Dasypus_novemcinctus Locus WDR43
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus WDR43
Dasypus_novemcinctus
WDR43
GeneScaffold_5286
SNORD92, SNORA42
31088..31175, 71572..71706
76407
AGAACGCGAACCCAGGGCCTCCCATATGGTAGACGGGAGCCCAACTGATGGAGCCACAG
CTGCTTCCCTGTCATTGTATTGTTGAAAAAATGTTTTGAAAGGGTTCATCCTGCTGCCAC
ACTTCCAATCACCATCATCTCTGCCTGGGTCTTCCGGACTCTTCTAATTCATTCATCATG
CTACCTCCAAGGGCTCTCTCCAAACTGCAAATACTATGCCACCTCCTAGCTGTCAAAGTT
GCATAACCCTCAAGGTAATGTTTTTACCTTTCCTGGCAAGCAACCAGCTCTGCGTGGGTA
GAATTATCCCTGGCATTTCTAGGCTTACAATGCATAGATTTGCGAGCAGAAGTGGCTCAA
GCAGTTGAGTGCCTGCTTCTCACATGGGAGGTCCTGGTTTGGTCCCTAGTGCCTCCTAAA
AAACAAAAACAAGCAACAAGCAAACGAATGAAAAAAAAAAAAAACCAACTCAGGGAAGCT
GATATGGCTGAGAACAGGCTTCCCACTTACAAGGTCCCAGGTTCAATCCCTGATACCCTG
AAAAAAAAAAAAAAAGCATAGATTTGGTGAACAATTATGGAAACATGAAAAATCGTCTAT
TTGAAGGAGCAAACTAGAAATATTAAGACAAATCAGAGGGAATAGCTGCTCCTTTTATTT
TTACACTAGATGTGTGAATAAATTGTGTGTTACATGATTATAGCCTGGGAGTAGGGAAAA
ACGGGAAGTTGTTAAAATCCTGGAATTTTAAGTTAATATTTCCTTTAACCATAATATATA
CACATATTTTTTTAAAGTCGACTTTTTTCCCGAAAGGAACGGGCCGGGCCTTGCTTCTAC
AGTCACATTCCCCACACACCGCTTCTCCTCAGAGCACAGGTTAGCTACAAGCCCCACCCG
GCCACCGTCGGCGGGGCGGAATCGCCCAGCGCTCGCAAGGCTTCGCGAAGAGCCACGCCC
CCGGCTCCCTGCGCTCCCTCCGCCCCACTTCCTCCCTGCAGGGCCCGCCTCGCGCGGATG
CGCCTGCGCACAGCCGAACACGTGGCTGCCGCGGAGCCAGAGCAGCAATGGCGGCGGGTG
GTGGAGGTAGCGGCGACCCCCTGGCCCCGGCGGGGGTTCCCTGCGCCTTCTCCCCGCAGA
GTCAGGCCTACTTCGCTCTAGCCTCTCCAGATGGAAACCTGCGAGTATGGGAGACAGCCA
ACAACCGGCTGCACCAGGAGTATGTGCCTTCCGCGCACCTCAGCGGTACCTGCACCTGCC
TGGCCTGGGCGCCAGCGCGGCCGCAGGCCAAGGTAAAGCGAACGAGTCGGCTGAGGGGCG
GGCGCTCGCCGGGGCTCGGCCTCGGAGTCCCCGGGCTCGGCGGCGCATGGCCTGGTGTCG
CGTGTGATTCTCGGCGGCCCGGGGCGAGGAGACAGGGCGCGCCGCGGCAGCGCGGACTGG
GCCACGCTGTCAGCCCCGTGCGCGGCCTGCGAGAGAGCAGCGGGAGAGTGCGCGGCGCTA
TCCGGTGGGTTGTGGACCCAAGCCTTGCTCGCGGGGTCCATGTGTTCTGCTGCCCCTCTG
TCGGTGGGGCCGCCATGTTCGCCAAGGCTCTTTGCCCCTCGGGGCCAGCTTCCTCCAGCT
GGTCCTCCCTTATCAGCATGCGCTCCTCAGTCTTGGCTGTTGACAGAGCTGCTTCTTGGG
CTGGGCTACCCTTCTCCGACCTCTGCCCAGCTCATCGGGTTTGCTGTGGTCAGTCAGGAT
GAAGAAGTCTGTATCCTTCCGGACAGTACCCACCCCCCCCCAATCCCCCGCGCAACCCGG
CTTTGGGTGCTGGCTCACCACGTGTTCTGTTCCTCTCACTCTGAAACTCCAAACTTTTCC
AGGCTCCTTTCCACTCTCTGCATTCGAATTTTTGCTAGGCTCCCCCTTTCTACATCCCAC
CCTCACCTTGCCGCCCCAAGTCTGAAGTTACGGAGGTAAAATGAAGTAGTTTGACTGATT
GAAAACACTCCAGATGATGAAAATACTCCAGATGAAGTTTCCCCTAGATGGGAAACTGCC
TAGTTAGGGAAGGCTTTTCACTGTTAGGAACCCATTTCAGGTAAGAGTTGCGTTGCTCTA
GTACATCTGGTTTAACTCACATGCACGTGGTAACTCGAGTTATTGAGTAGCCACACCAGA
TCGCTGTTGTGATTTGTGATGTGAGGTTTCTGGCGTTTAGCACCAACTATGTAAAAGTTC
AAAAACTGGTGTTCAGGAAAGATCCTACGCTACCTGACTACTCCGGGAAACTTGCAGAAT
TTTTGGGTTGGAAGTAAGGAGACATATATCTTGCCACACTTTGGGTGGGTATGCTTAGAT
AGTTTTCAGATTTAAGCCAGATATTTATTGTTTCCAGATGAAGTGACTCCTCTCGGCTAA
TGAAAGAAACCTATCAGGGCTCTTAAGTCAAGCGCAAAATTCTGACTTTAAAAAATTTAA
TTGCCATTATTAAAATGACAGCACTACATTTTTTTTCTCCTCAAAGTTGTTCGCTGTCAT
TGTGCTTTAACAATTTTTTAAATTGTCTATAATAACACTGAAGGGAAATATGGAGTAATG
GTTAGGTGGATGGCCCAAGCTAGATTGCACAATTTTGAGTTCACGCTCTACTTGATAGTA
GTAATTGTATCTCTATTTCCCATTTGTAAAATGGGGATAATGATACTTCATGGGGTGGTT
ATGAAAGTTAACATGTAAAATGCATAAAGCATTTAAGATAGTTCTTGGTGCATAAGTACT
ATCAGTATTAATTATCATTGTTACTAATGTCTTTTATATATTTGGTGAGCTCTGCAGGGT
AGAACGGGGGGAACATTATTATTATTATTTGCCTTTTTTTGGGAAGAGGAAACAGGTTTT
GGAAAACTAAGCAACTTGGATAAAGTGAAAACAAACTGGGACTAGACACTTGGGTCTTTA
GAGCTCTGTTTTCGGTTATCTACAACAAATAATATAATGTTGACAAAACTTGTTGCTTAC
TTTGCTTTTCTTTTGACTTAAAATCATGTTGCATGCCCCAGAGGTGAAACCTTGCCTCGT
CTTAAATTTCTTGTTAAAAATCTTACTTTTGGATTATATACTATACTCCGATATAGTAGG
GGAAAAAAAAACTGTATTTGGTATCACAACCAGGACTCTTGACTCAATCTTGTTTTAGTC
ACATTGAGCCCGTCACTTTAATTTTGAAGAATGAGAGTTAGGCTACATATGAAATATGTT
TTTTAGGTTTCAGTACCATTTATTTGCCTGCGCTTTCTCATTTTAATCACACAGCAACTC
TGTGAAATGCCCTGAAATTATTGCGTATAAAAAACTGGTTGAGGATCAGAACTAAGCTAG
TAAAGTGACTTAACCAAAGTATTAATAATAGCCAAGTAGTTAAAATGATAGCTAAAGTCA
GGTATTCTGATTCTTGGTCCAGTGTCTTTACTCTAGAGGCACAGAACTGAGGCTGGAAGG
AATGTAGGGAAATCCAGTTCCCATCCTGGGGATACATCTTTTAGGAACACCAGTTTTGTT
TGAAAATTAGGGAGAGACAAACTTGCACATGTATTATGGAGTAAAGTTAAAGAGTTACAT
GATTTTAAAGATAGAAAATGAAGAGTCACTTTAAGCAAGTGCTTCAAGCTCTGCCCTGGG
GTCTTTGGGTTCCATTCTTCACCACTTTAAGTTTTAAGATACCCCTGTTTCGTTTAAACC
CTTCCTTTTATTTTGCATCCTTGAAGCTCAGAGTATGAGGCATGAAAGGGGTTGTTCTTC
TGAAGCCCATGTTCTCAGCACCTTGTTAATAAGGTCCTGGCATATAGCATTCTCTCAGAT
GTGAAATGGGGGTACCAGCCACCTTTCAGGGTCCTTGGAAGAGGCAGTGTATATGAATGG
TGTAGTGTGGTGTGGCACATAGTAACTTTAATAAAAGTAGTTATTTCTGAATGAATCAAT
GAGTTCTGTCTGGGCTTGTTTTTATCGTTTAATGCTACATTTATAATAGAAATCAATTTG
TAAAAGGATTCTGCAAAGTGTGGTTCAGTAATTGACAAATTCCTGCCCATGTACAAAGTT
TGGTAAGGAGACTCTTATTAATAGAGAAAAGGGGGTTGGTGGTGCTGGGTTCTTGGGTAA
GAGGGCTTAAGGCATGGTTCGTAAATGTTTAGAAAAATTAGATTTCTGCTTCTTGTTCTT
GGTCACAGAATGATTGTAATACTTTGTATTTATGCTACAATAGTTTTTAGAGCGATTGTT
TACGTATCTAACTGAGCATACCATTTGGTTAATGGTGTCTAGGAGAGAGGGGGTTCTTCA
ACGAGGGCCAGAAAATATTTGAGAATAGTGCAAGGAGACAGATTGATGGCCTGGAGATGG
TTCCTGTTTTTAGAACTCCACGGTTTATTTGTGTAAACTGAGGCTGGGATGTGAAGTGAT
ATGCCAGAGCCACACAGCTGACTGAACCATCTAGGAACTGACCCTGAAAACTTCTACTTT
TCTTTTCCTGGGTGTATTAGGGACCTCGGGGAGCAGCCCCTGTCTCCGTATTGGCTACCA
CAGTGAATGTGTTGAGGCTGCTTTGCCTCACTGCATTCCCATGACCCCACACAGCTCAGT
GCTTGTTGAATGAAGCACATAGCTTTTCAGACATTGGACAGGACAGGGACGGTCGCATTA
TGGATGATTCTAGGAATAACCTGATATGAGTATTGCCATTCCCACCCTTAGAGATGTAGT
ATAATCCTGATGTGTTTCCTGTACATATTCTCTTTGTGGTCTTTCCAGTTTTTAAACTTC
AGTAGAAGGTAAAGGTTGTAAGTAAAGATTCTGTAGGCAGAAATAGGAGTTTCTGTGTAT
TGGAATATAATAGCTCAGATATAAATACCTTAAGTAATAATTCGTAAAATGCACATTTTT
TCCCTACTTTTATCTGTAAAACTTAAAAGCCAGAGTAAGTGGCAGTAAGAGAGACCAAGG
AATGGAATATGAGTCTAGTTGCAGAATGAAACTTAAAACTGGGCATAATTTTCAGTGTCT
AGAGGTCAGTATTTTTCAAAAGTAGGTTTTAATTAGTGGGTTGTAATACTGATGTCATGG
GTTGTGATAGCATTAAAAATAGAATAATTTAAAATAGCAGTATTGTGCATAGTAAAGTTA
AGTATTTTTCTGAGCCATGTTTCAGTTGTATATACATAACGTTGGCATGTATGTACTGGT
TCTCTGAATAAACTCTTACTCTGGGTTCTCAGTCTAAAACAGGGGTTCTTAACCTTTTTT
GTTCCACGCACCCACTTGGCCAGTCAGGTGAAAACCCTTACTAAGTCCCCACTATACTGT
GTATTATTTAATAAACATATCACACGCACACCAACACATCCCCGCAAGAATGTTTTTTTT
TTTTTAATTTTCAATTCAGGCTCATGGACCCCCTGAAATCTTGGTCTGCGGACCCCTGAT
TAAGAAGCCCTAGTCTAAAAAGTCATTACTCTAGACATAATTATTGATCATATTCATACT
TCTCATCACCTGGGTGTGCTTTTTTCATCTTTGTCTTCACCTCATCTGTGTTGCTGCTTG
CTTTGATAAATCATGCAACATGTGCATTCACACTTAGCTCTCTGATTGTTTTCTGGATCA
AATGCTGATAAGGGGGAATGGATGTAGCTCATTGGTTGAGTGTCTGCTTCCCATGTGTGA
GGTCCTGGGTTCAATTCCTGGTACTGCCTAAAAAAATTGCTGGTAAGTTTCATCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTAGGTTTAGACCAGTGAGCC
TTAGCGTTAGACGTAGATCGAAAGCTACTCTCCTGCTTCAGCTTGCTGTTAGCAGAAAAT
ACAGACATTTCACTGATGCGGACATTACGGTTTTGACTACGATAATGCTTAATTTCTAAA
CTTCTTTGTGCTTTTTAATGCAAATCTAGATCTGCAGCAAAGTATATTCATATTTGGACC
AGCTTGTATTTCACACATTGAGAAACCTTAATGTAAATAATTTTGATTTGTTGTGGAAAA
CCAAGAGTAGAAGAAATATTTACTGGACTCTTCCAGAGAAGATTTCTGATTGAGGTAGTC
TTTGGTTAACATGCTATCCATCCCCCTTACTGTCCTTTCCTTGAAATTGGAGTTTGTGTT
CTCAATCTTATGTGGAAATCACATTTACCCCCCAGAGTTATTCTTAGGTGGCTTTTAGAA
ATTCACCTGACAGTGGGTGCTAGGTCCTTGTGCTGAGTTTCAATGTTATGAGCTTTGCAA
CATCTATTTGGGTTTATTAATGTAGTTATATTTCTCAGGACTTGTAAAATGTGCATGTTT
TCTCTTGTATGTAAAAAGTTAACTTATTTCTTGTTAAATCATTGTAGTTTTTGTTCAAGT
GTCCAATGAATCAAATTTCACAAATAGTAACCTCCCCATAAAATGTCTAAATGAATAAGA
TGGGAAATGATTTGTAATATTTACTCCCTGACATTGTGTACTGATAACGTCATAGTTTTC
ATTGGTGGTTCTTGGGTTGGGCAAATTTTTGTGTCTTGGGCTTCTTTTTTTGCACTGTAG
AGCATAGATCTTGCACTATCAAGAAAATGTTCTCTTTTCTACAACATTGGTCTATTTTAC
CCTAAAAGAATGCGTTTTTCAGAGCTTTATGCTAACATGTATAGGCTGGTCTCCTTTCAT
TTAAAAAATTTCAAAAGCATAAGGAAGAGAAACTCTAAAAACTGTAAATAATTTCTTAGT
GTTGTAAACTCTAAAGCAGTACTTCTTAGGTTGTGATCAATTGTCTTTTTGATGGACATA
CTGAACTCTCAGCATCACTTTTTTTTAAACAAATCAACTTTCTGATACATATTAACATAT
ACAATTCATCCAAAGTGTACAATCAGAGGTATTTTGTGTTATCATATAGTTGTGTTTTCA
TCACTTCAGTCATTATTAAAGCAGTTTCATTATTTCAATAATAATAATAATAATAATAAA
CAGACAAGAAAATTCTTCACCTCTCAGTGTCTCTGTGCTTTCCCTGCTGTACATAGCTGC
TGTTTCTGGTTATTCTTGCACAATTATTAATTTATTTATTAAGCAGTTTTACTGAGATAT
ATTTACATACCATGTGATCCAGCATCACTTTTTTTTTATAAATATATTTTTTAAAAGATT
TATTTATTTCTCTCCCCTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTACGCAGGACACCCTGCATGCACGCACTCCTTTGCACGCATCAGCACTGCACGTGACC
AAGTCCACTTCCCCCAGCATCACTTTTGAAATAAGTCAAGGTTATGTAGCATTTGCCACG
TGATTGAAGTCAGTTGGAATCACTAAGCCAGTATGGATGTACCAAAGTGGCCCTTGATCA
GTCGCTAGAGCAGTTCCTCAAGGCTTGCTCTGAGCCGCTGTATCAGTTCCAACTACTGGT
TCACTCAAATTAAAGTAAAAGTGGGTGAATTGAGTGTAAAAATGTTTGAATTTCTCTTCC
TGAGTTTCTAAACTAGAATGTGAGAACGTTTTAGGGGACAAAGAGAGGGAAGCAATGACT
GGGTATGGATAGATAATCCATTTGTGTGGGGACGGTCAGGAAGAGTGGCCGGTGCCTGAG
AAGTGGCAGCAGCAGTGAGGCCATCTGGACCTGTTGAGAGAAATGGTATACCAAGCTGTC
TTTCTTGCCTTCCTTCCTTGTAGAGGGATAGGCGAGGGAGAGACTGAGAATGGTGAGCTT
CTCTTCCCATTCAAGAGTTATTTTTTTAAGTAGTGAGAAAGAAATCACATGAGTATCCCC
TTCTGTTGGTTTTTTTAAAGTGTCTCCTGGTAGTGATCACATTTCCTTTGTGGGCTAATG
GACATTTCCATTTATACCTTAATGATACTTAAAATACTAAATAAATAATACTAAATAAAT
ACTAAATAAAAATTGTTTTTTCTTTTCTTTCTTGCTTTTTTTTTTTTTTTTTTTTTTCAG
GAAAGTCCCCAGAGGAAGAAAAGGAAATCAGAAGCTATAGGAACAGGTGACCAGATTGAC
TTGTTGGCTCTTGGTACAGCAGTTGGAAGCATTTTATTGTACAGTACCGTAAAAGGAGAG
TTGCACAGTAAATTAATAGTAAGTGCATCTATGTATGTGTATTTTATATAAACATAGAGG
AGGGGATTTCATTATTAGAGGCTTATTAAAAACAAAACACCACAAGGTGTGCTGTAGCAT
CTTTGTGACTGGGGCAGCCCTCTGCCCACCTCCGTTCAAAGTACTGAAGAGTAATGTTTG
ATAAATAGCTCTATCAGGTAACCACAGGCCTTGCTATGGGTCACTGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAA
GTTTAATATCAAGAACTGTTAACTAGGTTTCAGTTGAGAAAAGGTAAAAAAGAACTCTCA
GGTATCACAAAGGTAACAACTCCAGGAGGTAGCTCACTCCCTGTAGGGCTAGGGGAACAA
GGAAAGAGGTCAGTGTTATTAAAATTTAAACGCTTAACAGGAGGAACCCTGAGGGACTGA
AAGCCAGACTGCTTGGGAGGAGATGCTGCTCTGTTGGTGTGGCTGTCGCCCCATGTCGCC
CCATGGACTTGGGTGCAGCTCTCTGACGAGGGGCTCCAGCTGGCTAGTTCTAGTGTCTGT
GAAGGGGAATGATGAGACTGGTTCTCCAAGTGTCAGAAATTGGACATTGGGCTCAGCTGC
TGCTGGAGAGAATTGCCACTGCTGGAGCCAAGAAGCATTTTTGGAGTGATGCAAACGAGA
AAGCCTTTTCTTCTCTCTCTAGTACCCCTTGTTGGTAGAGCCTCCTAGGGATCTAGCTGG
CAAGGCGAAAATGTAGTTTGTAGAGTCCTAGCCCTAGCTTTACAGAGCAGGGTAAAGAAA
GGTTTGGCACTGAGATACAGTAACTTGATGGGCATAATTTGTTTTAAATAATATCTGTTA
CAGCATATTTTTGTTCACCAGAGGTCCTGTATGTGGGAATGGTTTTATATGTGAATGAAT
AAAACATAATTTTTCCATTTTAGTTAGTATGTGCCTGTAGAAAATTTGGAGCTACATAAA
GTTGAAAAGTGAAAAATTCTTTATACCTCATCAGCGAAAGATCCCTTGTTTATAGTTTGT
GTACTTCTTTGTTTTATGCATATGATTAAAAAATATAGTTGGGTTCTGTCTGCTTAGGGA
CTTCCTATGCTGGTGTTTTCATTAGATGTTTACCAGTGATTTATGTGTTTGTCAAAAAAT
TAGTCATAAACATTTTGAATGACCGCCTAAAATTCTAACTGTGTAGTCCTTTGATTACTT
TATTCTTCATCCTTTAGGTAGCCTAAGCTTTTTTGGGGGGGGGGCAGATACAGTAAGGAA
TGTTTTTTTTTTTTTTCTCTCACCTTGATTCCCAGATTACTTACCTGTACCTACTAACCT
CAAAGAGGGTTTAATAGTTAAGACTATTCTATGCATATTACAGAAACATTTCCAAAAGAG
TTTTCCCTACTTGTACTTCTATCAGCAATGAAAGGTATGAATTTATCAAAAAGACACTCT
GAGGTGAGGTGAGGTGAGGGGTGTTGAGATGGTGTGAAGTATTAATCGAAAGTCCGAAGT
GCCTGGCATATAATTGATCCTTAGAAATTGTTGAATGAGTAAGTGAAAGAATGCACATGT
TGCTCAAATGCTTTCTAAAAGAATATTCTAATTTCACTGCCCCTAACAAGGTATAAGAGT
ATCATTTTTACTATAACCTAACCAGCAGAGGTGTTACAATGCTAAGCAAGTTGCTAGAGG
AGCGGACTGAAAATGCTACTTTGTTTTGTATTTTCTTTGATTACTAACACAGTTGAATAT
TTTGGTATATTTTCTTACTGAAGTCTTTTTATGGAAATTATTCATATTCTTTTTTCAGTC
CTTTGTGCATATGTGTAATGTAGGACTAAGTTCTTTATGTAAGCTGATAGGAGGGGAAAA
GTAATTGAATTTAAGAACATTTTACAATATTTTTCTTCTGAAGTGGAAGTGATATTTGAA
AGTAGCTTCAGTGATTTTTTAGTTACAAGTTTACTTTTATCCTTAGCTTAGATGTGCGTA
CAATGATAATTTGTTGTATATGTATTTAATTTATGGGAATTCAGGAGAAAAGAGGTAAAA
TAACACTTGCTTACAGTGTAGATTATCTAGCACCTCACTCTACTTAGTGAGTTTGTCCTT
GAATGAGTTTGAGATGGGAAACCCTCCCAGTACCTTCCCTCCCAGTACAGTCCATTCTTG
TATGCCTCTTAATAGGCAAGCATTTTGCTGTGCTGAGTGTGTTTAAAGTAGTGTTTACCT
AAAGAAATTGATTTCTTTATTGAAAGATGGTTTTGGTGCTTTTTAAAAGGAATTTTCAAG
AGTAATTTTCACTAGACTTGATTTTTACTATACATACTGACTTTCAACTCTTTGCTATTA
GCTCACTCAAGCATCACAAACTTTTTGCCATTGTCATGCTTAGGGCTGGCATTCCTGTCA
AAAGCAAATAGCATTTAGGACTAGTATACTTTGATTTAGGATGTGGATGTTGGTTTTTCC
AGTAGGGAGAAGGGAAAGTTAACATTTTGATGAAGTTCTGTCTGATTTATCTTATATTTG
ATGTTGCTGGAAAATTAAAATAAAACAGAAAGATGTAGGAAAGTGGATGTGGCTCGAGCT
ATTGGGCTCCTCTCTACCATATGGGAGGTCCAGGGTTTAATTTCCAGAGCCTCCTGGTGA
AGGCAAGCTGGCCTGTGCGGAGAGCTGGCGCAGCCAGATGACACAACAAAAAGAGACACA
GAGGAGAGACAATAAGAGATGCAGCAGACCAGGGAGCTGAGGTGGTGCAAGAGATTGAGC
ACCTCTCTGCTGCTCTGGAAGGTCTCGAAATCGGTTCTCAGTGCCGCCTAAAGAGAAGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTCTGTGGTAATGCAGGAGTTCATTCAGGTACTGCTTGAGAATGTGTTAGAGTTT
GACAGATCTAGACTGTAGACTTGCTGTATATAAAACTTTGTTAGATGGCGGAGTGTAGAG
TTGAATAAGGTTATAGGCTCTTCCGTGGGAACTTTTCAAATTGAGCATTTCAGGATATTA
ACACACAGAAGTGAAAGAGTGGTTCAAGAGTAAAAGAAATGTACGAGAGATGTCATAGGT
CACATGTGGTAGTTGTCAAATGAGCAGTGTATGCTGGGGAGACCTGGTGGGAGAACATGG
GCTTTCACCTGGGCCTTCTGGCATAGGTATGATATAGAGAGAAAGGGTAGAAAAACACTT
TCAAGGGTGGGGAGGTGGCAGTAGCAAACACTAGGAGACAGGGAAGTGAGAGATTTACTT
GGAACTGTGAGAAAACTAATTTAGAGAAGGAGCATAGTAGGAGATAATGGTTGGTAGAGG
GAAGATGGGCCAGAGTAGCTTAAGAGTTTGGCTTTAAGTGTCATAGATAAAAATCTTCAA
CAGCTCTTATGGTTTATGCACTTAATCCTGTATTACTGGTATAGTAGATGCTCAGTAAAC
ATGGTCTATGGGATATAGGTCAACTCATTATGGAATATAGGACCCTAAAGAGGATTATGG
TGCCCATGGTCCTGTAGCTAATAGGTGGCAGAGAAGGGACTCTAATCTGCTCTCTTGAAT
CCTGGTACAGTGTTTTTTCTCTTATACTAAAAGTACTCTGTTGGAGTTTTGGGATCCTAT
TTGGTAAGCAGGTGGAAGCCAGAGGTGATTAGTGTCTTGGGAATAAAGTAACCAAAGTTA
TACTTCAGGAAAAAGTAATCTGTCAGCAATGTGTAGAATTTAGGGAAAGGCGATAGATTA
AAAGCAGAGAGGCCAGGTAGATGGCTGTTCTTGTAATAGTCCATTTGTAGGATGGTAGGA
ATGGAGTAAGATTGGAAAAGTAGCAAACAAGGGGAATCAGTAAGGCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGACTTCCAACTAGCAGACATTTAATGAATAGACTTTCATTTCTC
ATGGGCTAATATCCCAACTGGCAAGGCTATATAGGTCAGTACTCGATATTAATGCTGGCC
ACATCCAAGTCACAGGCTGTCATTACAAACTCCATTAACATGAGAAAATATTGTATTTAT
CAATTACAGCAGAGAATATATAGTTTTGTCTTACCCAAACATTTAAGAATTTGATTGAGC
AGTAGGGACCTTACAGCTTGTCCCAACTGTTTGCCTTTTCCAGACCCTTAAAATACCATT
TTCTCTGATGTTTCTTAGTAGGGTCACTGCCACAGGTTTCTTCTATGCAGCCGGATTCAT
TGCCATAAGGCCAGGCCAGAAACCCTTGAAGAACTGCAAAGTCCATTGTTGACCTTTCCA
CACAGTTTTTATACTTTTTTGTATTCATTCAGGCTTGTTTTACTTTTACAAAATCTCACT
GAATGCTTCCACAATACGTTTACAACCTGCTATATGCATACTAGGTCTGTCCCGCATATC
GTCATATTAACCATTTTATTTTAGGACAAAATACACCTTATAACCTTTCAGTTAGCATTC
CCACAAACTTTTTACCTTTTTCAATATTTGCTTAACTTTTACATCTTTCATTTCATCCTT
CCTTTCTTTTTTCATCTTCTTCCTTTTTTCTATTTCTTCCTTTCTCTCTTTTCTTTCTCT
TTTTTCCCTTTTTCTTTTTCCTTCCTCTCTTTTTTCTTTTTTCCTTTTTTCTATTTTTTT
TCTTTCTCTTTTCTACTTTTTTCCTTTCTTTTTCCTTTCTTTCTCTTCTTTCCTTCCTTT
TTATCCTCCTTTCTTCCTTTTTTGTTTTTCCTCCCTTTTTCTCTTTTTCACACACACTGA
AACCATTACAACACACACACTGACATTGAACAAACAGGCAAACACAAAAGCAGTTCCAAA
TCTATTAATCTAGAATTTCTTCATTGCTTCCTTTTATAATTCAACATTTCTTTTCCAGTT
TTCCTGCTCTCAGTTTCCTTCTTAATCTCTTTCTGTCCCCAAGTCATACTTGCTTTATGA
TGCCATGCTTGAACAAGTTCTGTAGTTTAGATACTTTGATGTAAAGCCATTCTAGTCTTC
GGAATGAGACCCAGCCATGCAGTTTCCAGCATCTGTCTCTCCATCTGCACTACTGGAGGT
TCTAGGTTCCACAGGAACTTTCATCGTCTCTTGGCGTTCATGGTATGGCTTTATCCCACA
AGTTGGTACCCACATGCTGGTACTCACACAGGACGTTCTCCATCTCCTGGGGAAATAGAA
GCAAACCCTCGAGGACTTTGAAGGCTTTCCAAACCCTAGGGGCTCTGCGCCATCACAACC
ACTTTAGTTTTGGTCTAAGTGATCCTTCTTCCTTTCAGGCCCCATGTTGGTCTCCAATTG
CTGAGATCAGCTCAGCGATAGGTTGGCTCGAAGGGAAGTGACACAAAACTTTACAAAATC
AAGGAACAGAGAGAGAAACACAAGAGAGGAGATAGAGATGGCACCAGGGGACTCACACAC
AGCTTCTGGAACAGAGAGGCTTGACCCTAGTTTCCTCCTTGTATTTATTGGAAACTACCG
AGCAGCTGTTTGCTATCTGAAATGCAACATCATCTAAAATAATAGGGAACAACTGCAACA
TCAACATCATCTGCAATAATAGGGAACAACTGCAACATCTACAGTAGAACAGGTGTGACA
TTTCCATTAAGGAGCAGGTAATTATTTTCCCACAGATTAACTGTATTTTTAAAAAGCTGT
CTAGATGAGAGTTTACAAAGATAAGTCCTGCACATAGAGTTGAATGCTGTTTGAGGCACA
GTTCAGCACGTACACGCCTTGTATCTAATCATAACTGTGAAGTGGACTCACTCTTTGTTT
TACTGTTGACACATAGGTTAAATAAGAGCCTGAGCTCTCATCCACTCAACTGTCCTGCCT
CATAAAATGACTTTCCAGTTTTATTCTTGGCCTCTCTTTCCAGAGCACACAGACTTTACT
GTTCTGAAAACACACTAGTCTATGGCTCCATTTTTTCCATTATATTCCTTTGGCCTTAAG
TATCTTTCTTCCTGTGACAATTTTTTCTTTTTAAATCACAGAGTAGCTGTAATTTCAAAA
GTCACATAGCTCTACAGAGGTTTCCATCATACCTTACTCTGACTCCAACAGCTTATTCTT
AGGGGCAACCACTGGTAATTCTTTAACTTTTCTTTTTTTTCCCTCCAATGGTTTTATTTA
TTTATTTAAATGTTACATTAAAAAAATATGAGGTCCCCATATATTCCCCACCCCCCTCAC
CCCACTCCTCCCACATCAACAACCTCTTTCATTATCATGGGACATTCATTGCATTTGGTG
AATACATCTTGGAGCACTGCTGCACCGCATGGATATGGTCTACACTGTAGTTTACACTCT
CCCCCATTCTACCCAGTGGGCCATGGCAGGACACAAAATGTCCAGCATCTGTCCCTGCAG
TACCACCCAGGACAACTCCAAGTTCTGTAAATTTTCTTGAGGTATTTATTTCCATGCTTT
CGACTAGCATTCTCATACTGCTATTAACTGATTTTGTTTTCCAGTTTAGGTACTATCTAC
TGATTTCCTACTGTGGAAGATGAGGATTGAGCTCTTATTCTCTCTCTCTCCCGGTCTGTT
TTCCTTGTATTGTTACATCACAATTTTGGGTTAAACAGTATTTGGTGTTTATATTACGAG
TCCTTAAATACTGTTACCCTGAGCCTTGGACTGTGCTAGGCTTGTTTGTTAATTGGGGTG
AAACAGTCACAGCAATAACCATTGTAAAGCATGCAGTTAAGTGGCATTCACAACCTTGAG
CAACCACTACCTCTTAGCTAGTTCCAAAATATTTTCATCAACTCAAAAGAAAACCTGACC
ATTAAGCAGCACTCACTTTTCTCTGCTTCCTCCAGTCCCTGAGAACTGCCAGTCTGCTTC
CTCTGTATGGAATTACCTGTTCTGGAAATTTCCTACAAATGGTATCATATAATATGTGCC
TGGCTTCTTTCAGTCAGCAATATATATGTATAGTTTTTTATTTAAAAAATTTATTGAAGT
TTATTATTCATACATAAAAATACATAAACAGTAAGTACAGTAAAAATTAGGATACTATAA
AACAAACATGCATACCAACATACAGGGTTCTCTTACATCACCCCATCACCAGTACCTTGT
ATTACTGTGAAACTTTTGTAACTAATTATGAAAGAGCATCATTAAAGTATTACTACTAAC
TATAGTCTGTAACTTATATTCGTGTATTTTTCCTCCAGCCCACCCTATTATTTTTTTTGT
TCATAAACCCTATAATTTATCTAAAGTGTACAGTCAGTGGCATTTGGTATGATCAGAGTT
GTGCATTCATCACTTCAATCAATATCAGAGCATTTTCATAACTTCAAAAAAACAAAAACA
CTATCATATCCGTATGTTAGTGCCACTAATTCCAAATCTTTCAATGTGCATTCTCTATTT
CTATTCATGTCCAACAGCTTTTTACTAATTATACACAGATTAAACCTCAGCTTTCCATTC
TTTAACCACATTCTATTCTCTGATGACTTCTTTTCTAACTATTAACTCCATGAGTTTGCG
CATTATATTTAGTTCATAATAGCTAAATCATAGAATATTTATCCTTTTGTTTCTGACTTG
CTTCGCTCAATATAATATCCTCCAGGTTCATCCATCTTGTCATATGCTTCACAACTTAAT
TTCTTCTTACACCTGAATAATACTCCATCTTGTGTGTATTCCACAGTTTATTCATTCGTC
AGTTGATGGGCACCTGGGTTATTTCCATCTTTTGGCAGTTGTGAATAATGCTGCTGTGAA
CTTCGGTGTGCAGATGTCTGTGTCACTGCTCTCAGGTCTTCTGGATATATATATCTAGTA
GTGGTATTGCTGGGACACATGGTAGATCTTTAACTTCCTTAGGAACTGCCAAATAGACTT
CCACAGAGGCTGTACCATTCTGCATTCCCACCAACAGTGAATAAGAGTTCCTGTCTCTCC
ACTTCCTCTCCAACACTTTTAGTTTTCTGTTTTTTAAATAGTGGCATTTCTAGTAGGTGT
GAAATGATATCATTGTAACTTTGATTTGCATTTCCCTAATAGCCAGTGATGTTAAACATT
TTTCCATGGTTCCCCCCCCCCCGCCCCCTTTTGTATTTCTTCTTTAGAAAAATGTCTATT
CAGGTATTTTCCCCATGTGTTAATTGGGTTATTTGCCCTTTTATTGAGTTGTAGGTTCTC
TTTACAGATCATGGATATTAGAACCCTGTCAGATGTGTGATTTCCAAATATATTCTCTCT
TTAAATAGGCTGTCTTTTTACCCTTTTAACAAAGTCCTTTGAGATACAGAAGTGTTTACT
TTTGAAGAGGTCCCATTTATCTGTTTTTTCTTTGTTACTTGTGTTTTGGGTGTAAGATTT
AAGAGACCCCCACCTACTACAAGGTCTTGTAGATATTTCCCTACATTATCTTCTAGGAGT
TTTATGGTCCTGGCTTTTATGTTTAGGTCTTTGATCTATTTTGAGTTGATTCTTAAATAG
GGAGTGAGAATAATTGTCCTCTTTCATTCTTTTGGTTATGGATATCCATTTCTCCCAATA
CCATTTGTTGAAGAGACTGTTCTGTCCCAGGAAAATAGACTTGGTAGGCTTATCAAAATC
AGGGAAGCAGATTTGGCTCAACTGATACAGCGTCCGCCTACCACATAGGAGATCCAGGGT
TCAAACCCCAGGGTCTCTTGGGCCTGTGTGGTGAGCTGGCCCATGCACAGTGCTGATGCA
TGCAAGGAGTGTCGTGTCATGCAGGGGTGTCCCCCGCGTAGGGGAGCCTCCACACACAGG
AGTGCATCCCGTAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTTCATATATCCCTCTTTATTATATGAGGAACTTTCCTTCTATACCTATTTTTTGAA
GTGTTTTTATCAAGACAGAATGTTGAGTTTTGTCAAAGAAAAGAAATAAGTAGGAAATCT
TTCCTTTAAAAAAAAAGTCTTCTTTATTTCCCTTCCCCCCATTGTCTGCTCTGTGTGTCC
ATTCACTGTGTGTTCTTCTGTGTTTGTTTGTATTCTTTTTTTTTTTAATTTCTCTCCCCT
TCCCCTGCCCCTGTTACCTGCTTTCTGTGTCAATTTGCCATGTGTTCTTCTTTGTCCGCT
TGCATTCTTGTCAGTGGCACCAGGAATGTCTCTTTTTGTTGCATCATTTTGCTGCGTCAG
CTCTCTGTGTATGTGGCGCCACTCCTGCGTAGGCTGCTTTTTTCACTCAGGGCAGCTCTC
CTTGAGGGGCACATTCCTTGTGTGTGGGGTTTCCCTATGTGGGGAGCACCCCTGTGTGGC
ACTCCTTGCACACATCAGCACTGTGCGTGGGCCAGCTCACCACGTGGGCCAGGAGCCCTG
GGTTTGAACCCTGGACCTCCTATATGGTAGGTGGACGCTCTATCAGTTGAGTCAAATCTG
CTTCCTTGCTTGTATTCTTATTAGGCAGCTCCAGGAACCAATCCTGGGAGCTTCTGGAAT
GGGAGAGAGGTGATCATTCTCTTGCGCCACCTTAGCTTCCTGATCTGATGCGTTTCTTAT
TGCCTCTCCTCTGCCTCTTTTTTTTTTTTTTAAGATTTTATTTATTTGTTTGTTTATTTC
TTTCCCCTTCCCCCCCCCCCCAACTCCCCTGTTGTCTGCTCTCTGTGTCCATTTGCTGTG
TGTTCTTCTTTGTCCGCTTATGTTGTTGTCAGCGGCACAGGAATCTGTTTCTTTTTGTTG
TGTCATCTTGTGTGTCAGCTCTCTGTGTATGCGACGCCATTCCTGGGCAGGCTGCGCTTT
CTTTTGCGCTGGGCGGCTCTCCTTACGGGGCGCACTCCTTGCACGTGGGGCTCCCCTACG
CAGGGACACCTCTGCATGGCACGGCACTCCTTGTGCACATCAGCACTGCGCATGGGCCAG
CTGAACACGGATCAAGGAGGCCCGGGGTTTGAACCACGGACCTCCTGTGTGGTAGACGGA
TGCCCTATCCACTGGGCCAAGTCCGCTTCCCTGTCTCCTCTGTCTCTTTGTGTTGCGTCA
TCTTGCTGCACCAGCTCTCCGTGTGGGCCAGCACTCCTGCACGGGGCAGTACTCTTCGCA
GGCCAGCACTCTGCATGGGCCAGCATTCTGCATGGGCCATCTTGCCATATGGGCCAATGT
GCCTTCCCCAGGAGGCCCTGGGCATAGAACTCTGGACCTCCTAATGGTAGACGAGAGCCC
AGTTGGTTGAGCCACATCCGGTTTTCCTAATTTTCTTTTCTTGTAGTGTCTTTATGTAGT
TTGATATTAGGGTGATTTTGGCCTTATAAAATGTGTTGGGTAATTTTCCGTCCTTTTCAG
TTTTTTGGAAGATTTTAAACAAGATTGGTGTAATTCTTCTTGAAATGTTTGGTAGAATTC
ATCTGGTAAGCTATCCTGGAGTTTTCTTTGTTGGAACATCTGTACTTGTGATTGGTTTGT
TGAGTTCCTTTATTTCTCGTAGAGTCAGTGTAGGTTGTATGCGCATTTCTAGGAATTTGT
CCATTTGATCTAGGTTGTCTAATTTCTTGGCATATAGTTTCTCATAATATCTTATGATGG
CTTGTGTTCTCTTATCCATTGTCAACCTGTGTTTTTTGACTGGGGAGTATAATCCATTAA
CGTTCAATGTCATTATTGTAAAGGGGCATTACTTCAACCATTTTATCATTTGGCTTTCAT
ATATCATATTTTATTTTTGTCCATCTTTTTACCCTTTTGGTTACCCTTTCTGATAGTATT
CACTTCTACACTCCTCCAGACTTCCGTCTCTTGTCTTTTCTAGCTATAGAACTCCCTGTT
GTGTTTCCTGTAGCGCTGGATTCTTGCTTATGAACTGTCTTAGTTTTTCGGTAATTATAT
GTGAATATTTTAAACTCACCTTCATATTTGAAGGACAATTTTGCTAGGTAAAGAATTCTT
GGCTGACAGTTTTTCTCTTTCAGTGCCTTGATTATAATATACTACTGCACTTTTGCCTCC
ATGGCTTTTTTTTTTTTTTAAGATTTATTTTTTTATTTATCCCTATCCCCTCATTCTTTG
CATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTTCATTTGCAGC
TTACCAATATTTCTTAAAATATGATGAGAGTTTCTATTTTTTTAAAAGTCATGTTTTCAT
TGAAATATAGTCCAAATATTTTTTAAGCTTCATACAGCTCTTCTCCCACCCTTATGGCTA
AATAAGATCACAGTTCCTATGTCCTTGGTAGAAATTCTAGAGCCTGCCAAGATTCTTCCC
ATGGATGAGTACTGGTTAAAATTGGTTTCCAATAACTTTGACATTTATGGCCCACTGGTT
TTTCCATTTAAAAAGACCCTCACAACTAACATGGCAGTATTCCTACCAGCACAAAATATG
GGAAACACAACTTTGACAAGAGAAGTATTTCAAAACCAACATTTAAAATCAAGAATATAT
TCAACTTTACAGTACACAGCACCTAAGCCATGCTGCTGTATGCATCACTTTCTAACATAG
ATGCTGAGGGAGGTGCATTTATACCAACTTTAGATGGGCCTAAGGAAGAAACCTCACCTA
TTTGACTATTTAGTTCAGGGCTGCTTGGGCAAAAACCACAGGGCTTGGGGCTAATGTAAA
AAGAGGCACTTTGTATAAACCAAGATGGAAAAGATGAATCAAAGCACATTTTTCTTTATT
TTTATGGTGGTTTGGGGGCCTAATCTTACTTTTATAACTGAAAAACAGTAGTTTCAGTGC
ACACAGGGGCACTGTGGTCAACAAGCACCGATACCCACAACACTTTCTATACTGCACACA
CTCAAGTGCAGGGCTTGATACATGCCTGTGAACACTGTTTGCTCAGCTGACCAAGGGTTG
CATGATCCTGAGGCACCTCATGTGGAATGGGGTGGGGACCTGGGGTTACTTGTATTTTAA
TGCTGTGATTTATATTATACGGAAGTTTCATGTAATTAAATTTTATATTATTAATTATAG
CCCATAGTTTACATTAGGGACGACTATTCGTTGTACATTTATGACTTCTAAGAATTATTT
TCTGGTAACATGTACAATCTAAAATTTCCCATTTTAACCACTTTCAAGTGTATAGTTCAT
GGTGTTAATTACATTCACAGTGTTGTGCTGTTACCACTACCATCTTTTTCCAAAACTTCC
TATTACTCCAAATTTGCTACTTATTTTTAATCAATTGGTAATTTGTGTGTGTGTAAGGTA
GTAATTTTGTTTTTCCAAATGACTAATTTTGATCCAATTCCACTTGACTGATGGAATAAG
GTTTTTTTTCCTCCCACTTTTGAATTATTCTACTTTGGTAATAAGATACAGTTATTTCTT
GATTTTTTTCCCATGCGTGGCTGAGCTCCCTGTGGCCACATTAATATGTGCTGCAAACTG
CAAAGACACTTCCATCTTTGAGGTGTTATTAAAGGAATCATCTCTGTCTAGTTCTTTTGC
CCCTTTCCATTGGGGTTGCATTCATGGATTTAGGCTAGAACCACTAACCTTTTTGGGCTG
TAGTTTGAGAACTCATATGTGTTGCTAAGTGAATTAAAGGCTCTCACCTTTTAGGGAATG
TGGGAACCGTGGTGGTGGTAGGATGGACTTGTGGAGGTCTGATGCTTTTGAGTTTTCTTG
GGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTAGATATTTTAGGATTGCCCCTGTTTAACCTCTAA
AATCAGGGCTAATGAGCCAGTAATGGAGTGCAGGCCAGTTTCCAAGGACCTTGGAGAGGG
GGACAGTAAAGGCACCCTTTTGCCTCTTGTTTGTTTATTATTATTTCCTGCTTCCTTTCG
TGCACTTTTCTGTTCTGCCAGCAGATGACGCTCTCTGGCAGACCTCTGGGCTCAGACCCC
AGGTGCTAGAGGGGAGTGCTTCAGAGTAATTCCTCAGGAGGGTAGGCTGTGCAGAAGCAA
TGTCCTCAGGGCAGGCCAAACCTCACAAAGAAACTTTCTCAGAAGCTATTCTCCCTTGGC
CTCTGCCACTTTCCCTCCCTCTGCCTCCTCAGCAACCAACCCTGGATAGTAGGGATGGTG
TTTGAGAAGGCAAATTATCTTTAGCCCTCTCTCAGGGCAAATAATGCCATGGTCCTATGG
GACCTGGAAGTGTGTGACTCTTCCAGTTCAGTAGACTAAGTTTGCTGGCCAAAATCTGCA
TTTACTGTAGGCTTTGTCCTTCCCTATCCCCCCCTCTTGGGGGAAGAGGACCCCTGCAGC
TACTTCAGTCTGTAGCCCCTGTAGTCCTTAGACTGCTGTTTGCTCCAAGGGTTGGGGGAT
GGGTGCCAGCAGCTTCTGCTGCAGCTTTACTCAAGGAATTTTTCCATCTAGCCAAGACTC
CTTTCCTTTGCACCTCTCTCTCCAGGGTGGCATCTTGCCTTCCCCTGTAGACAGACTCTG
CCTCTCCTCTAGCTATTTTTTTCTGGAGGGAAGCAATCCCTCTGTGTCTCTTATCTTCCT
AATCCTCCATATTTCTGGAAGTCCCTCAACATAATGTTTTTAAGGATTGTCCTTGTTGTT
GCATTTATCAGTACTTCATCCCTTTTTATGGCTGAGCAACATCATGCTGTATATGTATAT
CATGTTTTTTTGTCCATTCATCCATTCCTGGACATATGAGTGGTTTCCACCTTTTGTTTC
TTGAGAATAATAGTGCTCTGAACATTTGTGCACCTGTATGTATGCAGCATTTGATACTAG
TGAGGTTGGACATTTTCATATGTTGATCAACAATTTGTATTCTGTGAATTAATTGCCTGT
TTATTTCCTTTATTTTTATTTTGAAATTTTCCTTCTTGATGTGAAGGGGTTGTTTATATG
TTCTGGGTATTAATCCATTGTCTATAATATATATATTTTTGATATTTTCTCCTGGTCTTT
TATTTTTTTTCCTTCAATTTGCAGCTTACCAATATTTCTTAAAATATGATGAGAGCATCT
ATTTTTTTAAAAGTCATGTTTTCATTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGG
ACTGTTATTTAGAAAGATGAAAAATAGCTCAAACAACAAGGTCCACCTCATTCAGTTTGG
CCTTACCTTTACTAATGACATCGTCAAAGGCCCTAGTCACCAATGGGTCTATATTCACAT
GACAGGGGGTAGGACTTGAACAAGTCTTTGTGTGCCGCAGGACACTGGGCATTAACAGAA
CCCAAGCCGTGGTTCAAAGGATACACCGTCTACCAACTTGATGTTCCCAAAACTCTTACC
ACCCATTCCCTGACGCCCCTCTTAGTCAAAAGGGCCCCATTAGGAAGGCTTTACTGGAAC
GTTTTTATGTCCAGGGCTGCTTGCTGACACAAACTTTTAGAGAATGAAGTTTGATCTAGA
GCCTTATTTTTAATACCTGGTATGTTTTTTTGTTTTGTTCTGTGTTTTTGTTTTGAGGCA
CGTTTTCTCACCACTGAGATGTTTTTGTTTCTTTTCACCATACAGCAAATGGAAAGGTGA
CAATAGCAGTGTCAGTTCCCTGTGTATCAGCCCAAATGGAAAGATGTTGCTTTCAGCTGG
TCGAACAATCAAGCTTTGGGCTTTGGAGACCAAAGAAGTCTACAGAGTGAGTGATCAAAT
TAGTTGCAAACATGGTAAAGTCTCAGTCGTATAGATTAAGTATAGGGAAAGACAGAACTA
TGAGCCATTGAATAAGTTTCCTAATACAGATTCTTTATTTTCAGTATCAAATAATAGAAC
TAACAGGCTAAAGTTAGCTTTCATGTCTAATTTGTTGCTGTTAAATAGGTTAAACAAGCC
AACTTCACATGCACTGGGGAAAAAAATAGAACAAATAAAAGAAATGTGAAATTAAAAATC
TTTTACTTTCCTGTGATTTGATTGCTTGCATCCATTATTTGGTCTACTTATAATATTGCA
CTATGAAGACTTAGTAATATGTTTTCTGAAGAGTTAAAAAATGTTTTCCTGAGGAGTTAC
TGAGGTTTTGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACCGAGAGCAAAA
TGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACCCAAATACTCCTTTAAAAAATGGAT
ACAATTAAGTGAATCTTTAACTCAAAAATGGAATAAAGGTTGTGCAGTAGGGTTGTGGGA
GTTAGAAGGAGCATGTTAATTTTCAGTGTTTTCTGATGGACTTTTTAAACGGGGAAATAG
AGCATAGATAACCTCAGTTGCTTCAAATTTAATGGTTCTTTTCAATCTGTAGCTCTGCCT
TCAAATATGTAGCATCTGTATCTTTCTTGTGATACTCTTGTTACTACTTTGAATCCATCC
CCTCCTAAATGAGATTTAACTTTCTCTAGCACTTCACAGGACACGCGACGCCAGTCTCAT
CACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTCCTTTAAAATGGATACAATTAAGTGAATCTTTAA
CTCAAAAATGGAATAAAGGTTGTGCAGTAGGGTTGTGGGAGTTAGAAGGAGCATGTTAAT
TTTCAGTGTTTTCTGATGGACTTTTTAAACGGGGAAATAGAGCATAGATAACCTCAGTTG
CTTCAAATTTAATGGTTCTTTTCAATCTGTAGCTCTGCCTTCAAATATGTAGCATCTGTA
TCTTTCTTGTGATACTCTTGTTACTACTTTGAATCCATCCCCTCCTAAATGAGATTTAAC
TTTCTCTAGCACTTCACAGGACACGCGACGCCAGTCTCATCACTGATGTTCACAACCATC
AGACCTCCTAACGAGAGCCAACCCTTTGATGGGATCACAGGTCTTTATTTCTTGTCTGGA
GCAGTACATGACCGGTTACTTAATGTCTGGTATGTAGTCTTCTGGATTTGGGAGGCAACT
TTGCCTCGAAAGAATCTGATAAAGCTTACATGATATAATATAAATGATGATTCTGAGACT
CTCTATATTGTGTTTAAGCTTGGATTTCCTTAGACTTGTAATAAAGAATCCACCTTTTTG
GGAATAATTTAAGGGTATTATATTGCGTCTCCTCTGTGTTTAGAGGTACATGGATTTACT
ATTTTATGGCTGGGTAATTGTAAAAGTTCTCTTTTTCCTTTTTGATTTTAGGCAAATATT
TGATTTTGATATATATGAGTATTTATAACATAATAGCATCGATAATCGTCAAATGTGTAT
CTCTTTAAAAAAATTGATGGTGATGATTCATGAGACAAAATTCTTCTGATCACCTTTAAA
ACCACTGGCTTAATCATATTTCCTAGTTATGCCTCTTTGATCAAATTTAATTAAATTTAG
TTCTAGAGGCTTTAACACTTAAGAAATTAATAATGTCAGAAAGTTACAGTATACCATTAG
GTTCCCTGACATGACCCAGGTACTTCAGTCAAAATGCTTTACCCCTTTGCCTCTTAGTTC
TTCATACCAAGAGGTCTCCAGCTACAAAGTTTCTATACTAGAAATGTTTGATTTCTGTTA
TATTGTAAAGATCCTGAAAATAGTATTTTATCATGTCTTATGGCTTCAAAATAGCATTTT
ATCATGTCTCGTGACTTCTCTTCGTAACAGTAAACTAAATTTAAAAAGACAAATTTAAAA
CCCATGTTGAAAGACAGTTCAACAAGACCATTTGTGAAGCTCTACAAACTTTGTATGTTG
GTGGGTAGAAAAATCTAAAGTTCCCAGATAGTTACCTTTGAAATACACATTCCTGTAAGG
AAGAAACATGTGAAGGTTTCTTGCTATTGAATGAAGAAAAAAAACCACAAAGACCTTTCA
TATTACAACAAGGAGTCTGTACTCCCTCCCCTTGGTAGGCTAAGATAAGTTTCTTCTGTA
CATGGTGGTCTGAGGGTAATGATTTGTATATGCATAGTACATATGACTTCATGTCGATGA
ATGATGTTTTGTTAGGAGTGTATTGTACATGAAGGCATTTAGGGAGGGTTTGTCAAATCA
ACTTTCTTAAGTTTCTTCTAGACCTAAGTTAATTGAGATTGTTTACTGGTAAACATATAA
AGTTCACTAGTTGATAAAATGAACTGACTTTGAATCATGTTTGTAAACTACGTTGTTACT
CAATTTAAAATTTTTTGCTACCTAGATGTATAACAGCTTTATTGAGGTATTACTGACATA
TGTAATAAATTGCATGCTTAAAGTATACAGTTTGATAAGTTTTGACACATGTACACCTGT
GAAACCACCACAGTCAAGGTGATGAATCTATTCATTGCTCTCAAGAGTTTCCTCATGCCC
CTTTGGATTCCCCTTCCCTACCTGTTTCCAGGCTTGTTTACAGTTTTGGGGCAGGACAAT
TAAAGTTACCATGGGCTCTTCTGTACAGCTCTCTATGGGATGTAGGTTCTCATTTTCTGT
TCTTAGGAAATTGTCAAACTTGTTTTCAGTATACCGTTTTGCATTCCCACTAGCGGTATA
GGAAAGTATTAATTCTTTCCCATTCTCACCAACTCTTGGTGTGGTCATTTTTTTCATTCC
AGTAGATGTGTAGTGGTATCTCATTGTGGTTTCGAATTTACATTTCACTAATGGCTAATG
ATGTTGAGGCTTTTATGTGCTTACCTGCAGTATGAATATTTTCTTTGATGAAATGTCCAT
TCAAATATTTTTTTGCCCATTTTTAAATTGGATTCTTGTTGAATTTTAATAGTTCCAGAT
ACAAGTCTGCTTTCAGGTATATACTTTGCAAACATTTTCTCCTAGTCTGTGATTTGTATT
TCATTCTCTTAGTCTCTTTTGAAGAGCAGAAACTTAATTTTGATGTGGTCTATTACATGT
TTAGAAATCTTTGCATAACCCAAAATCACAGGATTTTCCTGGAAGTTTTATAGTTTTAGG
TTTGCATTTAATTCTATGATCACCTTTGAGTTAATTTTTGTATGTGGTATGAGGAATGGA
TTAAAGTTCATGTTTTTACTTTTATCGATGTTAAATTTTTCCACTACCATTTTTTAAAGA
CTGTCCTTTCTCCACTGAATTGCCTATGCACATTTGTTGAAATTAGTTGTTGCTGTGTTT
GCATGTGTGTACCTTTTTCTGGTCTCTGTTTCATAATTGCTATTAAGTTAATTCTCCTCA
AATTTTGATCTGTAGATGCAATGTAATCCCAGTTTAAGTCCCAGCAGGCCTTTTCAATTA
GCAATAATCGTGCCTTGGATAAACCTCATGGACTATGATATTGTTGCTGGGCAAAATTTC
CCAGCAGGCCTTTTTGTAGAACTTCATAAAGTGATTCTAAAATTCAAATGGAAATGCAAA
GGACAGAATAGCCAGAACAACTTCAATAAAGGTGAATGTTGAGCACTAACATTGCCTGAT
TCCAAGACTTAGGAATCATAGTCATCCAGGCAGTTAGTTGGTCTTGGCAGCATGATAGAC
ACATAAATGAATGGAAGAGAATATAGAGTGTGGTTCATTCTTTATACTGATATAGACTCA
TGAATGCTTTTTCTTTTTCTTTTCTTTTTTTTTTTAAGATTTATTTTTATTTATTTAATT
CCTCTCCCCTCCCCTGGTTGTCTGTTTTCTGTGTCTATTTGCTGCGTCTTGTTTCTTTGT
CCGCTTCTGTTGTCGTCAGCGGCGCAGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTG
CTCCCTCCTTCGCGCTGGGCGGCTCTCCTTATGGGTGCACTCCTTGAGCATGGGGCTCCC
CTACGCAGGAGACACCCTTGCGTGGCACGGCACTCCTTGCGCGCATCAGCACTGCGCATG
GGCCAGCTCCACACGGGTCAAGAAAGCCCTGGGCTTGAACCGCGGACCTCCCATGTGGTA
GACGGACGCCCTAACCACTGGCCAAAGTCCGTTTCCCATGAATGCTTTTTCTTTTCCCAA
GTGGTCATGGTATATGGTAGTGAATGCTTCACTTATTTTGATCTTTGGTCACCTTATTTA
GTTTTCAGCATTGGGATTCTAATGCTGTCATCATCCCTTTTAGGTGCTGTCTTCCCCACG
CCCCCCCTTCCTGCCTCTTTAGCTAATCCCAGGTTTTGTTATCTAGGCAGGTCCGGTCAG
AAAATAAAGAAAAGAATGCGGTGATGTCTTTCACAGTCACAGATGAACCTGTCTATATTG
ACCTGATTTTGTCAGAAAACAAAGAAGAGGTAAATGGCTCAATTTTTGGGAATGTTTTTG
TATTTCACAAAGGTTATTTTTTTCAAAGTAAGGTTTGATGATTTAATGACTCATTGGGAA
AGAAGGAGGGGGCATTTGGGAAGACCAATGACATAGAATAAAAGTCTTCTTAGATGTCAG
AGTGACCATTAAATCTGTAAAAAAAGCTCTAATGAGGGGAAGGGAAATTTTTATATGCAA
AGGTAGTACATTTTGGAATTCATTATGTGGACTAATAAAAATTAATGAGGGTGGGTTTTA
ATAGCAACATATATATGATTTTTCTGTTAGGTGCTTCATTTTTGTTACAAAACCTTGTCA
CTTGTAGGACCTAAGGTACATTTTGCTGTAAGAGCAGCATCCTAATGTTTGATGCTTTTT
TATTTCAGAATTTTGCACAAAAATAGTAGATTCTATGTTTGTAACATTTTCAGCATTTAG
CATACCTGACATCACTGCAGTGCTTTCATATTTGTGTTTCTGTTACCCTAAAGGTACTTA
GGATTTTGATTTGGACAGAATCTTAGTCTTTCAATGAAAGTGAAGGCATTTCACTTTAAG
TACAACCTAGGTTTTGAAAGACATGTTGCATAAATCTCTAACAGTAGTTTTTTATTGTGT
TTTAGTAGTTCTGAAAAGTGTTGTAGTGGAAAGAGCATTGGCTTAAAAGATCAATTCTAT
TGCTAATGTAATCAAGGGCAAGTAAACAGATGGAAGAATCTTGGCTTTCTAATGTGAATG
GCTGGTGTGTCAGTGTGGATTATCTCACGGAAGGACCTTTCTCACTTAAGTAGTCCAGGT
CAGATAGTAATAGCATCCGTTAGCTATTTTCAGTATTTTAGAAAAATCTAATAGAAATCC
AACACATAACCATGGTACATATACAATTTAATTGTTTTCAGTACACTTATTATGTCTGTA
CATTCAGTGTAGGTAATGCACCAGTTATCTCATGATGGCTAGACATATTGATCATTGGAA
ATTTCTGTTGTAAAATCAGAAACAATTGAGTATTTGTCCCTGTAACTATTAAAGAAAGAA
GTTGATTTAACTTGAAATGACTTTTTAAAAAAATTGTATGTTTTTTTCCCAGAGGTTCCT
TAAATCCCGAAAGCAAGTGATTTATATAAGAAAAATATCCTCTATTGGAATATGAAAACT
TGCTCAAAGACTGAGTCTTTGTTTTCTATTACTGACTGTGAATTCTTTTGTTTTAAATTT
AATTTAGAGTTTATCTCAGAATAAATTGATATATACTTAAAAATTATCAATAATAAAATG
AAAGAGGTAGGCTTTCTGTTTTTTGTCAAGACTTTTTAAACTTAGTGGGAGTGATGAATC
CTGATTATCAAGAAGGAAGCCAAGTTCTAATTTTGTCATTTTATATAAAATTGTAGTTAT
AGTGATAATTTAAAATAGAAATTCCAGATAAAACCTTGATTCTGATGTTGCAATATATTC
TGCCTGTGTTTCCCTAAAAAGTTATCAACCTATGTAGACATTTTGATGGGACTGAAAGAT
ATCTGTCAGTAGGGGTTGTGGTGGAAGAGGGGACTAGAAAATTTGATGGGGAAAAGTAAT
CTTATCTCACAACTTGCATATGCTGCTAAATGTCAGAAGCAAACAAAATTTTCCTTAATA
CTTTTCCCATTTCTGATATTTCTTATCTTTAAATAAAACAGCAATTACCTGTTATAATTC
TCAAAGTGCTTTGACATACAAAGGGAGCCTTAAAATGTTTTATGTATTTCTTTCTCCCAG
GATATTTGCTGCTGTCTGAATTCTTCCATTACTTTCAGACCTAGACTAGAGACAGCACCT
TTTTGGAAGTGGTGCTTTGAATGTTCTAAGGCTTTCGTTTAAGCTTTCTTAAGAAAACTC
AAAACTTTCAGTTTTGGGTGGTAGACCCTTGAGATGCAAGACCTACAGTGCAGTGTGGGG
TATCCAGGCAGCTGGGTTACTCGAAAGGACCAGAGAGAAGAGGTGACCCCTCCCCCCAGC
CCCTTTTCCCAGCCTTCAGAACAGAATGGCCTTCCCAACAGCCCTGGCTGCTCGGACATG
ACACAGGGCTGAGCACAGAGGCCGGCAGTGTCACTCCATGCTGCCAGCCTCTGCCTTGTG
TGGCTGTGTTCATCCACCTTCTGAGGCTGCCTTCTCCATGACTGTGCTATCTGGGTCTAA
CAACTGATTTAAAACTTGACTATAACAACAGTATTCATCGTTATTTTGATGGCAGTAATT
ATCTTTAATTGCAAGAGTTGTGCATTCTTGCTGTTGTAACCTTTTCTCCGGTTATTTCAA
GGGGTGTGGAGGAGAGGTGAGGGTTGTTAAGTTAGATTGGGGAAGGAAGCTATCATCTGT
GTTTGCTGTAAAGTAATCAGTTACATTTTTTCTTTTAGCCTGTTAAGTTAGCTGTTGTTT
GCAGAGATGGTCAAGTTCATCTTTTTGAACACATACTAAATGGGTAAGTAGGAAGTTTTT
CAAGTTGGAAATTTCTTCCCCTGACTTACTACTTTGTTCATTATTCTATTGCAATACTTT
TTGCATTGTATTATTTTTAAGTAAGGTGGTTTTGAAAGCATTCTGAAAATTCCTAGTTTA
TTTAACTATGTACATTCCCAGTTAAATGTCAAGTTCCTGGAGCTGTGCACCATTTCTCAA
CCTGGTTTTGGTTAGAAGAGTGGCTACTTATGCTATGTTTTTATTAGTGTTGGTAGTTCT
AGTGATGGAATTTAAAAGAAGGTGGCTCAGTTGGAGACTTGCTTGTGGACTTTGGTGAAG
TCTTAATTTCTCTCCTTGGTTGTGCTTTAATTCCCCCTGCTACAAGTATGCATATCAGTG
AAGCATTGCAATCCAAGTGCTTTGGTGGACAGACAGGAAGTGTTGTTAAAAGGTTGAGTA
GTAGTAGTACTAGAGTAGGAGTTGAGGAACTGTGACCTGCAGGCTGTATCCAAAAGAGAC
CTGTGTAGCTTGCAGAACCTAAAATGGTTACTACCAAGTCCAGTAATGAAAAAGTTTGCC
AACCCTTGCAGTGTGTTAGAAACAAATTCTGAGATTTAGTTACGTGCACTATTATGTTAG
AGTTTAACATGATTTCAACTTTTCATTGTCATTTGATATCCTTTTAAAATCTTAGTATAG
GAATTTAAGTAGAAACAAATTATGAAAGTAATATATATATTCATTTTTAAACATTTGGGA
TGCATAGAAGAATTGATTGTGAAGTTTGAGTATCCCTAGAGATAATCAATAGTATTTTGG
CTGGTATTGCTGGGAGTCTTTGTTTACAAAGTCATCTGTAATACGAAGATTTCTTCCTAA
GCAGTGGTAAGCTACTGAAGGAGAAGCACAGGGATGATGGGATTTGCCCTGTGTTTTAAT
ACAGTCCTCATCTCTGTTGAGAATGGACTACAGAGGAGTAAAGGCTGAAGCAGAGAGACC
AAAAATCATTGATAGGGCTGGTTATGGAGTCAGGATCTAAAACAGAAGTGAGGTGGAAAG
TTGGGAGGGACAATTGACTGCTTAAAATGGCAGCGTAGGAGGATGTGCGCTTACAGGTGG
TAAGTGGTGGGAGGGTGTTGAGAGCATGAGGATGGTGCCCCTTAGGTAAGGATGCATGTG
GTCACTGGAGATGGGAAAGTCAAGACCTGAGAGGTCAGGATGCTAGGAGGGTCATCAGCC
TTAATACCAGATACGGAAATCACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCATTGGGT
GATGGCAGGAAGGAGGATGGGTAGGTGGTATCTGGTGACAAGAATTTCTAAGGTTTTAGA
GATAAAGGAGGAAGAGGTCTTTGTCTTGAAGTGCCAATGAAAAACCAGGAGAACTCTTGA
ATCCTGCAGTCAATTGTCCCTCCCAGCTTTCCACCTCACTTCTGTTCTTGCCCCTGACAC
AGTGGTGTGAGGAGAAAAAACAGCTACAGCTTGGGAGGGCTGCTGGGGTGGGCTAGGATA
GAGCAGGAAGGTGAAGGGCACTTTAGAGATGGCATCGCAGAAGCAGTTTTGCGGATGACT
GCGTTCCAGAGGGGCATAGTTGGATTCGGGAGAGGTGCAAGGTAACTGACAGAGTGGGAG
AGAAGGGCAGAATTTGGTGGTGAGGTTGTGAGTGCCATTGGGGTCAGGGAAAAGGCAAGA
GAGGGGGCACTGTGTGCTGGGTACCCCGGTCCACCCCTGATGACGCTGTAGGGCCAGAGA
ATTTGATGTGAACTTTGCAGAATTAGTGTGAGATATTCTGATTTCAAATTCTCTAATCTG
TTTTCCTTTTTCCCCATTTCTAGATACTGTAAAAAACCTTTGACTTCAAACTGCACAATT
CAGATAGCAACACCTGGGAAAGGCAAGAAATCTACACCAAAGCCCATCCCTATTCTAGCA
GCTGGGTTTTGCTCAGACAAAATGTCCTTGTTGCTTGTGTATGGCAGTTGGTTTCAGCCC
GCCATTGAGCGAGTGGTACGTAGCAGCAGCTCTGAAGTAAGACAGTAGAGCATCAAAATG
TCTCTGGAAGAGAATATGTTTAAAACGAACTATTGATTTGCTTAATGGAACACTTAAAGA
ATATATTTTTCTCTAATGAAAGGACTTTTCATCACTGGGTGGTTTTTTTAGTTTGTGAGA
CTTGTATATATTTTATTTAACTCAGTATATCCAGTATTTTTTTGGGGGGGGGGTCTTTGA
AATCTTGGAAACACTTGCAGCACATGCAAGCCAGGTTTTAAGTGCTCAGTAGCTACATGT
GCCTAGCAGCAACTGTCTTAGTGCAGATATAATTTCTGTGTGAATTTTGCCCAGTTACAC
AAAAGTTAACTCTTTCAATAGACGAGTCCTTAGTCGTAGCACTTCTAAGTGCTGCTGTAA
GAGACAAGTACAATGATTTTACATGTTTGATTATAGAAGTTTCTTTGAAGATTCGTTACT
ACAAGCATGTCCAATAGCTGGTGATTTCTTGAAATTGCATTTATTATACATTTATTCAGT
AGGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAATTTTCTTTTCTTGTAGT
GTCTTTATGTAGTTTGATATTAGGGTGATTTTGGCCTTATAAAATGTGTTGGGTAATTTT
CCGTCCTTTTCAGTTTTTTGGAAGATTTTAAACAAGATTGGTGTAATTCTTCTTGAAATG
TTTGGTAGAATTCATCTGGTAAGCTATCCTGGAGTTTTCTTTGTTGGAACATCTGTACTT
GTGATTGGTTTGTTGAGTTCCTTTATTTCTCGTAGAGTCAGTGTAGGTTGTATGCGCATT
TCTAGGAATTTGTCCATTTGATCTAGGTTGTCTAATTTCTTGGCATATAGTTTCTCATAA
TATCTTATGATGGCTTGTGTTCTCTTATCCATTGTCAACCTGTGTTTTTTGACTGGGGAG
TATAATCCATTAACGTTCAATGTCATTATTGTAAAGGGGCATTACTTCAACCATTTTATC
ATTTGGCTTTCATATATCATATTTTATTTTTGTCCATCTTTTTACCCTTTTGGTTACCCT
TTCTGATAGTATTCACTTCTACACTCCTCCAGACTTCCGTCTCTTGTCTTTTCTAGCTAT
AGAACTCCCTGTTGTGTTTCCTGTAGCGCTGGATTCTTGCTTATGAACTGTCTTAGTTTT
TCGGTAATTATATGTGAATATTTTAAACTCACCTTCATATTTGAAGGACAATTTTGCTAG
GTAAAGAATTCTTGGCTGACAGTTTTTCTCTTTCAGTGCCTTGATTATAATATACTACTG
CACTTTTGCCTCCATGGCTTTTTTTTTTTTTTTAAGATTTATTTTTTTATTTATCCCTAT
CCCCTCATTCTTTGCATTTGCTGTCATTTGTTGTGTGCTGGTCTTCTTGTTTTTGGAAGC
ACAGGGAATCAAACCTGGGACAGACCTCCATTGTGGGAGGGAGGTGACTGATTGCTTGAT
CCATTATGTTTTGTTGTGTCATCTTGTTTCGTCAGCTTGCAGCACAGCCGTTTTGTCAGC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTCACAAAGAAACTTTCTCAGAAGCTATTCTCCCTTTGCCTCTGCCACTTTCCCTCCCTC
TGCCTCCTCAGCAACCTTTCCCTGGATAGTAGGGATGGTGTTTGAGAAGGCAAATTATCT
TTAGCCCTCTCTCAGGGCAAATAATGCCATGGTCCTATGGGACCTGGAAGTGTGTGACTC
TTCCAGTTCAGTAGACTAAGTTTGCTGGCCAAAATCTGCATTTACTGTAGGCTTTGTCCT
TCCCTATCCCCCCCTCTTGGGGGAAGAGGACCCCTGCAGCTACTTCAGTCTGTAGCCCCT
GTAGTCCTTAGACTGCTGTTTGCTCCAAGGGTTGGGGGATGGGTGCCAGCAGCTTCTGCT
GCAGCTTTACTCAAGGAATTTTTCCATCTAGCCAAGACTCCTTTCCTTTGCACCTCTCTC
TCCAGGGTGGCATCTTGCCTTCCCCTGTAGACAGACTCTGCCTCTCCTCTAGCTATTTTT
TTCTGGAGGGAAGCAATCCCTCTGTGTCTCTTATCTTCCTAATCCTCCATATTTCTGGAA
GTCCCTCAACATAATGTTTTTAAGGATTGTCCTTGTTGTTGCATTTATCAGTACTTCATC
CCTTTTTATGGCTGAGCAACATCATGCTGTATATGTATATCATGTTTTTTTGTCCATTCA
TCCATTCCTGGACATATGAGTGGTTTCCACCTTTTGTTTCTTGAGAATAATAGTGCTCTG
AACATTTGTGCACCTGTATGTATGCAGCATTTGATACTAGTGAGGTTGGACATTTTCATA
TGTTGATCAACAATTTGTATTCTGTGAATTAATTGCCTGTTTATTTCCTTTATTTTTATT
TTGAAATTTTCCTTCTTGATGTGAAGGGGTTGTTTATATGTTCTGGGTATTAATCCATTG
TCTATAATATATATATTTTTGATATTTTCTCCTGGTCTTTTATTTTTTTTCCTTCAATTT
GCAGCTTACCAATATTTCTTAAAATATGATGAGAGCATCTATTTTTTTAAAAGTCATGTT
TTCATTGAAACGATAGTCCAAATATTTTTTAAGCTTCATACAGCTCTTCTCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAGGAGACTTTGAGGGTGAGGGAACGATTTAGCGTGGTGTTCGTCCCTGGGT
GTGTATGCCGGGCTGCTTAGTCTAGGCTTCATATACATGTAAAAGAAAAACACCTCTGCC
TTCCGCGTCCTCCCCTTGGTAGTTGTGACTGTGGTTGATAGGGTTGTTTCTTAGATCCTT
GGAGTCAGTCTAGCAGTGATGGTGACTCCTCCCTCTGTCAACATTTTGTTTGGTTTGGGA
TAACTTATGCTTTTTAATCTTAAGTTTGAAAATTATTATAGTACCTGAGTCTTCAGTGGA
TATCCAGATTACCCTGGGGTTTGTTAAAAAATCTCCTGCCCCATAGTTTGGGGTGACTTC
TAAATAGCAAGACTATATATATATTTTTTTTATCTGGAAGTGATAATTCAATAGTACTTG
ATGCTTTTGGAAGAACCTTGATGATGTAAAGATAGTTTACAAGCAAATAAAAGCCATAGG
CCATTCTGAAAGGCTGCATTAGGAACTGTAAAGAGAGGTTGGAAACTAGTTTTCTACACC
TCTGCCCTTCAGTGCTGTCCATGCATGTCTTTTCTAGCAACAGCCACCTCCAAGGCAGCA
CACACCCTTAGGGAGACCCTCAAGGAGCGGGTGTGATAGATTTATTAAATAATAAACAAT
ATAGTGTGGACTTAGTAAGGGGTCTGGGTTTTTCACCTGACTGGCAGAGGTGTCTGGGGA
ACAAAAAAGGTTTAGAACCCTGGGTTTAGAGGCATGGAATGGGCTGCCTGAGAGGATGCA
CGCAGCTTCTCAGGGCCAGGCCTGAGCTTCAGGTGGGGTTTCTCCCGTAGCTTCACCCTA
AATGCAGCGTGGTTTTATCCAAACATTCATGATAGTTTAAAATTTTATCCAAAAGTTGAC
TATTTAATAGATCATTGCTTTCCAAGTGTGACTTCACTTTGTGTTTTGCCCACTCTTAGG
TGGACACTTATTCAATTTTACAAAATGAAAATTTGGAGATTTCTAGTCTTTTAAGTGGTA
TATCTGTATTTATATGCCTGGAAAAGTTCTTGGCATTTTATATAAAATATTGGTTCTAAG
AGACTAGAATTTGTGGAGAAATAACCTGTTTATTGAAGGAAATTTCTCGATAATAAGATA
TAACATCCTCCAATCAGTCCCTCCAACTTCTGTTTGCTAAAATTCAGTTGGTAGTTTTAT
TTATTGTCTTGGTCTTTTTAACCATCTTTACAGCTTTTCTTGTAGTATCCTTAGCTTCTG
AATATACTTATCATAATATTCCTTTTATTTTTTCACAGAAAGTACTTCAAACTAAGAATT
TAAATCTCATAAAGAAGACTGTCTTAAGGATGCCCCTGCATGCAGTTATTCCACTGTTGC
AAGAGGTAACCACGTGCTCTTTTATTTTAAGGTCCTGCTGGAATACTAAGGATTAAAGAT
AGAGTCCAGCATTAGAGAATTGGATTTGGAATGTATGGCATTTAGAGTCGATGCTAGATG
CCAGAAGAGAGAACTCCTAAGTACTTTAGAGACACTGGTGATATGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACTCCTATATAG
TTTTCCCCAATTTATTATCAGGCTACTGTATAGTGCATTTAATAACTAAGCCTTATGATA
TGTAAAATTGTCATTTATAGAACTTGTGTGACTTTTGGTAGCTGCTTAAATTGCTTTAGA
GGGAAGGTTTTTGCTGTTTTTTATTGTCTCTCCTCTCACCCATGAAGAGGTTAGTACATA
ACATAGATATCAAATGGACTCTGAAGGAAAGAACTGTTACATTCACAGTAGTATTATTCC
TGTAGGCATCTTCACAGAACACAATTGATAGAGCATCACTTGACCTTACTGGACTTTTCA
GAACTTTACAACTGAGATGTTTCATTTTGAATTAGCAAGCACTAGTTTACTTGGAATTTT
TTTTTTTCAGTGCTGTGTTAATGGTTCAGTGGCTGAAATGTGTGTTGACGGTCCATGCAT
CATACTTATCCACAGTAAGTCTTTTCAGCTCTGGTTACGTAGTAGGAATGCTTTGACCTG
GATAAGAATTATAAACTTGTGACTTAGCACCACCATCCCCTCTCCATCTGTCCTTTAAAC
CATAGATGCTTCCTTTAGAGATTTTGTTGTGCTCCTGGTGCACTGACATGAACCCTTTTA
TATTGTCACCATAAATTGCCTGCTCCCACCTCACCCTTTAGATTTTAAAGGAATGTATAT
TCCACAGAGAACACAGAAAGGAGAAAAGTTAAATATTGCTACCTTAGCCTTCTAATGGTT
TTCTGTGTCTACTACCTTTTCAGCAAAATTGCTTTTACATTGTATGTGTCCCTCTTGTCC
ATTTTTAAAAACTTCCCAGATTTTAAACATTTACATACACACTAACGTGTGTGCCCTACC
TTGTTCCAGGAGCATAAAAGGTAGCTTGTGAGGATATATGAAACGACAGCTCACGTTTTG
CTGGGGCGGCTATTAGCTGTCAGTGAACTATGCAAATGGAGGGAGGGGGCATAAAATCTT
AAAACACCAGTAAAAGCTAATTTACGAGTCACAATGTGAGTTGGGTTCTTTGTCCCCACA
TCATTGTGTCAGTTATATATTAAGCTAGAAATAAAATTATACAATCCATAAGTGTATGTG
TGTATGTATATATGTGTGTGTATATCTTTGATTTAATCATCTAGCACCTATAACAGATTT
TCTTAAAAGGTTGTAGGGGATAGTTGAAAAGAATCCTTTCATTGCTGTTTAACCTGTAGT
TCTTCCTTCTTCACACAGTCCCACCCAGCCCTTGCCTGGCCACTTTCCTTTGTTTTATGC
CTCGGACTCTTTTTGTCTTCAGTAATAGCAAATAGGGGAAACTACTGGATAACCTGCTTT
GAGGTCAGCAGTTTGTTTTTTGTGTGTCTGGGGAATGAGCTCTCTGCTGAGATGTTAGAA
TGAGGATGAGCCAGGAAACTGAAGATGAACGTTGCTTCTTGCGGTTTGTAGGAATCTTTC
TTGGGAGATGGAGATTGGAGGCACTGGTGGGTGGAGTGACTGGTGGCATAGGGTAGGGGA
AGGTCCCAGCAAGCGTCAAGGCTTGGGACTCTTCCTGGGGAACAGGCAGACACTCATTTT
ATGGCCTCAGTTACTTGCTTGGAAAGGAAAAGAGGCCCATGAGGCCTTGTGATGAGACCC
TCCGGAATCGGCTCCTAGGGGAAAGCTGCCAGAGAGTAGTTTTGGAACATTCAAGGTCTG
GTGAACAGATCAAAGAAAATGTGGTATAGGGAAGGACTCTGCTGCCCATAACAGTTTCTT
TTGCTTCAGAGAGCAGCACTTACCCTTCCTTTTCTCCTTCAGTTCTTCTTTCCTTACACA
CAAATCTTGAGTCCCTCCTCCAACCCACATGCTGTTGTAGGCACTTAATAGTATACACGG
CACTCTCATCCTTGTCTTCCTGGAACTTACAGTCTGAGTGGAAAAATCAAAGGAAGATGA
TGGTAAACTGCCATGTGATAACACTAAACCTTGTTTTATTCTTATTTGTGTCTATTTACT
GTGTAAAGTTTATTAACATTTAAACGAAGTAATTTATGCTGAGGTGTCAGAAAGTCAAGT
AAAAGGTAATTAAAAGACTGAATAGAGTCCCTTTGTGGTAGCTCTGGAGGGGCAAATGAA
AAGATTTCCTCCTTTAATATCTTTACCCTCTAATGGTTCACAGGTTTCATTAATCAAGAG
TGTGTTTAAAATACTACAATGTCAGCTTTGTACTCCATATTTCCGGGTCCTTTTCATGAT
ACCTGGTAGAGAGCTTCCCTTAGCTTGTTGGGATCTTGTGGCAGGTTAGATTTAGAGGAA
CCCCTCTTTAGTTCACAGATACGTGGTGTGATACATTTTATCTATTTTCTATCGACCCTA
TCTGAAATAATTTTGATCAATACAAAGAAGTCCTACCCTGCATTTTGTCCCTCCTGATCT
TGTATTATTTTTAAAAATATGTTACTTTTTGCTGTGTGGACATTGAGGCCTCTGTGAAAA
TTGTAGCTGTTGCCAGCCTGTGCTGCCGGCCAGCTACTGGCCTGGAAGTGTTATTGAGCA
GATGCTGAGTGGTGCTGTGTGGCTGAGCATGCCTGTGTTCGCCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCAG
AAGGCAAAAGTTGGTGTACGAAGAAGGTAAAGAATGAGGCTCGGGAGGAGTCTAGAATTG
GAAGGAGTATTTTGATTTTTGTATTGACTCAGTTCTCTTTTCTTTATTTTATAAAAACTT
CAATCATAGTTTGGCTCACCTCCTCTAATGAAACAGGCAAGCAAGTAGCCAAAATAGGCA
AAACCTGTGCTCTCATAAAAAAGACAGGCACAAATACAATACAGTAACAAAAAAGGCTTT
AGGTACGGAAGAGCTTCAACTAGACTACCATGATGAATACACTTTATGCCAATATGTTTA
AACTCCTAGATGATAGGGAATTTCTTATGAAACTTTAATTACCAAAATCAACTTTAAAAA
AATAGAAAAGTTGGTTAAATAATAGCTTTTTAAATTATTTCATCAGAACCTCTCATCTCA
AAAATACCATGCCCAGAGGTTTCACAGGTTTATTTTATCATGTTATCCTTTCATATACTG
TTTAGAAGTTTTATGCCTCAGGTGCACTAATCTTGTTAACCAAACCAGATAAAGATGGTA
AGAAAACTTTAGACCAAGCTCAGACATCCTTAGTAGTAAATTGAATTTTGCTTTGTAAGT
GAAATAATATGTTTGTTAGCAAGTAGAATATATTTACAGATTGTAAGATGATTTAACATT
AGGAAAGCTACAAATGTAGTTAGGACATTAACACATTAACAGGAGAAGACTAAAATATCT
TAATATAGAAAAAAATCCATAAAATTCAGTCTTTGTGCATCAGAGATAATTTCAGCAACC
TAGGAATTAAAGGGAATTTCCATACTTTAAACCTACTTCAAACATACGTAATGATTATAC
TTGAGAAACGTTTGCAAAACAATAATTTACTTTTTCTTGCTTTTATCCCTTATTGAACTG
GATGTCCTTCCTAGTACCATATGAAAGGAATACATTTTAGAACGTTGGGTTTTACAGATA
ATATGGTTTCTACATAGACAAAGAATTTAGTCGTACCATTGTTAATAACAACTATGTAAG
TAAGCAAATTTTTTGGATACCAAGATCAACAAAAATAGGAGTATTAACTAGTCAGAAAAT
GTATTAAGAAAAAGATGTCATTCACATTTTGCAGTCAAAGCTATGAAATAATGCATGAGT
TTGGATTTATGGCAGGCCCGTCCCCCTGAGCCTGTCATAGTGTCCCATGCTAGAGCAATC
CGTGGCCCTGAACCATTGCCTGGCCTCCTTGTCTATGGGCCTTGGCACTGAAGCGGGCTG
TACAGTGTAATAAAAGAACAAATTGTGACATACCTAGGAATATATCTAAAAAATGAAAGC
CTTTATAGAGAAATAGGAAACCATAACTGAAGGCTATAAAGGTATACCTGAATAAATTTA
AAGATAGGCCAATAACCACAAAAGAGAGGATTCCATATTTTAAATTTCTGTAAGGTGAGT
ATTTTGTTTAGTTGGGGGAACAAAGGACCCAGAAAAATTATGATTTAGGTATGAAGACTC
AAAGCTGGAGCGCAAGAATAGACCAATGGGCCAATATTAGAATAATTACTCTGAAAACCC
ATTACCTGTGGAATCATGGTGCAGTGACATTAGGGCATGTTTTATATCAGCAAATAAAGA
TAGCCTTTTCTTGCACTGAATGTGTTAAAAGAAACTTAGTATTGGAGGATAACAGTCACA
TGAGCCTAGGATACATAGATGATTTCTTGGGACAAACACCTAATAAATATTTACAAAGAT
AAGCCCTCTAGAGAAATGCAAATTGAAACCTCAGTGAGATAATGCTTCATACTCTGGTAA
AGTTCCTAAATAGAAAAGAGTTGGTGGAGGGGCAGGGAGCGGATGTAGCTCACGTGGTTG
AGCACCTGCTTCCCATGTACGAGTCCTGTCTTTGATCACTGGTGCCTCCTGAGAAAAAGA
TTAAAAATATTTGGGTTGGCAAGGATTTGGGGAAATGGGAACCACCTGTATGTTGCTTGC
TGGTGCGAGTCTGTTCATTCTTTTTAGAGAGCAATTTTGTCAACTTAAATAAAGTTGAAA
ATTTGCATGTCCCTCCATTCAGCAGCAGTCCATCTAAGAGTGTCCTCTTATGACTGACAC
TTGTCAGACTTTAAAGAAGTCTGACATATAAAGTCAGACATTAAAGAAGTCTGCAAAAGA
TAAAACAGTATTACTCTTCTCAGTAAATTTGTTTTGGAAAGTACTATTTGTAAATGAATA
AATATTTAAAATTTTTGGAAAATATATTTTAATTTTTAATGTGATCAGTATTAGAAGACA
ACCTACATAAAGCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTTTATTGGTAAAAAGAAATCAGGTCATGAAATGCTGTTTTCTATA
TAGTAGTATGAAATGTGCGTGTGTGTGAATACACATAAAGTTTGAAAACATGCAAAACAA
TGACGGATATTTTTAATGAATGTACACATGTATTCATGCACGTGCATTATATTTGTTGTA
CAACAGCCCTACTTGGGAAAACAATAAATTGAGGAGAGTGGTTTCTTTTGGGAACTAAAC
TGAGGGTGATGGGCATCTAGAGGGCTTCATCTGTGTGTAATGACTTATTTTCTTCAGTAA
GTAGAGGAAGAATGTTAGGAATTGCTAACGTGGGTAATGTGTGCACAGGTGCTTGTTTCA
TTTTTAAAGACATTATCATTTTCTATTTTCTACATCTATCTCTTAAAGAAATTAGTACCA
GTGATACACCCTGAACAGATAACATTAGCACACCTAACAAAATTAGTTTCTTAATTTCAT
CCCATATCCAGTCCACCTTCCACTTTTCCTAGTTTTCCCTAAGATGCCCCTTAAAGCTGT
TTTTTCCCCAATCCTAGTATCCAGTCTTGGCCCATGATGTTGAGTCTGTTGCTGTATCTG
TAAAGTCTCCTAGACCTTAAGAGCCTCTTGTTTTTCATGACAGACTTGCTGCAGAGGCTG
TTCCATGGAGTGCCCCCCTGCCTTATGGATTTTCCCAGTGGCTCCCTGTTGGTGTCATTT
AGTTTGTTCCTCTATAAACAGGAAATCCGGTCTAAAGCTGCAATTGGATTTTATGTCATA
GACTGCATCGGTGCTGGTGTGTTTGCAAAGTGCATCACACCAAGAACCCCGTGCTTCTTG
TTCCTCCATTAGTAGTACTAAGATGGTGCCAGCCTTTTTCTCACCATCATTTGTTGTAAA
CAATCTAGCCGTGCTACTTCAGCATGTGAATATTTTGTTTCCCACTATTCAGCTAATGAT
TTTAATACCAATTGATAGTTTCTCTACAACCAGTGCATTCATTATGGATTATTTTTTTTA
AGATTTATTTATTCCACACAACCCCCACCCTCCCCGTCTGCTCTCTGTGTCCATTCGCTG
TGTGTTCTTCTGTGTCTGCTTGCCTTCACTTTAGGTGGCACCAGGAACCGATCCTGGGAC
CTTCTGGAGTGGGAGAACAGTGCTTAATCTCTTGCACCACCTCAGCTCCCTGGTTTGCTG
TGTCTCTTACTTTCTCTCCTCTGTGTCTCTTTTTGTTGCATCATCTTGTCGCACCAGCAC
TCCACTCAGGCCTGCTTGCCATGTGGGCCAGCACTCCTGCGTGGGCCAGCTTGCCTTCAC
CAGTAGGCCCTGGGAATTGAACCCTGGACCTCCCATATGGTAGACAGGAGCCCAATTGTT
TGAGCCACATCTGTTTCCCAATTATGGATTCTTAGTTCTTCTATTTCTTCTACATTTATA
GGCTACTAATTTTTGGTAGGATTTTCCCTCATCAGCTGGGCCTGTTCAGTGACCCAGAAA
TGGCTTGGTTTTTAAAAATGAGGTTTTTTAAAGGTTTTGTTATTTAGTCCCTTTTAAGGA
CAGTTTGAAGGAATATCATAATAAATGTGCTTTTATGCAGATAAGAATATTTACTTAATA
CTTCTTATTTGGATAACAGCTGAATATGGTAGTATTTCTAAAAATAAATTCAGGAATCTG
ATTTTGTTTGATTTTTCAGGGCCAGGCCCTCTTCCTTGTTCACAGAATTAAAGCTGTGGG
TTTTTTCTCAACAGAATCTTCTGAAGAGGAGTCTGATGATGAAATAGCAGATAAGGATTC
TGATGTAAGTAATTTGTTTCCTAGTACATGAATCTGCCTTCATAACCTCTCTTATCTATT
AGAAAAGAGACCTTTACAAATACTTTCCTTGCCTAATATTTCTACCAGGATAACTGGGAT
GAAGACGAGGAAGAGAAAGAAAGTGAAAAAGATGAGGATGTTGATGAAGAGGAAGAGGAG
GATGGTGAAGAAAAAGATGACAATGGTGAGGACAGAGATGTGGCAAGTGAAAAAGAATTA
AATGGAGATTCTGATTTAGATCCTGAAAATGAAAGCGAAGAAGAATGAAGACAGAAAAAT
AGCCAGTTGAACTGTCTGAACTCTGGCTCACCTTGCCCGATACTGCCGAGTTCTCCTGGG
GAGAGTTGTTGGCTCTGTGCCAGGAGGCCAAGGACCGATGCTCATTTCCAAATTCATGGT
GGTGGTTCCTGGGCCACCTTGCTGTCCTGACCATCCCAGACATAACTGTGTAAATAAGAG
TGTTTCATTCAAATGTTAATAAAACTTTACACAGTAAATAGACACATTTTCTGCAATGTA
CTGACATGAGTGTCTTGATATATGGTATATTTTTATAATATAGCCTAGTACAATTGGTTG
TATCAAGGATTGACTGAAGTGAAGAGAAAGAGACTTCCTGTAGGGGTTCAAGAACTGAAC
TGTTGGGAAGGCATCAGCTCTTATCTCAGGTTGGTATCTTTCGTCAAATCCAGATGTGAA
GCAACACTAGTCCAAATATAATTTGGTCCATTTTCATAAAATATGAGGGAATGAATAAAA
ACTGCGTTTCAACAAAAAATCACCAATATCTCTAGCTTGTCTATTAACTGGTGATCTGAC
TTGAGTCAGATTGTATGTTTGAAGTGCTTCCAAAAAAGAACCACATATTTTTTAAGCTGT
CATGTGAATATTTTTTTAAAACAACAAAAAAATTATGGTAATTAAATATTCTAAAGAGTT
AGCCATATTAGGGGTTTTTCCTGACCGTAAATTGCCAATAAAGAATTATCATTGTATAGA
TTTATAAGTGCACATTACCTGCAACTTAAAAAAATTCTGTGAGAGCTGCTTTGGAAGAGG
TTTTCATTTTTATTTAAATTACTAATGGATCAAAGAACAATTCTTTATTTTTTCTCTTTG
GTTTTAGATATTAATGATAACCTTGTTGGAATTTTTCTCCAAAGAAAATATTTTTATAAT
TCAGTAATTTAATGTTTTCCTTCCTTTTCATTACCCAATCTTGGCAGTGTTAAGGTTATC
TGTTTACCTTTAAAATAATAACTGACTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1291, 9780..9917, 13681..13802, 30585..30705, 32589..32732, 35930..36028, 38438..38502, 40463..40634, 41267..41353, 41454..41585, 41686..41817, 65018..65104, 66089..66120, 67330..67393, 69902..70015, 70395..70447, 70449..70465, 75074..75123, 75228..75407
1001..1291, 9780..9917, 13681..13802, 30585..30705, 32589..32732, 35930..36028, 38438..38502, 40463..40634, 41267..41353, 41454..41585, 41686..41817, 65018..65104, 66089..66120, 67330..67393, 69902..70015, 70395..70447, 70449..70465, 75074..75123, 75228..75404
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved