Dasypus_novemcinctus Locus ENSDNOG00000017199
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000017199
Dasypus_novemcinctus
ENSDNOG00000017199
GeneScaffold_4268
SNORD61
1158..1223
5148
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGCTTAACCTGAGGAACGTTTTTTAGATTTAAAATTTTTTAAATTTATTTC
TCTCCCATTCCCCGCGACCCCGCCAACCAAGTTGTCTTCAGGGACTTTCTGTAGAGAGGA
ATACTTTTTTTTTTTTCCCCCAATAGACTCCGGGAAAAAAAATGGTTGAAGCAGACCGTC
CGGGAAAGCTCTTCATTGGAGGGCTCAATACAGAAACAAATGAGAAAGCCCTTGAAGCAG
TGTTTGGCAAATATGGACGAATAGTGGAAGGTGAGTTATCTGAAAGTATACACTGGTTTA
CTATAATTTAAAAGGTGAGCTGTGATGAGTTTGATTGCATTGATCATCGGAGATGATTTT
TGTCCTCTAAGAAGTCCTGAGCTTTTTCTTAAGGATTCGCGTTTGTGGTTTCATAGGAAG
TAGGTAGCGTTAACGTTCCTTTTCCCCCTCCCCCACACTCCTTTTTAGTACTCTTGATGA
AAGACCGTGAAACCAACAAGTCGAGAGGTTTTGCTTTTGTCACCTTTGAAAGCCCGGCAG
ATGCCAAGGATGCAGCCAGAGACATGAATGGAAAGGTAAGACAGTCTGTACAATTAAAGC
CATGTTTCTTAGTCTGTAAAAAAACAGCACAGTGTGCTCGGAATTATCTCAAGTCTTGTG
AAGAGCAGCTCGAATTTTTTATTTTTTGAATGTTTATTTCTAGGATCCTTTGACCATAGT
CCTTTGTAGTGGTATTCTAAACTGTATTGTAGTTTAGGAACCAAATTTTGTAGCCCAACT
GTGGATTATTCTCTTCAAGAGTCTAGATTTCGAGAATATCACTAGCAATATTTTCTCGAG
ATCCACAAACTGTGATTTGATAGCCTGCCTTTTCCTCTAGTATTTGTTTTTATAACAAGT
TGATACCCATCTGACCTGGTTTTAAATTTTACTTACCAGCAGTGTAAATGGATCTTACCA
CCTTTGTTTCTGCTCAAATAATCAGTATTTTTAAAAACCGAGTAAGCATTAAGTAAATGG
AAAAGTCCCACTTTACCTAATACTGATTATATTTGTAGCATTTTATCTAAGACTGGTGAG
TGAAATTTACCTGTTGGTAAAATGTTTTAACTAAATTTTGAAGGAAAATTTGGCAGCTCG
GTGCAAGTTTTTAAAATCTTGATATAACGGTTTTGGTGAATTAGTAAATAAATTTAAAAC
ATTTTTTAGTCCTTAGATGGAAAAGCCATCAAGGTAGAACAAGCCACTAAACCATCATTT
GAAAGTGGTAGACGTGGACCACCTCCACCTCCAAGAAGCAGGGGCCCTCCTAGAGGTCTT
AGAGGCGGAAGAGGAGGAAGCGGAGGAACCAGAGGACCTCCCTCACGTGGAGGGCACATG
GGTAATGACTTGCATAGACTTGTAGGCTTAACCCCTATAGGTTAGGGGGACTGTAAACTC
ACCCTGGTATGTTCATTTACTAACGGGACTGTCTTACAAGAAAAACAGAAGGCACCTAAA
GTTAAACTTTAGTGTTTAAAAATGGTGGGCAATCTATTCCTTACCAAGTTTATAATTTTG
TAGGAGAAACTCAACGAAATTTGCCTTTTTAAAGGTAGACAATAATAAGCGTTGGGCATA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCAGCCTTATGTGTTTTCCCCCAACAGTGAAAATACAATTTAA
AATATTTTATTAACAAGATCAAATGTTTACCATTGCAATATGAAGGAAAGTCTACAGTTC
AAAATTGCAACTTATCACTGGAAAGTGGCTGAGTTTCTACTATAAAATAACAAGCTGTCT
GGAATATCCTCTTGAAATACACACCGTCTTCAGTCTTTTTTCAAACAAACCTTAAAATCA
ATCCATTTCCGTATCTCAGCAGATGAGCAAATCCCTGTTATGGCCAGCAATGGCAGAGTT
TAAAGCCTCCCAGTTAAGAAAGTAAACGGTTAATACAGGAATTCTGTAAATTCAGATTTA
AATGTTGTATATATACAATTTATAGTGTTGCCATATTACCTGACCATTGACCCTGCAGGT
AACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGC
TATGATGATTACAGCAGCTCACGGGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGC
AGCCGAAGTGATCTCTACTCAAGTGGCCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTT
CCCCCTTCTATGGAAAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGC
GGAGCACCAAGAGGTGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGC
AGATACTAAAAACAAACAAAACTATGGACCAAAACCCCTGTTCAAAGAAAACAAACAAAA
AGTGGAAACTGTTGTCATAAATACCCAAGGACTACTAAGAGGAAAAATTGTGTTAACTTT
TTTAAATTACCTGTTAAGTTTCCCCTCCATAATTTTTATGTTCTTGTGAGGAAAAGTAAA
ACATGTTTAATTTTATTTGATTTATGACATTGCTTTCAACAAGCAAATGTTAAATGTGTA
AGACTTGACTTGTGTACTAGTGTTGTAATTTTCCAAGTAAGAATGTCCCTAAAGGCCACT
TCCTATCTGATTTTCCCCAGTAAATGCAGCAAGCACTCCAGAGAGCTTCCACAAACATCT
AGCCATCTAAAATGGAGAGATGAATCTTTCTGCCTATACAAGCTAGATATTTTAGCGGGT
GGTGGGGGTAATGCTACAATTAGGATTTCAGGATGTCTTCAAACTGAAATCTCTGTTCTC
AGTATGGAAAACTGAGATCAGATGCTTATGTAAGGAAAGTGCTATTCACCCAGTAAAGCC
CCCCCCCCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1308..1414, 2049..2220, 2560..2712, 2813..2927, 3028..3153, 3254..3336, 3838..4148
1001..1109, 1308..1414, 2049..2220, 2560..2712, 2813..2927, 3028..3153, 3254..3336, 3838..4145
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved