAAGCAATCTGCCTGTTGTCCATAAGCAATCTGCCTGTTG
TCCATAAGATTCCAGGCATTCCCTAAAGTCCCTTTCACTCACATGTGGGTTAATCATAAT
ACAAAATGTTATAAGGCTCGCTTTTATTGAAAGATGATCCTTTGACAGGCACTGTATTAA
GAACTTGATATGCTGTTCATTTAATTCACACAGCATCCCTCTACATTATTACCTTCACTG
TGATAAGAAAACTGAACTTAGTCTAAGTTTCTTTTCAGGGTGCTGAGTGAAGTTTTGGCA
GAGCCGTGATTCGAACTTGGTCTGTCTTATAAATCTTTTATTTTCTTAACCTCTATGCTG
ACAGCCACTGCCCAATATATTCAACATTAATTTGAAACCAGTATTTTGTTCATTTACTTC
TTTTGAGCTTAGGGCATGATTTACCTTTACCAAGAATCAAGATAAAATGGATTAAAAACA
CAAAATGATAAAGTTTCAATATAAGGGCAAAAAGTGCATGTTTTTCTACTCACCAGTGAG
AACCTCTTCCCTCTAATTTAAATCATTTTGATAGTCATAATACATTCTTGTTTATCGGCG
ATTGTCAAATGGAATCCTATCCTCTGTGCAGATTTCTTTCACTGAGTGCCCTTTTTTTTC
CCCAATAGGAATTATTTGGGACAGCTGTACAATGGGTTCTTACCTTATATATATTAGTGA
GTTCTCTATAGATCTTTTACTGGACCTCCCAAATCAGCATTACTCTTTTGGAAGTTAGGT
TAATAAAATTTCATCATCCTATTTCAACTCTCATTCATAATTTACATGTCATTTTATAAA
ATAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCATATTAAAATATGTTACTCTCTGAGAGAACAGAAATTAAAATTAGTAGCTGTTGG
CAAGATGTTATTCCATAAAGAGTACCCAAAATAGTGTTTTAAAAATATCAAAGTGCTGCT
TCGTATATTTAATCACTACATATGAGGTATTGGGGGTATATCAATTTTATTATTTGTAGA
CACAATTTATTTAAAATAAGATCTATAGAGTGATGCTTTGCTTTCTAGTGTTGCAAAAGT
GACCTTGAATGGGTTTTCACTTAGAATTTAAGGTATGCCTAGCCAAATGGGATAATTCAA
CTTAGGTCTGTGAGATATGTACCTTCCAGCTACATGATGAAATCTGAAGTCTAAAGTGAT
GCTGAGCCTGTGGAGACACAATCAAGATTACTGTTTTCAATAGCCACTTGCTGCCAAGGG
TCTTATTACAATTATGCTGAGGGCCTTCTGTATCATTAAACACTGATGTAGATTGATAAT
CAGACGGTTACTAATGGCAGTTAGTACTTTTTATGTATGAGAGTGGGAACAAGATAGTGG
AAGGTGATTGATCATTTTGTAGAAAACAAGCCTTTCTAACCTAAAAGTTGAACGGAAAGC
ATCATTTGATCTCGTGCTTACATTTAAAGAACTCTGACTTGGCTGGACCTGTGGTCAGCC
TCTGTCAGAGCCTCTTACATGTTTCCTCTGTCTGGCCCCACTTAGTCCCCACATCCTAGT
TCCTATTCCAAGGCCAGTCTAAGCTGTGCCATGTTGTTCAAAGCCAGGCTTCAAGAAATC
TGTAAAAGCAACTTCAGCTCACACTGTTTGCACCTTTTTGTTCATCTCCTTTGTTAGTAA
GAAGTGGTTGAGTTTCTTGCTGTCGGCCCTCCTAGCGTAAGTCCAGGCTCACATGTTACA
GAACTCCTCGATCATTTTCCTACTTCTTGTGGTTCAACCTCAGTGGCTTGTAAATTGCAT
TGAGGAAGCTGTTCACTAGTGGATTAAGGAGCTTGCAGTTACATTGTCAGAGGCACGGCT
GATAACGGTTGCCTTTATTTGAGGGCAGCCTTCGTTTCCAGAGTAAACTAAACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCAACGGTTGCTAATACTTTATCC
TATGAATTGAAACGCGACAGGCTCTGATTAGAACCCACACTCTAAGTCACATATGTAAAA
CTCGAAAAAGTGTATCAGTTACCTATTGCTGCCACTGCAAGTTTTAGTGACTTAAAACAA
TAACCATCTCTATTTCATCATGGTTCTGTAGGTTGGCAGTTTGGGCTGGGCTTCATTGGG
CAATTCTTTTGTTGCCATACCTGAGGGGTCTCAGCTGGTCTTCATATCCTGGGGCCTCCC
TCCCTCCACCCATCCCTTCTTCCTTTTTCCTCCCATTATCTACTCTCTCTCTCTCCTCTG
ATTCTAACATTCTAACTTTCTGTCTTAGCTTTCCAGGGCTGCTGCAGCAAAGGACCACTG
TCTAGCTGGCTTAAACAACAGAAATGCATGGTCTCACAGTTCTGGAGGCTAGAAGTCCAA
AATCAAGATGGCAGCAGGGCCATGTTTCGTCTTAAAGGGAAGAAACCATTCTATGACTGT
CCCTTTATTTCTGGTGGGTGGCTGGGCGTCCAGGGCATCCCTTGGCTTGTGGCAACTCAA
ATCATTCTCTGCCTCCGCCACATGGCCGTCTTTCTCCATCTCTGACTCTCTCTCTGGGTC
TAAATTTCCTCTATTTGTAAGGACAGAAGTCATATTGTTTGACCTAACCTTAACTAATGG
CATCTTCAAAACCTTATTTAAAATAAGCTCATATTCACGGGACTGGGAGTTAGGACTTAA
ATGTGTCTTTGTGGGGTGACGATTCAGTACATAACACTCCTTGATCCTCTCACCACCTTG
TGTACCTATGTACAGGCCGGGCTCTAAACAAAATTTCAGAGTCATCAAGGACTTCACCTC
TGAGGAAACTTGAGCTGAGATGGAATGTCTGAGTCCGGGAGTAAAGAGGGCAAGAAAAGA
ATTCTAGAAGTGAGAGATAGCAAGTGAAATCACCTTCTCTAAGGCCTTTCTTCCTTTAGG
ATTAAGCATCCCTCATGTTTAGCATCTGGACAAGAGGTTCTGAACCCTGGTTGCACAATA
GACTCTTCTGGAATCTTTTTATAATACTGATCACTGACTTCTACCACTGACCAATTAAAG
TAGATTCTCTGGAAATATGAAGAGAGGAGGACCAAGGTATCTGTATTTTATAAGTCCTCA
TATGAGACCAAGTTTGAGAACCACTGATCTAAAGTAGCACATTTCAGACTTCAGTGGACA
TGGATCCTCTGGAGATTGTTCTAAAATGCAGGTTATGATTTAATAAATCTGGGGTAGTAA
GGTAAAGCCCAAGATTACACATTTCTCATAAGCTCCCAATTGATGCCAATACTGCTAATC
CAGTTGCTGTGCAAAGTGTGGTCCACAAACCAGCACACTGAGTGACACTTGGGAGACTAT
TAGAAAAGCACATTCTCAGGTCACTCCCCAGACTTTCTGAATCAGAAATTCTGGGGTGCT
GTCTAGCCATTTGTGGTTAAATGAAGTCCTCCGGGTGATTCTGATGCTCGCTGAAGTTTG
AGAACCAGATTCTGGAACTTGGCATTTAGACACCGTCTATTTGGTGCCGAATGGGGTTCT
ACATTGCGTTTTCTGTATTGGATCGCGGCTAATGGTCTGATGAAGCTTCTTAAGCACTTG
AATTGAACTGAGGGAATGAGACCACAATACTCTCTTTCTTTTACTTAGTTTCCTTCAGAG
CAAGTCCTAATTCTGGTCAGAAGAGTAAGAGAGTAAGAGAGTCAGCTCTAACCAGTCTTG
AGCTTTTGCCTCCCAAGCCTCTTTGTTCACTGGGCCCCTGTGGTGCCGATACCTCGCACA
GCTTCTGTAGATGACACTGTACCATTGCCAGTGTTACCTTGGTAGGCTGATGTATAAAAA
GCCCATCTGTGGAAGTTTAATCCCTGGCACGGGATATTGTAACACACCTCTACTGCTGTA
CTATCAGATAAATCACCCTCTGTACTACTTCTCTTTGTTAACTACCTTCTGTAAAGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATTGAAAATA
TTGTAGGCTGACAATTAGCCCTTGGCTACTTAAAGAATAAAATTGTTCCTGGCCCTTAAG
AATTATTTAGCCACAGACTGGATAAGGTTAATCATCAAAGCAGGGATTTGTGAGCTGTGT
CTAATCATCAGTGATATGGTGCAGAATGGTTAAAGAGAAAGAGTTGGCAATTTAAGGAAG
TAAAAAATAAATATAATCCTGAGAAAAAAAGAACTTAAATTATATTTAAAACTATGTTCT
TCTTGAGGTTTTTAAAAAATTGATTCTGCTTATCAGCTGTCAAGCAAAAAAGTTCTGTTA
CTTTTGGAGATACATTACATGAAGTATGTGGATGCCAAGTTGCTGCAGACACTCTTCCGT
GCAATTTGATGTAGCACTGCGCACAATTGCCTACATTTTTAGACCCAGGAAGATTTTTTA
GTCACAATTCACAGGTTTCCTCTAGAGTGCTCATGTAGAGATTTCTGGGGCATGTATAAA
CTGTCATACTGTGTGTCTCACTTCTCCCTTAACATTCTCGCAATGCACTTTTCCCCCATA
ATCTGTTTGCTCCTCCCGTTTGGTCCTGAGGTTTGAATGATGCTCTCTAGCTCTGGTTCT
GGGTGGCAGGCATGTCTGCTCTCTTGTTGTTCATTCCTTCTCTTCTCGACCATCTTCCAT
TTGATCAGGATTAATTGAGATGAGGAGCATCGTCTCTCACAAAACTATCCGTAGACCGTA
AAATATTTGATAGGCGAACTCCTGCACCATCTGCCCGGAATGTGTCGCAGAAGTAAATAT
TCTTTGTCTCTTCCCTTTCACAGTTTGTGGGGACGAGTGCACGGGCATTCTTCTTGGGGA
CTTGGCTCATCTGGAGCAGATGGCCATGAGCGTCAACCTCACTGGCCCCCTGCCTGCTCC
ATATAAAATGCTGTACAGTCTCGAAAATACGACACAGGAACTGAAGGTAGGTTGGTGCAG
TCGCGGCAAGAGCCCGGAACTGGATGCCAGAATCTACCCACCGGGTATTCTTCATAATTG
CAAAGTGCTCTTTCCTCAGCCCCAAATCAAAAGAAGGAGCAGTTATGGGAGTCCAGAGAC
ATTCTCAACCATGTTTGAGATCTGGAATATACAGATTGCAATTAAGTGAAAAGAGTCTCA
TGAACCTCCCAGTGTTGGTCTAAATTTGTTTTATTGTTATTTAAATATGTACAGACATAA
AAGTCAGGTATGGATCCCTTAAATTAATAGCTCTTATAAAATCAAAACAAATGAATCCTT
TAAAACCTGCAAAAACCAATAAAATTCAAATTAAAAACATTAATATAAAGTAACAGATGA
TTTTTGCTGAAAGTAAATTTCCTCTTGGAACAAGATTATGACACTGGCTGCTACCTTCCA
CACAGTCTCCCATCAGCACGTGGCAGGTCGTAACTTGGTTCTCCCATCTTTCCATTGTGA
ACTGAAGACCCCTGTATCTATGTCAGGGGCTCAAGCTGGAGTCCAGAAACGCTCACATTA
ATATTGAAGGCTATTATCAAAACAAATACCCAAGATTAAAATTTTGTCCTAGAGGACCGG
TAGAAACCTGAAAGTACTTCAGCAAGAGCCAATTTGAGACCCACTATTCTAAAACATTAT
TAAAGTTCTCAGTAGTTGATGGAATAGTAGGAAATACTAAGAAAGTTAGGGATTTTTCAT
CTGATGGAAAAAAAAAAGGAGAGGTGGTATTTCATACACTGCTAGTCAGTGATCAAGTAT
TTATTGGGAAATTATACAATGCCTACTATTACACATAGTTCCCTGCAGACTCCATAAGTA
CTGTAAAATTATCACTACCTTCAAGAAGCTTGGCATATACGTGGTATGAATAAAATCAGG
AAACAATGATCATGCTCGTATTAAGCATACACATAATTATCGTGTGCTTATGAAGATTGG
AAGTACAATAGAAATCACAGACTGGAGAAATTAGTAAGTGTATTAGTCAGCCAAAGGGGT
AGAAGCTTACATTCACAAGATCCTAAAGAGTCCAACTTAAAGTACCATATGAGGTACTTT
CTCACCCAAAGTCTGTTGCCACGTGTTGAAGCAACATGGCTGCCGATGTCTGCAAGGGTT
CAGCCTTCCTCCTCTTAAGGCTCTGTAGTTCTTCTGATCTCATCTATAGGCTGGCCTGGG
GTTCGTCTCCCTTTCCAGAGCTCATAGTTTTCTAGGTTCAACTCCTCTGTTCTCTTCACA
AGGTCGCTATAAACTCTCAGACTCATCTGTCTTCCCAGGGCCGCAGGATCTTCTGTGTAT
CTTCTCTTTGTATCTTCTTCTCCTGTCTACCTCTGGGTGAGAGTCTGTTTTATCAGCCCA
CCAAGGGGGTGGGAACTCAAGCCTGCATGCCCTAATGATGTCATCAAATCAAAGCCCTAA
TCTTAACATAATTTAATCAAAGACATCTCAGCATAATCTAATACAATCAAAGGGTATCAC
ACCCGGAGGAACAGACCAGTTTACAAACATAATCAAATATCTCTTCCTGGGAATTTCATA
AATAATATCAAACTGCCACAGTAAGATTCAGGGTAACCAGGGAAATGCACCACTTAAGAG
GGTGATTTTTTTGAGTTTCAGGGATAGACACAATTTTAACAGGCAGAGAAAAACTGGTGG
GAACTAGAGGAAGAAATCTAGAATTTATTTAGCTGACATTGACAGACACTCTTCTAGGGA
ATAGCTTCCTTAGTCCTGACCATGGCCTTCGAGGTAAGGTTGTTATTATTATCCCTGTGT
CCCAGAAGCAGCAACCAATAAAGATGACAGCAGCAACAGACAACATTTATGGAGCCATGT
CTCTGTTCTCAGCACGTGACTAAAGCTTTACATGGTTTAGCCTACATAAATCTTATAGAC
TCTCCAAGTAGTAGGAAAAGAGTACTGTCTTGTCCATGTTTTCCAAGTTGGGAAACTGAG
GCCCAGGGAGGTTAGATGTTAGAACAGAGCAGAATGGGGAGTAAATGTAGCTCAAGGGGT
TGAGCTCCTGCTTCCCACGGATGAGGTCCCAGGTTCAAGCCCCAGTTCCTCCTAAAAACA
AAAACAAACAAATGGAAAGAAAACTTACACCCACCAGGGAGCAGATGTAGCTCAGTGGTT
GAGTGCCTGCTTCCCATGTACAAGGTCCTGGGTTCAATCCTAAAAATTAAAAAAAAAATA
AAAAAAGATTTTAGAGTACAGCAGCATAACTTTAGGGCCTGTGAAAATGAAACTGCGCTG
CCAAAGCTCAGAGAGAGATAATAACTTTCCTGGGATGCCCAGCTAGTAAGTGGTAAGGTG
TCCAAGCCCCCAGCACATGCTCACTCTTGCCGCTGATTTGTGCCTGAGAGCCACGTGTGC
AGAGCCGACGTGGGAACTAGGCAGGCATTTTGGGGAGAGGTTCAAAGCCAGGTCTGCGGG
TCCCAGGTGAGGCTGAAGACTTAATTGGGGCAGGGGAAAGCTGAGGAATCTGGGCTGACC
TTGTATTTCCAGTATTCAGGGATGGGAGAGTTTTAATACAAAGGATGCTGAGTAGTTATT
TTCTTCGTACGTAGAAGGAAATTTTTTTTTTTTAATTAAAATAAGAAAGCAAATAGTTGG
ACCTAAAACAATTTTTTAAAAAATACCTAAGGATGGTGAAACACTCTGGGCCCTCTGAGG
AGGTGAGGATGTTCCGGCCTGGGGGCATCATCTAAGCTAACAGATTCCGTTGGGTGTTAA
TCAACGGATGTCCTTAAAATGCTGATATTTCTTGATACTGTGGTTGTATTACTTTTACAT
AATTTCATTAATAAATGGGTGCTTAGGATCTCATTTTGATCTTTTAAAACCATGAGCAAG
TTATTTTAACTTCTTTGAAGATCAGTTTCTTTAACTTGGTCAGCGCCTTCCAGGTTCCAG
TCAAAGGCCACGCGGGACACCGCATGTCGGGTTTATTGATTCTTTGCAGCCAGGGAGACT
GCGCAGCATGGGTTCTAGGGGGCATCTCATAAGAGGGTGTTAACAATAACTTCTTAGGAT
ATTTTGGCTTCTGCTGGGCAGTGTGGGGACAGGACAGGTGGAAGGAAGCAGAGGTTTGTG
TTGGACTGGGTGCTATCAGCAAGGGGCGGAAATTCTTCGATTGGGTATTGTAATGATTTT
TATGTAGGAGGGGGAAGAGCAGAGGAAGGCTAAAGCTGTGATTGTCCAGGAAGCAACTGT
CACTCAGATTAGCCATGAACGGATGTTTCGGTATTTTTGTGGTTTGCGCAGAGACCGTGT
TTTTGTCTGTGCTTAGGCAAGATTATGGTGGTTTTATGTTTGTTTTTCATTCATTAATGC
CACAGAATGGCCATTTCTAAGGTGGGAGTTCTGGAGATTGTTCACACTGAGATTCTCATG
GTCTAACCGTGTGTGCCAGACCTGCTCCTGGCACGAAGGCCAGTGAGTGAGTGCCAGGCC
AGGTCCCAATGCCAGAAGCTGCTCCTCTTCTCGCCTGCAAAAGGTGTCTCTGTGGACAGG
AAAGGGAGGCTGAAGGAATCAGAGAAGAGTTCGTCTTGACTCTACTCCTTACCTAATATG
CAATCCTGTGCCAGTTTTTTAACTCTTCAGCAAGCCAAAGAGTTCTCACCCACAAAACTG
AATAGTATCCATCTCATAGAACTGTTAAAAGAATTAAATGAAACAAAACAAAGAAGACTG
GCCTATAGTCAACTGCTCAGTAAACTGTAGCAATTATTATTGTTTGCCTGACTGTGAGCC
CTGATGCTCAGTATGTAAGTGCCCAATTAAAATACTTTCTTTACTCCTCGGAGGTAAGAA
GGTTAAGTCCTTTGTTCATGAAGGAGAAATGTGTCCTGTTAAGTATTCAACTATGTGATC
ACTGAGACCATTTACTCAAATGGATATGGAATGAAATGTTTTTCAGCACTTGCTCTCGCC
TCAGCGGGCCCCCGAGAGGCTCCTTCAGTTGGCAGAGGGCAACCTGAATACACTCGTGAT
GGAAATGAATGAGCTTCTGACCAGGGTAAGTTGGCAAAATCAGGAATCACCTTAAAGTAG
ATAGATAATGTGAATTAAGGGAAAGTACTTGGAATATCTGAAATGCAAATCTTGTTCTTC
CTAATTCCCAATGTAATGTGTAAAATAGATGTCTTTTGACAGGCTCGTGCTGCTCAGATC
AAATCCTGGGACCCAGTAGTAAACAAAAAGCTGGGAAGCTTGGGAAGTGTCAACAACTAT
GGTGACAAATACCATAGTGGCTATATATTTTGAGAAGTTCATGCAATAGCCCCAGTGATA
AAAGTTTTAGCAATTCTGAGTTCCAAAAGCACTCTCTTTGATTTTATGTAAGGAAAAAGA
AAAATCAATAAAAAATGTGTGCAGTTTCTGATCTCATCATGGGATTTTGGGGCATGTGTA
GGAACCCTGTCCAAATCAGTGTTCCTACACTGAAGAGGAAACCTTCATTAATTGCGAAAT
ACAACGCATTTAAAAGATACTTTTTTAAAGTTACAAGTTAAAATTAATGCTGCATTCACC
AGACTTTCTAAGAAATTGGGACTTTAAATTTTCAAAGCTGCAGGAGAGTTAAGGTTCTTT
TTGCTCTTAGGGATGGAAGAAAACAACATAACGTGCGCCATCGTGTGGCCAGAAAGTGCA
CGAACAGAGAAACTGGTCTGCAATTTAGGGCTCTAGTTCGTCTAAAGCTTTAAATGTCAA
AGGCTGTTGAAGCTGGAAGGTTACTAGGATTATCTAATCCATTTTGTGTTTTAAAGAAGA
GCTGCCTCAGGCCGTGACAGCGAAATGAATTAGCAGGATCATACAATTCACTAAACTGAG
AGCCGTAAACTGCACCCCGGCTGTAGATTTTCCCACTGGCTGAGCACTTTTTCCACCCTA
ACCTGCTGCTGCTCAGGAAGATGTCTGCAGGGAAATCAAGTGGGCTTCTGAGCTCGTAAT
GCTAAACAACAGCCCTGATGTTGCAAATAGCATTCTAAGCACTTTTTCAGAATCTCATAC
CAACAATACAGAATGTGCAAATGCAGAATAGAGTTTCTTGCCAAGTGTATTTAGACGTCG
TTAGACAAATGAGTAAACATATCTTAAATTAATTTAATATGGGATAATTTTGTATGTGTT
ATGAGACTACAGATAAATACTAAATAAATGTTAAATAGGTCCTAGCAGGGTAGGCTCGAT
TTAACAAGCGTATATGGATTTCACCTCATATACAACCCAAGTTGTGTTAACAGATGGAAA
ATATAAATAAAGCCTATCTTCCAGGAGCTTGCAACTGTGTGTGCAAGTCGAGTAATGTAA
AATGACTGCCTACAAATATGTAATACAAAATGAAATAAAGGAACAAGAAATGTACTTGAT
GAATATATAAAAATAAAACCAATTAATCTGGGTAGGGTAATTAGGAAATGTTCCATGGAT
CAGGTGCATGCCATTCATTCATTCATGGGATTAATACTCTCTGGGGATCTACCAGGGTAA
AGGAATTGTGTTAGACTTTGACAATACCAGTGTCAGCAAATCTGGCACAGTCTTTGCCTC
CACTGAATTTATCGTAGCCTAATGATCTGAGCCTGGAAAAACAGTTCACTGGGAGAATCA
ACTCTTTACTATGCCTCAGCCTAAGTCCTTTCATCTTTCCAGCAGACTCCCCATCACTAT
TTTTAAACTAAGCTTTTCATTTTAGAGTAGTTTTAGATTTACAGAAAAGGTACAAAGACT
GTACAGACGGCCCTGTATACCCCACATCAAGTTTCCTCTACTGATTTTTTTTTAGATTGA
TTTATTTCTTTATCGGTCCCCTTTGCCCCCATTATTTGCAGTCACTGTCTGCTCTCTGGG
TCCATCTGCTGCATGCTCTCTGTATCTGCTGTCTCTCTTTAGAGCACTGGAAACCCAAAC
CTGGGACCCCCCATGTGAAGAGAGTGCTCAGTCATCTGAGCCACCTCGGCTCCTGGTTGT
GTATCTCTGTGTCTTTTCTCTTTGTATCTGTTTTGTGCATCATCTGCCTGCCCACCACGC
CAGCTCATCTTCACTAGGAGGCACGGGGAACTGAACCCGAGACTTCCCATGTTGTAGGCA
GAAGCCCAGTCACTTGAGTCACATCCCTTCCCTCCCCTACTGTTATTATTCTATATGACT
ATGGAACATTTGTCACAACTTGTGAACTAATATTGATACATTATTATCAATTAAAGTCTA
CTTCATTTGGATTTGCTCAGTTTTTACTTAATGGTCCTTTCCTCTGCCAGAATCCTTTCA
AGGTACTACACTTCCTGTAACTGTCACATCTCCTCAGGTACCACTAGACTGTGACAGCTT
CTCAGCCCTTCCTTGTTTTTGATGACCTTCACAGTGTTTGGGAGTATGGTTCTTGTATTT
GGTGGAATATCCCTTAACTGGGGATTTGTCCTTATGCTTTTCTCATTATGAGACTAAAGT
TATGGGTTTTGTGAGAAAGACCACAGAGGTGACATGCCCTCCCCATCACATCGTGTCAAG
GACACATGTCATCAATATTACATGTCCCTGTAGATGTCAACCTTGATCACTTGGCTGAAG
CAGTGTTTGGCAGATTTCTCCACTGTATAGTTATTTTTTCCCCTTTCCATACTCCAATAC
CGTTTTTATCTGCCCAGTCTTCACATTCCATAATACAAAAAAAACCTGAAAATGAGACTG
CTGAAAGCAAAGCTCTCCTTGAGATAGAGAGGTTAGGGAGGACATGGAAACAAACTTGTT
AATCCTGCCTCTACCACATTTGTGATTAGAAATATAACCATCATGGAGACTGGAAGTGTA
AGTCAACATGATCAATTCCTTCTTTCCCTGTGGTCACGCTGCATGATAATCAAAGGTGAA
TTGACACCCGTGGAAGCATGACCATAAGGTACCATGTGGGGCAGAATTATGAGAGTAAGG
TCTGTCTTGAAAATACTGACTTATGAGTCACCAGCTTATACATGGAAAAGGGACAGAGTT
TATGCGGTCTTATATGTAGTTTTCACAAGGTTTAAGTTACCAACAATATTGTTATTTCTG
CTGCTGTATATCAAAAGAGAGAGAATGTATCATAAATCATCCTTGTTTCTTTTGGAACTT
TCAAAATTGACACAAGAAATATTTAGGGAGAAAAGCCCCATGGTCCTGGCTCGTTATGAT
TCTGCAGGGTCAGTTAGCTGCCCCCTGCCTCTTATCCTTGGGCGTCATCTGAACTAATAG
TTTGCCTGAGGAGTACTGCACGGCCACTTAGAAGTACAGAGCTGGTGGTGTTGAAGGAGA
ATATTGAGACTGTCATAGAAATGATTAGATCTGAAATTTAATTTAGCAGGAAACCATATG
AGTCTTCAAAGGCAAAGGTGGATGGCATCTAAGCAGTGTTGTCTGTTCAGTAGTTAGATT
TGCTCCATTAGATTCTAGTTTTAACATAAAGAAGGCAGAAAATGAAAGACAGTAGTGATA
TCCAACCAAGAAAATTATGTGCAGATTTCAAGAGGCACAGTAAGAACTGCTTGAGCTAAA
GCAAGACAGTAACAGCTCTATTGTTCAGAAGTAAATTAATGTGTGCCTAATGGTGATGCA
TGCTGCCTAGATATAAATACACGAAAGAAAACAAAATAACCCCCCCAAAAAAAAGAAAGA
AAAGAGGAAAAGACGTAGTTGAGTGAACTTGAATGTTAAAAAAAAAAAAAAAGACGATCA
AAGGTAAAAGAAATATAGACAAGGTATTGTGTAGGCATCATTTACAAAAGAGCCCAGGAA
AGATTGCAGAATGGAGGTAAGAGAATGTAAAAAATAAGAAAATCAAAGATAAATAATGAA
AGGAAGATTGTAGAACATATTAGGATAAATGAAAAGATATTTGTCAGATGCTCAAAGAAC
AAGATAATAGTGCATGAGGCAGATAACTAAAGGATGGGGATGGTAATTTAATGAAACACT
GGAAGAAGCAAACCGAGCTAGACAGATAGCTCCTATCATGTAGTACTTAGCATTTTTCTG
TAATATTTTCCATAGCCTGTCCTGGGTGAAACTGATTTTGGTGAATTTCATCCTGATGAT
GATACCGCTATCTCAGGGTGGTAGTACATTTATCATAGGCTTCCTTTATGGGTAGTTTGG
CAAGAGTGAACCTTCAACTTAATTACTCTGTGATGAGACAGAATTTTTAAAGAATACATT
CATTTCATGCTCTGATATGGCTTTTGAAAGGTGTTAATTCACTAAAACACAAAGTTTCCC
CACTTTTAAAGGACTTCATAAGCAAAAGCAGTTGCCCATCCCCTCATCCAGAATGCTCAA
TTCGTCATATATTTTCCTGGTCTTCCTGGATGTTAGCCAAAGATTAGGTAGTATCTGGTA
AAGGCAAAATATAAAGTTGGGAATCAGAAAATTTGCATTTTGTCCTAATTCCTCATATAC
GTGAATTCAGATGTCCCCTAACCTAACCATACCTTCTTTTCACTTATGTGAAAGTGGGAA
ACCTGACCCGCAGTAATGAGACTCCATGAAGCCACATAGCAATCCAGTGCACAGCTGAAC
TTGACGGTGTAACCCAACTTTTAGAGTGCTAGTCCACATGAGTCAAACCAGTCGTTTGCC
TTGGGGTCCCAGGAGCCTCACATCCCCTCCTCTGCCTGAGCACAGGCAAGAGAGGAAGAT
CTTCTTGAAGGAGTAGAGGGAAGGATGGCACCGGCCCAGTGGGCACTGGGCTGACCTCAC
CACCCGGGCAGCATGGTACTTGGTGTGCAATTGCGGGCACAGTTTTGAATTGCCTCAAGG
CCAAAGGCTAGAATGCAGTGTGGTTGGAACTGGAGGCAGCGCCTGGCTCTCATCCCAAGC
ACTCAGCTGCAGCTCTCAAGCAACAGCTTCTTAGGATGCCCTGAAAAACGCCGGGAAAGC
TGCCGGCCAACCACTTTTGCAGGCAAGCATAGCACCAGACATATGGTCAGTTTGAATGGT
GTTGGGAAGGCAAATGGAAAGAGATTTATTTTTTTGCTTCCAACAGGCTTTAGAATTCTG
AAGGGATGGTTGGTTTGATTATCATTCTATCAGCCCATCACCCACCATCTTTGACCACGT
ACAAGTTTCCAGGCAATATGCCAGGCTCTCTGAGAAATAAAGAAAAAAGATAAGACACAG
CCCAAGGCCCCATGAATGGAGATTAGACAGATATTGAGAAACACCTAACAAAATTATTAC
TGATTGTCCTAACTAAGTCAAGAGAAGTTAAAAAGCAATGGTATGGGAGTGGGTGTAGCT
CAGGTGGTTGAGCTCCTCCTTCCCATATATGAGGTCCCACGTTCAATCCCTGGTACTTCC
TAAAGTAAAAAAAAAAAAAAAAAAAATGCAATGTTATGAACAAAAGCTTTTTCCAAGAGT
GTTCAAAGAATGCTAGGCAATAAGAATAGGTGGGCAGGATGAATAAGGTGGGCAAGATTA
GTTAGGAACATGCTTCTCTTCATGTGTTTAAGAACCATGGCTGACTGTTTGCTGTATGGT
AAGCATCGTACCAGAAGCTGCACATCAAGTGACGCGCAAAACAGGCCCAGTTTCCACCCT
CTCCTCTAGTCAGGAAGGGAGCCAGTAAATAGGTAATTAACACATAAATCAAAAATTCTA
AAATGCATGGTGCTGGGAAGGGAATGTTCTGCTGTGGGTGGTGCAGAAACCTGGACAGGT
GTGCTGGGCATGACCTCATTTAGGAAGAGACGCAAAGTGAAAGCTAATCAAGCAACGAAT
GGAGGAGAAGCTCATTGCGGGAAAGATGGCGGGTGCGAGGAGGCCCTAAGATGGGGAGAG
TTTGGCATACTAAATATACTCAAAGGAAGCCAGGGATGCTGATTGTGTAGGCGTTTAGTG
ATAACTATTCTAGCTTGTTTCTTGTTATGGGGCACATGGAATTCTTGGCCTCATACTATT
GGAGTGCACATACAACCAGTACTAAGAGTGAAATGGTTGTTAGTGATGCCTCTTACAAAT
ACCACATCAATTCCTGTTGAAGGAGTAGGACTAGGAGAAATCAAGGCATTGAATACTATC
TTGATCATCCACAACTTATGAGACACAGTATACCAATATACATTTATTTTCAATGATGTT
GAAGCTTTGGACAATTAAGAATTTTTGGAGCTATTATCAAGAATCACTAAGTTTGATAGT
ATGAATATTTATAGAAATTATGATATTTTGGTAATATAGGTAAGGTATTATAAAGCAAAA
AACAAAATTTTAACTTCCATTTATTTCATGTATATTTTCTGTGTAGTAAAAGCATTGGTA
CGGGTGATACATTAATTCTTAAGGGAAGATATTGGAAAAAAAACAGAATATAGATCAAGT
CCCTTCTATGGCACTCATGTGACATAAGAACATAGCAGTGGTATAGAGAAGATCCAAGTC
CAGTCTACACAAACCTATGGAATCATCTGCCAACACCTTGAGCAGCTGACCTCAGTTAAT
GATTAAAAAGTAGCATTTTAGAAATTATGTGTGCATGGGTTTGAGTGGGACATTTGACCC
ATGTGAGTCTCAAATGCGAGCATGTGACTGGAACCAAGTTTAAGGATGTCACTATGCCAT
ACTTGCCATACCAACCCTCAAAGCAGAACTTGAGTAATTTAGGGATTTCATGCACAGTTT
ATTTACAAGAAAAATTGTTTTAAAAATATAAAATTGAAAAGAATGCCATTATTAATTTTA
GAAGAGTCAATCCAGACAATTATAATACATTGTTTAGCGCCCTCCAAATCATTGTGTATA
CATATGCAAACTCTAAGGGGGGCTTTTGAAACTTCCAAGGAATTCTTATCTTTTCATACT
TTTACTTGTGATGCTAGCACTTACAGGTTGAGGAATTACATGATAATAGTCGGAATTTAT
ATTGTACCTTTTGTGCAAAAACTTTCATAATTTACATCGCTTGCTGTCCCTGGGAAGTCA
CAAAATGCAGCACAATTCCTATAGCATCTCTTACCATGTTCTGTGCTAGCCAGACATTCA
GTGCTACTTAAAATCCACTTATGTGTAAAAATAATTTAGATTCTCTGGGCATGTCTAGAA
TGCAAGCGCTCTGGTAAAAATTGTAAAGTATTAATATTCTGCCAACTTGGACCTGATTTG
AATTATATCTGGGCAGTCTGTGATTCTCTGATTCATCATCTAGAGTTAGAGTAGCCTTAT
CATTTGAGTCAAAAAGAATAACTCATATTTATTAGCATATGCATACACATAGACAAATGA
CGTGAAAACTTTCTTCAGGTGCTCTAAACCTTGTGGTCCTTTTATAAGGCACTGTTAAGG
TCCCACATGTCATTTTTATTTGACTAAGCATTATATCATAACTATGAACAGATTAAATGG
ATTCTATTGTGTCAGATAACTTTTTCAATATGAATAAAGGTGAAAATATATGAGGATAAT
ACTTTTTGGGGGGCTAGGATCTGTATTAGGTTCTGTTTGATTTTGTTGAAAATGGTATCT
GGAACGTGATTAACGATCATCTTTTCTGTTGCTGTCAAATGGAAAAGTTAGCATTTATTC
TCTGAATATTTTCCTGGCATCTTTAAAGCATTATAATAGCTAAGCATTTTCCCCTCTTTG
TTTCTTTAATTAACATATCAATCTAAACTAAATCTATAGGATCAAGCTTATTGAGACAGA
CTGCCTGTGCCTCCCTCAAGAGATCATTGCTACATGCCACACTTTTTCAGTAAATAAAAT
AAGGGCAAAACTACAACATGTAGAGGCTGAAGAATCCATTAAAGACTTTTGGCAATAGCA
CCTTAAAGATATTTCAAAAATAATTGTACTTGATCATTTCTTCTGTGCTATTGCCTATAA
TGAGGGCTTAAAAAAGACCAAGAACAGCTCCCTGATTTGCATTTAATGGGAGAAGTAATA
AAGTTTAATTGTATACTTGAGCACAGGGTGTCATTTCTAATACATATGATCAATAATTCT
TCAATTGCTATTGGCACAAAGTAATATCTGAAAGAAAATGTAGCCAGTGGGAGCTTATCT
AGCCATAGTTTTATCATCCCTATTAATTACGTTTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCTACCAAAGTGACAGCAGATGGCGAGCAAACTGACAGATGCAGA
GAGGACCAACACGAGAGCAAAGTCTTTAGGAGAATTCACTAAGGACCTTGTCCAGGATGC
AGAAGGTATTGAAAAACAACAATTTAATACTTATTTCTCCCAACAGAAAAATAATCAAAA
GGATTGCACAGGACTAGAATTTCTCTAGTGAGAGATCATATTTCCAGATTTGAGTGTTGC
TAAGACTCTACAACCGATGGTGTTAAATTAGTGGAAACCGTCAGTGAATTTGTAATTATA
AATGGCAGTAACTTAAATTCAGCCCTTTAAGAATGTTCTGATTCTTGAGGAATGACTATT
ATGATGAAATAACTAATGGGCAACTTCTGCTTTGATATTGTTCGTATTCAATACAATTTC
AAAGATCTTAATTTTTAAAGAAAGCTAATGTTATCATTCCACTTGGTAGATTAAAGTGTC
ATTTTAATTTCTCAAAATGGCTTTTAAAATTCTTGGTGCTGGTTTTTAATGAACATCTGG
TGCTTGGCATTTGGATGTGCTACCTTACCAGAAGCTGTCCCGTATTTGGCCCACAGTTCT
CTAGGAGTTAGTTCTTGGCATGTACCAATGTGATTGAGAATGAGAGTAGAAGCCATTTTT
GGCAAAAGCCCAAATTAAGAAACTCTAAAAAGAAAATAGATAATGGCAAAATAAAAATAA
AATACTCATTCCTAAATATCTTCTATTATTAGTAAGGAAAACTTAATGCATAGTAAGCCT
GCATGCATGTTTAGAAGGTAGGAAAAAGTATGCTTATTTTATTGTTGTACAATATTATGG
ATTTTTGATACATACTTTGCCCCTATAACATAGCCAAAAAATCAGGCCCTAGATAACATA
GAGAGAATAGCCTGGCCAATAATTCTTAGAATTTGTGGGTCAAAAAGAAACAGAAGGTTC
CAAAGCAAGAAGCACACATGGGATAACATGGATGAATCTTGAGGACCTTATGTTGAGTGA
AGCAAGCCAGGCGTTGAAGGACAAATACTACATGACCTCTCTGATTTGAATTAAGCAAAT
CAAGCTGTCTCAGAGAGCTAGAGACTGAAAGATAGGCTTACAGGAAATTGGGAGGGAAAG
AAAGGTTTGAGCCAATGTCCACATGGGCAAAATCTTTGAGAAAGTGAAGGTAAGTAGCTG
TGCAGTGAAGGGATAAGATGGGGGTATAGGGATACTATTGGGTTGGGCTTTGCAGGCTTG
AGGGGTGCTAGGGTTGGGAGAATGGGTCAGATGGTCCATGGAATTGGGGGGAGTGTTGGG
GAGAGCAGGTGAACATGGGAGATTGTCAGGTACGTGGTTGAAACTATAATGTTGAGAAAA
CTCTTTAGAAAATATAAGGAAGGGTCACTGGTTTAAGGTGTTTGACAGGGGGCATCTGGC
ACAGGGCACACCTGGGGCAGGCTTCCAGGGAGTATGTGAGTGCTCATCTTGTCTTAGTGT
GTTACCTCAGTGGGTGGAGACCATACGATGAGCGGGAAGGTATTATACCCCCATCCTTGG
GAGGCCTGGTGCTGTCAAACCGAGGGGAAGGTGTGTCTCAAGAGCATGGGTGGCTCCCAG
TGGGGGAGGACACTCGTGTGTCAAGTCCTCAGCATTGTTGCAAGTATGTATGAATCTTGT
CCTTCAAGCAGGGAAGCTTGGTTGCCACTGTGGGCCCTAAGGGAAGGGGGAGAAAGGAAT
AGAATAGATGGAAGAGGGGGTAACTTGGGGGCAATGGGAATGTTGCACAAGATCGTGCAT
CGATGGATATAAGACATGTTAAATATCACCAAAATTTTATAAAAGTGTACAGTTTAAAAT
GTAAACCATAATGTAAACCTTAATGGAACCATGGTTAGTAGCTGTGTTTCAGTATCTGTA
TATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCAGGATCTGAAA
TAGAAGTTACTCCTGGCAGAAAAAAATTCACTTAACTCATTGTGACCAAGCCTCTGATAA
ATGCTGTTGTGCTTTCTCTGATCTTATTTTCTATGCTTGCTATGTGGCAGTGTCAAAAAA
AAAAAAGTTTGCATGCAGTTGGAGCAGTTTAGCTATACTTGGATCACCAAAGACACTAGT
CCATACTCCAGGACATTTCCTTTCCCATCTGGCTCAAATCTCAAGCACTTAACATGCAGC
AGCCTATCCTGAGGACTTCTCTTAACATAGTTTCAATCAAATATCAATGCATGAGAATAA
ATGCTAATACATGTTTTAGTAGAGCCTAGTATCAGCCCTGCTTACTTCTCTCCAGTGACA
CATGCACCGCCTCCCGGTGAGACGGATATTCATGGCTTCCTCCTTGACATCTGTGTCTTC
TTTTCACCATTCAGTGTGGGTTTTCTTTCTGGACATTTAGGGCCACTGTGTAAGGTTGCT
CAGTTTGTGCACTGCCTAAAAGCACTAGCTTGGGAGCAGAGTGAAGATCATAATAACCCA
GACTTTGCTCACCAACCACAATCGCTGGCTTATCCACCAGAGAAAGGGTTTACCCCTCAT
GAAAGTGTCCTCCATTCCCTTATTTCTGCATCGGTCAGAGAGACTGATTGTTCTTCCAGT
TGGAGCACGTCTTTCTAATTCACACAGCATTTCACGTGGGATAGCTGTGATCCTGAACCT
GAAAAAATGGGAAGACTACCTGCCTCAGCAGCGGCAACAGTAAATGATAGCCACAACCTT
CTATAGAAGGATTAATCTGTTGAAATCTAATGAAAGTTCAATTTGAGTATGCTAGCACTA
AACAGAATCCTTACTACAATGTTTGACAGGGGAAGGGGTTAAAACAAGAAAGAAAGAAAA
TGAAAAGAAAAACTCAACAAGACTTTAAGTAGGTTATATAACATACCTGCATTTTTTCCT
CAAAACTACAATAATGAGGATAATCATAATCATTTTCAGGCTTTATTAGGGGAAATAAAT
GACTGTGGGAAAAGTAGATGCTTTAGGCTGGCATTTGTCTATTTCAGTTTTTTTAGATAG
ACTAATACCTTATTCATTCTATCTTCTACTGTATGCCATGATCTCTTTATAATCACCTTC
TATTAATCTAAGACAGTCTTATCTCACAAACATTTTGTAACATTTACTGTGCTATGAATC
CTGATTAGATCATGAATAAGCTATATTTTACTCCATCCACTATTAGAATTAATGGGTGAT
CACATATGAACCCATTAGAGAAAGTCCTGATTTACAAGAGGACTTTATAAATGTTAAACA
CCCTTCTTTCCTGTGTTCCATGTCAAAGTAGTGTTTTCATTCATGATAAATTTGCCCTCT
GGAAAATACATGTTATTCAGTTTCAGTATGATTAACATCTCTGTTTCTCCTGACGAATTA
ACCCATTGTTATTTTACAGGCACTGTGTACACCGAAGCGTCTCTTTCCCTGCACTTCCCA
GTATGTACTGGCTCCTGAGAAGTTTAGAGCTGGGTTTAGGATACACTGGACTGAATATTA
AGGCATGCTTTTCTGTCTAGTAATGCTTCCCCAGTCGACAGTGATATTTCTTTTAACCTT
TACCCTTATTTCATTTCTATTAATTTTATCTTGCTCTTAAGATACTTTAGACTACCTTAA
ATCTTCTTTGACATGAGGCAGACGTAGATGACTTAAAGTCAAAGATAAATTTATTTTATA
ATTTTGTCCAAAACTATGGAAAAGGAAACATACTGAACTGGCAGTATATACCTTTGAATA
AGATATTAAATAATACATTATCTTTAGTTTAAAAATACTTGGAGAAGTTCCAAATCCTGT
TATATGTAGACATTAAAACAAGCAGACCTCGTCTATCAAAATGCATCATCATTTTGTGAA
AACATTTTCTGTGTGCTAATAATTTCTTCTAGGTGTTTATATATTGCTTTAGTTTAAAAG
AAATGATGCATGTATTAAAAGGGTCCAGCCACGTTTGGCTTTTCCCTTTCTTGCCATCTG
TCTTTTCCAACAAATTCTTTTCTGCAGAAGTTACTCTGTAAGAATGGACCCCGAAAGAAA
GAGTGAAGCTGCATACCATATCCCTCCCTTCCTCAATGCAACACAGGCCCAGAAACTAAA
TTAAATTGAATTTCAAAAGTATCAAAGAATCAAAGCTCATTTATATATTCATTTAGTAAC
TGAAAAGCATATAGCTTTGACAGGTTGGAAAGTGGAGTTTATCACTTTTTAAAATAAACA
AATAATAAGTAAATAAACATGATGTCACTAGTTAAACACTACAGTCGGTTGAAAACAACT
GAGCAGGCAGGCAGGTGCCATACAAAAGAATGGGGCCTGGCAGTAGCTATAACCAAGTTG
TCTACTGCTTTTCTTAAAATCTAAAAAGCAAGAAATAAAGCAGATTTTGTCCACACATAA
TCATTGGGATTCTGGCATGGTTCCCACTTAGTCTGTGGCACCAAGGAGCTTTCAAATAAG
TCGGTCCATTGGTCATAGAGTTCTATAACAAGTATGGAACAATCTATAACCCTTGTTCCT
AATCCAGGGCTTTTTTTCTCACTCCCTTAAAAAAAAATGTACTCAAGGAAAATTCCATGG
AGGTTTGGGGACATTTTCCTTCTCAGGGATCCCATCACTGATAATATACCTGTACTCAAT
AATCAATTTTCTGTGACTGTGTCTGATTAGCAATGCAGACCTTCTGTTTTCAGCTTCCAA
GTATTATACTGCACGTCTTATTGTTTATTTACCTCTTGTCTGAAGAGGCTTTGGTCCTTT
TTTGTCTTTATAGTTCTTCCTTATGAGGTAATAACACCATGCTTTAATTGCTGTGTCCCC
AAATGAAGTATCTAACAAAAATTGGAGAAATGTGTCAGATTTTCCTGTTTATTACTATAT
CTCTCTATTAACCACCTCTCTCTTGTCCATCAGGAACACCCAGTGCAAACTTCCTTTCCC
TTTGAGATGGTGGTGAAGAGCAGATGCTGACTGCCATTTTGCATATGACATTTGTATTTA
CTAATTTGCAAAATTTGTTTTACCTCCTGCAGCTGTAAATGAAAAAGCCGCAAAGCTAAA
TGAAACTCTAGGAGTTCAAGACAAGGCCTTTGAGAGAAATTTGCAAGAACTTCAGAAAGA
GATTGATCAGATGATGAGAGAACTGAGGAGAAAAAATCTAGATACACAGAAAGAAGTTGC
TGAAGATGAGTTGGTGTGAGTAGATGCTTTATTATTTTTTCATTTGATAAACTGAGCTTT
CCAAATTGTTACTGTTTTCTTAATTTTCCATGGCATATTTGAGCAGAAGATATTTTGCTT
TTCTGATCTGGAGATGTTTGCTATTCATTCATTCATTCATTCATTTCTTTATACTCTACC
TTGCTCTAAAATGGATGAAAATCATGTTCTTGCCCTTATATAACTAATCAACTAAATAAA
ATGTTTTGGTGCTGCCCCTTCTCTAATTAGGCTAATGGCCTTGCTTTATTAAATGTCTGC
ATTAGGGTTTTTAAACTATCAATAATTGTTCGTTTTAATAAAAATATTTTTGGACAAATG
TAGTTATAGGTTAATCAGCAATCCTTTATGTTATCTCATCTTAAAATATGCTGAAAAGAA
GAGTTATCCAATAAAAAACCCTAATAGTTTGAAATAAGTATGAAGATTTGGAAAAAGTAA
TAATGACATTATTAACACTAATAAACCCTTGTGCTCACTTTCAATAAAATAGATAATTTT
GTATATCTAACTTCAAAGTGATTGTGTTAGAAATGTTTAATATATAGGAAACCAGCAGCA
TCAGCAACTTCTGAGAACTTGTTAGAAGTGCAAATTCTCTTAACCGCTATCCCAGACCCA
TTGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTGAATCAGAAACTCTGGGGAGGGAACCCAACTTTTCCCAA
CTTTTTGCATTTTAGCAAACTCTTCAGAGGATTGTGATGCTGGTTAGTTCGAGAACTACT
GTTTTTCATGTAGTTAGCCTTTCTTAAGGGCTCAAAGATTATTACCATTTTAGGAAAATT
ACGAGGTTAAATGAAAGAAACTGCAAGATCATTCTGTTGTAAGAAACAAAAAGCAGATCA
AAAATAGTGATATTATACTAGTGTGAATATAAGAGAGTTCTGCTCACAACTTCTACCCAA
ACATATCAATATTCAGCCCTTACGCTCAACGTCATAGAAAAATGTCTAATGGTGAATGAG
GTAGCATTTTGTCGGTATGTGAAATGAATCATAAAATTCAATTCAGCAGTCAGATTATGG
GAATTATTTGAGACCCTTTCCTATTGAAAATGTTATACTACTAATAAATGGGGGAAATTT
TTTGCTTTATTTTAATGATAAGAGGTCTGCCACTTTTCAGTACCGGTTTCCAGTTTGGTT
TAGTATTAATTCATAGCGAGTCTGCTTTAAATGTCTAATTTTTTTTTCTTTCATTCTTTG
TAACACACTTTAATCTCAATAAACTCTCCATGGGCTTATTGTCTGTATTGGGCTTGGGGG
TGGCTGCAGAGCTGCAGAAGCCCTGCTGAAGAAAGTGAAGAAGCTGTTTGGAGAAGCCCG
GGAGAAAACGGAAGCCATGGAAAGGGATCTCCAGGAGAAGCTGACTGACTACAAAAACCA
AACAGATGATGCTTGGGACCTGTTGAGAGAAGCTACAGATAAAATCAGAGAAGCTGATCG
CCTATCAGTGGCAAACCAGAAAACCATGGCCGCTTTGGAGGTGAGTCTTGGGGATGCTTT
CTTCCCGGTCTGGGAGAGTGTGGGACAGGGGGGAGAAGGGAAGGAGGATGTTGAACCTGC
CTGGAACGAGTCAGATTGATCCCCATTTACAAAGGTTGAGAATGACAACTCTGAAAGAAA
AACTGTAAGAAGTAGAACAGGGACTGTTCCTTATTTTCTCCTAAATTTCCACTGCCCATG
AAATCAAATAAAAGTAAAAGATTTTTACGAACAATGTGTACAGTGGAAGGAGCTCTTTAT
CGGGAGTCAGGGGACCTTGGTATTACTATCAGCCGTGCCTCTAACTAGGAGTATCAACCT
CTGTAAGTCACTTCACTTCTCTAGACATGAGTGCCCCGACTATACAAAATGAGTGCATTA
TCCTAGATACCCACGGTGTCTTCAGGGTACTAATAGCATATCATTCTACAATTCACCCAA
ACTCATCCACAAGCCATGATTCAGACGTGTGGCTGCCAGAACTCACAGGAGTTCCCTGTA
TTTTCAAATGGAATCTGGGCACATGAAGAAAGGGTCGTTGAGAGACCAGAGATTGGGGAA
ATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAAGAGATACTTCTCA
AGAAATGATGGGCAGCTTCTGCCTTTCCCCAGTGCTGATGCAGCTAGAATGCAAACAGAT
TTCTCCATCTCTTTCTCTCTTTTTTTCCAGTTTATTCCTTAATACTTACCATGGCAAACT
GATCACTTTTCCCAAGTAAACTCAGCACACATGACAACACCAACTTGTATTTCAAAAACA
ACAGCATTAGCTTTCTCACCAGGAACAAACCTACTTTTGCTGTTTTCAAAATATCTCACC
CTGGCAGATCTGAAAGCAGTAGTGGACCGATATACTTTCTAACATATAATTTCCCCTTCA
ACTATAACCAAACATTCTCTGGCCTATATTATGCTCTCAGAAAATGTTTGTTAAATGACA
GTTGAATAGAAACCTGAATTTTGTTTAGCCACTCATTTCTTTCCGTTTTCCTTTGGATTA
AGAGGTTAGAGGATGAATTAAATTGTAGAAGCATTTTTTTTTTTTCCGAGGCCCTCTCCT
GGGACTTAACCTTATCATTCTGGTGAAAGATTGAGAAGGCTCACTTTTTTCTTCGCTGGT
GTGTCTAATCTTAATCAGTTTGGAGTCTACCGACATGCTGGCAATGTTAAAGAAAAAGCA
CCACCCTGTAAGGCAGGACGCTGGGCCCACCATCATCTCACATGCTTCTATACAATTCAT
CCTCCTTTGAGATGTGCCAACGGTGTGTGTGTAACTTACCGGAAGGTGCGATGCTCCATT
TTATGACTACAGTTTAAGAAATTAAAATGAAGGATATTAAGAACTTTACCTTGCAGAAAG
CATAAGAAGCATCTGGGCAGTATTTCGAGATGAGTTCTGGCAGCACAGCAAATGGTGCTT
TCTGTTTTTCCTTCCTTTTCGTGATGTTTAAGACCTGGTGCCTTCATCCTTGGGCACCCC
TCAAGAAGCCTGGAGCTCAGGTAGTCAGCACTGAAGTTCTAGTGGTCTTTTTTGTATTTT
CATTTCATATGCCTTGCTTAACCATAAGCTGGTTAAAAACTGGCTGGAGAAAATACACTG
AAAAAATGAACACCAGTAAGGCACAGCATCTTTTAGGTGACTTATGTCTGAGTGTCAGGA
TGGTGCCAGACTCGATGAAAAAGAATCACCCAGAGAGCTTGTGAAGTGGATAGATTCCCT
GGCCTCTCCAGAGCCAGCCGCTCTAGGGTGCAGTCCTAATGGCCCAGGTGACTCTGATGT
CAGTACAGGTTTGAGAAAAACGGGTACACTGTGTATGTTTGATTGACTAAGGAACACACT
TTTCAACAAATGACTTCACCGTGCCTTTGCCCATGAAAACGAAGGTATAAGTAAGACCTA
ACTCCAGTGTTTTCTCTTTACTATGTTGAGGGTGAAGATGCACCTTTTCTTTCATTATTA
AAAACGTTTCTTAAGCGCCTACGGAGAACAGGTGGTGTTTTGGGCTAAGCCCAAAAATGT
GATGATATCGGCACTGGTCCTCACTGCGAGCGCCAAAGACCTGCAGCATCAGCATCTGCT
AGAGGCCTGTTAGAAATGCAGATTCCCAGGCTCCATCTCAAACCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGAAACTCTGAGGATTGGAC
CCCGCAAGAAGTGTTTTAAAAAATCCCTCCCTGATTCTGATGTGGCCTTAAGTTTGAGAG
CTGTTGATATAAAGGAATAAGTAGCAGGGAAGAGCATTCCTGGAAAAGAGAAAAACATAT
GAAAAGGCATAGAGAAAAAAAACAGCAAAGAATTTTGGGGAAAATTCAGTGGCTGATAGG
ATAGGAATGAAGGCTACGTGGGAAAGTTTAGAGATAGGAAGCCAGCAAACATAGGTGGAG
TGAGGTAGAAGAAAATTGCATTTGGAATTCCATTTGAATATATATCCCAAAGCTGTAGAA
ACAAATTGGAAGCAATATTGGAACCAGGGATGAAAATTGCGTTTAGGGAAATTGGTGAGT
GATTCATGGAAACTGGATAATTGATTTTGTTTTGGGAAATATGGTGAAATCAGGCTAGGA
ACATAGATTGGGGTCATAAATAAATGTCACAAGGCACCCGCCACATCAAGATTCTGTTGC
CAAGCAGGCTGTATGAGGTTGAATGAGTCCTGGCCTCAGAGAGTTTATAATCTCCTAGAA
AATGCAGGCATCAAAACCTTTCGTGGCATGTCACACTGCGATTAATATTGATTGGGAGAA
TCAGCAGAAGATTCACAAAAATGATGGCATCATAACAGAAATGGAGGCAAAGGATGGAGC
AGCGTGAGCACAAACAGAGCTCAGGAAGTATGAGGTGCTTTTAGGAAATGCCAAAGAGAG
CAACAAAGCAGAGTCATGTGGCTACATAAAAGTCTGTAGCGGCAGATGGCTCTGGAGACA
GCATTTGGGGCCAGATCGTAGAAGGCTGTGAATGCAGCCTCCTGGATGGCCATGGGGTAG
GAAGGGCATTCCCAGGATGGCGAGGAGGCAGAAGCAGACCAGATGAGCAGTTCAGTTCAG
CCAAGGAATATGTATGTAACCGTCTGTCCCAAAGGCTGCCATTATTATCATGCAAAACAC
AAATCTGTGAAGGAAGTAAAAGGTAATTTGCTAGACAGAGGAGAGAAAGATAGCTTTAGC
AGGTTCCTCAAGAATCCACCACCCCCACACCCACCCCTGCTGCCCAAGCAGAACAAACAA
AACATTGGTGTTAAATGTGCAGACCTCTGGAACAACCTAAGATCTAATTAATTAGAAAAT
AAATGTAGAATTATAATCAACCTTGTTATCCAAACAGAATCATGTAACGATTATATATGT
TTATGGCAGACTTTCAGAGCATTATTCTCGCGATGTATACATGGGCCTTCTTTTTTGTTC
ATCAAGCACTCTAAGCTTCCTGCCTTGGGTACTTTACATCCTACATCATTCTCTATCTAT
TCCCTTTCTCTGCTTACTTTATAGCATTTATCATTACGTAAACATTTATTAAACGTTAAT
TTAGTTATTTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTTTATTTCAATGA
ATAAACAAAATGTCATAAAGCAAAACAACGTTATCTCTATACTTTTAGCAAGATTTGAAA
GCTCCAAATCTCTATCATTTCTCAGTTCATAGCTTGATTCCATCAGTGTCCAAGCTGAAA
TTAGCCACCTCTGAAATCTCCTTTATCTCTAGATCACCATTTCTGTTTTAATATGACAGA
AGAACACTTTAATCTTTGGATGGCAATTGACTCTCTAATGTGGCTGATTTAGAACTTCAA
TAAAAAGTCACTTTACTTCATTGAAACAAACAATTATAGCTCTTTACCTAATACATTTGT
GGAAATATCCTCCTTACTTCCATTGGTACAACATTTTAAACTATCTTGATTTATTAATTC
AAACAAGCCTTGACGAAAAAAAGATTTGAATTTCTGTACAGGGTGTAATTTTAAATCATC
TACACAAAATCTAAGAGCTAAAATTGGCAGGTTTTTTGTTGTTTTTTATAGATTAAAAAA
ATGTTTAAAAGATACATAGATCATACAAAAAATTACATTAAAAAATATAAGAGGTGTGGA
GTTGTATGGGAAATCTACACATCTGCATGACTGTTTTGCAAGTTCACAATATCTGTAACA
AAAATACATTTAAAAAATAGTGTGGGTTGGAGGAAGAATACACCAAATGTAAGATAAGGA
GGATAGTTGGTAGTAATATTTTGACAATGCTCTTGCATAGTTTGTAACAAATGTTTCACA
CCGATGCAAAGAGTTGGTGGAGGAATGATGTATGAGACCCCTGTGTGATGTTATGTATGT
TTATTTTGTAAGTTCGTAATCTTTACTATACACTTATTGTTTGTGTGTTCATGTATGAAT
GATATACTTCAATTTTTAAAAAAGTAATTATCAACTACAACAAAAAATATATATATAAGA
GGATTCCATATACCCCAACTCCCCCCTGCCCCCACTCCTCCTACATCACCAATTCTGTCA
TCATTGTGGCACATTCATTGCATTTGATGAATACATAAAATTGCCTGTTATGTAAAAGAA
TGCCAGATCCTTGGAAGATAAGATATGACTTGTAATCAGAGACACCTAGAATGCCCTTCC
ATTCGTTGGTGGTAAAGGGGAACTGACATCTCAGGACCAATTCCCCAGCTCAGGAGTAAC
TGAATGAGCTCCTGAAATATCACCAGCACAAGCCCCAGGAATGGACTCTATTTACTAGTA
TCCATTCAAGATATTTATTGAGGAAATTCTTCTAGTTAGAGGAGATGCAGTGATAAATAA
GATTTTTATGGAATTTATATTTTATTGAAGGAGACAATCACTAGAACAATAAATAGACCT
ATAATGTGGCCATAAAGGCTAGAAACACTGGCTAATATACATAATAAATGGTTTATTGCT
GTATAATACATGTTTTGTTAGGGGTGCTAGCCTCCACTAGTGATGTGTGGCTCAACAGGC
TGTGCATTTATTTCCATGGGCCCCTATGCATGCCGCTGTGATGTGTGGCCTGAGATTATT
GGTTTCTTCGATTTTCATTTAAAAGCATTGGCTTTTAGCATATTTCAGATAAGGTAATGG
AGATGGTTCGTGTTATAAAAAATAAAATAATATTGTCATGTTTCTATAGTTTTGGTGGCC
ATACTATAGGACCTAACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGTAAATGGACTAAAAGTTGCTAAGGACTATCATTTATGCCTTTATACCTATGAAG
TAGCATTTTTTTAGATAATTAGGTTCTTCTGGGTGTAAATTGGCTTCATAAATTTCTTAA
TCATTTTCATTAAATAAGTGCTTTTATTCTCTGTGCTCTTTTTGCTATGTTAGTAAATTT
TAAATTTCATTAAAAATGAAGCATTTGTAATTGTGTGTCATAGAGAAATTAGCAAGTGTG
TGGAGGCTCAGCTTCAGTTGCTTCAAGTGTCCTCTCTTCTCTACATATCAGTATGTGGAA
GACATTCAAACGAAATTGCCACCAATGTCTGAGGAACTTCAAAATAAAATAGATGACCTC
TCGCAAGAAATGAAGGACAGGAAGCTGGCTGAGAAGGTGTCCCAGGCTGAGAGACATGCG
GCTCGGTTGAGTGAGTCATCTGCTGTACTTGACGGGTATGTCGTTGGCTGTTGGCAATGT
CTATGTATTTTGACACACGTTCAGAAGTTTTGCCTAACACAAATGGCAGAGAATTGCTTT
CAAGTCTTGATTTCTGTAATTAGGAACATGCGAGCTACATGGCCTTTCTGTGGAAGTGCC
TAATTAGGAAGGTCTGGACAAAGCTCTTACTGGAGCAGCATCAAAATCAGAGTTAAAAGT
GGATGCAAATATGGCTTGGTAGGGAGTGAACACAGCCCTAGGCTACACTTAGAAAAAAAA
ATTTCTCTACTTTATTAGAAAGCCTAGCAGTTGCCTCATTAGCATTTTAAATAACAACAT
TTAAATCCACATTCCTCATTAAATTTCAGCTTTCTATTTCTAATGGAATAAAAATAATTC
ATTTTTAAAAGGCTGGCTTTGGAAAATGTGGCCCCATGCATTGCCTTTAAGCCAGTGAAT
TTTAATCTTCTTGCTTCTCCGGTTCCAAACTCCAGGGAGATGCTCCACGCTCCCCTCTGT
AATAACAGTTCACGATAGCCGGGATTCTTAAATGGGTCTGTAGCGGGAAGGGCAAGTGGG
AGGAGCATGGCTTGTAAACATCTCCCTAGGTAATTATGGTATGCATCCTCTACTTCACTA
GAGCGAGCACTTGGGGGATTATCCCAATAAATATAGATGCTATTAACCCCAAGAATAATC
CTCCCAAATCATTTGGTGTTTAATGTCTGTCACACACAAGGCTCTATCCCAATACTTAAT
ACTCATATGAAAATATTACTATGGGGAGACCTTGGAATTATAGAAACAACTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CACAGAAGAATGATAGGGAAAGCAGCAGACAACTAGTCAAGGACATTTTCACCATTATTC
CCAAATGTCCTTCCATAATAATCGGTGCCTTGAAAATTACCTGTTGTTTGTAGCCACACA
CAAAGCTGGTTTTGCAAGAGGTTTTGACTGTCAAAGTACACATTTTATAAAACACATCAA
GCCAGATGCTTCTAACAATTTACACTCTTTTTATCCAATGAAAACCCCTGATCATGCTGT
TGTTATTCCTCAAATTACGTTTGGAACTAATATTTTAGAATTTGGGGGTTCTGACTTATG
TCACATGGTTGGAGTATCTTCAATAGTGATGAATCTTCATCCTTTACATGTAGAGCAATC
TTTTGTAAATAATTTGTGCAATAAATCTTGGGAATACTGTTTTAGGTCAAGAACATTTCT
TAAGAGTTAAAATGTTCAGAACTACCACTTAATCCTTTTGCTTCATACAGATTGCCCAAA
TGCATCAGAATTTCAGAAAGAAAAAACAACAACCATGATTGGACATTTGAATGAAATATA
CGTAAAATATTGGTAATAAAGAAACAGATCAATATTTGCTTTGGTATTTGGCAAAAAAGA
TTATTTGGATCTCAGTGATTAATATCACTGACTTTTACCACAGTCTCAAGAGGTTTTGTT
TTGTGGTCATAATGAAAACATCATATTCCAGCAGCAGTTTCTACTGTGATTTCTCTGGAA
AAACCTCTACTAATGCCATATGTTCTTTTTATTTCTTACTCAAAATGGTAACACAATCAT
TACTGAAGCTTTCCTATGCTCAATTATCTTTTCAAAATGAATCTATTTTTCACATCTAAG
CTGAATTTTTTACTCATTATTGTGATGGTTTAAAGCTGTATGTACCCCAGAAAAACATGT
TCTTAAATTTATCTCATGCCTGTGGCTGTGAACACGTTGTAAGTAGGACCTTTTTGTGAG
GTTACTTCACTTAAGGTGTGGTCCACCTCAATCAACATGGGTCTTAATCCTATTACTGGA
GTCCTGTATAAGAGAATGAAATTGGGACAGAGAGAGGAGAAGGCCACGGGAAGCCCCATC
AAGAGAAGAGAGAGGTGGCAAACTTGGCCCAGTGGTTAGGGCATCCGTCTACCACATGGA
GGTCCGCGGTTCAAACCCCAGGCCTCCTTGACCCGTGTGGGGCTGGCCCATGTGCAGTGC
TGATGCGTGCAAGGAGTGCCGTGCCATGCAGAGGTGTCCCCCACAGAGGGGAGCCCCATG
CACAAGGAGTGTGCCCCATAAGGAGAGCCGCCCAGCGCGAAAGAAAGTGTAGCCTGCCCA
GGAATGGTGCCGCACACACGGAGAGCTGACACAACAACATGACTCAACAAAAAGAAACAC
AGATTGCCATGCTGCTGACAACAACAAGCGGACAAAGAAGATGACGCAGCAAATAGACAC
AGAGAATAGACAACCGGGGTGGGGGGGGGAAGGGGAGAGAAATAAATAAATAAATAAATC
TTAAAAAAAAAAGAGAGAGAGAGGGAGACCAGGAGATGCCACCATGTCACAGAGGAGCCA
AGCATTGCTGGCAAGGAGCCCCAGAGTGCCAGTCTTTGGAGAGAAGGCATTGCCTTGATG
CCTTGATTTGGACTTCCTTTTAGCTCCAAAACCATAAACTAATAAATTCCCATTTGTTTA
AGCCTAATCCTTGCATTGGCATTAAGCCTAGTAAACAAACCATCTTCTTATAGATAATTT
GCTATTTAAAAAGCCTAGTTTTTAACTTTGCCAATTTCATCTGTATTTTATTGAGTGACC
ATTTTCAGCATCTAGCACAGTGCCTGCCAAATAGTGGCACTCTTAAGTGAAAAAAATAAG
GACTGAAGGGAAGAATTTCATTCATTGCAATTGACATTTTTCATGTTTATTTACGTTCTT
TTGTACTATAAAAATCTTGCCATTATCAGTTTTGTCTTTGTCAATGTCTTTAACATTTTA
TGTTAAAGAGCTGTTTAATTTCACCCAAATTTATTACTATCGCTTTATACTAACCAGATT
CTGCTTTTTAAGCTAACATGAAATGTGAATTTCTTATCACCAGTGATTATGCAGATAAGC
TAGCCAGCATCAACCATAGAGTTATGGCGAGTGGTAATACATTGCTACTTGCCCCCCATT
ATCATTATTCTTCCTCTCTTTCAATAAACTATGTAAAAATAATTAAATATCTGCAAAGTT
ACAAGAAAATTGCTAAAGAGAATCACTGATTTATTAAAAATGGCTGTTAGTGAACACAAA
GAATGCTGATTTGTCCCAGAAAGTTTGTTGAACTGCATTTCATGGACAGAATAAATAAAG
CTTTAATTTTACTAAGTCATTATAATTTGACTGTTTTGCTGGAAGAAAATATATTTGCCA
AACATTAAGTTGAGCAATTACCTTGATAAAACAAGCATCTCGTAAATATAAGATCTGTTA
TTATGCTAGAGATAGAAATAAACAAGGATGGGTGAGATTAAGTTTATTATTTATTTATGC
AAGAATTCAAAGGATGACAATACAGAAAAACCCACCAGTCATTTGAATAGAGTCCTATAA
AGAAGGAAGAATGTTTTCAATGAATTAAAAAGAAAAAATGTAGAAACAATGCAGGAATTT
ACAGAAGGAGAAAAACTACCTATAGACAAACAATAAAACAACCAATTAGCACTAAGAAGA
AAATAGAGGTGAGAAAATTTGAGAAGAAACATTTTAACAAAAGCAGCCATTTGTATATGA
CTTACACAAAATACAACTGAACCATGAAGATACAGAAAGACTGAAAGCACAGGGGATGGG
AAAAGACTTCAGGACTGCTAACCAGAAGAAGCTGGTATGCCAATGTTAATAAGAATCAAA
ATAGACTTTAAATTTTAAAAATAGGTATAAAGAGTCATTAGAAATGACAAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTGATAACACATAGCCTCACAATATT
CAAAATGTTTGACATATACACATAGGTCATAACACATAGCCTCAAAATAAATAGAGACAA
AAATGTAACAATAAGACAAATTAACCTCCATATAGTAGTAGGTGATGTTACTGATTTTAC
CATTCCTCCCTTAAAATTTGATAGTTCAAGCAAAAAGATGTAAGGATGCAGAAGATTTGA
AAAAGACCATTAACAAGCTTGAACTACTGGTTTCATAGAACTGTATATCAATTAAATAAT
TAATTCTATATCCTTCAGTGGGTAAAGCACACATGAAACATAAAACGCATATTTATATTA
AAAATTGATGCTAAATATTAGCAAACAAAATAGTCTTTAAAAAAACTCAAAGTAATTCAT
GAATCAAAGGAAAAAAACAGAATTGGAAATGACAAAATATTTAATAACTGAATGAAAATA
AAACTACTATAAAAATTTGTGGGGCACAAAGAGGCACTTGCAAGAAAATGTACAGTTTTA
AAGGCAGAGTTAGGGAAAGGATAAGAATTGAAATCAATTATCCAAGGCTTCTGTTCTAGA
AGTTAGATGAAAAAACAGCAAAAAAAGCACAAGAAAGGAGATAATTAAAATGAAAGCAGA
AAGTAATGACTTAGGAAAAAAACATGAACAGGGTTGGCAAAATAGAAAACTGATTCTTAG
AATAAGCAGGCAAATAAACATGAATAAAAGAACAATTAATTGAACAAGGAGAGATGACGC
ATATAAACCATATTAGGGATGAAAGGGGACATAATTATAGAGACAACATCAATTAGCAGA
TAAATGTGGACCCAGCAGAGTATAGGAGCAACTTTATGCCAATAAATTTGAATGCCTAAG
TGAAGTAGACAATATATCTAGACCAAAATTTACTCAAAAAGAAACACCAGGGGAGCAGAT
GTGGTTCAAGTGGTTGAGTGCCTGCTTGCCATGTATGAGGTCCTGGGTTTGATCCCTGGT
ACCTCCTAAAAAAAAATAAACAAAAATTCCAACTGTCTTTGGGGAGCAGATGTAGCTCAG
TGGTTGAGCGCCTGCTTCCCATGTACAAGGACTGGGTTCAATCCCCTGTACCTCCTAAAA
AGAAAAAGAAAAGAAACACCACCTGAGTTGTCTTATAACCATTAAATGAATTGAATCAAT
CCTTAATAATTTACCTAATACAAAACAGTATCTACCAAAATTTCCTGGACCTATTATCCA
AAATGTTCCTAACAACAGAAAAGGAAGGAAAGGTTCCCAGTATATTTTATTTGGCAGGTA
TAATACCAGGCTAGGACAATATTAAAGCTATCAGCTAATCTTAAATAAAACTGCAAATAA
AATATTAGCAAACCAAATTCAAATAATATTTTAAAGATCTGGATAAATACAGCAAATTGT
TAATATTCATCAAGGCTGAATTGGGAATATAGGTATTTGTCATTAATTTCTGTTCTTATT
TGTATGCTTAAAATATTTCCTAGTTAAATGTTTTAATTAAAATGAAAATAAGAGAAGATA
GAAAGTCAGTGTTACAGAATGATTGGTCCCGAAAAAACAAAACAACATGTATCTAAAAGG
CTACTAAATATGAGACATCAGCCTCATCCTTCATACCAACAAAAGGCCCTAGATTGATCG
ATTGATTGATTTCTTTTTAAATTGAAAAGAGCAGCTGATAATTTCATGCACCAGTCCCTT
GACCTAACTTTTTTCACCCTTAAGTTCATAACCACTTCTAAATCTTCCACTATTTCTTCT
GCTACCAAATCTCTTAATAATATCATTGTCATGCTACTTGACTCAATTTTAGAAATGATT
TCTTCATGTCCTACCATAATGAATGAGATTCATTTAGGATGTAACATAGTTATGAATTCC
AAAAACAGATATTGGATTATGTTTGTAATCTGGGCTGTACCTGGGCATGATTAAGTTATG
ATTAGGGCTTTGATTGGGTCATGTCATTAGGGTGTTGAGACCCCACCCCTTGGTGGGTGG
AGACTCACAGAGAAAAGGCATGGCTAAGGACAGAGATGAGGGTTTTTGATGTTGGAGTTC
GATGCTGAAGCCTTAAGCTGGAGCCCTGGGAAGTAAGCACACAGCGGAAAGAGAAGCCAG
CCTCGGAAAGAGAGGAACCCTGAACCCAGAAAGAAGCAAGAACCAGGAAGATAGGAACCC
AGGAAGCCTGAACCCTTGCAGACGTCGACAGCCATCTTGCTCCAACACGTGGAAATAGAC
TTTGATGAGGGAAGTAATTTATGCTTATGGCCTGGCATCTGTAAGCTCCTACCCCAAATA
AATACCCTTTATAAAAACCAACCAATTTCTGGTATTTTGCATCACCAGCCTTTGGCTGAC
TAATACAGGGTGTATCCCATCAGATTTCCTTCCCATCCATTTCCCAGTAGAGACACATCA
CCATGTTTAGATCCTTCCCTCTTTGCTTCATAAACTTAAATAATATACTCAGAGCTTGAT
TTGCTGTGCCATCAGTGATGGACTTCACACTCTTTGATGATGTTGAAGGTATTTGTGCTT
TCATCCTGCCCTTTTAGCTACCCTTCTTGCCTCTACCCTCCCAAATTCTGCCCTTTTAAC
TTTTCATATTGTCACAGTAACATTCTATCCATAACCGTAATTAAGCATTCCATGACAGAA
GGTAGAAGTTTTTTCCTCTAGAGCCATTTCAATTTTTCTTCAATAGACCCCCCGTCCACT
ATTTTTTTATTTTAGTGAGGAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGTCTCCTC
TGAACAATTTCTCTACTTACTTAGGCTCTTGATACTGTTTTCAGAAAATGACCAATGCTC
TGCTCAATGTTCACATTTTAAATGCTTCTGAAAGGGCTATGCTTTCAATACATCTTTAAC
TTCATCCATGGGAATGCTATGCTTGAGGCTTCCACTAGCCCAGGAAGTCTTTGGATGAGT
TAGAAAAAGGTATCCTGCCAGGGAACATAACTGCAGGGCACATGGCTTGGCCACCACTGC
TTGTGCTGACATCTGTGGGTTCATAGACTCTGCAGCTCCAGCTCCCTGGAGCATCTCTTA
TATTTTTAGGAGATGATAAACCTCTCTGCTCCAATTTCTCTTGTCCAGTGGCCTGCTGCC
TCTGTTTTCACTGCTTTGTGACTATGGGGCTCTGTTTTCCTATTTTCTTCTTTCCAGAAA
CAAAAGCTTTAGAATTCTTTAGAATTAAAATTTAAGCTGAGAGTAGAACCCCAGGGGGCA
GAAGCATGGATAACCACAAAGAACCCCCTTGGTATTTCCCTCCTTTACTATATCATTGGC
ACCATTCTGTGATTTTCATATAGCTAACACCTGCCACATTGTAGGTGTTCACTAAATGCA
GCTTCTCCTCCCATGAATGCTAGAAATCTAGAATGGCTGGGAGGCTCCAGATTTTCAGAA
TTAACAGATATTTATTTCACTGTGAGATGTAGGAAAGTTGAACAGAGAAGAGAAGTTCAA
AGGGAAAATTAAATTATTTTGTTTCCCTACTTAGTTTGAGATCATGTCTGAATATTGATC
AAAATTAAGTTCAAGTGGTATGCTGGAAATTCCTAAGCCATTTGGTGGAAAATGCTAGCA
GGTCAGCATTTGGGAATTAGAAGCTCTGTCTCCAAGTTGAGTACATATTGTCTGTGTATT
GAGCTGTGTCAGCTAAAGAATTACCTTTTTCAAGAACCAAAGTACAGTCCATTCTGATCC
CTCATTGGCTTAATTTCTATAGTGAATATAGTCCCCATAGCTTAGAACTTGACCTTTATG
TGATTTAATGTTTAATCTCTGGTTACATAAGATCATTTCTTACTGCTCATTGGCCCTATT
ATGGCTCTTGTAATAAGTGCTTATTAGCTTCTTATTCATATCCACCACGTTTCCAATGTT
CTCTTTAAAGTTTTAAAATCTTATTTTAGCCAGATACTTATTCTACTTCACTTGTGAATA
GCATTATAAAACACACAGCATAATCAAAGATAAACAAAATTCTCACCTGCCCTCAGACCA
GCAATAATGATTTATGCTTTAATTATTTGTCATTCTAATAATAATGCTTTTCTAACTTTT
ATGTCCTAGTAATTGTTCTTTTCATTATTAGGTTTTTCAATCCTTGTAATAGCAAGATTC
TTTTGATAACACTGCTATGGGTCAATGTCATAAAATAATGTGAATCTTGCAAGAGTATAA
TTAAACATGAAGGCATTGCTAATGAGTGTTTAGAAATGCAGTCATATCTTCTCTTTAGTC
TGTCTTATTTAATATTTGCTTTTTGTAATTGGATGAACCAAAATACATAAAGAATACTTG
CAAGGTGATTTTTGAGTTTTATTTTCTACATAAAGGACTGTGTAAATTTTAGCAAAGTAC
CTACTGCATTCAAAAGGTCAAAATATGGTATCATCCAAGTTGTAAACTTTAATTTGCATA
TACCTCATCTTTTATTCTTGTCAACCAAGTTACTTAGTCATTAAAATACTAATTTTAACT
TCTTATTAATATCTGTAAGAATTGCAATTTAAATTTTATACCAATGTAATATTAATGGGA
AAAATCATATAAAATCATAATTGATATAATTGAATCTGCCACTAAAATAATTGAGCATTT
CTTCTTCTAATTGCTTCCTTGGCAATTTAGTAACTTATCTGAGAACTGAGTGAGTCATGC
AATAGCAAATATGAAAAAAATGAGTGAGAATCTAAATGACGTAGAAAAATATTAAATCTG
CATGTGAAAATACTGTTCATTAAGCCACCATGAGTTTAGCAATTTTCTCTAAACATTATA
CATTCATTTGAGTCAAAAATGAAAAATCTATGGGGAGCTATTTTAGTTTTCTTGGCTGCT
AAAGCAAATATCATGCAATGGTTTGGCTTAGACAATGAGAATTTTTTAGTTCATGGTTTT
GAGACTGAAGAAAAGTCCAAATCAAGGCCTCAGCAAGGTGATGTTTTCTTCCTGAAGACT
GGCATTCTGTTCTGATGCTGGCTACCAGTGATGCCTGGTCCTGGGCTCCTCTGTCACATG
GCAAGGCATGTGGTGGCCTCTCCTGGCCTCTCCCTCTCTTCTGGGTTCCACTGAACTTCA
GCTTCTTGCTTCTTGCGGTTTTCTCTCCCTCTGTCTGAATTTCCTTCTGCTTACAAAGGA
CTCCAATAATGCTATTAAGCCCCATCCTGATTGAGTTGTGTCACACCTTATCCAAAGTAA
CCTTATCAAAAGGTCCTATTTACAGCTGGTTCATACCCGCAGGACTGCATTAAGTTTTAG
AACATATTTTTCCGGGGTATATAGCTCCAAACCACTATAGAAGCAGAGAACAAACCTGTA
TTTTATGAGCATAAGACATGTAAAAATTCAGGGCTTAATTTTTTTTAAATCAAAGGGCTG
GTGTCCTCATGCAGAACCACAGAAATCTTTGGGATGACACTACAATTCAATATAAGTTTG
AGCTAATTTTCTTCAAGACAACAGAGATCTCAGTGTGCTTCTACCAACCATTTAGAATTT
CTGCCTATGGGTGGAACAATCAAGAGGTAAGATTTTCATCTTAGGTTGATTTTGGACATA
ACCTGGAAAGGAAACCCTATGCTCTGCTAGGATCATCTCTGACATGATAGCACTTCTCCA
TTGTCTTACTTCAAAATCAAGAACTCTGGTAGAATCCATTCACCAAACTTTCTCTGGACC
ATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCC
CAGTCCTGATGTGTATGAACCCATTGGTAAATAAGATCTTTGAAGGTGTAATTGGTTAAG
GTGTGCCCAGACTGAATAAAGATGAGCCTTAATCTAGTATGACTGAAGTCCTTATACGCA
AAGGAAATTGGACCCAGAGAGAAAGCTATAGGAGAAGCAAGAAGCTGGATGTCAACAGAA
TCCAGAAGAGAAAGTAGTATTGCCATGTGATGGAAGAGCCAAGGAATATCAAGATTGTTT
GACCAACCAGAAGATACCAACTCAGGGAGGAAGCATGCCTTCTAGGCTCTAGAACCATGA
ACCAATAAATTCTTAAAGCCAATCAACTGTATGGTATTTGCTTTAGCAGCTAGGCAACTA
ATTCCCAACTCATGTCCATTACAAAAAAAAAATAGGAAATACAGAAAAACAAGAAAGAGA
AATGTTAAACGCAAATAACCCTGGCAACTACAAATAATCGTTTTTTATCACAGTTTTGTA
ATTCTGTGCAAACCTTTTCTTATGCAAATAGTTTTTGCACAAATGTCTGTTTTATAACTC
AATATATTAACATCATATGCACATTGGATTTTTTATTTCTCAAAAATTATATTCCTTAAA
ATGTATATGGAACTAGATTGTACCATTCCTTCTAAGAATTTATTATAGTAAGAAAGTGCT
CCCTGATTTTTAATAGTATCTAATATACCAGAATATGAATAATTTCTGACATGTACTTTA
CATGAACATATTACAACTAATCATTAGCCCATACATATATTCCTTCACATTTTGAACAGT
TTTCTTTAGTTGAAAAGATTTTAAATTTAAAATCATCTAAATTAGCATATTATCTTGGCA
TATTAATCCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGGAA
TGTGTGAGACTTGCCTTCTAAAATAAGCAGTAAAGGGGGCAGAGAATAATGGAATACTGA
TGAGGTTTCCCTTGCTGCCATCTTAAAAAACAACAACTACAAAAACTGCATCCCTTCTTA
GAGCTTGAGACATCTAAAATTTTTCTTAGTACATCAATTGATCAATTGATTTACCAATTG
ATCAATGGCTTGATACTGTAACAAGAGTCACTATGAATATCTAACAAACATTTATTAAAA
GGAAATGAAAAAAAATATTTAAGCCAATTAAGTGCCAAGTCCTCTGTTAAATGCTTTAAA
CACTATCATTTCAAATTTTCCTCTTTCTTTCCTCTGAAATGAAGCCTTAAATTTTCTCAC
ATTTTCTACAAATGATATGTAACTAATAAAAACATACAGCAAACTAGATATAATTATAAA
ATACCTATCATATGGTATTATCATAAAATTTATATAATTTTTTATTTGTGTGTATTCACA
CATACAGAGCCCTAAAGAAGTTTTAATAAAAATGCAATTTCTGAAAGGCAAGGAGCAAAA
TGTCTTGCAACTCTAAGAACCTCATTTAAATTTCACATATGCTGTAGACACAGCTCAGAA
ACTCAGATATGATGCTTATGAATATGTATAAAGTATAATTAGCTTGGAAAATGCTGCTTC
ATCACCTGCCTGAGACTGTTGATATGCTTCAGTGACTTACTAAGCAATGTTGGAAAAAGA
TCTCTCCAAATCCCAGTGATATGAAACAATTCCATTTATCCATAACACGTTAGTGTTTTC
CATTCTGTTGTCATATCATAGACTCATCTTTTAAACCTGGATTGTTGGTGGGCTGTTTAT
AACTGACAGGCATATGGCATCAGCAGTTTTCTTTCCTGTTTTGGAGTGCTTCTTGAAGCA
TTGAGATAGGTCTTATTCCTCCACATCTATTGAATCCAAACCCCTCATTCCCACTGCCAT
GCCTCAGGTCACTCTCTTTTCTCTGATCTACACTTTTACAGTGGCCCAGTGATGGCTCTT
TCTCCCACACATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTCA
GAGCAGCTTTATTTCTAAGAATCAAATTGGAAACAACCCAAAGGTCCATTAGGAAGTGAA
TGGATAAACAGATTGACATATACCCATATGATGAGTACTCTTCAGCAATAAAAAAAAGAA
TAAAGTAATGGTAAACACACAACCTGGATAAATGTAAAAATAAGTATGCCAATTGAAAGA
AGACATACAAAAAGAGTACACATAGAATGCCTCTACATAAAATTATTTTTTTTTAAAAAC
TGACTATAATGACAGAAGTCAGAGCAGTATTTGCCTGGAATGGAAGGCAGATAAGGAGAG
TTTGAAGTGAGGGATTAAAAAGAAGTAATGGACATATCCATTACTTTGATTGTGGTGATA
TTTGATGGCTATGAATATGCCAAAATTTACCAAACTGTAAATTTTAAATATATGCAACTA
TTATATGTCATTTACACCTCAATAAAACTGTAAAAATATTTAAATTTTTTAAAGAAATGA
ATATTGGTCACCACTGTTCATAGTCCCACAATTTCCACAGCCCAAGCTTTGACCTCTTTC
CATGTTATTTGGGCCTTCTCTCTCTTTTCTCTCCTCTCTCTTCCATTACATTTTCTTAAA
CACAACTCTCTTTCTCTTTTACTCCCATTACTTAATTTGCATTTCCAAGGTTAGTTTTTT
GGTTTTTTTTTTTTTAGAGATTTATTTTATTTATTCCTCTCCCCTTCCCCCACATTGTCT
GCTCTCTGTCCATTCGCTGTGTGTTCTTTTGTGTCCACTTGCATTATCCGGCAGCACTGG
GAAACTGTGTCTCTTTTTCATTGCATCATCTTGCTGCATCAACTCTCTGTGTGTGTGGTG
CCACTCCTGGGCAGGCTGCGCTTTTTTCACGTGGAGCGGCTCTCCTTGCAGGGCACATAC
CTTGTACCCCTACACAGGGGCGCCCCTACGTGACATGGCTCTCCTTGCATGCAGCAGCAC
TGCACGTGGGCCAGCTTAACACACAGGTCAGGAGGCCCTGGGGATCAAACTCTGGATCCT
CTATATGGTAGACAGATGCTCTACCAGTTGAGCCATGTCCACTTCCCGAAGGTTAGTTTT
TAAATTATGGTGTTTAAGTGCTTGCCAGATTATGTTTTTATATAAAGGCAATCACACCCC
AAGTCTTTGGGAAGATGGTTTTGTGTTTGTTTGTTTGGGGTTTTTTTTCTTGTTGTTTTT
TTGGTCTCCTTTCATCTAGTAATATCAGTGTCCCTCTTAATGGCAGGATCATCATTATCA
ACATTAGTTATTTTACTCTGATAGTGGTGGCATCTACTGAGATCTTTAAAACTCATTTTA
CCTCTATTCAACTTTAATTGGAATATTGAGCTTTAAAATTCTGCTCTGCTTTTTAGAGTT
TTCCTTTCTCTTTCCTCATTGTTAGATAGATTGTCAGCTGTCACTTGTGCTGTTTTTGTG
TGCTTCCTTAGAGAAATCTTCACCATTCTTTCATTATATTTTCCTGTCTCTAATCTGTTT
TGATTTGGAAAACCTATAACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTTCTCCCAATAAACCATCTCCCTGACTTCGTCAAATATGTGCTGATAACTACAATCT
GTTTGCTGAACGTAAGCTCTGTATGCCTCTTGCCGTCTAGATACCTCTGTTTGATAATTC
TGTGATTTTAGATACATGACATGTCTTTTTCTGTCCTTAGGCAACAGGCCCTCAGGGCTC
ATTAAAGGAAGGTGCTAAAGGCTCTCTTCAGAAAAGCTTCAGGATTCTTAATGAAGCCAA
GAAGTTAGCAAATGATGTAAAAGGTTAGTGTGACCTCGGTTTATTATTATTTTCAGGTAA
ATTGTAATTGGTAGGAGATTTTATCACACCATTGAAAGAATGTAATTGTTTCATCATGAT
TTTTATAATTATTTTATTTGGATTTACTGCAAGTAATATGTGTTCTCACCAGTTGTACAG
TAGTTTGTCTTCATATCTCATTTTTCATTGTGTAATATTTCATAATGCTTAAACCAAATT
TTCATAACATCACTTTACCTACATTTGCAGTATAGTAACTTTTCAAAGAGGGTTTGATAA
CTTTTAAGAGAACCAAACCCTACTTTGGCTTCAGAAATGAAAGACAAAAAAAATGAGTCA
GGCAAATAGAGTGCTAATGTCATTGTGAGACTTAATTTTGTTAGTAAGTTCCATTTCCTG
AAAGGTTTTCCAAGCTTTTAAAAATCATTTATTTGGTGTATTTTGTTCTTAATTCAAGGA
TCAAAATGCATGGAATATCTGCTTTGATCTTCTGTGGGTTTTATGTTAAGAATATATTAT
TAAATATGGCTGATTTATATTTAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTCTAATCTGTTGCTTGGTT
CAATTCAGTGTCATTCGGTTAGTTCACAAGCTTTAGTCATGAGTGATTTAGTGCTGTTCT
TGGCCATTTTTATGTTGACCTTGCCTTGAGGGAGTCAGAACTTGCCAGAAGCAATTCATC
GTCCTTTCTAATTTTTGAATACACTTCTCTTAAAAGTGAATTTGCCCATCTGCGAGTTTG
AGATTTGAAGGTAGTCTGCATTGCACTGGTTGAATGTCTACAGAGATAAAAATCATTTTG
TTGATGGAGGCAAGGCTTGGTACAGATTGATGACTGAGAGAGTTCAAAGATGAATTAATG
AATTAATACCACCACATGACTTAATGCTACTTGCGGATGGGCGGGAAATGTTGTCAATTC
AATAACCAGTTGCGGATCTCATGTACCGCGTGTAAGTCAGGAGATGAAGTGGAGTGTGGT
ATATGAGAAGTCTGACAATACTACTATTTAAGAGTAAACACATAGGGAGTAACATTCCTA
TTTTATTTACTTTGTAACTTGCTGCTCATTTTGTCTTGCCTTAAACAAGTGAAATTATTT
AATTACTGAGGAACAAATAGGTAACATTTCAGTAAAATGGATGAATGTCACATGAAATTT
AAAAAAATTATTTCTAAGCACAAGAACACTGATTATATATATATAATATATATGATAACA
TATTGTGCTGCCAACCTGTCCAGGCAAAACAGTAACAAATGTTATTCCAAAGATTAATTT
TTGTCAAATGAATCAACACTTTCTGTCCTGCAAGCACTCAGTCATTTAGTCCAGACAAGT
ATGTCAGAAAGGGTCTGTGGTGATTCATGTGATACACTTGTAATTACACTGTTAAGATTA
TTGGTTATTGTTTTATATATTTTTTAAAAAGAGAATAGATAGGGCTCTGCCCTGTGATGT
ACGATTCCATTCCACACGTTGGAGATGAAGCCGGGCCTCGAACTTGCACCTACATATTCC
TACAGCTTCTCAGAGTCCTATGGACAATGACTGAGGAGACAAGCCATGCAGGAAACAGCT
CTCCAGAATAAAGGAAAAAAAAGAAGAGTCAGGACTATTTCATTGCTGTTAAACCAAAGT
ATGAAACAGGAGTCAAATTTTGACTTTTGTAATTACTCCTTTTGAATTCACACACTACCA
ATTACCTGAACCAGCCTTTCTATTGGTACGTTTGTGAAAGACAAACACAATCTACTCCAA
TAACAAAATAACAATATTGGACTAAGTGTATGAAATCTCGCTTAGGCCCCAGCCTACCGG
AAGTCTGGAGAACAATGTCATCTTTTCGTGTAAATGAATTGGTTAACTCCTCCTACAGAA
GTTTGCTACCCCCTTCAGACTGTGAACAGAGAAAACCAAGGAAATAAAACCAGTTTGGAC
TTGGTTCAAGGTAAAAAAGAAAATAAAAAGGCAAAACAGTAGCAAATATGGAGCTATTGG
AAAGATCTTCCCTCGGAACGAGACGACGCTTTCACATCCAAGTCTACGGTGTGTTTAGAG
GGCAAGATGCAAGTCCTGCAGACATGCCCTTGAATCATCTTAACAAGAGACAAAGTCCTG
TACAATGAAAGACAGGGGTTATAGCTAAAAACTTGTCTGGGCTTTGTTGTGTATTCAGAA
TCAAAATCTAAGAACAGAGTTTTACACAAGCATAAAAAAATATAAATGCCTTCAAGAGCT
CGACAGATAATAGAGGGGACTGGGAGTTCTGTCTTAAGCCAGAGGGTGCTTGTCTTATTT
AAAGATATTCAAATTCAGTTTCTTTCAAAATGCCTTGCTGGCTGTAGCAGCTTGACATTG
TTTATGAATTCCAAAAATAGATACTGGATTATGTTTGTGAATTGACCTATCCCTCTGGGC
ATATTCGATTGTATTGGATTCAGGGGTTTCACTTTTACTTGAGTAAATAAATATTAAGGC
TTTGATTGGGCCATGTCGGTAGGATGTTGAGTCCCCACCCCCTTGGTGGGCAGGGATTCA
CAGAGAAACTGCACCACCCAGAAGGGATGTTAGAGTTTGTGAGCTGGAGTCCCAGGAAGT
AAACATGCAGGAGAAGAATAGAGGAATAGACACAGCGGAGGCCCCAGGAAGAGACAGCCT
GATAGTTTACAGCTGGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGCTTTAAGTTGCAGAGAGCTTAGCAAGATTAACT
CCTGGTGTTTTACAGAAGACAGAATTTGAAAATGGCAAGCCTGGGCATTTAGCTGAAGAA
CTTTCCAAAGTAAACTCAGAGACTGCAGCTTGGCTTCTCTTTTCACCTTATAATAAAATG
CTCGATGGGAGAGATAAGCTGAGGACTGAATTGTTGGGCACAAAGAAATGAGAAACTGAC
TCTGGAACTTCCAAGCCTCTGGAAATCAAGTTCCCATATGATAGTGCCCCATTTGAGGAC
TTACTTAAACTTGGAAATTATAAATCAGGATTGAAAATGCAATTATCTAGGAAAGACTTG
TGGAAAATCTTACTGTCTGATGGCTCGGACCCCTGCTTCATGCATGTTAAATCAACAAGC
TTTTTGAGAGCATTGTATGAACAAAATTTGCTGTCAGCTTGGACTAAAAGGGACATGGAA
GAGAGAGACTGAAGGGGAAACAGCTTTAAGAGGAAAGCCATTGAAGCTGAGACCTGGAAT
TAAGACATCACCTTGGGCCAAGAGAGGAACCCCACCCATATGTACAGAGAGGGTTAGTTT
GCCCCAGCAGTGGAAGACAGTGGATGCTCCTGCCCGATGTTCAGGGAGGATTTTACCATC
CCAGAGTACAGAGAAAGTAGAGCACATTCATCAAGGATTAGGAAGGTTAAAGTCACCACC
CCATAGGTCTGAGAGGGATGGACCTGTCCTCCATGGATTAGGAAAGGCCAGGTTGCCAAC
TCGTTGCTGTGACAAGGTTGGTCCTATATGCCAAAGGTTAGGGAGGATGCTCCCTTCACC
TCACTGTGCTAAGGGGGTTAAGTCTCTAACCCAAAGATTGGGTGAAGTGTGACAATCACC
CCAGTGCTCTTGGAGGGTGAGGTCTGGATCTTAGTGGAACCAAGGAAATGGCTATTGGGC
AAGCCTGTGGAAAGGTTGTGTCCCCATGTGGCCCCAGGGAGAAGAAACCATCATCTTAAG
AATGACTCTCAGACTTTGACATCTATAAGCCCTAAAGGTTTACAGAACTGCTCTGGACCC
ATAAATCATGTTTCCCTCCCAGTTTCTCCTTACTATAATGGAAATGTTTATATTTTGTCT
GTCCACTTGTGTATTGGAAGCAGATGAATTTTGTAAGTTTCAGATGTCCTCAGCCAGTTG
CAACTTTGTCCCAAGACAAATTGTATTTCTATAACTGACTGTAATATGCTCTATATTTAA
CATTGTACTGATTTGAGGTGGGTTTTTTTTTTTAATATTTTAATGCCTTTTTGGAATTGA
GAGGGTGGAGTATAACAGTTTGATCTTGTTTATGAATTTCAAAAATAAATATTATATTGT
GTTTGTAAACTGCTCTGTTCATCTGGGTACATTAGATTATATTGCATTCAGAGGTTTCAC
TTTTACTTGATTAAATAATGAGTAAGGCTTCAACTGGGCCATGACAGTAGGACATTGAGT
CCCCACCCCCTTGGTGGGCAGGGACTCAGAGAAACCACACCACTGAGAAGGGAGGTTAGA
GTGTTTGAGCTGGAGCCCCAGGAAGTAAACACACAGGAGAAAGACACAGAGAAATAGAGA
TGACTCCATAGACATGGCAGAGGCCCAGGGAAAAGAGACAGCCTAATAGTGTACCACTGG
CCTTGTAGAGCGAACAGAGGAGCTGAGCCTTAGGAGAGAGAAAAGTCATATCCCAGCCTA
CAGCTGCTGTTGGAAGAAGCTGGGACCATGGAGACTTAAGAGGAAGAAGCAGCCTGGACC
CTTGCAGATGTTGGTAGCCATATTGTTCCAACATATGGCAACAGACTTTGGTGAGGGAAG
TAACTCATGCTTTATGGCCTGGTAACTTCTTTCTTCCCAGACGTGTTGCTCTTGCCTCCC
ACACAGTCTCAGGGTCCTGCACTTGGTAGGGGGGAGACTTGCTTTAGAATTCTCCATATT
GGGAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGTCTACCACATGGGAGGTCCGCGGT
TCAAGCCCCGGGCCTCCTTGACCCATGTGGAGCTGGCCCATGCGCAGTGCTGATGTGCGC
AAGGAATGCTGTCCTACACAGGGGTGTCCCCCGCGTAGGGGAGCCCCACGCGCAAGGAGT
GCACCCATAAGGAGAGCCGCCCAGCGCGAAGGAGGAAGCAACCTGCCGAGGAATGGCGCC
ACCCACACTTCCCGTGCCGCTGACGACAACAGAAGCAGACAAAGAAACAAGACGCAGCAA
AAAGACACAGAAAACAGACAACCGGGGGAGGGGAGGGGAATTAAATAAATAAAAATAAAT
CTTTAAAAAAAAAAAAAAAAGAATTCTCCATATTGTGAAGACAAAAGACTATCCCAGTAG
CTGAAAATTTGTAGTAAAACTCCTTGAATGAAATCATACCTCTTAGGTCCTTAAAAATAT
CTAAATATGAAAACATAACATTATGTAATAAAATTAACTTTAAAAAATAATAATTATTAA
AGTCAGCTTCTTAGTGTATAAAACAAAATCAAGTGGAAAAAACACTAACAGTTCAATAAA
CTATTATTTTTCATTTTACTTCTATCATATAAAGTGATGAGAATTGTATATGAGGTTATA
ATATAGTCATCCATAATGGACCAAATGGAAAAATTAATTATTTTTTTCATCCATATTTCT
TTTTTACTGTTGTTGTTTGTTTTGCATATTACTTTCACCTGGTTTTATTGTTTTTGATTC
CTTCTCTCTCTCTCATCCCTCTAAAATCCCAATCTTGTCTTCCAAATCTTGCCAAAATCT
TCTCTGCCTTTTCATAATTCCAAATCTTGTCCTTTTTGTTTCTGGTGGATCACTGGTTTC
CAACCCAATTACAAAATCTGGCTTACTACCCACCAACAGCGTGGTGTTGACAGCGAGACT
CTAAATCTTGGTCACCTTTTTTACTTTCCCAATGACACCACTTACCTAAAAGTGGATCCT
CTCCTCTTAAAATTATTTAACTGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACAAAATGTCCTCTGGATTGTAA
ATTGAATTATTTTCTTCATTACCAAAAATTATAAAGATTGGGTTGGATTTCCTTTTAACT
ATTAATAATTCTGTATCTTGGACTGTGTTACAATTCAAACTGGACCACACGCATTCTTCC
TTACATTTTGGCTATAGATAATCTGTGACCTAACTAATCTTGGAGTGCTTATTGATTTAG
GTCAGGGGTTCTTAGCCTTTTTTGTTCCATGGACCCCTTTGCAAGTCAGGTGAACACCAC
GGACCCCTTCTCAGAATGTAGCAGTAGATAGTTTTATGGCACTCAACTAGTGTTAGGTCT
AAGCAAGCGTACTGTAATTTTGAAGTATTGATGATTGTAAGCAATTTTTTGAGATATGCA
ACAACTGTAATGTGATATGAAATGAATATAACTAATTTATTGCATACATTTATAAGTGAA
GGAAATACTAGATTTCAGTTAGAGGTCAGAGAAAATAAAGAAAATAAGTTGATTTTTTTT
CAATTGTAGCTCATAAACCCCCTGAAAACCTTTAGGGGTCCATGAACCCCTGGTTAAGAA
CCTCTGATTTAGGTTTTCATCCCAACAGTTTCCTGTATTTTCCATTTTAAAATCTGCAAT
TATCTAAAACAACTCACCTAATTCCATTGTTGGTCCTCTAAAATATTTATACCCAGTTTG
AAAAATTCCAGAAACTACTTTAGAAAACATGATCACAGTATAAGGAAGGATAAATTAAGA
AAGAACCAGAGTCATGTAGCTGAAATGTAGTAATTAGAATAGGGTAAGAATATACACATT
TTGATTTTCTAGTACAGAATGAAGAGGATCAAAATTACTGCTTTAGGCCTTGAGGGACAA
AAGTGAAAGTGTCCTTCAGGTCAGTTTTTCTTCTGAATAATTGGCCTAATTGTTCAACCA
GGATATGCTCTCAGAATGCAGAAGATAGAATAAACCCAGTGATGCCCTTGAAACTAATGA
TTTTTCACTGTACATGAATATCTTCCTTCCCAGAACATTTTAAATGCTTCATTATTTAAA
GCATCAAATCCAATCAGGAAGATAAGAAATGAAATGTATATATTTCAATTTCCCTAATTG
ATAAAGACTTCCAAGTGATTATCAAAGAAAGCAGCCGCAACTGTTATCAAGGGATTCGTA
TAGATCTCACAGTCTCTTCTGACTAGCCTTAGTTCAGAAGTGCACTTCGGGGAAACTATC
CAAAATGGTTATTTTAGTGCAACTGAAAAATAATGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTGTGATATTATTTTTACTGAT
CAGGTTTTCTTGATGGTATTGTTTGATATTATATCCTTGAAGCTCATATTCTTTTAGGGA
TACCATTGTTTATTTTTATTGGCATGATAGGATAGTAACAAGAGGTATTACCATGTATTG
AATGCCTACTCAATATGTTGATGTTCACTGTATTTATTCCTCATACTATTCCTGCTAGGT
GGTTAGCATTATTATTCCAGTTTTACAGGGGAGAAACAGATAAAGCTTGCTTTAGAACTT
GAAGGACAGAAGTTAAAACATTCTTCAAGTCAGTCTTTCTTCTGAACAATTGGCCTAATT
GTTCAGCCAGAATTTGCTCTCAGAATGCAAGAAATAATGTAAACCTAATGATGCCCTGTA
AATCAATAAAGCTCGAAGTCATTGTTAAAAGTGTATATATATATGAGCTTTGAATCCTGC
AGTTTGACTTGAGAGTCTGTGGTCTTAGCCACTAAGCCACACACACACTAGGAAGCAAGA
GAGGTTCCTTATTTGTACAGATTTTGATCAAGGAGATAAATGCATGCAACTATACAACAC
AGGAAATTCTAAGATCTAAATGGTTTTTATTTTTTTAACATTAAAAAACCCAAGTAACTC
ATTTTCATGTCATCTGTTCAATAGTAAGAGAAGAAATAAATAGAAAATCTCCAGTGCTCT
ATTCACTGAAAACATATATAATATAAATACTCAAACATATGGTCTAGCATACCCAAAATA
AGCTTATCTTAAATTTGAAGTGCATGCATTGTATTTTCCTCTGGAAAATCCAATGAAATT
CTAAGCCTAGTTTTGATGATGCTCTATGGCTCATGTGGATAAATTTCTCTCTTTAATATG
CTCAATGGCAAATTACAGTATATGCTCATACAATGAGCATTTAGAATAATCGCATTGGTA
TATTAGGAGCTAGTCAGGTGTTCATAGCAGACGTTCCGAGAAAACTTAAGTTAGCTAAAA
ATTTGCTTCATTTTCTACAACTGGACAAGACAACGTTCGGCCTTTTCTCGTTGTAAATGT
ATCCCTCGGGCCAGGCAGCCAAAGCCTGGCTTGAGCAAGTGTGGATGAAGCCAGACTCTT
TGTTTGGGCCCTCATACCCTCTTCTGCTGACAGATACAGCTGCTAAACTGCAAGCCGTTA
AGGACAAAGCAAGACAAGCCAACGACACAGCAAAAGATGTGCTGGCACAAATTAAGGATC
TCCACCAGAACCTGGATGGCCTGAAGAAAAATTACCATCAACTAGCAGACAGCGTTGCCA
GGACAAATGCTGTGGTGAAAGACCCCTCCAGGAACAGTAAGCTCTCTTTCATTTTCATTA
TGTCACTTAGGACTCTACAAAAGGGTCCTAAACCCATAAATATGAGGGCTAGAAAAGACT
TGCAGTGGAGTAGTGTGCCCTCCGCATTAGTAGATCAGGCTCAAAAATTGAGTGTCCTGA
AGATCCAGAATGAGAATCCAAGTCTCCTGGCTCTGTGCTGGTGCTGGCATTCACCTAAAT
TTTGTCTGCTTGAGAGGAAATGAAGATATTAGGAGAGGGATGCCAAATACGTTTTAATTC
TTTAGTAAAATTGAATATACAGATAGGCTTTTGGAAATCACATCCTCAGAGTTAGTGACG
TTTCATGGAACATAGAGATTAAGGAGAACACTCATTAGCTGGTCTGTTAGAACAGGGTAT
TAAAATGGTACCAATGTGAAGTGAAATGCACTAAACTTGAAATCTTGATATTTATTATTT
AGATTCCTATTAGTTAACATTTCCAGGAAGTAAAAATAAAGCATTTATTTAGTTTATAAA
TAATATTTCTCCAATCATTTAAATATTGCATCAACTTATAATGACTTAATAAAGATTTAT
TGAAAATAAGCTCAGGCAAAATGTGGGAGAATTTAATAAAATGATAATTCAAATTATGAG
GTAAGTAACAGTCAGTGGCCATTAGGATTTTTAATGTTATTTTTCCATTCTATTCAATGA
TAAACCCCTATTTTGGTATATGAGTTAACAAAGGAGGTGTTTTGTTTTTCACACTCTTCC
CTCTTGAGGGACTAGACCTTTTCATATATCAACACGATCTTGAGTATCAGAATATTTGTA
GAGTGCAAAAGAAAACATCACTAGTATTAACCTTATAAGCTGTCTAATTCAGATGCTGTC
TAACTGGCGTTGGAGACTGATTTCAGCCTAGACTCAAAATAAATGCTGAGGATGCTCTGA
AACAATAAATACTATTAGCATGACTCCTTCATGAGCAAGGAAAGGAACAGTGCAGACACA
AATACCTGCATTTCAGAACTACATGCCATTTCTTCAAAGGCCTAGAAGGAGTTGTACAGT
TTTATTTTTCTCGTGTAAGTCTAGATATACCTTCCCTATTCCTGTCTGAATAACTGGTTC
TGATGCCTGCCAAATCACAATATTTCCCCTCAAAATGAATGAAAATAAGTTTCTAAGTAA
ATATCACTGTCTGTTTTACTTATTTTATAATTTAAGATATCATTTCATTCAATTTCAGGT
TGATTTTCAATTGATATTGGCCTTTACATCACATTTATTTCTAACTTTTTTTTATCCCAT
CCTCTATCACAAGGAGCACTTAATTTTCTGTAAATATTAATTAAACTAGGTCTGTTTTCT
TTCTTAGAGCATCATAATAAAACTTCTTTTAATATGAACAGTAGCTTTTTATATGCCATA
TATCTGTGCATTTTTATTTGATAACATTTGTCTTAAACTCGGTTGGGATTGTAATTATTA
CATGTTGTGGGAAATATCATTTTTTTGATAGTCATTAGTTTATAATATTTATGAAAAGTA
TCTCCTCATAAGTTTTCTAATTTTTTTTTGTTTTACATGTGAAATTACCTGCAGAAATCA
GTAAGTAGATGCTTATTTTTATACTTTTTAGTAACTTTTATGTTTGGTTGCCTATTGTAA
AAGCTGCATGTGCATGTTACTGTGTTTTGATATTGCTTTAAACATTGTATCGCTATTCTT
TCCAATGTCACAGTATTAAAGCATATATATGCTTTATATATATAATGCATATATATACAA
CAAAGGTAGTATATAAAGGTAATTGATTTAAAAATTTCTATTTTGTTATGAAAATTAATG
AAACATCAGTGTGACATCCGCATAAAAGTGGAAAATTGAATTCCTCTGTGGGTTGAGCTA
AATTGTTACGCTTCTGATAATACAAATTCAGTCATTACAATTCAAATAACTTCTTTGCGG
TAGGATTAAAAAAGATTGGGTCTATTTTATTGATGTCCCCCCTCCCTCCAGTTCACTTTT
CCTGCATTCTTATAAGTAATTAGACTCAACTTCTAGAGAATTATATTTGGATAAACACCT
TATAAACCCAGATTTTAACAAATATGCAATCAGTGAGATATAAAATATGTTATCTTTCAT
AGTTTAAATTGAAAGCCAAACATAAAATAGTAAAATAGCTAAAATTATATAATAATGAAA
TCCATCACACAACAATCTGAAGAATAGGGCCAAATCTATGCTCAGATGAAAATGAGAGCA
ATTACATTACTAAGCAAGCACTGAAATCAACAATTTAGGCAATCAAATCAATGTTAGAAA
AAATAAAAGAAAGAAGATGGAAAAAAACATTAATAAATTAGAAGCCAGAAAATAATATCC
TTCATGACAAAAACAGGTGAATCTCTGTGACTACAAAAATAATGAAATAATAATTAATAT
AAATAAAAAATAATAAATCCATTGGCAGGATTTATTAATTTTCTTAAGAAAAATAAAGTA
CAAATAAACAAAGTTCAAAACATGCTGTAGCTAGGTAGAGGAAATTTAACATACTATATG
GGACTACTTGGGAAAACTGTGCTAATAAATATTAAAGCTGGAAATATGTGGATAATTTTT
GATGAAAATATTAAATTATCAAAATTGATTTCCAGAAGTGGAAAAATCTGTGCAGTTAAA
TAATTATGGGAAAAAGTGAGAAAGTTTTCAAAAACTACCCTATAAGAAAGCATCAGACAA
CATCACAGATGATTTCATTTTCAATCCTTCAAGAAGATAATTTCCATATGACTTAAACTG
TTCCAAAAGGTAAAGAAAAAGACAAATGACAGTTCCATTTTGAAGTATTTGAAAACAAAG
TTTTTTTTTGGACTTTAAAAGAAATCTAAACCATTTCCTCATTTTAGAATAATTTGTAGA
GTATTAGCTATTGGAGAGTTAAAGAATGGGAGAAAATGGATAAATAATTTATTAAAAGTA
TGCAAAACAAAATGATAATTGTGCTTATGTTTAATATCTATACAGTTTTCTAAGAGCTCT
GACTCTCATAATCTACCTTCCAGGTGGAAAGTACATACTCAGTTCTTGATAAGCATCTCT
ATTAATTACAGAGTTTATAATAAACCTATTTTCTTTTTAAATAACACTAATAATATAACT
CATTTATAAGCATGAGTTCAAAGTATTTACTTCCAAAACTATTTTAAAAATAGTAATAAT
TTTCTTCCTTTGGGGCACATTTGACTCATTCCTGAGGATTAGTTATTGGCAGTCAGCCGG
AGAGCAGGTATTCATAAGTCTCGCAGGACATGTAGCCTTGGACCTTAAATAGTGACACTT
TTTCACCAGAATCACAATGACAGGAGGCAGAAGAATGCATGTTCGATCAGATAATAAATG
ACATAGTTTGGATAAGACTGCCAACATCCTAGAGATAAAATAATTGGTTTTCCAAGTGTC
ATGTACCCTCCTATGAAAATTATACATTGAAAGTTTATGAATCAGTGATAAGTATTTAGG
GATGAACCTTTTGAATTAGCCAATATTTATGTTTTGTTTTGTTTTTTAACATCCAAAAAC
AGCAGTTTCACATGGTTCTACCTACTACTTAGAAATGGATAATCAACCATCCTTCTGTAT
TAATCAGCCAAAGGGGTGTTGATGCAAAATACCAGAAATCTGTTGACTTTTATCAAGGGT
ATTTATTTGGGTTAGAAGATTACAGTTACTTCCCTCACCAAAGTCTGTTGCCACGTGTGG
GGCAACATGGCTGCTGATGTCTGCCAAAAGTTCAGTTTTCTTGGATTCCTTTCTTGCCAG
GGCTTGGTTTCCCTGTGGGCTCAACTCCTCTGTTTTCTCCACAAGGTCAGCTCTCTAGAC
TATCAGGCTACTGGCTCTGTCTTTGTACCCAGGGCTCGATTCTCTCTGGGCTCGGCTGCT
CTGCTCCTCTGTGTGCTTACTTCCCAGGGTCCAACTCAAAGCCCCAGCATCAAAACTCCA
ACTCTGTCCTTTGCCATGTCTTTTATCTGTGAGTCCCCACCCACCAAGGGGCAGGGACTC
AACACCCTGCTGACATGGCCCAATCAAAACCCTAATAATAATTTAATCACTCCCAGGTAG
AGACCAATTTACAAACATAATCCAATATCTATTTTTGGAATTCATGGACCCATATCAAAC
TGCTACACCTTCCAAATGAAACTGAACTGCAGCAGGAAAGATTTCAAGTATGACATAGAC
CTTCAGTCTAAGAGGTGCTCAGCACTGAAATATTTTCCAAAAGACATTTTGATAGCTCCT
CTCTTGACTATGTGCAAAGACAATAAGGGGAAGGAAGTAATCCAATTTTGTATGAGACTC
TTGTTTTAAATTTAGTTAGAGCTTAGACAGAGTAGGTGACATTTTAAAGGTATTTCTAAT
CCCTGAATTCCATGACTGAAGTCTATTCCAAAAAAAAAAAAAAAAAAAATTCAGCTTTCT
GGCTGAAGCTAGAAAAATTAAGCATTGAATTAAGTTCATCATATTCTCTACCTTCAGTGC
TAATTTTCACCTTAGCCACAAAGCCTATGTTGGCCCTTTTTCTCTAACATCTCTTAGTCG
GGCGGGCGTGAGTCCAATCGTCATGGAGAAGGGGCACGGCCGGGGGGCGCACCTTGCGCT
CCATGCGCTCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGCT
TTGTCATGTGGATAAGATGAAACTGTTGCAATTGTTTTAGGAAAAGCGTACTGCTACTGT
CATTTCTCCTCTGTGTGCCTGTTCACTTTGTTCTGTGCAGTTGCAGATGCAGGTACCACT
GTGAAAAATCTAGAACAAGAAGCTGATCGGCTGATGGATAAACTCAGACCCATCAGAGAA
ACTTGAGAGATAACCTGAAGAAAAACATCTCTGAGATAAAAGAATTGATAAACCAGGCCC
GGAAACAAGCCAATTCTGTAAGCTCTTTTTATCTTCAGTGTTAGTTACTGATGCTAACTG
TTATTATTAGTACCAGTGGGAATGACTTCCCCTAGTGTTCCCTGTTGATTGATTCCTGGC
TCTTTTCTTAAAAGAAAAACTTGAAATAATTTTGGGTGTGGGAGGAAAGTTAGGTGTTTT
GTTTTGTTTCACAAATTTCAACAGACTTTTCATGGGAAAAATAATCATCACTTATTGTTT
TTAAAATGGGAATTCTTGTATTTTTTGTTTTAAGTACAGTAATACAAAACAGTAGAAGTC
TTTAAAACTTACTATTATATACTAAAAAGGCACAGGTAAGAGTCCTTTTCTCTTGATGGA
AACAAACAAGGTCAGCAAGTAGCTTTTAACAGGGAATAAGGGAATAAATGAACAAGATAA
TATGGAGTAATAGCTAAGAGGAACCATTGATTTATATATATATATCACATATAAATATTT
TGTCTGAGTATATGCAACAAATAAAAGTTTTGTGGTTATGAATAATTAATATAACTTTTA
TTGTAAAGTAAACATGGAATGTCTCATTTGTCTCAAAATTTTGCTCCATATTAATCCAGT
TAGAAAACTATTAGGATACAAGCAGAACTTTCTAGATGAATCAGGTCAGAGGTCCTACGT
GCCAATGTGAAACTTTATCTCACCAAGTAGAGTCATCCTATGATGACTTCAGAAATAGGA
ACAGATAATAACACCAGTTTGATAATATCATATACTGCAAGTCTATACATATTTTAACTA
AGTCTTTTATGCTGGGGTTTTCATGCTGTCAGGTTTAAACTCAAACCTTTTGGAAACTTA
AGTGTCCCATCTCAGAAATTCCATTAGTCTAACCACCTTGAGGCTCAAATACCAGAAATG
CCTATTTCTGTTAACCCATCGATTTATATTTTTTATTGGTAGCCCAGAACATGATGCCCA
AATGACATTATATCCTTTTCCGCCCTTAAACATATCTAATACTCAAAAGGAGACCAAGGC
AATAAGTTCAAGGTGAATCTTGAAAAAAAATTCATGATCAGCTGAAGAAATACTTAGAAA
ATGACAAAATGTTAATGACTCTGATGTTACAGAAGATCAGAGTGACAGAGTAGCAATAGA
GTCTGAGAAGACAAACACTGTGGGGCAATATGACACCCATTATGACAGCAAGTGATCATT
ATCTATATGAGACACAAGGTAAAAAGAAACCAGATGATACTCCAAGGTTTAGGGTTTTAG
TTAAGATTAAACCAATGCAGAAAAGTCATCTCCTACATTTAGCACTACTTGGCACAAGGC
ATGCCAGGATGAATGAGACAGTCCTTCCACTCAAAGTTTACAATTAGAAGAAGTAAGGCA
TGTACATAAATAATTCCTGGATAACGCAGAGCATTGTGCTACATTCGATGAGCAATCAAA
AGTATTATAGAACTTGAGAAAGGAAAGCTCACCTCTGGTAGGGGCCAGATTCCTTGAAGG
GAAAGATATGAGCCTGAGGGATAGTGATGGAGATGGAAAGGGAGGCTGACAAAGGAGATC
ATTCTACGGGGGAAAGTCTTGTGCCAAGGCTGGAAGAGCAGATGAAGTTTCAGGGCCAGT
TCATGAAAGAGCAGCTCATTTGCTAAGAGTAATTGGTAAAGGGAACCTTAAACTGGAAAG
GTTAATGGGTCAGGTCTTGTCAGGTCATGAAAGGCAGTTTCACTTAGTAGCAACTGTACC
TGGGATAAGCCTCATTCAGGAAGATTTGCTTAAAACTTTTGAGCATGAAAAATATTAAAA
TCAGAGTTGTGCTCTTTGAATGCAAATCTGGGAAGTGGTTTGTGGGACTGATGAGAGAAA
CTAGAAAGAAGGAAGCAAATTTAATAAAGACCCAACTCTAGCTGTGGCATGGCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGAG
TGAAAATTGTACATTTCTTGTCCACAATGTTTCTGCAATTCATTTTGATTCACCTACTCT
CAGCAATGTATGTAAATAGGAAATATTTATTTTCCCTCAGGGAAATTCCATCATTTTGTG
GAGCAAAGAGCTAACATTCTGACTGAAACCCAGCCCCTCACCCCAGGGCACAGAGCAAAC
CCCCAGGGACTCGAGTTGACCCCCAGTCGTGGGCCCGCACTTGGCAGGCTGGGCCCAACC
CAAATGAGGAGGCAAGGACAGGGGTGCCATCTAAGTAAAAGGCTTCTCAGGTGCTTCCAA
ACCCAGGCCACCACACCAACCTTCTGGAGGGTGGGCCCCTCTTTCTTTCCCACCCATGGT
TTCCTCCTCTTGAAGATAACCATTTTCTTAGCCGATGAGGTGAGGCAAAAATGCTGAGCA
AATTATGCGGGTTCAAAGGAAATGCAGCAGATCTGCCACAGCCCAGACATTCTCCAACAT
TTTTGTCTGGCTTACATCTTTGTCAAGACCAAACACACCTCCTTAGCTCTCTCTTCTGAA
TCCAACCAGGTTTCCACTTAGTATGTGGCCGGCACCATGTTTGGCAAACAGTCATGGTGT
TATCTCCTTGTGTCACCATGACACAGAGACTGGCTTTGTGCTCTGAACTATCCTGTTTGG
CATCTGCAGAGCCCTTCCATGGACATTAACAATAATGCTAGTTGTCTTTCTTCCAAGTAT
GCAAGCACAGGAGGAGCACAAAGTGCTGGAAGAAATATGAAAATGGAAATTCACCGTTAG
TGGGGGGCAAGAGGTTTCCTGAGGTTTTATATCCTCCCCTCTCCACCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTGTTATTGTGATTGAAGAAGTCTCTCATAATGTAAGTAAA
CCTGACATGAACCGTGTTGAGTTCTGCTCACATAAGGATTTCTTTCTTAGCCATTTAGAG
TAATTTTTAAAGTACTAGTCCAAAGAAAAGGGAGCTTTTAAGTAAGTTAGTAGTGATAGC
CACTGGAAATTATGTCCATCTCATTTCCTGGCAACTTAATAAAAAGGCTTAATTTATTCT
GAAATGCATGTTCTGAGTGGAATGATTAATATTATTCTGATCACTAGAACATGTAGAACA
AAATCTGTCTGACCTCTTTCAACTGTAAGAAGATGGAGATAGGTAATTTTCCTCCTGAAA
CCTAAAAGGAAAACGGTTTCCTACTATGTTATACCAAAAGTTGCAGACATTTGAATATTT
TAAAATTTCATTAAACAACTTTAATGAAGACCATTACCATCAGCTTCATGTAAAATCATC
TTTTGAAAATGTTTCTTCTTTGTTACCTTTTTTGTAAAGGAGAAAGAATGAAGGAAAGAA
ATTGTTAGTTGCACACTTCAAAAAAGCATAGCATACTAACCAGACAGGGAACTGGGAGCA
GCTCATTGTCAAAATGTTAGTGGAAAACTGCACTTCTGTGCCCTCGTTAATGAGTATAAT
GAATGATACTATTTGATGACAGAAAAATAACTTCAAAGAAGAAATGATGACAGCTTTGTG
GTTGTTTGGAAGCTATTTCAAGTCTTGCAAGAGATTTAGTCTTGGTCCTTTGTACCTTGT
TTTTCTTGAAGATCAAAGTCTCTGTGTCTTCGGGAGGTGACTGCATTCGCACATACAAGC
CAGTTATCGGAGAAGGGAAGCTACAATAGCATCACTGTCAACGTAAAGACGGAGGTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCTTGTGCATTTCAATTGCAGAGTGCCTGC
ATTTCACACCATTCTCATGTTGATTAAATGGAATTAGGTGTTGGAAAACGACCTGTGGGT
GAGATGAAAGTGCACAACCAAATATAATGGATAATCCCAGGCTTGTCAGAATCATCCTGG
GATGAGATTAGTCAGAAAATGTGAAAAACTAGGGTGACCCCAAATTTATGAGAACTCAAC
CTTTACATAGAGTGAGGTGGTTTTATTTGCCTTGTGTACGAGATGTGACTCTAAAGTACT
GGAATTGATTTAACAAGTACACACTAAAATCATCCTCAATTCTTAGAGCTGCATATGAAT
ATATGTGGTACATAGTAGTGTGTCATCATATCTCCAACTCTCTGTCCTCCCAGAAAGATA
AATATAGAGGTAACACATTATAGTACCAAAGTCTTGAATCTTGAAATCAAATCTGGGTTG
GATTCCCTGCTCTACAATTTATTAAAGTTTAAGCTCAAGCTAGTCAATAGCCTCTTGGGC
TTCAGTTTCCTCAACTAGGAAAGGAAGCTAAAAATATCTATTTTGGGGAACAGATGTAGC
TCAGTGGTTGAGCACCTGCTCCCCCTGAACGAGATCCTGGGTTCAAGCCCCAGTACCTCC
TGAAACAAAGAAACAAATGAGAAAACCTGCTCTCATTAGGGAGCAGATGTAGCTCAGTGG
TTGAGCAGCTACATCCCATGAACAAGGTCCTGGCTTCAATCCCCAGTACCTCCTTAAAAA
AAAAACTACCTTGCCATCCTTTATAAGATATAGTAATTAACTTTTATAACATTTATAGAA
ACCTTACTGCAGGCTAAGTGTGAATAAGTTTACATGAATAAACTTACTTATTTCTCACAA
CAACCCCAAAAGGTAGATAGTAATATACTCCCACATTTTGTATATAAGATTTTATATATA
AAGAAACTAAGACACAGAGATATTAAGTGACTTGATCGAGGTCACACAACTAGTAAGTAC
CGAGTTAGGATTTGATCATAGGTAAACTGGAACAAGAGTCTCTACTCTTAAACACTGTGC
TTTATTGCCACAATAAATAGTAAGATTATGTGTTTAAAATATATCAAAAATGCCTAAGAC
ATGGTAGTCACAACTTAAATTACAAGAATTGTTATTATTCAGTAAATGGAAGCATTAAGT
GACCGAGGACCATGAGGTGTGCAACCTATTCTCAATTGTTTAGAAAATAGGTGATAGGTA
GGTAGGTAGGTAGGTAGGTAGGTAGATAGATAGATAGATAGATAGATAGATAGATAGATA
GATAGATAGATAGATAGATAGATAGATGTAGAATGATACAGAAATGTAGCAAAATATTAA
AGGCTAGTGGATCTGGGTATCTGGGTGGGAGTATATTGGAGTTCTTTCTATGGGTTTTGT
GTTATTTTTGCAACTGTCCTTTTAAGTTTGAAATTATTTCAAAATAAAATAGTTTTTTTA
AAGAATTGCTGTTTTCAAATGTCAGTGGTAGAAAGCAACTTAATTATGTCAGTCTCAGAG
AAAGAGAAAACATAGACAAAATGAAATACACAGAAAAATTTTTTTTAAAAATCATTTCAC
TAAGAGTTGAAGGCTCCTGCCACATCAGAATATCAACCAAAAGCTGAAAACAAGTAACTA
AATGAACTCACTAATGAAAATTCAGATGCGTAGGAACATGTCCCAAGTAGTCCTTTAGGG
TGAAAGAAGGAAAAGTAAAAAGTGAGTACAATCCACAAGTAAGATAATCAACCTCTGGAA
AATTGAGAGTTTCCAAGGACCATTATGCCTTACAAATGTCAGTCGCTCTGATCAACATTC
TTCCTACTTGGCAAAGATATCTCCAGAAATATTTAACTCTTGAGTGCCCATCTTTTTACA
TTTATCCCAAAATGCAAACATGTCAACTCACTTTTTTGCCCAATTACTCACGTAAATGTG
GATTAGCTTTGGTACACATTTTCTAAAGTTAGAGACACCAGATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGCCACAGAGCTTTACACCATAA
AGAAATTATCTAATTGCATCCTCAGTAATCCCTTTTCACAGAAGCACAATTAGAATCTCA
GAGAGGATAAGCAGCTTGCCTAAAGTCAGGAGCTGGAAAGTGTTTATTTACTAATAGCGA
TAAAGTAGTTTAATGCAAAAACAAAAAACAAAAAACAGGTTCAGTTGATGAAATATTTGA
ACTTTTTCCCCTTTCGTTGACCCCTCTGTTAGTCACTGTGGGGATGAAATGTGGTTAAAT
GATGAATACGGGCAAAATCAAGAAAATCAGAAAGAAAATCTGGATAACTACTCCAGATTC
CACTCTCACAGATACTCCAAGATTATTTTTCAAATCCTAAATTCTAACAAATGTACTCTG
TCTCTCTGCAGAAGGCTGATGCCGTACGTGTGATTACGTTCACTGGCTGTATGGGAGAGA
CATACTTTGACAACAAACCCATAGGATTGTGGAATTTCCGAGAAACAGAAGGTGACTGCA
AAGGATGTACTATCAGGTGAGTTGAGATGAGGACTCTGTCCTGTGCATCATAAAAGCTTT
AATTTTATTGTGCAATATTCTGTTGTTGGGGGTGGGATGGAGCAGGCTGGAAGTGACCAT
ATTCAGAAGCCAATTTATATAATGAAACCTCATGTCACCACCCTGTTTTTGCAGCACTTT
CCCAGGCCCTGGGACGTGTCCTAGCAGTGTTTTTGCATGGTTGTGTGTTTTATAAAATTT
GCAAAAGTTAGATATTTCAGCACAATCAGTTAATATAGTTAAGATTGGATCTCTCCATTC
CAACGTCCTTTCATGTCCTGGTGCTTTTGCGTGTCCATGGGTGTTTTGTGGTCCTTTTAT
TCCTTCTTAAAGAGAGCCCTCCCTAAACTGATTAAGTACCCGAGTTCCCTTTGCTTATGT
TTATGGCAAAATGTAGAATAATAGCCCAGGTTTTATGCGCTATGGAATTTTTCACTGACT
TGTGGGATCCTGGAAGTGCTTCAAATTGAAACCCATGGGCCTTGAGGAGTCTGCTTAAGT
AGAGGAGAACAAGGGGCCAAGACTGGCCTGGGCAAGGGCCAGCAACCATAAATTATCAGA
GAGGGGATAGAATAGCAAGCAGGCAAGCTTATATGGAGAATGTATAATTTTCATATAAAA
CCTGAATAGAGATAAAAAACAAAGAGATAAAAGTAGAGGATTTTTTTCAGCATCAAAAAT
CCTGGAGCCCACTGAACCCAAAAAGAAAATTTAATTTATTAAAGTAAAGCTATAGTTTTT
CACTTAACTATCTGGAAGTTTAATGTATATACATAGCGTATTAGTCAGTGAAAGGGGTGC
TAATGCAAAATACCAGAAGCCTGATGGCTTTTATAAAGGGTATTTATTTGGGGTAGGAAC
TTACAGATACCAGGCCATAAGGATAGGTTATGTCCCTCTCCAAAGTCTGTTTCCACATGT
TGCAGCAAGATGGCTGCCAACGTCTGCTAGGGCTCAGGCTTCCTGGGTTCCTCTCTTCCC
AGGTCTTGCTTCTCTCCAAGCTCAGTGTTCCTTTCTTCCCAGGGCTTCTCTCCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGGGACTAAGA
CTATAAACATCACTAATTATCCATTCTGTAAATGTCTAGTGCCCTTCAATATATCAGGTA
TTATGTTGTTTATATAATTATAATAATATCCTATATATTTGTGAGTATTTTGAAAATGAC
AGGTATTCATACTTGCTTCTTGGTACTGACTAGTATGAATAAGGCCTAGTCCCATCTATC
AAAAAACTGAAAGGCAGGAAGAGAGGAGAAGACAAATAATAAATTAGTCAAAAAGCAAGG
AATAAGAAAAATACCTTTAGAAAGGCCCACTCAATGCTCTATAATTATTTAGTGGAGCAG
ATGATCACACCACGTTGAGGTTATCAAGATTCTGCTTCATGGAGGAGGTGACACTTGGAT
GGGCCTTGCCATGGGAGAGCCCAATAGGAGGGAATGGCAGGTGGGATGGAGAGAGCGTTC
TATCACCAGGGAGCAGCAAGAGCAAAAGTAGGAAGGCAGGAGAGCCAGAGATGTTTCTAG
AAAACAGCAAGTAAAACTGTTCTGCCACAATACAGCCTCAGAAATGTGAATTGGCTCACC
CGGTGTTGGCAAGTGGGAGAATGAGGACAGTAAGATGCAGAAGTCACATAGGTTAATATG
GGATTCTTCACAGCACATTACTGTTTTGCGTCACCAAGAAAAGGGAGCTAAATGTGAAGT
ATACCAGCACTGCTGAAGACACCAAGCCAAAGAAGAGTCTAGAGCCCGCAGCAGTCCTGC
ACACAATGTCCATTTGCCCAGGCACTTGCCCTCAGCCTAGTTCAGACAAGCATTCTCTCT
AAGAAATAATCATTGCCCACTTCTCTATCTTGTGCATTTTTATGACAGCTCTGTCACTCA
GCAGGTCAACCCTTCCCTACACTCCCTGCCATCAAACTACCTTCACTTTTTCCTTTTAAT
GTAGAGTTCTACATCTTCTGGAATAGTTATTTTTAGATTTTGTTGGCATACCTCTTTGAG
CTGTGCTAGGTCTTCATCAGGATCATTATTGTATTTGTGAGTTCTCTGCTGACAAAGTTG
CATGGTTTTAAATGATCTACCCCAACCATTTTCCCATTAGCCCTCGTATTTGTAGGGATG
ATTTTACAGAACTCTTGGTGGGTTGGTTTTGTTTGTTTTCTGTTTCATTTTCAAGAGAAC
ATATGTTGCATTTTAATATGAAGGCCAGTCATTCCAGCTAAAGAGGAGAAATGATTATAT
GGGAAGGGTGTGAAAGATAAGGCTACAAGAGATCAACTGGGAAATTTATAGAAGTCTTTA
GAATGTCAGTGTTAGGAATTTGTATTTATTCAGTAGTTAACATAAAGGATATAATTGTTA
TGCTTTAGGACAAAAAATCTGTCAGTGGTATAATAAAAAAAAGAAATCTACTCTATTTTT
CTTAAACTTCTGAAAATCACATTGTTTAAAATAGAAAAAATGTTGCCACAAGTAAAATGT
AATCAGCTTAACATTGAAATGTTAATGAATTTTTCATATACTAAACCCCAACATACATCA
AGTTCTATATTAACAAGCTGCATGCAGAAGAGAAAGGCTGTTCCAAAAATAACATAATTA
GTCCTTACAGACTTCACCAGCTATCAAGGTTCAAAGGAGAAACAAAGGGCAAGTTTAGAA
ACTTAGCAGTTTATTATCAATAATTAATTAATTATAAAATAATAGTTATTTTTCCTAGAT
AATGTATTTTAAAAGGATAGGAAAACTCTAATATAATGTGAGAGGTTAAAATATGCCAGA
AAAACTCATTTGTGTCCCTTCTCAAGGTCATCAATTTAAATACAGCCCTGTCTAGTTACA
ACTAATATAAGCTAATGAATGAAGTGAAGCCAGCTAATCTACATCTGTTCATTTAGCTGT
TTAAACTCTTTCCCATAGCTTTCCCTTTTGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGGCAGTCTGGCAGTGTATAATGCAGACTCTTCATGTTGGAGATTGTCAAGG
AAGCTTCTTCTAAGTAGTCTCTATATAACATTCTCATATCTCCAGTGCAATGTTCCAGAA
ATTTTTGTTTTTATTGTAAGGATAAAAGAAGGCTAAATAATAGCTCATGTGTTCATTTTT
CATGAATATAACAAAAGCATCTTTTATGTTTATATTAGAAAACAATTGTCGATAGAATCA
CCATGTGTTACCACATATTAGATGTAATTTAAATTAACAAAGATTTAACCCTGAAAGATA
CAGAACAACACATTTCTCCTTTTGTCTCCAGTGCTTTCTTCCTCTCTAGTCCAGGAACAG
AAAGAAAAACAACTTTTATGAAATGTGTACAGGTCCATTAATTATTTTTCTCATTAGCCA
GAATTTCATGAAAGCAATATTCTATGCTATTGTTGTTTTATAATTACATTATTGTATTAT
TTCTCAATATCTCTTCTCTACTTCCAAATTAATTCAATAACCCAACCTCAAAGATTCTAA
TCTGTGCTCATATATAGGTATTTAAAGTTTGAAAATAAATAGCTCCATAATTGAAACTTA
CTCTATAACAATATTATATAGGTAGATGATAGATAAAGATAGATTTTTAATAGATAATTA
ATCAGGGTACTCCAGATAAACAGAATTGACAGGATATATATGTATGTAAATATTATGAGA
TTTATTATAGGAATTGGCTAATATAACCATGGGGATTGTCAAGTCCAAGTTCCATAAGGC
AGGTTGTAAGCTGGGAACTCTGATGAAGGTTTTGATGAAATCCCCAGAGCTGGCAGGTTG
AAGTCAAGATAGAAATTTTTCTTTCTGATTGCTGAAATCATCAGTTCTTCCTTCAGCTGA
CTGGATGAGGCTTCTCTCTTTGCTGAAGGCTGTCTCCTTCATTGATTTTAGATATAATCA
GCCACAGGTGCAATTAACTGACTAATGATTTAAACCCACAAAAATCCTCATGATAACAAT
AAGGCCAGAGCTTGCTTGCCCAAACAACTGGACACCATAACATAGCCAAGTTGACATATG
AACTTACCCATCACAAATGGATAGAGAGATCATTAAGATGATAGGTAGATAGATAATATA
AAGATGGACAGAGACTAATGATAGAGATAACATACATTTGCAAAAGAAAAGCTTTTAAAT
GTCCTATTTATTAGAATTATAATCAATATACCTTAATTTTTCAACCAATACTGATGGTAA
AGGTATTCTCTGTGAGGCAATTTGCTATACTAAACTCTCTTTCATACCACAAACATTTTT
TTATGCCAACTTTCACACTAGATGCTGAGTTTTTGCTTGCCATAGGTCCTGGCTAATAGT
CATCTAATGGAGGAGACAAAAAAAACAAACATACAAATAGTTATGCTTCCTTGTCTAAAT
CTAATCTATCCCAAAAAAACCTCTTAGATGGCAAATGTTCAGAGAACATGGACCTATATT
CTGTTATGTTAAATGGGAAATAATGTATCATATTATATCCTCAGCCCTTCCAAAACCCCC
ACCAGTTCCCACAAATACCACTACAATACACTGAATCACCAATATAACCATCCACCAATT
ACTTCTACAAATATTAAAGCAATTAAATCACCAAGGACCTAATTATTCAACACCTTCTGA
AATCCTTAATGGGTATGCTTCATTCTAATACCTAAAAGACCATCAGAATTGGATCCAAAT
TACATTTTCCTTCTAGATCTATCTCAAGAAACATTTACTTTAATGTACAATGAAATAATG
TGCTAAACATTCCACTGAGACTATCTAATCTGAACTTGGACTGGCAATACCCCAGCCCAG
CCAATGCTTATGAAGAGCTAAATCTTCAGGGAAAGAGTAGGGAAAATAATAGGGATAAAA
TAGAATATGTTCAAACCTTGCAAGCAGGAGATTGGACAGCTGAGGTACTACTGGAGAGCA
TTCTACATTCTCCCATCCAGACCCATACAAACTTACATGATTTTGATTGCCTGCTTATGC
AAATTTATCATAGCAGGTTTCAGTTATTAAATGTCATTGAAAACAAACATTATAACAAAT
ATGCAGATAGTGAGGGATACCTGAATGTAATTACAAATGTGCTGAGTGCTATAAAAGAAA
AAAAAAAGTAGACTGGTAAGTCAGAAAATACCAAGGGACACATCTTTCTTTTATTAGTCT
GAGTAGTCCTCTCTTAGGAAATAATATTTAAGCTGAAACATGAAGGAAAGAGTGGATGAA
GAAACACAATATTTCAAGGTCTTAAAACCTGGAAAGAGTGAATTACTCTGCCTAAAAAGA
AACCTTAGGTTGTATTGGGGCAAACATAGAAGTGGGAAGATGAGTTTAAAAATTGTCACC
CAAGTCCAGGTGAGAGGTGATGGTTAGAATGATGGCAGTGGACATGGAGAAAATTGGAAG
ATATATTTGTTATGATTCCTGCCCTACAGCAGCTTACAGTGCAGTCCTAGAGGATAATTT
GTTGTATTGAATGGTGATGGACCAAGTAGACATGGTCTGATTCATGTGAACTGTCTCTCT
CTTCAGCCCACAGGTAGAAGATAGCGAGGGGACAATTCAGTTCGATGGAGAAGGTTATGC
ATTAGTCAGCCGCCCCATTCGGTGGTACCCCAACATCTCTACTGTTATGTTCAAGTTCAG
GACATTTTCTTCCAGTGCTCTCCTGATGTACCTTGCCACACGAGATCTGGTAAAGACCAC
ATGCACAGCACATCGTCCATTTGAAAATATTTTTGCTTCTTTTCCTTAGGAATCTAACGG
AATTATCAGTTGTTGTTAAATGTACAATTATTGTATTTTGAAAGGAGTCTGGGATGGCTG
TGTGATAGCCAAGAGTAGGTGATACCAATAAAGGGTTTATATTTTTCATTGATAATTTTA
ATCACAGATACAATTTAATTACTGTTTATTTTCAACATAAGCCCTATATCATTCTTTAAG
AGAAGCACCCAATAAGTGTTGTTCCTATATGGAATCACGCTGCAGCCAAACTACTTCCTT
AGCCTTCTTGCAGAGACCTAAGTTGAAAGGGGATTCTAAATTTCTTTTGCATCATTTTAT
TCCACATCAATATTTATGAGTAAATCCTTTCAAGATACAGACCTTTTGATTTGCTCAGTA
TGTTTTCAGAAGAACCCACTTACTCTACTTGTAATAAATGGGTACATCCTAGTAATTTGA
TTATGACCATTTACAACATAACATCACACCCTCAAAAAATATACAATACAACAGCACCAA
TTCTATTTCCAAAATGGATTTCTATTACAGAGCAACACATATAGTAATTTAGCCATTAGT
TCCTATTATAAACCCTGCAACAAAACCGAACACCCATGTATTTCTCTGTGTATCTAATCA
CTGGTATGTTTTTTCCTCTCTTAATAGAAAGATTTCATGAGTGTTGAACTCTCTGATGGA
CACATAAAAGTTAGCTATGATCTGGGTTCAGGAATAGCTTCCATTGTCAGTAATCAAAAC
CATAATGATGGAAAATGGAAATCATTCACTCTGTCAAGAATTCAAAAGCAAGGTGAGTTT
TTATAGGAATAATGCAGTATAGCCTTAATCATGCTATCCCAAACTCCCATGTAACTACTC
CTGAGGAAGACCCGTCTATAATTTTAGGCACTCACAAATTCGGTGTACAGTTGATATAAG
TCATTTATTTTCCTTAGATTGTAGACTGATTGAAAAGCCAAATGGTTCTCTGTCATTTTC
GTTTGAAACTGAGAGCATGATTTGAAAGCATAAAACTTCCTACAACTTGGAAAATTATAT
CCTGTGATAAGTTTGAAAAGTATTGTAGGCTTCCTTCTCTGCTATTTTGCCAAGATGTTT
TCTGTAGAGGAGCCCACAGCTAGAATTTTTAAGGGTGGTAGGGCACGGCTATCTGTTCTT
TCCTCTAAAAATGCCAAGAATGTGTCTGCCTGCAAATAAATAATTGATGAACAATAACTT
GACACATTTATGTTTCCAGGACATTTTTCAAGACATTTCTGCACACATTATTTCATCTGA
TCATATAAGCAGATATTTTGTTCTGGTTTTGGAGAAAGGAAAACAGACTCAAACTTACAA
ATAGCCACAGACACATCTAAAATCCCACAACCAAGACAGAAGCCCAGTGTGCTGCTATTG
CTGTTTAAGCATGATTCTCTTAACTCTGTACTGTAGAGGTACCAGTATCTGCGTATGTAC
CTTTGATACTTCTGCGAATATAAATAGACCTAATTTATTTTGGCCACACCAATGTGAAAT
TTCATGAAAATTTACATTTAGCTTTGTACCATCTTTCATTCCTATGTTTAACAAGGACCT
ACTAAGTACCACACCAAAACTAAATGAAGTCTGAGACAGCTGCTTGCCTTCAAAGAGCTT
GCTGTCTAATGGGAGAGATGGATAGTAAGTGAACGGCCAGAGGGTAGAGCGCTAACTTTT
GTGATGGAGATTGCATAGAGGGTTAGCAGTCTCAGAAGAAGGAACATTTAAGTCAGAGAG
GTCAGCTCCTAAGAGCACGCCCTGAGACACAAACAGGATTTGAGGAGTTACCTAGCTGGA
AAGCACATTTGGACATTTCAGAGTGGTGAAAGTTGTGTGAAATCATGAAGGCACCACAAA
GTATAATGCATCATTTTCACCTGCTTTTCCTTGGAACATGAAACCCTGGAGAAATTCCTC
ATGAGAATGAAACCTTGTTTTGCTCTTCATAAACTGGAAGACTTAGTCCCCTGGAAGAAG
GGCACAAGGCACATTTGCAGGTTCAAGGCTCTATATCAGAGTTCAGTAAGAAGAAACTGG
TTAACTCTGTTTGACCCAGCAATTCCCAAACTTCTTTTATCACAGAAATCCTTCCAATCC
CATAATACTAGCATTCTGCTGAACACAGTTTGGGAAATGCATTAGTAATTACCAAAAAAT
CTATAGGCAAAAGATGAATGGTGGCAGAAAGTTATCAGGAGATGAGACTAGAGAGATAAC
AGAGCCAATTCATAATGGGATTTATGAGCTAAGCTAATGAGCTTCAATTTAATCCTGTGA
ACTACAGGAAAGTACTGAAGAGTTTAATCAAGGGTGTGACACGATCAGATTGGTGCTTTA
GTAAAGTTTCTTTTGCAGTGGCTTGGAAGGTAGATTTCTGACAGTTTAGGATGCTACTGT
TGTAAACAGGTAAAGAGTAAGGAGAATGAAAAAAAGCCAATTATCATAAGAATGGAGAGG
AAAGAATAGACTTGAAAGATGGAACACATATGAAACTGAAGAACATTGCAATATATACAT
TGTGGAGGCTAAGTTGAAAATGGTGTGGGGAGGAATTTAGACTGATTCCCTTTGTGCAAA
GTATGGAATACAAGAGAAAGAACAGGTTTACTGGAAAAGATGTTGAGTTCAATTTTGGAA
AAGTTAGAGCTTATGAATTTTTGGAACAGTTGAGGGAAGCTATTTAATTGGGCCAGTAAT
TAGTTATATGGATTTGAGGTTCAATAGACTTTGAGGAAAGAGATGGATAACTATTACAGG
AATCATCATCATGTTCTAAACACTTGAAGCTGAATAGGGATGAGAAAGCCAAGCACTCAT
ATTTAGAACCCTGGTGTGCATAAATATTAAAAAGAGGACAGTAAAGAAGAACCCACAAAG
GGGACTGTAAAGAAATAAAGAGAGGAAAAATAAATCCTTGAAAGTGTGGAAGCAAAAGGA
AGAGAATTTCTAAAAGAATGAAGGGTTTACTTAATGATGGCAGAGAAAGCTCAGGGAAGG
CAAGGACAAGGAATCCATTGTCTCTGGCAACGTGGAGATCATCGGGGGCTTGGTGAGAAA
GGTGGAGTGGTCCAAGTGAAAGCTGGTTGTAGAGGATTATGGAGTCAATGGACTATGGGA
AAGCAGACACAGTGAGTATAGACTGAGCCTGAAGGGATGTTCAGAAGAAAAGGAAGGTAG
TAGCTAATAGAGGGATATAGAGTTGGAGGGCAGGCATCAGAAGATAAGGGGTCATCTTGG
TTTTGGCCATCCATCCCTAGCACAGAATAGATGCTCAATAAATATTGAATGAATGAATGA
AAGACCATGTTTGTAGGCTATAAGGGCTGTGCCAGTAAAGAGGAAGTGAATGGGGGTACT
AAAAAATGGGAAGATGAGTACCTTAGCAGGAGCTCTTAGGAAGCCTGAGAGCCTGGCACC
CAGAGTATGTGTGTGGGGGGAGAGGGGGTCAGTACTCAGTATGAGACAGGAGAGACTCTA
TCCAAGACAGGAAGGAAGGAATAGAGCAATCGTTGAAGATAGAGACAAGTTGAGTTTGAA
ACGGGATTTTGAGATAATTCTCTCCTGATGCCCTACTTTTTTCATTGATGTTAGAAGCAG
AAAATTGACTTAGAGTAGGACTGATGAGAGGTAGGAAAAAACANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCATG
TTATGTTGTAATTTGAGCATGTCACCAATTCAGAAAGCTCTTCCTTCCAATTGATCTGAT
TTAGAGTACTTAGTAAATACTCTGTGGTCCAGAAAAAATTTTTTAGGAATCTTCCCTTTA
TCATGGCTCTTTAAGCGTCATCTTTCCCATTCCTTTCCTTTGGCTTGATTTATTTGATAC
AGTTGGCTGTTCTCTATTTTTTCTTATTTTTCTCCTATTTTTATTTCATATGTCTCTCCC
TGGCCTTTAAATGACTCTAGACTACACATTATTTTTTGCCCTCCTGATATTAATGATATG
ATTTATCCTTCTTCCTTTTCTTATGTGTTTTCATAAAGTTGCCATTAAAGTATTGATAAA
ATCATACTTAGCCTGTGAGGTTCAGTGGTTGGGCACACTGATCCTCAAATTAGGTTGCAA
GCCTCTTCCTTCTCCTTCCCATGGGTGGGTCTGAATCTCCTTTATCTCTAATGTTTTACC
ACCAACTTTTCAAATCAAATCAGTGAAAATTTTTATTTTAATGAAACTCCCAATAACTCT
TCTATTTTTCCACATGTAATCTGATATATATTCTGTATATAAACTTTCAAAAGCATTTTT
ATTGCTCTATCAGATCAATGAGCATGTATTAATTTTTATATTATAAAGAAAAGCACTAAA
GCCACAATAGAAAAAATTGTAAATATTATAAACAGACAATTCACAAAAGAAAAACAAACA
CATTTCTAGTGTATAGTTGAAAAATGTGTTATCAGGAGAATGCAAGAATACAATCATTTA
CCTGCAGTAGCAATGTTAAAAGATCACCCTTAAAATAATAAAACCTAAATTAAAAAGGAA
AGGAAGGATAGTTTGAGAAAATAGCCATTCTATCTGCTTTCTTAAGTTTAGCATTTCTAA
GAAACATTTATTGAGTACTGACTATGTATCGGATGCTGTGCTGAATCTCTGAGGATGACT
ATAGATTCTATCTTTGAGTAATTTATAGTCTGTGATGCAAAAGTAAATAGATCAAGTCAG
TAGGATGCAGTAAACACTATGGTAGTAGATACTTTAGGAACAGAGAAGTAGAGCAACTAA
CCAAGTGCTAGGGCACTCTTTCTGGGATTTGAGGCAGTTGAGGGTTATCCAGGCTAAGAA
GCATCACATGAAAAGTCAAAGAGATATAAAAGATAGACTGTTTAGGGGGAAATTGTAATG
ATTTTGAATTACTAGAGTTAAAATTTCAGAGGGGTGGTGGAAGATAACACTGCATGTTGG
CAAGAGCCAGATCACAGGGATCCATTTTTGCTATGTTGAAGAGTTTGGAATTCATGTTAG
AGGATTTTAAGTAGAGATGTGACATAGTGACTTTAATTTTAAGTAAATTAATCTAGTCAT
CAATGTGGAAGGTAGATTTTCAGAAGATCAAACTGAAGACAGTATAAACAATTAGGTCCA
GTAATAGTCCAGGCAGGAGATGAATGATGGTTTGAAATAAGCAGTTGCAGTGGGGTTAGA
CTTATGGAAATGAAGGGGAAAAATCCATTATGAGATACCACCATGCAGTCAGTAGAACCT
CTAAAATTACAAAGACCAACCATACCAAATGCTGGAGAGGATGCGAAGTAACTGGAACTC
TTACATACTCTTGGTGAGAATGTAATATGGTATACCCATACTGGAAAATAGGTTGATGTT
TTCTTGAAAGGTGAAATATACATCTTCCATATGACCCAGCCATTTCCCTCCTACTTAGTC
ACCCAAACACATTAAAACATATATTCATACAAAGACTTGTACTAAAATGTTCCAAACAGC
TTTGTGACAGTCAAAAACTGAAAACAACTCAAAGGCGTCCATCAGTAGGTGAATGGATAT
ACAAATTGTGGTATATCCATACAATGGAATACTACTCAGTAATAAAAAGCACTTAACTGT
TAATACACACTCACAAAATGGGTGAATATCAAAATAATTATTCTGAGTGAAAGATGGCTG
ACAAAAAAAGTACACCTGAATATAAAATTCTAGAAAATTCAAATGAATCTATAGTAACAG
AAAGGAGATCAGAAGTTACTACTAGAGTGGGTTTGGCAGGGAAGGGCAGGAAAGAGCAAT
TACAAAGGAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTCAGTGACCAGAGTAGTGTTTGAGA
TGAACTGTTCTCAGCCAGTTTGTAAAAGCACCGTCCCTTGAAATCCCAGTACTCTGCCTC
AGGGGGCATTCTCCATCTTCCTTGAGAGTCACTGAAACCACAGTGCTGACAGAAGTTGCC
GTCTCCCCCACAGGCATCCATATAAAATAAGGCCGAGGTGGATAGCTTAGATTTTCAATG
GAGTAAAAATGAGATGGCAAGAATTACCAAAGTAAGCTTATAATAATTCAGCATTGGCTA
CAAAATATTTATCAAGCCCTTCCCCTGTGTCTAGTATTTAATAAATTCCCGATTTCCCTA
CTCACTGATAAGTATTGTGTGTACTCATCAACTCTTAAATTTTGTATTAATAGCTTATTT
CTCTGTTCTGTAAAGGAAAGAAATAGGTCAAGAAATAAGAGGAGGGGAGCAGATGTGGCT
CAAGCAGTTGGCTGCCTCTTCCCCATATGGGAGGTCCTGGGTTCAGTTGCTGGTGCCTCT
TAAAAACAAAAAAGCAAACAACAAGCAAACAAATGAAGGAGACAACTTGGGGAAGCCAGT
GCTCAACCACGCATGAGGTCCCGGGTTCAATCTCTGGTCTGGTACCTTAAAAAAAAAAAA
GAGAGAAAGTAAGAGGAAGTGTTAGCGTTTCATAGCAGAATCTACTTTACCGCTAAAGAA
CTTCCTTTAGGTCAGTAATCAATATGCCATTTGATGCCTCTCTGATGGAGCTAACTCTTG
GGCCACTGAGTTTCAATTCCATTGTGTTGTTGCTCTTTAATCAGTTTTTCTGAATGATTT
CAAAAATTGCATATATTCATGCAAGGATAAGGAGGAAAACTACCTCCTACTGCTGGCTTA
CCTGAGATAGAGAGGCAGAATCTCATTTTCACAGACACCATTAAAATATCCACAGGTCTG
TAAAAAGAGGATATTTTCATGTTCCAGTCAACAGCCCCGTATGAAAGCTTATTTGCTGAT
CTGGATAAAAAGGAATTTGTATGAAAAAATCATGAAAAGCATTTTATAAATTTCTATTTT
TAGTCACCAGTCTATGTCAGAGAAATATAATCCTTTAAATATATTTTGAAAAGTAAATTT
TTAAATCTTGTTTAAATGATTTTTAGTAGGATGATTTTTCTTTTTTGGTGTTTTTGTTGT
TTTTTCTTAAAAAGTCTGCTTTGAAGATTTGAGGTGTTAATAGATTTGAGTACTTTATTT
TGGTCATTTTTTATGACATTTGAGACAATTATATTTGGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGCATCTAGAAATGTCTTATAATTCATTGGTCCAAATGT
CCATTTTCAGACTCTTGCTAATTCAGATCTTTTATCGGGCAAAGATTTAGAGGCCAAATC
TATCATGTTAATGAACTGATACTTTAATACCTATCAGCGCTCCAAATATATGAAGCAGAT
AAAGGCTGAGCCTAAGAAACATTCTAGTGAGGACACACATAATTCAGAAAGTAACTAGCT
TGATTCTTAAGAATGAGAGGAAAATATCGGTGAGGTAAGGGAGGCCCATCTGCTTTCTTA
TTTAACAAAGCAGTTTAAAGAGAGAAGTGCCTCTCTTCTTTCCTTTTTTCCTTTCTATTT
CTGAATTCTTATCATACTCATATCAGACAGACCTTTAGAGAATAGAGAGAAAAAGCAATA
AGGGATGAGGACTTTGCCACTCTCTCAACACTCAGCATCCCAAGTTCAAAGTGAAATTTA
CCATGGACCTGGATCCTATCATCTTGCAGACCTAAACATCCCCATCTTGCCACTTCCATG
TGCACCTGTCTTATACAGCGGAGTAATGCTTTTTGGAGGAGCCTAACTCCCAGGAGTTTT
GTGGATTCTGAAATTTACAGAAAGAGCCACAGATTCAGTATATTCCTAAATATTTAATTA
CTACTAGATATCTATTTTAATATCTAATTCATTATTTTATATCTAACTTCCCAACTTATG
TATATTTTGAAAAACTTGGTCAAATGGCATTTTGATGTTCATCTAGATTTACCCTCAAGG
GTATTGACTTGAGAAGCTATTGTTTTCATGCCTTGTTATTGTGGATATTTTAATAAAGTA
TTTTATTGATGTAACTGTCATTTCTGCAGTTATTAAATGACTGTGCATAGTACAAGTGTT
TGGAAGAGTCCACATAAATTTGAGAATTAAACTAAGTTTATCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTTTTAATTTCACATGTGCTTTTTAGCTAGCAGGGGACATTTAACCAGCAA
AAAAAAGGCACATTTTTAGTTCATGGTTTAGTTGGTTCAAAAATAAATAAATGTAAGTAA
CCGTAAAATTTCAGAAAATATTTCATATAGTATTTTTTTAATTTACTAGTTATAAAACAT
AAGAAATAAAAATCTATAAAATACTTGGTGCTCAATAAATATGAATTGAATTTAATTAGA
TTGAGATGCATTGATTTGATTAAACCCTAAGTGCTTATTTTAAACAGACTACCATATTTT
CAATTTTTTGTTTTGCTTTGTTAGTTGATTTATTTGTTTTTTAATGGGTACCTGAGTCCT
GTCCATGTGTTTCTACTCTAAAAAGTTACATTGTGTTTGGAGGGATTTCAGAATAGCAGA
GAAGCATGATGACTAGTTATTTCCATTTTTCCCAAAAGAATTTTTCCCATTTTTCCATTT
CCCAGTGAAACATCGGTCTCATTTTGTAACAGCTAATGCACAGGCTGAATTTACTCTTCT
TCTTCTATCTGCACTCATAGATCAGGCAACTGTTTAATTACGTCTTTCAAGGTTATAAAT
TATAAGTTTCATGGTGCAAATAAACTGGCTCTGTATTCATTTTCATATGTGTTTCCAGCA
TGTTTTGTGTTAGGAATATAGATTCAAAATGCCTGGTCAGAAAAATTGCTAATCAAATGT
ATTTGACTAGTGACATAATTATTTTTTGGAAATTCATTTGGTCAACATTCATTCGTCAAA
TGTTTGTTGAGCATCTCGTGTGTGCCAGGTACCACACTAAAAGCTAAGGATCCAGAAGTT
TTTCAAGTCTAAGTTTGCTTTACAGAGTCATTTACTATATTCTACTATAAGTGAAATACA
GCCCAAATGAGGCTATCCAAACCTAGGTTCATTTCTTCTAGTGGTGACTTGATTTAAATG
ATCTTAATTGATTTTTAAGTATTAGGTACAAAGGTGAATTTCATTGAGATGGGTTTGTGT
ATTAATTGGTTTGCAGTCTGCGTATCTAATATCTTTATTGCTAAGATGTTTTTACCTTCA
TAATTCATAATTATCATAGTGCTATGGTATAGCACAGTATTTCAGAACAATCTTTAGACA
TCTATTTGTGACTGACCAAGAAGCTGAACAGTCATAGTTACCTGCTATGTTACCCACAGA
CAAGATCTCAATATGATAAAGTGCAAAAGATGTGGTAAAACAAATTATTTTTGCAGATAA
TAAGTTCAAGCTCTACAAGAGGCAGTATTTATAAGCCATTCATGAATAACACAGACGCAT
TTGCACTTCCCCATTTGTTAGATTGATAAAAATTCATACTTAAAATCATATTCCAAAATA
AAAATTTTCCAAGAGACTAGCTTGGGAAATTGGTCATTTTTAGATTCTAACTTCACAGCA
GTCAAGGACATGTGTCAGTTTTTCATTCTGTCAGGGTGTTCCACTCCTTTCCTATGTAGA
CCTGAGATGCTTTCTGTAAAGATTTATAAGTAAAAGTTATTGTCTTACTAAATGGAAATT
CAATGATAAGTAATTTTTTTTTCTCTTTCTCTTTCCTTTGACCTAGTATGAAAGCAAGGT
AACCTTTACATTTATGCATGCCTTCTTCAAGTGCATGGGTTGGGGAAAAGGGCTTCTTAG
ATAAAGCGGCCATGCAGAAGCAGAGTGACAGCTGTGCAGCTTTAGCTATAGTACATTTCA
TGAGCAAGGAATGCTTTCTGAGAAATTGCTCATGCTGCCCTTTGCTTTCAAAGTTGCTGC
TGCTTAGCCACCATCAGCTGGGCTGCGATCTGAGTTATTTCACCAGCAGCAAGGCTAGGT
TTGCTCTGCTCATTTGTTCAATGGCCAGTGGCGTGCCCTGGGGATCGGCAGCACTCACGT
GACCTGGTCAGGTTTATGGGTGGGCACAGACTAGTTCTGGGGAGCAGAAGTGTTCTGCCC
GCCCCTCAGGTCGAACCTTGGACCTTTCTAGCACCATGCTGCCTGCTGAACAATCAACCT
TTGCTCACCAGTGCTTACCATTGTCTTGTTGCTTTCTGTAGGCCTCCGAGTGTGCAAACG
ATTCCGTGGCCTATAGGCCCCTTAGCAGAGCTGTTTATTTATTGCCAGGTTTATTTAGAC
TTAGCTCTGGAGCCGAAGTCTAGATGAAAAGAATCTCTGGAAATGCTCTCTTTATTACAA
GGGTTTGCGTTAATGGTGAAGTTAGTGGACAGCAGCCCTAGCTTCACAGGAACGTTTTAA
TTCTCACTTGCAGGCAGGCGTTCGCAGGAAAGCTGTGAGCCTCAAGCCTCAGTAAAGTGG
GTGCTGGCATCCCAGAGAAGAGCAGGGCTGGGGCAACCTGGCTTGAGAGAAAGCTGGGTA
ACGTTTCGGAGCCCAATCATGCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAATTCAGATCACTTAGCCCA
GTGTCACATAATAAACCAGAGCAACCAGCTGGATGCAAGGGTAAGGACTTCATTTTCCAA
CCTGTTGGCATGTTTGTCCATTCTAAGAAGTAGTGAGCAGGAAGTAAGCGTTCAAGTGTA
ATATGGCTATAAACTCCATGCTTTCAGTCCTATTGGAAAATTTAATTTTGTTTTGTGCCT
CAGGTTGCTTTATTTTGTTATTGCTCTGGTATAGAATAAGACTCTCTAAATCTAATTTAA
AAGTATTTTGTTTTTAGATGATGAATCCAAATGAATGTTTCTTGTACTTTGTTTTAGTTA
AAAGTTTTAAAGAGAGGTATCCCACCCCACAAAAAAAAAGTCTCAATGAGAGAAGTATGC
TCTTTTCAAACTAAAAGTTTGTAGACTTATTTTCTAAATTTTGAGCAGGTTTATTTTTAC
TTTTATTTGTATGTAGTTTGATTATACTGACTATGCAATTATCCCCTCTTCAGAGGGAAA
AAGAGACACTTTCATTAGGCATATGAAGCACTTAATAAGAAGTCAGTTAATTCCTGCAGC
TTGTATTAAAATGCTATGGGCAAGGTTATTTTAAAAAGGTGAAGAATTACACAAAAACTC
CTAAAGGATGCTGTTAGCATCCACTTACTCCAACCAGTAGATGACGGACAGCGCAGTTGC
TGGGTCCACGCGAGCCTGTTGCACAGGCTGATAAACACAAGCCCGCTGGTGAGGGGTGAG
TTTGCGCCACACTGCTTGCTTCCAGGAGGACAGGAAGGACATTGCTGTTGCCCTAATGAT
ATGGCTTTTGCTTTCCCTTTGACTTTTCAAACAGACCGGAAGTCAATTTGAAGAAATATT
CTGGCTGCCTCAAAGATATTGAAATATCAAGAACCCCTTATAATATACTCAGTAGCCCTG
ATTATGTTGGCGTCACCAAAGGATGTTCACTGGAGGTTGGTCTTTTTATTTCATGGCTCC
CTAAACACACTCCTATCAGATTTTGCTTTGTTTGGGTGCTCTAATAGGGACGGGTCTCTG
GTAAATGTATTTTAGATCCTACTGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTCTGGGATCATTCTCTTGGGAAGTGGAGGGACGCCAGCACT
CCCTAGGAGAAAACGAAGGCAGACTGGACAGGTAGTCACACCTAGTTGGTGATGCATTCT
CTTCAGTGCTTATATAAAGCAGTTATTTTATAAGGAGGCTAGTGAGGCATTTAGGGTTTG
TAAATTGCTTTTATCATTTTAGATTTGTATCCTTTTTTTCATTATAACATTCCCTTTATT
TATGCTTGTCTCCTATTTCTCTCTTGCCATCTTTTTAGGACATTTGTATCCCCTACAATT
TTCTGGTTGATCAATTCCAGGTTATTTGCACCTACATTTCAAATGAATTTATCATAGGCA
TAAATAAAGATAGAAAGCTCAGCATATATTCAAAATTATACTAATCTTGTCTCTAAATCC
AAGTCTTTACTAGATCTGTAGAGATCCATCCATGGTCTTGTACATTTAAATTCCTGCTAA
AATCAGTTTCCTGGTGTCATTAGCTAAGGTGATGCTGTCTGTTAGGGCCGGGCATGCCCC
ACCCCTCTCTGGCACACAGAAGGGCAGAAGAGGGAAATAGAGCACAACAAGTGCAGGTAT
GGACAATGTGAAAAAGAAAAATAATAGCTCAGTCCTTCTTGTGACATTCAAATAAAGCCT
AAACAGTGTTCTCCTTTGTAAGTTCAATCTGTTCTACCCTAGCCACTTGCTTCTGTTAAA
CACTGTCTCTCAGATGCCCAGATCTAGAGTTATACTTTACTGCCTTAACAGCCAGACCCT
CAAACATATTTTTAAATATAATTTTTACATTCAATCTAGTTTTCCTCAGTGAAAGGGCTC
GTAGGAATTACCCAGTCTGCCATGAGGGGAAGATGAGAATGCTTTACAATATGCCCATAA
ATAGCCACACATCATTTTAAGTCTGGGTTGTGTTATTTGTGATTATATGTGCTTTTAGTC
AACTTTATCATTTAATATTTAGCAGAGTATTATGCAATAAATCTTATTAATTGCTTTAAA
AGTAATAAAGCTTAAATAAAATATTAGCAAACAGAACCCAAAGTTGTATAAAGGAACGAT
AATACATCATGAGTAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAATATGGACTATAAATACTCTCACAAATCCTTT
ATCTTTGAATCATGAGAAAAAAATTGTTTTCTCACTTTTACAAGTTATAAAGGTAGTCCT
AATAAGAGATCAGATCAAACGTTCTGAAATAGATTTCCATTAAAGGACCATTGTTTTCTT
AGTATCTGCCAAATTACTAGGTATGGCCTACTGGCTCCAAATTTCTCCTCATTGGGACTA
AATGAATGAACTTGAATCATCAACTTTCAGGAGATTTCTTGAAGTCAATATGTTCCTATT
AAGATAAGAAAAATAAGAAAATACGAAGCACTGTAGTCCAAAGTAATTTGAAATGACGCT
TAAGTCTTTTAGCAATTTAACAATAAGGAAGGTCTGCTTTTAAAAATGTCAGAGGAAATG
CTGTCTGAAAAGGGAAACAATGTTAAATAGTTCCTGTTCTGCTGAATGGGTTTGGTATAT
CAAATGATCAATCAACTAAGAAGTTTTAATTGAGTGAGTCTTTTATGCTTGCCTCCTCGT
TGGATGGTGAGCACTACTCCAGGGGACATTTTGCTTTAGACAGAGAGCTGCATAGCTACA
TAGCTGATTTAGTAAATTATTGGAGGCATTATAATGTTTGACTGAAACCACCTCCACCGC
CGCAGATGGCTCCGGAGGCCCCGGCAGTCACTGGGCAGAGAGGCCCCCCACAATCCTCCA
GATTTGGAGCCACATGGCATCAGTTCCGGGGAGGAGGCCTGCCTTCGAGCCCCCTAGGGG
TCATCAGAACCGTACTGGTTGCTATAGTAACAGTGGCAAGAAGAGAGCAGGCATGTTTGT
GGGTGAAAAAAACTGTCTTCCTTCTTTCTGAATGTGGGAGACCAGTTACATGTAAGTGAT
AGCAATCTGTTCAACCAGCTCAGAGAACACAATTGAAATCTAAACATTCAGAATGGCAGG
AGGCTGAGGGGCAGACCTGATTTCCAGAAGCCAGCTGTCCTCTTGTGAATGTAAGGGAAA
GGATATGGTTGACACCTGTATTTCCTGAGGGGTTTTGTAAGTTGATGCCCAATCCCAGCA
CAGCAGTTACTTGCAGCAGCTCAATCCACTCTGCAGAGAACTGCTAAATCATCCAATTCG
CATTCCATCTAACATGCCAAAAAACAAAGGGTAANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATTTTAAAATGGTATTTCCAATGGCCCTTAACGCCTTGTAAGGAAATGTCTGATTTCTC
AGGTACATGCTCAGAGTCAAAGTGTGAGAACCTCTAAAATGAAGTCCTTGATGAGCTGTT
TAGTCCTCCGTTTGCTCTTGCAGGCCTACTATGCGGTATTCCTGAACAAGGGCCGCCTGG
AAGTGCATCTCTCCACCGGGGCGCGGACGATGAGGAAAATCGTCGTGAAACCGCAGCCGA
GCCTGTTTCACAACGGGAGAGAACATTCCGTGCATGTAGAGAGAACTAGAGGGTAACAAT
AACTCCGGCGTACTTATCGTTAAGCAACCCTACCAGCACCAACTTGTTTCCGAGCATTAG
GCTCAGCCCAAGGTTGTAGGCATATGCAGTGCCCAGCTATGAAGTGGCTTCATTTTCTCT
TGACCTTTCATTCTCCAGGAACTTCATTTACCGTGGCCCTCAGGATTCTACTGTAACATT
GTTATTCTTGGCAGTTCTCTCCACCTTTGGAGAAACCAAATGCATCTCCTGAGGCTATAG
ATCAGAAAAACCCCACCTCTCAAATCCTCTTCTCAAGTAAGGTGTGTGCCTAATGAAGGG
CGCAGGAGAGCTCAGCTAGAGGCCACAGCCTTTGGCTGCTGCTGCTTCATTCAGGGTCCA
AGGCCGTTAGAGCAGCTGCTTAGAAACCTGTCACAGATAAGGGGTGGCAGCAGCTCCAGG
CCCTACAGAGCAGAGCTCCGTGTTCACGTGGCAGCCACACCACCATGCCTGGTTCCCCGT
CGCCCTCCCCCAGGTGTGCAGGCTCTCTGTGGAGTGACTTAGGGAGAGAACAGAGCTGAG
GGAGGGGAGAGAAAATGTGGCTCTCTACAGAGCCACAGAAGCACAGGCTTTCCAACCCGA
GTCAGGGAATTGGCCTCAACAGTGTATAAACTGATTCTTCAAAATGTTGCAGTACATCCA
TATTTTTCCTCAAAGTATTGTGTGGTGACTCAGAGAGGTAATTAGTTGAAAAGACAATTA
AAAGAGGGGGAGAAAAGCCTAGAGACTTCAAGGGCCTCCGAGCTCCAAACAAGCAATCTG
TTTACTATACTAAAGACTTAGAAAAGAACTGGAAATCAAATCTGATGACTCCTCAAAACA
CAAAGAGTACTTTGATTTATTTATTTTTTTTTAAGATTTATTTATTTATTTAATACCCCC
CTCCCCCGGGTTGTCTGTTTTCTGTGTCTATTTGCTGCATCTTGTTTCTTTGTCCGCTTC
TGTTGTCGTCAGCGGCACGGGAAGTGTGGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTACTAAGTAAATAATCTAACT
GTCCTTGGCTCTTTTTTTTCTATTATTATTATTATATATAGCAGAGGGTTGTGGGCTGAA
TTGATACTAAGCATTCATGAGGTGTCTTCGAACCGAGATGCTTACGGGCCCTGATTAAAC
TAAATGACTCATCACTTTTTGTGACACGCTAAGAACTTTCACTAATCTAATACCTATATA
TTTCATGGATGGGCTCTGGGGAGAAATGCAGATGGAATTTCCTCATTGGAGTCTTAGGAA
ATGCTTTAGCATACTGAAAGATACGATATTTCTCCTAGATAATATCCCACGCCTCTGCCA
AACTTTAACGTTTCTCATGACAGGGACGATTTTCTTAAGTCTTTAAACATGCATGTCAGT
AAGGGAATACAGACTTGAGAAATATGGTTGACCAAAAATAATCTGAAATTTGTTGTTATG
TACAGAAAGAGTTTGGAAATTCCCAAATGCATTAGGATGTTCGACTGAGGTGTCATTCGA
ACAGGGTGTGTCTTCTGGAATGACATTTTATTATGCTAGCTTCACCGCTGTTAGACATCT
CTCCTACCTTTAGGGTGATTAAGCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTTCAAAGAAGGAAGCCAGTACAATAAAAATTAAAA
AAAAAAAAAAAAAGATAAAATATTTCGTTTAAATTCATTCCACTAGGCCCATGGACTTTG
CACAGCCGGTATCCTTCGAAAACGCGGACATCGGTCGCTGTGCTGATCAGAAGCCCCGTG
AGGATGACGATGGAGCAGTTCCAGCTGAAAGTGTTGTCTCTCCAGAGCCTGTTCCCACCC
CAGCCTTCCCCACACCCGCCCCAGTTCTGGCACCTGTGAGTGTTTCTATTCGCATTGCTT
TCTGTTTTGCATCCTGCACTTTGAGGCCTCTTCAGGCGGAAGGACATTTGAGATAACTGG
TATAACCTACTGCTAGTACTGGAGGCAGGCGGTCCTGTCCAGGAAAAATGATTCTTCCCA
CATCGTCCTCAGGTTCCTTTTATTTATGGATCTGTTCTGCTTTCACTGGCCTGTTTTTTT
AAATAAAACATGTTTTCACTGGAAAAGTTGAAAAGCACAGAAATGCCCCAATAATCAGGA
ATAAGCCCACCTATAATACACCATAACCATATTTATTTTCAGGCCCTTTAATGCATTTTA
TATAGAAGATCTCATATCATATGTACAATTTGATATTGTTTTTCTACCTACTGGTAATCC
ATAATTAAAACTGTTCCTAAACACAATATAAATGTGTGTATATGACTGTATACATCTATA
TGCACACACAAACACAGACACACATATTATTTCATAGTATGGAGGCAGTATATCTTGAGT
AGAGCATGGGCTCCAGAGTCAGACCAAACAGGTTCAAATCCCTGCCACTCTCACATGCCA
TCTGTATGAACCTGGGAAAGCTATTTTCCCATTTATTCATCAGTTTCCTCATCTGTAAAA
TGAGGATATTAATAGTACATACATCAAAGAGTTATTGTAAAGATGAAAAAATCACGTTTG
TTAAACAGCACACCATGCCTGGCATTTAATAAATGGCATAGTTAATGACATAGTGATAAT
AATGATTACTATTTTAATAAATTCTTTCTATGTGCCAGCCGCTGGCTAGATGAATTCCAT
TTAATATTACAGGTAATTCTCCTAACAGCACTGTAAATTCTCCTAACAGCACTGTATCAT
TATCCCATTTTTAGGTGCTTCTCAGAATTAGCTACCTTAAATAACTAACCAATTCACACA
GCCAGTAAATGGCAAGGTAGGAATTTTAATCCAGTGAGTCTAACTCTAAAATCTGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAAACAGAATGTTAGTAATAA
ATGTTAGTAATAAAATAGTTAATTATGAAACTGAGAATCAGCCACTGAAATTGTAAGAAA
ATACAGCTGGCCTATCTCAGTACTAACAGTAACACAACATTTAATATAGTGCTTTGCAAG
CCATAGAGTCTTAATAAAGAGTTGTTGAATAAATACTTTAAAAAAACATACCAGGATCAT
AATGGACATATGGGTAATGTCCTTATTAAATAAATGATGTAGATTTGATGCTCCTGGATT
GTAAAATACAAGCAGGAACAAGTTTCTGTCTTCTAGCAATGCCCTTATTTAGTAATACAA
CCTCGGGGCAACCCCTAAATTAATGTTTTCCACTGTCTGAAGTAGGTAATTGTATACCCA
GTTTATAAATGAATGGAATGAGACTGAGAGGAGTAAATAACTTGCCGGAAGTCACACAGC
TAGTAAGCTTCTGAGCTAGTACTTAATTCCAGTCTGTCAAAGCCATGCTCATTCTCTGTC
ACCACCCCATGGTCTGGTAAGAAAGGGCCACTCTTATGCTCCTCGAGGCAGGACCGAATT
AGAAAGAGAAGGGATCCTGGCTCCTTAAAAAAATTCTAATCAAGACCAGAGATTTGCTCT
CCTTTGACAATTTTGGATAGTGGCTTGAACCCCCATTAAACCCCTAGGGACACTGCTGTA
GCATATTAGTCAGGAGCTGCTTTTAGGAAAAGTAAAAAAGAAGGTGTTTAAAGCATGTGT
GGGGGGTGCGGGGACTTCTCAAAATCACAGACACCCAGAAGTGTGTGGATTTCTAAAAGT
AAACCATCAACCCTTTTAGCAATGAGGCTAATCTCCTGATTTTTGCTACCACACCCTTCC
AGAGCTTGGGAGAAAATCAATATATCATTTTCCTTTGCAACTAAATCCAACCTGCTCCCT
CTCCACCCCCTAAACGGGGACATTTTCAAGCCATGGTGACATCCATCTTTTGTTCCATAC
TCTTACTATGAATTGTCCAAAAAAGAAACAGTTGCTCAGTGCCAGTTCAGAGACTCTTTG
CCCTGGTTTATTGTCCCCAGTTATACTTGTGGTTTTTCTTCTTTATAAAATCAAGAAAGA
TGGTACTTCAGGGCTGAGTTTCCACTCAATTATTTTGATTTTCTCCACAAATATGAAGTA
AGTTTTCAGTAACACATTAATAAGCCTCAAGCTTGTAACTAATACTTATGACTAATACCG
CCATGCTGACTGTTGGGGCTGATGCGCAAAAGAGCTTCTAGCACAAAAGAGAAAATGCCA
TTGGTCGTTTTCACCATCAGAACCCTTTGTCTCATTCTTAGTCTTTGACCCGTGATCCAA
GGATTGTTGTGAATAAAGTAGCTTGAGGTTCTCAATTAGTACTGTGTACATTATCTCTCA
TAAGCAAATCAGGGAAATTTAATGAAACAGCCACTAAGGAAAATCATGGCCAGGAACAAT
TAGCATGGTGTTCTTGCCTGCCTCTTCCATTCAAAAGCCAGCAGCGACAGTTTTTATAAA
ACGTACTCTATGTATTTGCTGTTCATTCCTGCAGTCTAAGCTCTCAGGAGTACAATTTGT
CCCCTAGAAAGAAGATAATGGTTAGCACAAACTGAGAAATAAAGAGCCAAACAAAACATG
ACCCCATGCTGTGCTAAACCCACCGAGAGCCTTATACAATTAGACATTATTACACCGCGC
AGAAGCCTCCGCTCTTACCGGCTCATGTGCTGGGCTGCCGACCACTGCTGTCAGCCCACC
GAGGCTAATGTTGCAGCTCCGCCGTGGCCTGGCTCCTGTAAACTCTCAGGAAGAGTTAAC
GAAGCAGGCAGCGGGACAAGATCCTGAGAAACAACATTTGCTACTGTAGAACGCCTTCTC
GCCACATTTGAGCTCACTTAAAAGCTACAGGAGGGAAGGGTGAGGGGTAGCAGGGAAAAG
GTTGATTTCCAATTGCATTGACCATTATGGGCTTCCTACTTGCTTATTTTTCTATCTTAC
CAGCATCTTTACTGTGCAAGTCGATGAAGACAGAAGGCATATGCAAAACCTGACCGTGGA
GCAGCCTATCGAAGTGAAAAAGCTCTTCGTGGGGGGTGCTCCCCCAGAATTCCGACCTTT
CCCTCTCAGAAGCATTCCTCCTTTCGAGGGCTGTGTGTGGAACCTGGTTATTAACTCTGT
GTAAGTGGAGCTCCTTGCTACGTGTATAAATATATTTTGGCATGAGGATCACTGTTGCTT
CTACACTATACAAAACCATGCCATCAGAAAGCTGCCGGGAAGGAATCAATAAAGATCTTC
AAGTTACATTTAGGAAAGGGCTCTGATGCCTTTCCAAGAAGGGTGAGAGGTGGGGAGTGG
ATGGAGCTCAAGTGGTTGAGTTTCTGCTTCCCACATACACGGTCCCAGGTTCCATCTCTC
ATACCTCCTAAAAACAAACAAACAAAAAAACAACTCTCCTCAGGGGTTGAGTGCCTGCTT
CCCCTGTACAAGGTCCTGGGTTCAATCCCAGTACCTCCTAAAAAACTCTTTTTCTTAAAA
AAAGGGGGGACCTCAATTCATTTCAAAGAAGGAAGCAAGACAATTAAAAATTAAAAAAAA
AAAAAAAAAGATAAAATATTTCGTTTAAATTCATTCCACTAGGCCCATGGACTTTGCACA
GCCGGTATCCTTCGAAAACGCGGACATCGGTCGCTGTGCTGATCAGAAGCCCCGTGAGGA
TGACGATGGAGCAGTTCCAGCTGAAAGTGTTGTCTCTCCAGAGCCTGTTCCCACCCCAGC
CTTCCCCACACCCGCCCCAGTTCTGGCACCTGTGAGTGTTTCTATTCGCATTGCTTTCTG
TTTTGCATCCTGCACTTTGAGGCCTCTTCAGGCGGAAGGACATTTGAGATAACTGGTATA
ACCTACTGCTAGTACTGGAGGCAGGCGGTCCTGTCCAGGAAAAATGATTCTTCCCACATC
GTCCTCAGGTTCCTTTTATTTATGGATCTGTTCTGCTTTCACTGGCCTGTTTTTTTAAAT
AAAACATGTTTTCACTGGAAAAGTTGAAAAGCACAGAAATGCCCCAATAATCAGGAATAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGGAATTTTAATCCAGTGAGTCTAACTCTAAAATCTGG
CTTCTTATCTCTACAACATTGTCCCTACACCATTTATTCTACCTCATTCCCATGGTGAGC
CGTTTAGGTTGTTTCCAGTTTTTCACTACTAGAAATTCTGTGCAACAAACTTTTTCACCA
TTTCTAACTTTTCTTAGAAGAGTTTCTTAGAGAATTATGAGACCAGGGGTGAAGATGCCT
AAGATTCTCAAGACATTTATCCGAATTGCTTTTTCCAAAGATTACACCAATTTATGTTCT
CACCATCAGCGCATCCAAGAAGGTCCACCTCACTACCCCTTGACAGCACAGGCATCATGG
TTGTAATCCTTGATAACTGAGGCATGGATCATGTAGTCTTGAGTGCAGATTTTGAAAACT
CAAACATTTCATTTCTCTTCTTTAGTTTCCATGATGGGATTGGTTATTTTGTAGAGCAAT
GAGTTCCTTGTCACTACAAGTATTTATTAAATGGAAGGCCAAATAATCATCTTTCCGAAA
AACTGGTCACTTATTCTAAGCATCATTTTCATCCTCTGTAATATGTAATAGTATGCCTTC
CTTACCTACCACCTGGGGTTATTTTAAGAAACAAATGAGGGAATGTATGTGAAAGTGTTT
TGGAAATTGGAAGAAACACATGCACCCACAGATACCGTGAGGAATCTTTGCATTTACTGA
GTAACTATTGTCTGTCTTCATTGGAGTTGCTCAACCAGTCCGTGTTGGTTTGGTTTGCTT
TATTTGGGGATAACCCAAATAACCAAAAGTTGGTCCCCAGGATCAACTTTTTTTTCAAAG
TGCCCACCAATCTTGTTTTATCGGTTTTCTCAAGTATATTCCCATATCCCTCTGTAGTTT
CTGGAAACTTCATTTTTTCCATTTTTCTGAAAATGAAAGTACTTACCCATTCTGGGACTT
TAATAACCATCTGTTCTAATCCCAGCTTCCATTATCTCTCAGCAGTGCATGTTTTAACTT
TTCCAAAACAGAGCAATCCAATTAGTAGACAAGAAGAAAGCAAGAGAGAAGTTGAGTAGC
AGCCCAAATGGTTGCTTCAAAAAGAATCATAGAACATTAGAGACCTTAGAGCTTCCAACT
CTTCATTTCCATGTGAGGAAGTAGCGCCATAGAAGGTACACCATGGCCCAAAGCCATCAT
ATTGGCACTTTCTTTAACCCAGATAACTAAATTCCAGCTGCTATCTTCCCTTTTCTTTAT
ATTATAATTTTTATGAGCAGGTGATTCAAATTATATGTTGTAGAACTTTCCATCTCTGTT
GAGCTCCATTATATGTTAGAATTTCAGATCATAGAGCCATACATATCCTCTCTTAGAATT
TGGTTTCTTTCCCTCTTTTCTCTTTTCTTTTTTTTTTTTCGGTGGGGGGGCTGCTTTTAT
GAAAGTTACTGAACATTAAAGGTGTGACTATTTATTTCATAACAGATATTTATTAAGAAC
TTACTAAGATATCATCATTGCTAGCCAGAGAGAAAAAAAGGAAAGTAGAGAAAGACAGAC
ATGGACATAATAATATAAATAAGAAAACATGTGGCAGGTTGATTAGGATAAGGCAGCAAA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGAGGACTTGTTG
ATATACCCTTTGTACTATAGGGAGCAGGTAAAAAGAGGAAGCAAAGCAAGAAATTTTACA
AGTCTCCTAGTTGGCTATTAAATAGAAATCATACTTAAACTCTGTTCCTTTTTCCATTCT
CTGGGTGGTGCTACCTCCCTGGAAGAAAAACTACATAGCAACCTAAATACGCTTTCCCTC
TCTGCCTGCCTTCTTTCAATCTCCAACCCATCCTCAAAGGCAATATAGCAAAAAAGATCC
AGGCCTCAGAGGCATAAAGAATGAATGCAGAGCAACACTTAGTAGTTTTGTCAAATTACA
AAACACAATTTCCCTACATCTTGTTTCAGTTAGCTTCATTTCATCACCTGCTCTAACTGC
AGTTTCTATCCACATGTCAATGTATCATGTTCCCTTGCACGTGGATTCTCACGAAGTCCC
TTTTATATGCAAAACCCTGTTATTACAAATTCCATCCAATATAGTAAAACTATTAGCTAA
GATTTATATCACTTGTAGAGTTTACAAACTTTTCTTGCACTTTTAATCTTCTTTTTAAAA
ATCCTATTTCCTTTTTTTTTACATTGTCAAATATTAATATATTGTCAAATTGCCTCATAT
GTTTTATAATGCTCCAGTATGCTTCTTTTCATCATCGGCTTCAAAAGAATTCTGTTATCT
CAAATTTCAAGGACCTTTCCATGTTACCAAAAAGATTTTTCTCATTTAGACAAGAGCTTC
CAATCTATCTTCTTCACTGCTACAAATTTAACTGGCCTTCTGGCTCAAGGTCTTTGGAAT
TTGTGATGTGAAGCTTGCCCCAAAAAGTAACCATGTAACACTTAATCCTGTGTATAAAAT
GGAATCCATGAGGAAAGAAAAATAGTTAAAACATCAAAAGCTTAAATTTTTTAAAAACAT
GATAATTATCCTATAGAATGAATCTGTTGACCCAATTTGTGAATTGCTTTAAACAATACT
TTTTAAGAAAAGTTTTTTAAGTTCACTAAGAACTCAAAAAGAGCATTATAACCAGGTCAA
GCACCGAGCAATGCCTGCCTTTTATATGTTAGGTTGTTTTCATGATTTCTGGCCTTAAAT
CAGAATTCAAATTATTGCCAGCTTCCCACATTTTGCCTATTTCCCCTAACAATGCCCACG
AGCAAAAGAAATAATTTGTGACTCCTGGTGATTAAATTTGTATTTTAATTTCTGTCAAGT
ATTTTAATTTTTTTAATGTGGCCCAGTTATGTTCATTTCAAACTCCCCTAGTCAATAGCC
TCCCTAGAGACCTGATCACTTTCACAATGTTAACTCTGGTGCTATCCCTCTAATGAAATC
ATCTGTGGCCATTTAATTTCCTGCTTTCTAGCTGATGTTCCACGTGGACAATGGCGCCGG
CCGATTCTCCGCTGTCTATGATGCTGGGGCTCCAGGACGACTGTGCGATGGACAGTGGCA
CAAAGTCACTGCCAATAAGATCAAACACCACATTGAGCTGACAGTAGATGGGAACCGGGT
GCAAACCAAAAGTCCAAACCGAGCATCTACATCCGCTGATACAAATGACCCAGTCTTTGT
TGGAGGTTTCCCAGGTAGGTGCTGGCTGCCCGCCCGGCCCCCCTCCCCGCCCCAGGACTT
CTTGGCTCTGTTGGTGATTTTGAAAACATTTACGTTTATATACATACGTCCAAGAATGGG
TGCTTCAGTGTTCTTGCTTCCCAGCTCTAGAATCTGCTTCCCATAAACAGCACCTTACCT
AAAATTTCCAGAGTATAAAATGAGCATATGACTTACAGAAACCACATGGAACTGAACTTT
CCATGGCAACCCCCAAAGTTTCATGTGTGGGGCGACTGAGGCTAGAGGAAATGAATTTGG
CTTATTAAAGATAAGGAGACATTTACCAGAAATCAGGGCCAGAGTTGGTATTCTTTCTGA
TTATTTTAAATTAGTATACGAGAATAATCATAAAAAGTTATGGAACTTATTTCCTCAAGT
TCTGGAAATAATTGGGTTAAATGTAGCTAATTTCCCCCTTAGGTTATTATGGCATTTATA
TTTATATTACAAAGAAAACCAAGCAGTAAATCTGCATTCAGAATTCCTCTCCAGCACATT
AAATACAGCATGTGAACCTCAGAGAGTTACCTAAAGTGCCCATAAGCAAGAGTGGCCAAC
TTGGAGAGAAACAAGTCAAGTGCCTCTTAATAAATACTGCAGTAATACAGGCTCCTGGAA
TGGTCTTGCATCATTTTCACTAGAGCAACTTTTTTGTCACCCTTTATATAAAGCTGCTCT
GCTTAATGAAACAAAATACCTACTCAGCTGCGGTTGACAGAGGGAAACATATAGGAGAAA
AAGGGGCTGATTCGGAGCTCCTCTGGGTTTTAAAATGACCTACTTGTGCTTCAGTCATGA
TACAACCCAAGCCATTAATTCGTGTGTAACTGACTTCACCATGCCCAGTCTGCCTTCCTT
ATGAAATGGGATCCTAGTTAGCCCCTAGTAGGCCTGCTGGAAGAAGGGCCTCTCCTTAAT
AAGAGGAAAGAGCTTCTGCATTAGTGTTTAACCAACTTTTTACCTTTGGGGATATATTTT
TACCATGTAAGAGAATAATAAAGTCACCTTTAAAAACCCATATCCTAATGCAGTTTTTAG
AGTTTTCGATCACTTCCTTTCTTTCATTAAATAAAATTTAGTTTTAAGCCACAACTGTAC
CTTCGTTCGTACCAAACCAAAGTCTTTGATGTTTTAAAATGTGCAATGTATTTTCATATT
TTGTAATACATAACTACAAAAGAGTTGGGATTTCTCTGCAAGTTCACCAATTAGTAAGGC
TAAGAACAAAAATCATTGACCTCACATAAGACAGCCTTCCAGTTTAATCTCTACTAACAG
CTGGCTTTGAGAACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG
CCTCAACCAGTTTGGCCTGACCACCAACATTCGCTTCCGAGGTTGTATCCGGTCCCTGAG
GCTCACCAAAGGCACGGGCAAGCCACTGGAGGTTAATTTTGCCAAGGCCTTGGAACTGAG
GGGCGTTCAACCTGTGTCATGCCCAGCCAACTAATAAAAATAAGCTTAACCCCAAGATAG
GTCCCTCAAAACAACTGTATCAAGTAAAACTAGTATATTTTAACTATGTATGTTAATAAA
ACTAATTTGTGCACGTATATTGAATTCTTTCTGTATCCAAATGGTGCTAATTCAGATACC
AGATTGACTTTTAGCTCAAGTGCTTTCTCCAGTCCATGAATATTAAACCAATTATTTCCT
TGTAAATAAAGGCTTGTTTGGGGTGATTCTGAGCATAAAAGGCAGCTGGGCACAGATTGG
TGAATTCGCAATATGTCCCAGAGGCCTCTCAAAAAGAAGGTATCAGATGTACTTTGTGAA
GGTACCTTTTTCTTTTTTTAACTTACTCCCATTAATACTTTTTAATCATCCTTTTCCATG
TTTGTCAGCTTTGGCATTCTGTCCATGCCTCTGAAAACAACAGGGCTTCAGATGGGAGAA
AATCAGCTCCCTTACCCTCTGTTTGTGAAAGCATTAGCAAATCAGTGCCCTGATCCAGGC
TCATTACTAAAGTTTTGAACCTTTCTATGCTGAAGGTAGAGACTACAGATCAGATTCAGG
GTAAAGAGCTTAATTACTTGATTTTCTTGTTTGATAATGACATATGCTTTGGGGAGTTCC
CAGAACCAAGTCCCACGATGACAATTAAGCACACACTTGATACTACAGTATTAAGGCTTT
GGGCTCTTTAAATTTACAGCAGATATCACAGTCTCCAAGGAGGTGGAGAGAGGAATGATG
CCCAAATGCATTTGCACCTACCAGAGAACTATTCACCAAAAGCTTAAATCCTCTGCCTTT
GTTGTAATAATTTGTTGAGGGCTGACCTAAAAAATTGATTTTCTAGAAAAGAAATATATA
TTTTGCACTCCTTTTGCCCTTGATTTCTGGGTCTGTGAGAAGACTGGCCTAGATTTTATT
CATTAGCTTAAGAAGGAAGCATTTTATTTGCCAAAAGAAGAAACAGTTGTAGTCTGATAA
TATTGGACATTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1118, 121222..121392, 136919..137031, 191147..191389, 267152..267331, 270358..270447, 271820..271937, 277341..277519, 278355..278454, 282131..282291, 296534..296674, 302635..302808, 399855..399956, 401525..401736, 419612..419723, 442171..442284, 446136..446263, 489943..490029, 497456..497667, 501046..501152, 506862..507042, 509885..510021, 515369..515605, 517184..517327, 518954..519133, 519232..519420, 519509..519642, 520065..520182, 520283..520417, 524828..524952, 532238..532324, 535994..536187, 544283..544425, 548386..548484, 556635..556667, 556670..556672, 556675..556744, 561752..561914, 564069..564279, 575113..575229, 576831..576994, 578326..578464, 598840..598942, 611706..611822, 614073..614255, 619120..619194, 619196..619206, 619208..619276, 627551..627607, 627609..627651, 627656..627699, 628456..628589, 628690..628849, 632411..632535, 643206..643368, 644067..644211, 653926..654064, 658648..658649, 658651..658660, 658954..659074, 662392..662497, 662600..662670, 670223..670371, 677163..677339, 677802..677970, 695220..695332, 695433..695622, 695723..695878, 695979..696132, 696233..696363, 697831..698053, 699476..699633
1001..1118, 121222..121392, 136919..137031, 191147..191389, 267152..267331, 270358..270447, 271820..271937, 277341..277519, 278355..278454, 282131..282291, 296534..296674, 302635..302808, 399855..399956, 401525..401736, 419612..419723, 442171..442284, 446136..446263, 489943..490029, 497456..497667, 501046..501152, 506862..507042, 509885..510021, 515369..515605, 517184..517327, 518954..519133, 519232..519420, 519509..519642, 520065..520182, 520283..520417, 524828..524952, 532238..532324, 535994..536187, 544283..544425, 548386..548484, 556635..556667, 556670..556672, 556675..556744, 561752..561914, 564069..564279, 575113..575229, 576831..576994, 578326..578464, 598840..598942, 611706..611822, 614073..614255, 619120..619194, 619196..619206, 619208..619276, 627551..627607, 627609..627651, 627656..627699, 628456..628589, 628690..628849, 632411..632535, 643206..643368, 644067..644211, 653926..654064, 658648..658649, 658651..658660, 658954..659074, 662392..662497, 662600..662670, 670223..670371, 677163..677339, 677802..677970, 695220..695332, 695433..695622, 695723..695878, 695979..696132, 696233..696363, 697831..698053, 699476..699630
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved