Dasypus_novemcinctus Locus PTCD3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus PTCD3
Dasypus_novemcinctus
PTCD3
GeneScaffold_3088
SNORD94
48986..49121
51146
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTTGCGCGCGAGA
ATCGCTGCTGGGAACGAGATTTACGTGGACGAGACTACTTCAACTGTGGAGAGAAGAGAG
AAAAGCAATTACACGACTCTCGCGCTATTTCTTGAAAACGATCAAATATATGTAGGGCAT
AAAAATAATATTTCAGGAAGTCTTCTGAGGCAAAAGCAGCGTACTGAGCTTTTACAATCC
GTAACAAGGTTTTTCAAGCTAAAAGGCCTTCCCCTCCCGTTGCTTTCGTCTGGTTCCTCT
CAGCCAATCCCCGCGCCGTTGCCCATCCACCTGGTCTCACTCCCCGTGACGCAAAAGGGC
GAGGGCGTGCTTTCCCACCATGCTCGGCGGGGAGGCTAAAGATGGCGGCGGCAGCAGCGG
CCTTGGGCTGCTGTAGGGTCCGCTGCTGGCCTCGCCTGCCACTCACCCGTAAGCGGACGG
GTCCGTGTGGACGGGCCCCAAGTTCCAGGTAAGAGAAATCTAGGGCATGCGCAAGGAAGG
CTCCGAAGTCATCTTAGTCCTCTCTGTGCCCCTTTCTCCGAGAGGAAATGTGGAAGCAGC
TATGGTGGTGCCGAATGCCCATGCGCGCTCCTGGCGGCCGCGTGCTTGAAGCACCGGTCG
GTGGAGCCCGCGTCCTTAGAATAGGGACAGAAACGCAATTATTCCTTTAGGGGGTTTTCC
TTGGTTGTCTGCGACACCCTACCGTTAAACCTGACAGCAAAAAAAAAAGAAGACTCTTCT
CGTGGCGCTTGTAGTCTAGGGAGTGTGCCTGGCTATTAGCAATCTCTCCTTATCTTTAAA
AAATACTCAGCCATGTGTGCTGAGTGTTGTAGGGATGTTTGACCGAAGAAATGGTCACGT
GTTTCTTAAACGGGAAAGTCTAAACCATCTGAACACGCCCTTTTCTGTCTTAGAATTCGG
TGGTTGGTAGTAGCTTGAATCATCACCCATTTGTGTAATTTTCTTTCCAGTGTAAATGGT
CATGTTGAAGAAACTTGAGAGACCGTAACTCGTAGTGAAAAGTTGAGAAACTCAATGTTT
GAGGCTCCTTAGTTGAATAATAGGCAAATTTCCTCAATTGTAAAGTAGGGGCTCATAGTG
ACAAAGCAAAAAATTGTTATAATTTCAAAGAGTCGATCCCTTTTCTGAAATGTTCTTAGG
AGAGAGGAATTCTATTTTAAGATGGTATCTGAAAGCAGATACCAGTGGAAGAAGTATTTT
CATGGCTAATCACACCTTGATAGTTTTCTGAGCGGTACTAAAGCCATTGAGGAAGGGAAT
ACCAGTGATGATGATAATAGTGCGGTTACTTGTGTGCTGTACTTTTAGCAGTGTAATCAG
GACATTTTAAAAACTCAGTTGTGGGTCAATGCTTCTGTTTTGGGGGGAAGAAAATTTTAA
CTTGAAACCCAGAAAATGGAAAACGTCAGTACTTCCAAGTTTGAATTAGAACATATGTAT
TCAGTACATTCTTGATTGTTGAAAGAAACAGAATAAAAGACTGGTTTATGTGTAGCTTGG
AGATAATTGCTTTAAGTAGGGTAGGCCTTTTTTTTAATCAGGGCCCTCTCCCTGTAAAAG
CAGGTGCTCACTCAGTTGTTCCTCTTAATGTCACTGTGTTTTAGGTTCCTAACGTTGAAA
GCTCTTAAATTTTCAGGCCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGATAATTGGAAAATTTGGGCTCAGAATACACATAAGT
GGAGGTGAGATGGGAATGTCACTAATGGCAGTTAACCTTAGGACTTTTATTTTTTGCAGA
TTGTATTCTGGAAGTGCATCCCTCCCAAAAGTTGAAGGAGCTGATGTAACCGGTATGTAA
AAATTGATGGAAATAATTCCATTTTTAGATTGACACGTTTTATTCTTTTCTAATTCTAGT
ATTGGGAAATTTTTGTTAATTTTGCTTTATTTTTCACATCAAGGTATTGAAGAAGTGGTC
ATTCCAAAAAAGAAAACTTGGTGAGTATTTCATCAGTGTTCATACAGCAAATGGTTGAGT
GCTTATAATGAGTGAAACATGATCCTAGGTGCTGAGAGAGGGGGATGTGTGTGCCAGACA
GACACATGAATAAAAGTAAATAAACACATCAGAATTATAGATGCTGAGAAATATTATGTA
GGAAATGTTATGTGACTCGGTGCAGGGTTAGTAAGAATGTTCTCCCAGGAAGAATAGTGG
GAGATCATTCTGTGAGGGGGGGGGAGAGCTTGGGTGTCTAAAGAATAGGAGCTTTATAGA
GATTCTTGAAAGGATTTACTTAAAAGAAGATTTACAAGACCTGAACTAAGTATGGGTTAA
TCTTTACATAATGAGAGCCAGTCACAGGGAGCTGAGATGGCTCAAGCTTTTGAGCGCCTC
TCTTCCACATGGGAGGTCCTCATTTCAGTTCTGGTGCCTCCTGAAGAGACGATGAGCAAA
CACAAGAGAGCACCAATGAATGAACACACAGCAGATAGCACAAACAATGAGGGGGGCGGA
TGGGAGAAAGAAATAAAATACAAATCTTTAAAAAAAAAAAAAAGTCATGAAAATCAACAT
TAGAATAATTTCTTTTTGAAAGTGATTTTTGAATTTTATTTTTTTAATTAGAAAAGTTAT
AAGCTTACAATACAGTAATACATAATATGCAGAATTCCCATACAGCCTCCCTCCACCAAT
GCCTTACATTGTTATGAAACATTTGTTACAGATTATGAAAGGATATAACCAGACTTTTAA
TATTAGCTATGGTCCATAGCACCAAATACTTGGTGTATTTTTTTCTCTACACCCCCTATT
ATAACACCGTGTTGTTGTATGTTTGTTGTACTTTGTGAGAGAACACTCATATTTGTGCTG
CTAACCGTAGTTCTCATCTATCACATGGTTCACTGTTATTCAGTCCCATGCCTTGTACAG
TCCATCCAACTTGTACAGTCAGTGGCTCTCACTTTTCATCATAAAGTTGTGCAGTCCTCA
CCACCGTAAATTTTTGAATGTTTTCGAGTCCCATCACCCCCTTATTATTGACCCTTAGCA
TTGATATAGTACTTTCTTTGACATCGACCCAGGATATTACAGTATCACTGGTTAACTATA
GTCCATAAGTCACATTAATTGTATTTTTCCCATACATCACCATATTCTTCCCACCTTGGA
AGAGTGATGTATTAATAGAACCTTGTCAACCTTGTCTTGTTCCTTATCTCATTGGGCAAA
CTTTCAGTCTTTCACCATTGAGTATAATGTTAGCTGTGGGTTTTTCATATATGTCCTTTT
TCATGTTGAGAAAGTTTCTTCAATTCCTATCTTTTGGAGTGTTTTTATCAAGAAAGGATG
TTCTATTTTGTCAGATGCCTTTCTGTGCCAATCAAGATGATTATGTGACTTTTCTTCTTC
AGTTTATTAATGTGGTTACTTACTCTGGTTGATTTTCTTATGTTGAACCATCCTTGCATG
CTTAGTAATACCAGACCTTGTTTTTTAGTGAAGAAAGAAAAACTGATTATTTGAGTAGGT
AGATAAGATTATTAGATAGATTATTTGGTTAGCTAGCTGATAGATTAGGGAGTCGCATAT
TGCTTGTGTTTTTGACATTCACAAGGAATATTCTGGAAATTCATAGAGCTGAATTTGATT
TTTGTTTTGGGAAATGTAGAGGGGCTCATTAAGGATTCACTTTTGAGCTGAAGCTTTTAT
TTTATTTTATTTTTTTAAATAATTTTATTTTTTTTCCCAAATTCTACTCAATTTATTCAT
TTTTTAAAAGATATTACATCAAAAAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGCTACATGT
GCTTCTCACCCTCATTTTTTGAAAGACAGCCTTGCCAGATATAGATCTTAGCTGACAGTT
TTCCCGTATCTTAAATATATCCTACCACTGCTTTCTTGCCTCCATGGTTTCTGATGAGAA
ATCTGTGCTTAATCTTATTGGGCATCCCTTCTGTGTGATGAACACTTTTCTCTTGCTGTT
CTCAGGATACTTTCTTTATCTTTGGCACTTGACATTCTGATTAATGTGTGTCTTGGAGTA
GGTCTGATCAGATTTATTTAAGATGGGAGTACATTTGCTTTTGGACACAGATATCTATGT
CCTTCAATAGGTTTGGGAAATTTTCTACCATTATTTCCTTAATTTTTCCTTTTGCTCCAT
TTTCCTTCTCTTCTGTGACACACGTGACGTGGGTTTGCACATCTTTTGCCATCATTTAGT
TTCCTCAGACCCTGTTCAATTTTTTCCATTCTTTATTCTTTTGTGTATTCACTTTCAGAG
GCCCCTCTTCAAGCTCACTGATCTTTTGTTGTACGTTTACATGTGCTGTTATATGCCTCC
AGTGTATTTTTTATTTCATTTATGGGGCCTTTCATTCCCATAAGATCTGCTATTTTTCTA
CATAATGTATGCTTTCAAATTATTCTTTGTGCTCACCCAGTGTCGTCTTAATATTCTTAA
TCTCTTTAGTCATCTCATTGACTTTATTAAGGAGATTTGTTTGAACATCTGCAATTAGTT
GTCTCAACTCCTTTATGTCACCTCGAGGCTTAGTTTGTCCCTTTGACTGAGCTAAATTTT
CTGTTTCTTGCTGTGGATTGCAATTTTTTGTTGGTGTCTTGGCATCTGATTTATTGAAGG
TATTTATTCTTGGTTCCTTTTTTCTCTTTAGTTGAGAGCTTTCTTTTTGGCTTTGTGCTA
CAGTCTCTCTTTGATACCTGGTTCTACTTAATTTGGAAATTTACAGTGGCTTGTGTTTAG
CCGATCTGAATTTTTTCAACTCTTTGTTTCTTGCCCTTTCTCCCTTTATAGTTGTAGAAT
AGAAGCTGAGGCTGTAGTTGGTACTGTAAGCCGTGGAGGCTCATGGTATCTACATTGCCC
CAGGAACTGTTGAAGCTTCTCCTACCTTTCTCACCTCTCGGGTAGGAACAGAGCCACAGT
TGTATGCAGTAATTCAAGCCATGCAAGCCAAGACCATCTGTAGTTGCATGGAGAGACTCA
GAGAGCTCCACGCTCTTTCCCCCCTTGCCTGGGGCAGGGATGGAGCCACAGATATGGGCA
GCATACTAAACCATGCAAGACAAAACTGCCTGTAGACTGATGAAGCCGTGGCCCTCTCCT
CCCCTGCCAGAGGCGGGAATGGAGCTTCTGGTGTGCCCAACAATCTAGTGTGTGCAGGCT
GAAAGCAACTGCGGTTGTCCTGAGAGGGTGAGGGAGCACTGTCCCTCCTCCTGCTCTGTC
AGGGGCGGGGATGGAGCCACAGATGTGTCCAATAATCTAGTTCTTTGGGGCCAAAAGCTC
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCACTCC
TTGCATGCATCAGCACTGCGTGTGTGGACCAGCTCCACACAGGTCAAGGAGGCCTGGGGT
TTGAACTGCGGACCTTCCATGTGGTAGATGGATGCCCTGTCCACTGGGCCAAGTCCACTT
CCCCTCGTCCTCAGTTTTGAAAGACAATCTTGCTGGATGTAAGATTCTTGACTAGAAGTT
TTTCTCTTGTAGTATTTTAAATATATCATATCACTGTCTTCTTGCCTCCACGGTTTCTGG
TGAGAAGTCAGCACTTAATCTTACTGGGTATCCCTTGTATATTATGCAGTGCTCTTCTCT
TGCTGTTCTCAGAATTCTCTCTTTGTCTTTTTCATTTGACATTTTGATTAGTATATGTCT
CTATTTGGATTTTTTCAGATGGGAGTATGCTGTGCTTCTTGGACATGGATATCTATGGCC
TTCAATAGTGTTGGGAAATTTTCTACCATTATTTCTTCAAATATTACTTCTGTCCCTTTT
CCCTTCTCTTTTCCTTCTGGGACACCCATGACATGTATGTTTGCACGTCTTTTGCTGTCA
TTTAGTTCCCTGAGCCCTAGTTCAATTTTTTGCATTCTTCATCTGTTCTTCTGTATGTTC
ACTTTCAGAGGCCATTTCTTCAAGCCCACCAATCCTTTCTTCTGCCTCCTCAAATCTGCT
ATTATGTGAGTCCAATGTGTTTTTAAAATTTTGTTTATTGTGTCTTTCATTCCCATAAGA
TCTGGTATTTTTCTGTATATGCTTTCAAAGTCTTCATTGTTTTCATCCATGTCTTCTTAA
TAGTCTTAATCTCTTTAGTCATCTCATTGACTTTATTAAGGAGATTTGTTTGAACATCTG
CAATTAGTTGTCTCAACTCCTTTATGTCACCTCGAGGCTTAGTTTGTCCCTTTGACTGAG
CTAAATTTTCTGTTTCTTGCTGTGGATTGCAATTTTTTGTTGGTGTCTTGGCATCTGATT
TATTGAAGGTATTTATTCTTGGTTCCTTTTTTCTCTTTAGTTGAGAGCTTTCTTTTTGGC
TTTGTGCTACAGTCTCTCTTTGATACCTGGTTCTACTTAATTTGGAAATTTACAGTGGCT
TGTGTTTAGCCGATCTGAATTTTTTCAACTCTTTGTTTCTTGCCCTTTCTCCCTTTATAG
TTGTAGAATAGAAGCTGAGGCTGTAGTTGGTACTGTAAGCCGTGGAGGCTCATGGTATCT
ACATTGCCCCAGGAACTGTTGAAGCTTCTCCTACCTTTCTCACCTCTCGGGTAGGAACAG
AGCCACAGTTGTATGCAGTAATTCAAGCCATGCAAGCCAAGACCATCTGTAGTTGCATGG
AGAGACTCAGAGAGCTCCACGCTCTTTCCCCCCTTGCCTGGGGCAGGGATGGAGCCACAG
ATATGGGCAGCATACTAAACCATGCAAGACAAAACTGCCTGTAGACTGATGAAGCCGTGG
CCCTCTCCTCCCCTGCCAGAGGCGGGAATGGAGCTTCTGGTGTGCCCAACAATCTAGTGT
GTGCAGGCTGAAAGCAACTGCGGTTGTCCTGAGAGGGTGAGGGAGCACTGTCCCTCCTCC
TGCTCTGTCAGGGGCGGGGATGGAGCCACAGATGTGTCCAATAATCTAGTTCTTTGGGGC
CAAAAGCTCCTGCAGTTGCCCAGAGAGGCTGAGGGAGCACTGTCCCTTCTGCCCTGTCAG
GCCTGGGGATGGAACCATAGGAGTATCCAGCACAGTAGTCCATGCAAGCTGAAAGCAACG
ACAGTTGCCCAGAGAGGTCGAGGAAACGCCCACCTCCATTCCTTTTAGGGGTGGAGATTA
TCCACAGGTTTAACCACCAATCTAGTACATGTGGTCCAAAAACACCTGTGGTTTCTTGGA
GAGGTTGCAGGTGTGCTATCCTTCTTTCCCTGTTGGGTGGGAACAGAGCCACAGATGTGT
CCAACAATCAGGTCTGTGTGGGCCAAAAGCTCCTGCAGTTGCCTGGAGAGTCTGGCACAG
ATCCCTCCAGCTTCCTTCCTTCCCGAGGTGGGGCTGGATCCTAGGCTAGGTCAGCAGTCT
GACCTGGGTGGAAAGAAGCTGGTCCCTCCCGTCACTGATGTTCAGTCAGCCCTGCTTCCC
CTCATGCTGGGTCAGAGTTAAAATGGAGGCTGCCAGCCTCTTTCTGACTTGTATAGGCTC
AAACTTTACCTCTTCTTAGATTGGATTTTTACTTAACAGAAGCTGAAATCAGTGCCAGAC
CATCTCTTAAGCCTCCTGTTTTTTGGAAAAGGGAGCTTCCAACTTCAGCCAAAGAGTTCC
CGAGGTGACTTGCAGTGGCTTGAACTGCCAGCAGGGGGAGGGACTCCAGTCTCTGGTGTG
GCGTGCTCTACTCACAAATCTTCACTGCATACAGGCAGTCTCCTCCTCCTATTCTTCCAA
GGATGTTGCAGGATGTTCTTCTCGTCTCTTGGGCCCCCAAACAAGTGATTTAGATAGCTC
TGGGCGAGTACTGAATACCCTGTAGGTCAGGCTGACTTTTGGAGCACCTTACTCTGCCAC
CACTTTGCCCCCTCAAGAAAAATTTATTTTTAATGGAAGTTATTTCTCAAATGGTTGGGA
GGCCAAATAAATGAAATTATTACATTTATGCTCTTTAATGAGATTGAATAAATCATGTGA
ACTGCAACTTAGCTTCTTTATTTACTGGATACATTCTTGAACAAATTGCCATATCTCACT
CGACAATTATTTAATATGTAACAACTAGATTTTTCACAGAAGTGATCATAGTAATATATT
ATTGAGTACATTCAAAGGCCCCTCAAAGAGCAGTCTTTTCTGAGAGTGATGTAAAGTCTC
ATTTATTTTTTTAAAAATCTAAAAACTGTAAAAGTGATGGATGTTTATCACCAAGAGGGT
GAAGGAATAGTAAATCTAACTTATGAGAAGGAAGCGAAATTATTGACAATCACACTTCCC
ATATAAAAGTTCCTTAATTTGTGCCATATATAAAACAGGGGTAACAGTAGTACCTGTCTG
AGGATTCCGTGAGCACTTTGAGCAGTGCTCTCTCTAATCCGATCTTGGTAAGTGATAGCT
ATTATTTAAACATTTGGGGGTTTAACCTTGTTTAATTTTTGTTTGTATTATACATAACCA
TCTTGCTCGGTAGAATTGAATTGTCACTTATACCTTTTAACCTTTAGGGGCTACATAGTC
TTTCTAATGTGGATATATTCAAGCTCATTTCTGTCTTCCCTGGGCTGAGAACTGAAACAG
CCAAAATATGTGTAAGAATATATGTATCCAGGAATGTGGCATTTTCCTGAATGGCATTCA
AGTCCATAGTCCTCTTGTCATCTCCTTGTGCCTCTACCACTGAAAAAAGCGACTATATAG
AAGATACAAAAGGGGGCATTCGGCCGGGTGTGCTCCCATATAGAAACAGGACTTAGCCAC
CTAAGACCTTCTTTTAAATGGCCCATGAGACAACGATTTTTGCATTTTATTTTTTAGATG
GGGGGGAAAAATGTAAAGAAGTGTTTTTCTTCATATCAGATGAAGAATGTCTGATACTCC
AAACTCCGCGTCCGTTAATGTTTTATTAGAACCCATCCTCGCTCATTTAAGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGGTCCCAGTTTGTTCCTGGTGC
TTCCTAAAAAGATGAGCCTATAATGTGGGGGTGGGAAAAAAGAAATAAATCTTAAAAAAA
AAAAAAAAAAAGGTAGAAAACCCAATGGTGATGATGTACATCAGAGAAATACTTGGTTTC
AGTGTAGAATAAAATTTCCTTTTATAGTCTTTGTTTTTTTAGGTGACTTACATTCTCAGG
AATGCTATATTGTAAACTTTCTTTAAAAGAATACCTTTGGTTTATTAAATTTACTATAAA
TACTTCCCTTTTAGACGTGAAACACGTTAACTCTAAAATTGGAGTAAAAACCTCTCTTGC
TGGTCACTTACTCCAGTGAAACGTCCTTTCCCAGCAGTGGAGGTCCCCACTCCAGGTGCA
GTGGACCGCTGGCCTGAAGTGCTCAATGTAGAAGGGTTCTTAACCTTTTTTGTTCCATTG
ATCCCTTTGCCATCAGGTGAAAACCATGGACCCCTTCTCAGCATGTAGCAGCAGATCGTT
TTATGATATATGTATTAGCCAGCCGAAGAGGTGTTAATGCAAAATATCAGAAGACTGTTG
GTTTTTATAAAGGGCATTTATTTGGAGTAGGAGCTTACAGATACCAGGCCATAAAGCATA
GGTTACTTCTCTCACCAAAGTCTCCTCCCATGTATTAAAGCATGATGGCTGCTGACGTCT
GCCAGGGTTCCTCTCTTCCTGAGGCTGGCATCTCTTTCCTCACAACCATTCTCCTCTGTA
TGCTTACTTCCCAGGCCTCCAGCTTAAGACTTCAGCATCAAACTCCAACATTAAACCCCC
CCCAACTCTGTCCTTTGCCATGCCTTTTATCTGTGAGTCTCCACACACCAAGGGCAGGGA
CTTAGCACCTTGCTGGCACAAGTAATCAAGTTAACCTCTGGATCCAATATAATCTAATTT
GCCCAGAGGAAAAGACCAGTTTACCAACATAATCCAATATTTCCTTTTGGAATTTATTGA
TAATATCTGCTACAACATGCAGCATTTGGAGGTCAGGGAAAATAAAGATAAGTGGTTTTT
TTTTGTTTTGTTTTTCTTCAATTCACACTCATGGACCCTGGTTAAGAACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCCACAATAAAATCCATAGTTTATGAG
GTGAGGGTGGCATCATTAGCCTTGAGCAGAGATGTTGGGACCAGTCAGAGAGTAGGTAAA
GCCTAACAGGAATGTGTGCTAACCACGTTTAAGTGGAAGAACTGAGCAGTTTTCTTATTT
TCTGTCGTGACTCTCATTACTCCAGTGATCTTGCAGGGTGAGAATTGGCTCTAGTTAAGA
CTTGAATTTCTTTTATTCATCTTTTGTTAACTTGTAATTCTCATCCTTAGGGATAAGTTG
GCAGTTCTTCAGGCACTTGCATCCACAGTGCACCGGGTGAGTAGGATTTGGGTGGTTTTT
GAACCATGTTGGTGGTCTTCGATCACCTAAAGAACGTGTTGAAATGCATGTTGCTGGGGT
GGTTCCAGTGTGATGGCCATAAAACCGGTGGTCCATGGACCAGCACTGAGAAATATGTAC
CTGCGGTGCTGGCAAGAATACGTTCGTTAAGAGCTTTATAGTCGAGCACTAACTGTGACC
TTAGGCAAGTTATTTTTGTATCTCATTTTTGTTTCCTCATTTCAAAAGGGGATTAATTAT
AACACCACTATTCTCGTGAGAATTAAATGAGTTGTAAAAGGGTATAGGACGTGCCTGGCA
CAAGGGGCAATGCACAGTAAATAACCATTTTATTAGTACTCCTGCTATCTTGTTTTCTTT
TTCGTGTTGATAATCGGCTCTGTTGGCAGTTCAGGAATAGATTTATATTATAGTCTGATA
AATATACTGAAACCTTGATAAATGCATCAGAAATAGAGCTTTATGTTTGGTTGTATTTTT
CATTAATGAGAAACTACTTTTTAACATTAGCTCTAGAGAAAATGTATAAAATAATTAATT
GCTTTCTCCTGCCACAATATCTGGATACTAACCGTGCCCAAGGCTATAATCACAAATATC
AAGAACTGTTTTTCTGTTGTAGATGTTAAACTTACAGGGTGTTGGGTGCAGTTTCTGAGG
AAGGGTTTTGAGTACTGCATCTCCCCACATGGAAGGCATTGAGATTTTTTCACAGCTCAC
TTACCCCTAACTAGGTGTCTGAGCTGTAAACTACAGAGATAGGGTGTGAGATTGTTCTTA
TGACATGGCTCAGGGCCACCTTCAGGTCATAGAAGTACCTGATTTATCAGGGTTTTTTGG
CCCTTAAGGTCAGAGGTAGGAAACAGCAGTAGCTCAGTGGTTGAGCACCTGCTTCTCATG
TATAAAGCCCTACGTTTAATCCCCATTGTGAAAGATCCCAGGGGTAGCCATTTATTTGTT
TGTCATCAGCAGTGCTTAACCAAGCTCTGAGCTGGGTTATAGAATTTAAGATAGGCTCAG
TCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTGCCCC
CTCATCTTTCAAGATTTGCTTATTATACTCTCGATGAGTCCTCCTGACTAGTCCATTAAA
AATTGCGACTCTCTTTTTTGATACTTCCTTATCCCTTTCTCTATTTCATTTTTCTGTGTA
GCAGTTGCCTCCTTTTAATTAGCTATGTATTTTATTATTCTTAACATTTTATTTCCTAAA
TGTTTATTTCAGACTAGGTAGTAAACTATGAGGGGGCAGGGATTTTTGCCCCGTCTCTCC
CTAGTAGCTAGAATAATGCCTGGTGCATATTAGGTGCTCATTAAATATTTCCTGATTGGA
TGAATGAGAACTGCCCTGAGCCGAGGCAGTGGCAGTTGGGATAGAAAGGATGGAGTGGTA
GGGTATCCCCTAAGGAGAACAGAACTGGCAGAACATGGTGGTGTAATTGGAGTGTTGGAG
GCAACTAACCTCAAGTTGCTTTCTGGCTTTCCTTTATGAAGCCATGCGTCTTGGTGGGAC
CAGAGGAAATGAGCCTCAGGTTGAGGAGAGTGGAGGGAGAGGGCTTAAAAGGATGGCCGG
GTAGGCAGAAGCAACGCTGCCCAGGGCCCAGGTCTGAGTGGCTGAATCCCGAGACCTGCA
GGCGAGCTCTGCCCTTGGCAGAGTCCCGGTCAGTCCAACATGCCATCAGGGGTACAGTGA
AAGGAGGTAAAAGAGGGTGAGTTTCACTATGAACAGAGGTTCCAGAAGGTCCAGGAAAGA
GGGTTCAGAGGGAGAGGTGAGGGAAAAAGGAAGTAATTTCTGGGCAGTTTTAAGCATGGC
CCCAGGTGGTGCTGCAGAGCTGATTTTGCTCAAGATTCTACTTAGAACCTCGGGCAACAG
AACCCAGGAGAAGGTGCTCCTGACGAGGGTCCAGTTGTATCCTCCTAGATGAAGTTGAGC
ATGGAGTAGATCGTGGTAGCGCTTTGAAAGAAACTGTAGTCCAGGAAACTGGTGCCAGAA
CTGACTCAGGGGCTCCTTACCAAGCGTTTAAAATAGTAGTCCCTGTGTTGGCAAGATTGA
GACCTTAAGAACCACCCACGGGGGGCTTGAGCCATTGTTTGCTTTAAACATGTAAAATTA
TAGCCAGGTCTTGCAGAGCTGAGAGTACAGTATAGATATTAGTGTGTGTATCTCTCCATT
TCTCCATTCCCCCTCCTCTTGTATGTCTGCAAGTATGTTAAGCATATAGTTATTTTACAG
AATTTTGATCAATAAAACTTACATGGTCCTTTTAATAAAAATCTAGCTAACCAAAGAGAC
TGTCTTTTCCACAGGATATCACAGCTACCCCTTACGCATTTCAAGATGATCCTTACCTCA
TACCATCATCATTTCTGGAATCTGTGAGTGTTTTCATGTAATTTTTCTACTACTGTGTTT
TATCTCACTGGGTTTGGGTACAAAACTGCATATGTTCAGTTGTAAAACCTTTGAAAAGCT
TACACATACTGTTAAAGATACTATTACAGATTTCTGAATCCTCTACTGCCTTTATGTTTT
TAAAGAGATTGGCTGTGGAGAGGTGTTTGGTTTTTGTTTTTTTTAATANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTCTCAGCACTGAGTGAAACACCT
TTGAGTGTGTAGCCCTACCTTTGCTCACAGTGCTACCTTTTAAAACTCCCATCCTGCCAT
TTGCCCCTTTGGCTTCTGCGACGCAGTTCTTGAGTCTGCATGGCCATGCCTGCTGATTTT
CTGTTGTGACACTAGCACTGGTGTCTCTCTAGGGCTGTGCACACAGTCACGGTCTCTCTG
TCCTGGCAGCATGCTCGTGTCTGCCAAACCCCGGCCCCTCTGCTTTGAGCCCCACGCGCT
CTTCTTCCTGCCTCTCCTCTAGTCGTGGCAGTATTTCAGCAGTGCCTGCTGTGGGTGGGT
GTCGTGCTTTATGTCGTCAGTATGGTGGGGAGCAGGACGTATTCCCTTACTCTCCTGAGG
CATCCTCTCCAAAAGTGCTCCACTCCCCTCCATTTCCCCTGCTTCCCCCAGACGTCCGCA
CCTAAACACACCCACCCTGCTTCTCAAGCTGTAACTTCTGCTGACCAGCCAACTAGAAAA
CCAGTGCAGTTGTGTGGGTCAGAATATCAAAGGCCTGAACAGTGGCCATGGCGGAACGGT
CAGTGATTGGCAGACCCTTTCCCCTCTGTGATTTTGACTCCCAGTTACTCTTCTGTGCTT
ACACTTAGCTCAAGGGCCACTTCTGCTGTGAGGCCTTTGGTGGGTAGCCCACCTCCACAG
CGGGCACCACCACACATCCCCTTCCTCTTACACGGCATTCCATTCCCACCGTGCTGTGGT
TATTTCCTAATCTGTCGTCGCCATTTGATTGTGGGAGCCTTGAAGGTAGAGACTGCCCCT
CCTCTCTGCATCCCCAATGCCTAGCCTCGGCATGAAGTGTCGTGTTCAGTAACTACTCAG
GTAAACTAGTGAATGAGGTAAAGTCAGCCCTACCTTGGTGGTATTATGTGTTTAGATTAT
AAGAAGGCATCAACGATGAAAGGTTTCTGCCTTTGGAAACTGGGTGAACTCTGACACCTT
TAAACAAGATTGAGGGTGGTTTTTTGTTGTTGTCATTTTAAAAAATTAATTTATTTTTTA
ATTGTCCTTTTTTTTTTTAAAGATAAATAAATCACACAAAATGTTACCTTAAAAATCATA
AGAGTTCCCATATACCCCATTCCCCACCCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCATTAAAAATCATAAGAGGTTTCCCATATATACCCCCATATTGCCAACCGCCACGCTCT
CCACATCACCATCCCTTTCATCATTGTGGCACATTCATTGCAAATTGGTGACTACATTTT
GGAGCACTGCTGCACCACATGGACCCATAGTTTACATTGTAGTTCACACTCTCCCCCAGT
CCATCCAGTGGGTTATGGCAGGATATACAGTGTCTTGTACCTGTCCCTGCAGTATCATTC
AGGACAACTCCCAAGTTCTGAAAATGCCCCATATCACACCTCTTCCTCCCTCTTCCTGCC
CTCAGCAACTTCTGTGGCCACCGTCTCCACATTAGTGATACACAGATCTCTTCCATTGCT
AGAGTCACAACAGTTCTGTAGTAGAATACCAGCAAGTCCACTCCAACTCACCTTGCATTA
TTCCGTACTGTGTACCCTGGGATGGCGATGTCCACTCCACCTCTAAATTGAGAGGGGGCT
TAGATCCCACATGACTTATGGATGTGAGTCTCCTGCTTGCAATTGTAGACACTCTTGGTT
CCCTTGTGTGGGAAGAGTGGTTTTAGCAGAAGAATATTGAGTTCAGTTTGAAAATGGGAA
ATTTTTTTGGAAATAGGGTTGTTCAGATAGGGATGTAAATTTTATGTTTGATGTCCTTTA
AACTCTTCTCCCCAGGTAAAACCATCTTGTTTTGGAGACTGGAGAGGTTTTTTTTTTTGT
TTGGTTTTGGGTTTGTTTGTATTGGTATTCTCTGGTTAGATTCCCTACAAAAACCTGTGT
GATAAACCTAACCATGATTTGCTGCATGAAATGTAAATTGGAACATTGTAGTTTATGTTG
ATGTGTAGTGGGTAAAAGTGTTTTTAAAAAAACAAACTTCATCCTAGTCAGTTATCCTTT
CGCCTTTACCTCTTTGTAGTAGCTTTGGCCATCTTGTTTTTCTAGTGTTTAATGCCCGAG
TACTTTGAACCTCAAATTGAAGAGGTAAGTGAAGCTGCCCTGAAGGAACGAATCAAGCTC
AAGAAAGTCAAAGCTTCAGTGGACATGTTTGATCAGCTCTTGCAAGCAGGTACAAATTCA
GTTAAAGACACTAGGAAAGTGAGCTTTGAAAGATGGGTTGCATTGATGTGATGTAGATAA
TTTTGAATCAAAGTTCAAGTACTGTTGTTTTACGTAGTGTTTTGGGCAACAGTTTTTTAA
AGGCTGCTATAGTTGGACCCTTTAAGCTAGTATTCCTCTAGGCAAGCATTTCAACAAGGG
CCTATTGGAATACTTCTGCTTGCATTTGTGAAACCGGAACTGAGCCCGAGGGACTGAGCG
GTGGTTGTTTGCAGTGTTCAGGTTGGAGATGATAGTTAAAACCGTGGGCAACCGAGTTTC
TCTGGGGATAGGAGTATATTAAATATGAGCACCTGGTCAAACTTCATTTTTTTATGTGTT
AATCTTTTAGGTAAGACCACACGGTAAGTGGTAGATTGTGTCTCTGTGTGCCTCATTTTC
ATTTTTGAGCCAACTTTGAGTTCATACTCATTAATTGCTCAAGTGGTAGATCATACCAAA
TATGTAGCCAGAAAGCATCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTGAGTTTCCTGCCTCTG
AGGACACCGAAGGCTGGTGGATTTCCCATGCGTTCCCTCTCTGGGCCAGGCTGTAACGGG
ACACTGGCTTCCTTGCTTCTCCAGGTCATCGTTTATAGCCAGCCTCATTAAGGTCCAGCT
TGGCTTTTCATCTGAGAAGTAGCTGCTTTACCCTTAAGTTAGCACGGATAAGCACACACA
TTCCCTGGACTTCCTTCCTCTGCCTTCCCTGGATCTGTATTCCCTTTACTTTTCTCAAGT
CCCTATGCCTTCCTGATTTTGAATGGTCTGACTGTGGCAGTGCATTTCCTGGTTGTCTTA
ACTTTTGTGTTATTTCTGTTGATTCACTTCAGGAAGCAGCCACAGAGGAAAATACTGAGA
AACCTTGGAAGAGGGATGGTCATCAACTTAGAGTTGCTTGGAAGTATGTCACACAGAATT
AGAAGCTTATATTGTAGTTTATTAAGTAAAGTGTATCGAGTATGTCTCTTCACCATTCAA
AAAGGATGTAAACCTGTGATGTTCTGGAATATAGTTTGTGTTCCGTGTGCAGTATAAATG
CCAAAATGTGTATTTATATGCATTAGCACCTTTTTTTCACGAGGTCTTCACCTCCACCTA
GCTGTATATGGCTCTCTTCAGAGGTTGGTACTTAATGTTTCTATTTTCCACTTAACGCAG
TGTAACCGTCACATCGTATGGGCCATTGATAGTTTCACCAGTAATGCTACTTTGCAATAT
ATACCTCTAGGTCACCTTTCACTCTGAAGATTTGATACATTTTGTTCCTATAAAAAATAT
ACATATGTTGGAATGTAGTGCTAAATTAAGACTACTGTCTTATTTCAGCAAATTCTGAAC
CAAATTCGAGAATTTAACTTAACTGAGTAGAAGCCTCTAAAATACTTCATGTGAATATCT
GGAGAAGGAAAGCTACTTTTAATATATGAAACCAAATTGTATCATTGATGTGGAGACAGT
GGCCACAGGAGTTGCTGAGGGCAGGGAGGGAAGAAGAGGTGTGATATGGAGCATTTTCGG
GACTTGTAGTTGTCCTGAATGATATTGCAGGGACAGATGCAGGACAGTATATATCCTGCC
ATAACGCACTGAATGGACTGGGGGAGAGTGTAAACTACAATGTAAACTATAGTCCATGTG
GTGCAGCAGTGCTCCAAAATATATCCACCAAATGCAGTGAATGTCGGCAATGATGAAAGA
GGTTGTTGATGTGGGAGGAGTGGGGGAGGGGGTTGGAATATATGGAAACCTCTTATATTT
TTTAATGTAACATTTTTTGTGATATATGCATCTTTTAAAAAGACAAAAATTTCCTTAAAA
AAAAACCAATTCCAGAAGGATCATAATTAAATGTGAATGTTAAAGCAATAAACTCTAGGA
AAAAAAGTAAAAATAGAGACATTTAACAACAACAAAAATAAATAAAGCTTCCTTAAGGTC
GATTTGAATAATTTAGCATAGTGGTTAAGACTATGGGCTTAGGAGTAAAACTTGGCTCAA
ATCCTAGTTCTGTCTGATTTTTAAACATATTAAGGGAGAAATCAAGGTGTAGAATAATTC
ATATAACATGGTACTATTTATGTGTTTTTAAGGAAGGGACTTGAATATGACTGAAGATGT
AGAAGAAACCAGTTGTTGGTAGATGCCTTGGGGGAATTATTTTTGAAACTTGAAGGAGGA
TACCTTGTTTTATAGTTGTTTTTTTGTTTTTTAATATCATTGGTATATATTATTTTTCAT
AAAATTGCTTTTCAGTGCTTGTTCTGCCGCTTTATTGCATAGCCTTGGGCATGCGGTTTT
TGAGCCTTGAGTTTTCCCATTTTTAAAACGAACTAATATGTTTAACGGGGCCTGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAATTCCCAAACCCTGTATAATT
GATGGCATATATTTCTAAGTGAATGGATTTGATGATGCTTTATTTTTATCCCTTTGCCGT
CGATCCAGCACCCGTGCTAATACACAGGCATTAAACTTATACACTGAAATTATTGAACAA
CAGACTTACTGGTAAGTGTGTTTTGAGAAGCCCTCTCTCTGCTCTTCTTTGAAAAATCTG
CGTGAAAATCTTCGTCTTTTCTCAGTCCTCGGCCCGCTTTCCGTCTTCACCTATGGTTTG
GAGATTGAAGCAGGAGCCTGGTTTCCCAGTTTGTAGATGTGTAACAGCCTCGGGAAACCC
TGCATATGACCACTTTGCCTTACACAGAGCCATTTAGGAGTAAATCTTTAACCTCAAATT
TTGTTAAAATAGATTTGTTCTCTTATAGCTGATGTGTATACCTTCAGTGCATTGATTGAA
GCAGAGTCACTGATGAATGAGAAATGTGAGGAAAAGTGGAAGAACATGCAGGTAAGGGGG
CGCCTTTATTTTGTCCCCTACTAGGCCTTGGCTATGTTTACTAGAAATAAACGATGAGGG
AGAACAGCATTCGTTGAGCACACACGGCCGTCACGCGCTCGCCGCGCTCAGGGAGCCTGC
CTTGGCTGCTGTCCTTCCAGTAATTGCATCTGCTGTGTGGGAATAGAGCCTTCCACTGGA
GTTCAGGAAGAGCTGGGTTGCTTTATTCACTTATTTTTTCATATTAGTTTTCATTTCAAA
AATAACATGTTTATTGTAAAGTAATATCAGTGGATTGATTCTTACTTTGTACTTAGTGTT
TTTTACTTCTTACTGATCATTTGCAAAAGCAGAAACACAGAATCCACTCTAGTTTGTTAC
TTTGCTTGAGCCTCTCCCTGGAAGACTCAGCAGGTGGAGGGGCAGACACGGGCACACGTC
AGTCAAGTGCAGGTGGCTGGCCCGACCGGAGGCTCGGAAGGGCTTTCAAGGCAGGAGCCC
TGGTCCTGTAACTAGTAACAGTTCCTAAATTAGGGAGGTATTTATTAACCTTTTAGACAG
GGCAGAAAGCCAATTTTTTCTTTATGTTATCTGTGAGATAGGATTCTGTTGGGCAGAATA
TCTACCTGGGCACAAAAATGGTCCCTGTTTTGATTCACCTAGGAGCTGCTGAAGCACATG
GTCGCACAGAAGGTGAAACCAAATCTGCAGACCTTTAATACCATACTGAAATGCCTCCGT
AGACTTCATACCCTGGGAAAGCTGCCAGCCTTACAGACCCTGCAGGAAATGAGAGCAGTC
GGGATCGGTGAGGGTGTGCTCTTGAAGATGAGGGTGGGGGCTGAGCCGAGGGTGCAGGCC
CAGGCAAGCTGAGCAGAGGCTGCCTGGCTCTCGTTCGCTGTTTACTGTGCTGTCTGGGCC
ATTTCCACAGGTGGCACACTCAGTTATGTGACAGGACCCCCTTTATCATCTTCGTGTTCT
TACAGCAAGTTTTGTTACTATTTTAGTGTTAGGTATTTGAACCCAAATTTATATTAGTGT
GTTATATTTTTCAGAAAATTGTAGGTTTTAGGAGTCAATTCACTTGAACATGCTTTAATG
TTCTTAAATGCTGAATCATAGTACATTAGCTATAATGTTTTCGTAGTGGGTTTTTAGACT
TTGTCTAAAAGTAATGCAATCTTTAGCAATAACTTTTTTCACCTTTACATTAATCCTATA
AGCTGGAAAAATGTCTTTGTTCAAAGGAATAGAAGTGAATCTTTTGCATAAATGCCAAAA
TGTTTCTAATGCTGCAGTAAGCTATATTTTGGATAGGTTTGTTCTGACTTACTTCTCATT
TTTTCCATCCGCCTGGTAATTTGAGAACCCTCGCTTGCAACGTATCACTATATTATTCAG
CTGTTTTATCAACGTGGTATGTATGATCTTATATTATCTCATGTAGAAAATTGACCAGAT
CCCTTGAGTTTGAGTAATTGTTGGAGATTCCTTCTCTGCATATGAATTTAGAGTAGAGTT
CACAAATTAACATTATTTATGGCTTGAGCAATAAGTTATTCTTTTTTTTAAAATTTTTTT
TTATTTTTAAAAGATACATAGATCATACAAAATGTTACATTAAAAATATAGGAGTTTCCC
ATATGCCCCACTCCCCACACCCCCTTCTCCCGTATCAACAAGTAAGTTATTCTTGAAGGT
AGTAGCCTTGTTGGTGATAAACAGCTTGAGCTGGAGAGGTGGACACGGAAAGTATGAGCA
GTGTTGGTGACAGACAGAAATGGGCAGAAGGTATTTCAGTTTGGAGCACCTTGTGCTCTC
CAGAGTCGTGCTATCCAATACAGTAGCCACTAGCCACATTCGATTAAGTTAATTACAGTT
AACCGAAACTCCCCCGTCACAGTAGTGCTTAGCACGTGTGGTTAGCAGCACCATCTTCAG
GGACGCAGGTGCAGGCTTAGAGCTTCCCCGTTGCTGCAGAAAGTGGCCCATGCTGTTTCA
GTGGCGTTGTCTTTATTTTAAGGCTGTGTGGGAGCAGGGAGCCTTGAGACTTCATTTGTC
CCCTTTGCGGTTCGTCAGTCCTTGTTGGAGCTGCGCTCTGATGAATGGGCTTTGGAGCAA
GGCACACCGAGTTGAAACTCCAGCTGTGCCGTTAGCAGTGTCAGCTAGGAATGGATGCTG
CCTGAGTAGCACCAGCAGGGTTGTAGTGGTTAAATTGATTAAGCAGGTGCTTATACCATG
CCTGGGAGGCACGCAGCCTGTTGGTTCTGACTCGTTTGCCACTGGCCTGGTAAAGAACCC
CTGAGTTCAGAAGTGAGGATCCTGAGTTAGATTATAAAGACAACAAAGAAAAACTTGCTG
CTTTCTGGTTTGGAAGGCTAATTTTATAAAAACCACCTCCATCCTTATTTGGTAAGTTTA
TTTGGAAACAGGTAAACCATTTCCATGATAACTATTCTCCAGAATTTTACTCAGCATAGG
TGAGATTGTAGTGGAACTAGTATTTCTGACTCAAGCATATGCCATTCCCGTGTGCGGTGT
TGCATCCCTGTTTCAGTTGCCAACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGGGTGGGAATACAGGCAGCTAGTCTGTTCTGGGAATA
CTGGAAGGTGAAGCTTCTGACCTGTGATACTCAGCTCATGTGATTGTTTATTTACGTAGT
TATTTTTAATATTTTCTTCATACGATTTTAAAGGACTCTACTACGTCCTTAAGTTTCCTT
GATGGTACTTAGAAGGAACACAGAGGATTTACTGCCAGAAAATGTGTTCGCTTGTCTGGG
TATGCAGGTGTAGTGTGTTCCCCACTCCCAAGGAAGTCAAGCCTCTTGTGCAGAGACTGA
GAAGGGAGGGAAGTGTCCCTGGTTGAAGATATGGACAGCGCCCTGGGACTGTCCCGGGCC
TCACAGACCTGCACCCCAGAGCGCGCTCAGTCCTGCTCAGGAACTCTGCCCTGCCTGGCT
CTGCCCTGCCTTAGGAGGGCACGGGGGAAGGAGACGCTTGTCCCTGTACTAGGTGCTGTG
GGCGTGCTGGTGGGGCCAGATGGGGGACCACGGTAAAGGCCGTTTGCATTCTTGTTCTAC
AGAGAACTCAAAAAGATCGTCCTTCATAATCTATGAAATAATCAATGAATTAAGGGGGAA
GACGCTTTCTGCCAAGGACTTGGATGACAGTATGTATAGAAATTGCTTCTGTTTTCCTCT
AAAGGCAGAGTACCTTGCTGGTTTCCCTGAGTGCCAGTTTTTAGGGGCCTTGTGTATTTG
GGTGATAATACAGCGTTTAATTTACCTTAGTAGTATTTGGGTGGTTATTGTGAGAAAGCC
AAATATTTGTGACACTTAGGTGGATACTTCCTCTCAGGTTTTTATTTTTTTTTAGCTTTG
TCTTGCATATCACCAGTTACATGGCCAGCATTTTTATTAATATTACTGGTTTTTGGAAAA
TTAATTTCATCCCTAGTAACCAAGACTCTGATGAACTTTGATTTTCAGATATGTTTTTTC
CATCAGCCATGAGAGTTGTAAGTACCATTTCTTGCTCCCTTTTTTTTTTTTCTTCTCAAA
AGAAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTTATTTTT
TTTTAGCTTTGTCTTGCATATACGATGAAACAGGGCCAGCATTTTTATTAATATTACTGG
TTTTTCTTAAATTAATTTCATCCCTAGTAACCAAGACTCTGATGAACTTTGATTTTCAGA
TATGTTTTTTCCATCAGCCATGAGAGTTGTAAGTACCATTTCTTGCTCCCTTTTTTTTTT
TTCTTCTCAAAAGAAGGCTACTTACTATCCATTTCCTTCCTAGATTTACCATAACTAGAA
CCCACCTTGATTAAGCCTGGCCTCTCTCCCTGGTCTTCCACTCCTGACTCGTAACTTCTT
CATGCCTTTGGTTCTAGTCATAACTCAGCATGGGTGGATTTGGACATTGTTCATTGTTGT
TATGCTGATACAGGGCTGCTGCTGGGAGCAGCTTCCTACATGGGTCTTTTGCACACTCAA
CCATTTTTTAGGATTGCTTTCTAAACGTATAATCACTAGACCAAAATCTTTTTGTTTTAA
AGATCATAAAACTTTGTGTTTTAGTTTTAGGTGTTTTTGTTTTTTTGGGTTTTTTTTTGT
AGTTCTCAGTTCCTTTTAACTCATATTTTTATCAACCAAAAAATAAGCTAAATCAGCATA
AGTATGTTTCAGAAGTAACTGCTTTATGTCATGGGCTGCTTTTTGGGTTGATAAGGATCT
CAGCATTATAATTAATACTTGAATTTTCAGTGGCTTATCCCTCAGAGATCTAGATCTTGC
TTACCAAGTGCACGGCCTCTTAAACACTGGAGACAACTGGAAATTCATTGGAACTGATCA
GCAGCGCAATTACTATTAGTAAGTCATGTAACATTTTAAAATTCATGTATCTTTTTTCCT
CTACACCCTCACTCCTCCATACTGGATATTTGAGTTGTTAGAGCAGGATGGGTCCCCAGA
GATTATTTTGTTCCATCCACTTGCTTTTGTTTTTTAAGATGAAGATACTGTAACCCAGAG
AGACTCCTTAAATGGTTTGCTTAGCAGATAAAAGCATGAACTTGAGGAGGCAGTCGGCTA
ATCGGTGTGCGATGATTGTCTTCTGTGTGTCTAAATCCTTGCTTTACACTGAATGTTTTT
AAATGAATATAATATTTAGTACCTACTTACTTGGAACTGAGAGTTTACTGAGGAGGCAGG
TGAAAACGACCAGGTGCTCAGTGTAAGAACACCTTAATTGGAAAGTCCAGAAAGCACAGT
TAGCGACTCCTGGGACAAGCATTGAACCATTTAACTTGAAATTCTTTGTAAATATGTCAT
AATTTACTTGTTCCCCTTTTGTTAGAGGTTTTAGGCTAAATTCACTTTTTCTCTCCGTCA
CAGTTCCAAGTTCTTCAGTTTGCTTTGTTTACTAGAACAAATCGATGTCACCTTGAAGTG
GTATAAGGATCTGATACCTTCAGTAAGATGGCTCATTAACTTGTCATTTGTCATTTAGAC
AAGCTGTATCTTTGCCCATTGAAGTTTTAAAATATATATTTTTATTTCTCTTAATCAGGT
CATCTTCCCCCAGCCCCACATGTTGATGGATCTTCTCCAGGCATTAGATGTGGCCAATCG
GCTAGAAATGATTCCTCAGATTTGGAAAGGTCTGTTTCAGCTTATGGGTCGAGGCCCATA
GCACTTAAATCTATTTAAGGTTTTGATTAACCAACATGTTACCATCATTGTTGGTGATGA
CAGCTTCCCAGTTTTGACTGAATTGATTACGTTAGTTGTGGTCCACTTGGAGGACACTGG
CTGACGGTGCATGTTGGCTTGCGTGAGTAGAGAGGTACTGAAACGGCCTCGGTGCCCTCG
TGACCCCAGTAAGCTGGGTTTTGTGCATCTGTTGTGTAAATGACCCAGGGAAGATGGTGG
CAGACCCTAAACCTGAGTCCAGACCTGTTCCGTCCCTCTCTTCCATGTCGCCTCACCTTG
GTTCAGTTGCTAGGCAGAGTCGGTGGTCTTTTAAGTTTCTGAGGAACAGCCACGACCACA
GGAGGGCCGGGGACTGAAGCACTGGGAGGGGGTGTCTGCCTGAACTGCCAGCAGAATGAG
TCAGGGGTCTGTATCTCTTCCACTGCACGACTACTCTATCTTCATCAAGGCCATTTCTTT
TTTGTTTCAGATTCCATGTCTGAGAAACTGAGCTTATTTATACCGCTGCCCTACTGCTTC
CCAAAACCACCTAACGATCGTATAGAGAAGAACACTGAAAATTTCAGAGTTCTGTACAAG
TACCTACCTGTTCCTGTGGAGCTGGTGGCTGCTTGGGTGCCGCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCATTTTTTTGACCTAACCAGTTTTCAGTTTATGTGAATGGTCAC
TTTATACATACTTTTTTTTGTCTGAAGGAGAGAAATAAGCAAAAGGATACTTTGTGAGGG
TGGTCGTGTTAGGATACCTGATCACTGTCAAAAACATGGTTGTTAAATATAACCAAGAAA
GCATGGTGCAGACGTGCCACCTCATCTGTTCTTAGGAGCGTGGCGCACACACGTCCAGCC
TGCTAGGAACTGAGCTGCTCGTGCCAGGAGTGCAGTGCCAGCAGGGCCCGGCTGGCGTGG
GCAGGGCAGTCTCCGCTGCTGTGGGTCAGGCTGTGATGATTGGCGCAGGGGTACGGACCT
CAGCTGAGTCATGGGAGCTGAGTGTACGTGCGTCCCCCTCGTCCTGCACGTGGCAGGTCG
GTGGTGAGCACTGACACGAGACAACGCCTCAATCTGAGCCTGCTCTGCGTAACGTCAAGA
AGGACTGGCCCACGCCTCTCTGTCCCAAAGTGCATTCCTTTCCTTGGAGGACGGAAGTGA
TTTCTAGTGAACGAGGGTTCTGATCTGTTTAGTTCTCCATGCTGCCCAGGGCCCAGCTAA
TCCAATTAGGCTTTTGACAAAAATATTTTTAGGATGTAAGTGGATCTTGCAACTATTTGT
TTAGTGAGCAAAATGCAGAAGCCTCTGAGATTGCTAATGATAACTTGCCCATTTGCAAGT
TAGAACTCAAACCCCCACTTCTTTTCTGGCTCCTGCCTTCCCTTTGCATTGCTGTTTCTC
TCTTTACTCTTATCCTCTTCCCTCTCTCAGGGCTTTCACTAGAAGAGCTCTACCAGCAGT
TCTCAGCACTGGCACCCTATCAAGTTTACCTCTGAGTGCTGTAATGCTGATAGGCAGAGT
TTGGGGAGAGGGAGTATGAGTCCCAGGGAGAGGACAGGTATCATCAGCCAGTTGTCCTCT
CTTCTGTTAATAGTCATAATTTTTCTCCTATCTTGAACAGGAAAATGCTGCGGCTTTTCA
AGAAGCATAATAAGATCCCCAGGTACGTTGAGTGTCACAGGCCCTGCCCCGGGCGCCACC
TGGAGACAGCTGCCTGGGCTTGAGTCCCCCTGGGGGCGGGTGGCAGTCCTCACGCTCCTC
AGCCACTGCGTTTTGGCACTCTCCTGATGGCGAGTGGACAGCTGGTCCTTCCCCCTCCTC
CCCAAGGGCCTCCTGAGGCAGGTGTTTTGGGGACATGTGGAGTGGATTCTCAATGAGGGC
ATAGTGATTAAATGTCCACTCCCCCCCCCCTCTTTAGAAATGCTAATTTTGCCTGTAAAT
CTTTGATTGAAGAGATTGAGGATTTAGTTGGGGATGTTCATATTTGCCATTTCTTTTCCA
GAAATGAGTTGCTGAATGAGTTTATGGACAGCGCAAAAGCATCCAGCAGCCCCGGGCTCG
ACCAGTTGAGGTGGTGAAGCTGGCGAGTGCCTTCCAGCTTGCCTGTTTGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1107, 3539..3591, 3702..3703, 3705..3739, 30590..30635, 33374..33442, 33888..33992, 36465..36588, 37203..37318, 37772..37842, 39602..39689, 40088..40091, 40093..40127, 40129..40150, 40408..40490, 41142..41286, 41845..41895, 43802..43892, 44433..44433, 44524..44547, 45090..45091, 45093..45197, 45723..45801, 45898..45988, 47503..47588, 47689..47837, 49660..49701, 50041..50092, 50095..50132, 50134..50146
1001..1107, 3539..3591, 3702..3703, 3705..3739, 30590..30635, 33374..33442, 33888..33992, 36465..36588, 37203..37318, 37772..37842, 39602..39689, 40088..40091, 40093..40127, 40129..40150, 40408..40490, 41142..41286, 41845..41895, 43802..43892, 44433..44433, 44524..44547, 45090..45091, 45093..45197, 45723..45801, 45898..45988, 47503..47588, 47689..47837, 49660..49701, 50041..50092, 50095..50132, 50134..50146
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved