Dasypus_novemcinctus Locus RPL30
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus RPL30
Dasypus_novemcinctus
RPL30
GeneScaffold_3114
SNORA72
3678..3811
5060
TGAGACTACATTACTTCTCTCACAGATTTGTTGTACTATTAAATAAAATAATATAGGTA
AATGGCATGTTGGTTTTGTTTTGTTCCTTCCCCTCCCATCCTTCTCAGGGCAAGATGACA
GCACTGAACACATGAAACTGCTTACCTAGTGGTGCTTTTACTTTTGGGGGAGGGAAGTCC
GGAAGGGTTACCATTCAGCGTCTAATATTTTAAAAGACCATTACCATTTGTACCAAGTCC
CAAAGTTCACAGCAAAAATAATACTGTTTCTGCGCAAATTCATCTTACAAATAAGCTAAA
ACAGACAAAAGGTGAGTTTCGAGTAAACCGCGAGAGCCTAACCGGCAACTGGGCCAGCGC
AGGCAAATGGATGCAGCTGCTTCAGCTCGGAAAGACGGACGGTGGAGGGCAGACCCGGCG
ACTCCGGCGAATGGGAGTCCTCCACTACTTGCCCCCAGAGTCGCGGCTCGGCCACCGACG
AACTCAGGTGCTTGAGGGCGGTGGTTGCGGCCGCAGCCACTGCCTCTTCTCACGGCTCCT
CCCGCTTCATTCTCAGTCGGCCCTTCCAACTTCCGTCCGGTTCAAGCTTCCTAGGTTTTT
ACGCCCGCAGTCTGAGTTTGGGATATCAGAGCAACAAAGCACGGAGAAACTAAAGGCCAG
CAGAAAGAAGAAACAGCCAGACTCGTAGTCATTGTGACTAGCTTTAGCACCGGGCGGTAG
CCTTCCGCTTCCTGCGCTCCCTCTTCCGCACGCAATTAGCTTCCGTTTCCGGTCTCGGCG
ACAGGGCTCTGCCGTGAAGAACTTTGCATTGTGGGAACTCTTTCCTTTCTCGTTCCCCAG
CCATCTTGGCGGCTGTTCTTGGTGAGTGGGGTCCACCAGGCTCAGGTTTAGACAGCACGG
GGGAAGCATGTAGGTTGCCGATTAGGGCTTCGGATCCTAAACTTCCTGTCCTGTCCCCTG
TATGTTCTAGGTTGGGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGA
CGGTGAGTGAGGCGGGCCAGGGCCGGAGGCGGATTCACGTGGAAAGATGAGGCCCTACCG
GGGAGGGCAGATCTGGGTACACCGGGGAAGCAGCATCCCCGCTGGCATTTGGAGAGTCCC
TAAGGGAACGCGAGAGAGCCTCTCAATGACTTGGGATCCTCCACTTAGGAAGTTTTATTA
AGGAACTCAGGCTTCCGGAAAGCTGCACCCAGTTTTGACGTGGTTGCGAATGAGGCCTTC
AGGTCCATGTTGTTTACTTTGTAGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCTCCAA
CTTGTTATGAAAAGTGGAAAGTACGTGCTGGGATACAAGCAGACTCTGAAGATGATCAGG
CAAGGCAAAGCGAAACTAGTGATCCTCGCCAACAACTGTCCAGCTTTGAGGTAATCGAAG
GAACCTCACTTTGTGTGTCCCCACCGCAAATTCATCTTGAGCTCATATCCGGGAGTGCAA
ACCTGTAATCCGGGTAGCGTAAAATCAGTTTTATGTAAAACTTGTTTTCCAAGCGAATGC
TTGCAGAATAATTACAGTCGCTATTTCGGTGTTCGGTGTCCTTTATCTGTACTTATCTTT
GGGAGAAATATGTGACAGATGGGGTAAAAACAAAACAGAATGTCAAAGTTTGAGGAAAGC
TCAAAATTTACATAATTTGTTTTCCACGTATTTTGTCCTGGTTTTCTTTGGTGATTCTTT
TTGCTGCTTTAACGATATTTCATTGTATGAGCTTGTTATAGTGTAGAAAAGCCGTTTATT
TTAGAATCACCTAGTTTAGCCCACAATACCAAATTTCTGAACTCAGGCTTTTCTTTCTTG
ACTCGCTGTTTTGAAACTGAACTTAGTGGGTATGGTAAATAAACTAAAGAAACTTGGAGG
TTGCAGAAATAAAAGCCATGTGCTCACTTCCTTACCCTTGTCGATTTTTCTATGGTAATG
CATAATCTGCTTATAGAATTTTATATAGGGTGTCTGTACCTAATTGGCAAAGCCTGTAGT
TCCCTCCATTCCATCTCATGGTTTGGTCAAACCCGCTTTTAAAGTCTTCATTCTATAACA
GTGCCTCTCCAAGGAGTGCCTGTAAGTCACTTGGGTGATTTTGTTAAAGTGCAGTTTCTG
ATTTAGTAGGTCTTGGAAGGGCCCTGAGATAATGCATTTTTTTCCTCCTTTGGGTTTTTT
TTTTTAACCAATTTTATTGATAATGTATTAGTAAAGCATACAGTTAATCCAAAGTGTGCA
AGCAGTGGTATTTGGTTTAATCACATAGTTGTGTATTGCATTTATCACTTAAGTCATTAT
TAGAGCATTTTCATTAAGAATTATGCTTTTTTAACCAGCCTTATGTGATTCTGCTGCTGG
CTTGTGAATCCCCAACTTTGATTGATAAGGTTCTATTGTAGAACACTTTCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTGCCAAGAAACTATAGCAGCATGTGTATCATCAGAAATTTACAGTGTTCGCTACT
GTTAAAGGCCTTGCCAACATAAAACCATAGAGAAATAGTAACATTCTGTCAGTTCCTGGT
ATGGCGTTTATATTTGCCTGTTTTTGGTTCCCAAAGGAAATCTGAAATAGAGTACTATGC
CATGTTGGCCAAAACTGGTGTTCATCACTACAGTGGCAATAATATTGAATTGGGCACAGC
ATGCGGAAAATACTACAGAGTATGTACACTGGCTATCATTGATCCAGGTATGCTTTTAAA
TCATACAATCGTTTTGTTTTGCTTTTTCCTCCTAATGTAATACACAAGTATTCCTTGCTA
CACAAACCTTTTTGGTTCCTGAAGTCAGATAGTGAGAATTTATATAGCAAGGGGTAGCCT
GTAGTTTTATTTTGCAGAATTGATAATAGATCAGTACATTATTATTAGTTTTGATTGTTG
CAATTTTTCTATTTTGGTGGCATGAATTTTATTTAACACACCTAAGAAATAATGACTGGA
ATTTGTAATTTGGAAGGAAAAGTGGATTTGACTTAGCTACTTCTAAACTTTCACTAAAGA
AGAAGAGGATGCAGAAATTGTGGGCTGTCAACATTTTTTTTTAAATTTCTGTGCTGGTGA
TAGAGAGCTATGTGAGTTTGAAGACCAGGAACTTGGTGAAATATGGGATTATAAAGAGGA
GAAATAGATGAAATAAGGGGAAAGTAATCTTTGCTGACTGCCTGAGAACAGACAGGTAAA
ATTAGGCTGAGAGAAAGTACCTACAAATACACATCATCTTATGTTTTGAACTTTTTAAGT
TAATTCTCAATAAATATACTGCGAATATTCTCGCTGTCCTGATTTTGTGATAATCAGGGT
AGGCTAAACATTCGCTATATTAGAAACCATGCATGTGTCCCCAGACCTAGTTTTTCTCTC
TAGGGCTGGTTTTTAGAATGCTGGTGATAAACCAAGCCTCATGTATTATATGACCATCCT
GTTTGGGAAATGACTAACTCAAGGTATCTTTGGCCAACCTTAAGAGATAAAGCAGCTACA
ATAACTTTGAAAATAACCAGTATTAATTTTGCAGTTATTTCTAAAGAAGGGAAAATTTGT
GATTACCAGCTGCCATTAAATGAATTGTAAAATTACTGTTTTATTTTCTAGGTGATTCTG
ATATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAATCATGTAAAAATTTTCTT
TAATAAAGCTTGTTTTAAAAGCACTTGTCCATTCCTTTTATTTTCCTTTTTATCTTTTTG
TTTCATTTCTCTTTCCTGAAGGTAGGTTTAGAGAGGGTAAGGCAGCTAGATGTGGTGTCA
AGACTTTGGGGTTAAGAGTTATGCACCTTTTATACCTTTATTTCAGTTTTCTTCTTTTGT
AAAGGGAGCACAGTGAGTTCATTTCCAGTATTAGGTTTTTAAGAGACCTAATTTTTATAA
TTCCTACCTTAGGACATTACTAACATTTTTATATTTGAAAGTACTTGAGAGGCAGCAAGG
TTAAATAATATCCAAAGTTAGAATTTGCAGTCCAACTTAAATCTACCAAATTTGAGTAGC
AAAAAGAATTAAATGAAGTATGTTCTACCTGCAGAAGGCTGTTGGAGACTGAGAAAAGCT
CTAATGAACTTTAATGAAGAAGGAACTTTCCTCTGGGTAGGTAGTAGGGGAAAAAGAAAT
GTATTTGGAAACTTCAGAATAATCCCAGGTCTTAAACAAGTGTTAAGTCCAAGACTGCCT
AAAGTGTGTTTTATGTAATTTTAAAAATATTTATTCATCTGTTCTCTGTCCATTTGCTGT
GTGTTCTGTGTCTGTCTTTTCTTCTCGTCTTTCTTTTTATGAGGGACTGGAAACCAATCC
CAGGACCTTCTGGTGTGGGAGAGGCACTCAGTTGCTTGAACCACGTCAGCTCCCTGGTTT
GCTGAATCTCTCACTGTCTCCTTTTATGTCTCCCTTTGTTGCATCATCTTGCTGCGTCAG
CTCTCCACAGCACGTGGCCAGCTTGCCTTCACTAGGAGGCCCTGGGAATTGAACCCGAAG
CCTCCCATATGGTTGGGAGGAGCCCCGTCACTTGAGCCACATCTGTTTCCCTGTTTTATA
TAGTTTGTCCTAAAAGATGCACTGTGAAGTGTGTTGGGTGTTATCTCCCAAGAGCATGAC
TACAGAATCCTTTTCCTGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1284..1429, 2976..3106, 4011..4060
1001..1021, 1284..1429, 2976..3106, 4011..4057
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved