Dasypus_novemcinctus Locus TRFP
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus TRFP
Dasypus_novemcinctus
TRFP
GeneScaffold_2728
SNORA42
8434..8554
10803
GGGCTCGTTTTCCCATTCCATCACTTTTTTTTCTCTCTCTCTTTAATTTAAAAAAAAAG
TTACATTAAAAAAATATAAGAGGTCCCCATATACCCTCCACCCTCCGACACTTTTTAAAG
AGTGTAATATGGACCGCTTTTTTAAAATTCCCAACTACTCCTCTGCCAGACACCTTTCAG
CCATTCGTCCATGTATCTACCCTCTCCTGCGCGCCCCATTCCCGGCAGCTCACCCAGCCG
TGTGGTGCGCTCCCTCGGCGCTGTGGGCCTGTCCCCAGTGCCATGCTCGGCCTCCAGTTC
CTCCTGCTGCTGCCTCGCTTGTTGCAAAATCCGTCGGGTCAGTCGGGGACCTACATACTC
TTCTTCTTCTCCGGTTCCGCGGCCCCGCCGCTTTTCCCGGGCCCCGGCCCGCACGGCATC
CCCAGCCAGGATCTGATCGGCCAGGGCGCATGTTTTCTTGACTCCCGGCCCCCGAGCCGC
CTTGAATTTAGGCATTTTTCTCGAAAAAGTTGTCGCGGTGATTACACGTGGGGACGGGAG
ACGAACAGCCCAGAATACGCTTGCGCAGTGAACTCCCAGGTCGTAAGAGGCCGCGTGGGG
AGTACAGTGCCCCCAAGAGGTCGGAGGATAGAAGTGCCGTCAGTAACCTCTAAAAGAGCT
CCCAGGCCCTAACAATGACCGCTTTAAGTGGTGGCAGTCCGAGCCACGCTTTCTTCGCAT
CATGGACCCAACGATGGGGAGCCCAGCCAAATGGAAATTTCCGTAATAGCAAGCCTGGGG
ATGAGAGTAGGATGGATGACATCACTAGGGACGCCACCGAGAGGCCGCCCGGGCACGCCT
CCATAACTCACTGCGCTCGCCCATGGGGCGCTCTATATTTACGTCACTTCCGGCGCTGTC
TCGCTAGACCGAAGCTTGCCTTTGGAGTCTTCATTTAATGCGGGCGGCCAGCTAGTTCCG
TCGTTCAACTGTTTGAATCCTCCACCCTGTTTCCCGACGCTATGGGAGTGACTTGGTAGG
ACTGCAAGGACCGTTTGGGATTGTGTGAGGCGGGTTTTGGGATCGTGAAGGGCCCTTGGA
GCCCGGCGTGGACCCGGGAAGGAGTATCGGGACTAGGGTTCTCCGTTCCTCCGGGGATCT
GAGCAAGATGCCACCGGGTTGTGTGGGTGAGGGGATACCATGAGGGTTGCGGGTTCTCCG
GGCCTTTTTCTTCGGAGATACGCTCCTTTCTCCCGGAATGCGGTAGGTAAGAGGTTTTAA
TCCCAAAAGTCTGTCAGTGGTTTTGTACCTCATTCCTTTTTTCTTCGGGAGTTCCAGTTG
CGTCACCCTTCAGGACGTGTTTCCAGCTATGTTAAATTGTAAGGTTCCTCTTCTTTCTGT
GGGCCTCTTATCTCTAACATGTTGTAAGTCACAACTGGAAGAAGACAAGGTGGTAGGGAG
AGGTGTGGGCCTAATGCTCTTGGAGGTGTTAGTTCCAGAATGCTAGGTTTTGGGACATTA
AAAAAATTAGATTTAAACGTTTCCAGAGAGAGCTGGAGGTTAGGATATCTGAAGTCATTG
GCATCAAGGCTTCTTTTATAAAAACCTGTGGGAAATACTTTTTCTCAGGTTCTTACAGGC
TTGTCAGTGATTTTTTTGCCCATGCTTCCCACAGTTGACATCATCATCTTCCTCAAAGTC
CTGTAGAGTTAGTGTGTGAGGGATGGGAATGAAAAGTTTGCTCACACAGACTTTAAACCC
TGGAAATCCCTTGTCTTTCAGTACAGATGGCATCCAGAGGGAAGGGCTTTCTGTCTGTTG
GGTCCCTTACCATCTTTTTCAGAATCTTAGAACTTCCTTCCCTTGTAGCATTAGTTTTTA
GGGGTCCTCTTTTGTGTAAAAATAAGACACATCACCATTACACATCATTGCTATTTATGA
GACAGTAGTGACAGTTTTTAGTAACAGTACGAACTTAATAGCTTCATTTAATTGATGGAT
CATAAAATAATCCCAAAGTTCAGACATATGACTGTCTTCATGATTTGCCATAGCTAAGTA
CGCCTGTACTATTATTTATTACAATTTTTAAAAAATCATGGGTTCTTAACCTTTTTTGTT
CCATGGACCCCTTACTAAGTCTACAGTATACTGTATATTATTTAATATATATATCACACC
TGCACCAACATGTCCCCATAAGAATGTTTTTTTTGAATTTCAGTTCAAGCTCACGGACCC
CTTGTTAAGCACCCCTGTTTTAAATCTATTTCTTGAAAAGTTTTTTTTTTTTTTTTTAAC
AGACAACAGCATTCTTAGAATATGTGACCTTGGGCTAGTTATTTAATCTCTGGGTACCTC
AGGCTTCTCAATTGTAATAAGGAGATAAATAATAGTACCTCTTATAGGGCTTTTTCTTTT
AAAGATTTATTTATTTCTCCCCCTCCTGCACTCCCGTTGTCTGCTCTGTCTGTCCTTTCG
CTGTGTTCTGCTTGCATTCTTGTCAGCAGCACTGGAAATCTGTTTCTTTTTGTTGCATCA
TCTTGCTGTGGCAACTCTCCGTGTGTGCGGCGCCACTCCTGGGCAGGCTGCACTTTTTTC
GTGCGGGGCGGTTCTACTTGAGGAGCGCGCTCCTTGCGCATCTGGCTCCTCTACGTGGGG
AACACCCCTGCCTGGCCTGGCATTCCTTGCACTCTGTGCGTGGGCCAGCTCACCACATGG
GCCAGGAGGCCCAGGGTTTGAACCCTGGACCTCCTATGTGGTAGGCGGATGCTCTATCAG
TTGAGCCAAATCCACTTCCCTCTTACAGGGCTTTTGTGAGGACTTGAAAAGTTAATTCAT
ATAAAGAATACTGCCTGGCATGTAGTAGGTACTTGGTAATTGTTATATATTACTCTAAAG
GGGAAGCCAGTTCACTCACCCTCAAGTAGAGGGAAATTTGAAATAACATTTCATTTTCCT
GTATTGATTAAATTCTTGTAGATACTGGTGCTCCCCACTCCCAAAGATTATAAATTTGAA
GCCTGCTTTCTCTTTGTTCAAGGCTGTCAAATAGAACTTTTTGAGATAATGGCAATATTC
TCTGATATACTATCCCCCAGCCTCATGTGTCTATTGATCCCTTGAAATGTGGGTGGTGCA
ACCGAGGACCTGATTTTTTTTCATTGCATTTGCTTCATTGATTTAAATATCCACATGTGG
CTCATTGCTACTATACTGAAAAAGTTCAGTGTGTTATAGAGTTAGTAAAAATGTACTAAC
CCCAAATTGAGATCTTCTCCTTGATATAGTCGGAACTGAAAAAACTGCAGTGGCAATCCC
TTGCTCTTTATATGATTTGATATTATTGACTGCTCAGTCTGTGTACTACCTAACATCTTC
TCTTGCTTGGTGACACAGTCAGGGTCAGGAAATGCTGGTGTGATGGGAAGTTCACTGCAC
TGGTGTGAGTCCTCAAACCTGTGCTCTAGTTCTGAAGGATGCTGTGAGTGATTGCATGAC
TGAGCTAGTGCATGTGTATCTCTGGATGCTGATGATTTGGTCCTTTCCTTCCAGTGTGTC
CCAGATGCCTGTGGCTGAGGGCAAGAGTGTCCAGCAGACTGTGGAGCTCCTTACCCGGAA
GTTGGAGATGCTTGGAGCAGAGAAACAAGGAACATTTTGTGTGGACTGTGAGACCTTCCA
TACAGCTGCTTCCACCCTTGGCAGCCAAGGTCAGTGAGATTACTCGGTAGGATGGCTACA
ACCTGGGTTGGAGTTGATAGACATTTGTGTTTACTGAAGTCTTTCTGATCTAGACGTGTT
TCGGAATTAATTTTCAGTTGAAACTTTTAAAGGGGTGTTTCCTAAAGAGTTGTTTGCTAA
TCAACAGCATCAGAATCACCTGGATTACTTGTTTGGGCTACATAATCTACATTTTGACAA
GTTCCCTAGATGACCTTTTGCACTCAAAAGTTTGAGGAAAGCCTCTTTTTAGGCTCAGAA
GTCTTTGTGGGAAAAAAAAATTTTTTTTCTTTCTGCCTGAAAGCTTCCTGTTTCCCCTGA
GCTAGCCAGTGGCTTTGGCCATCTCATTAGTGTAACATTGACCCTTGACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAGTGATAGTAAGACTAGGGTGTGGATGG
TAGTATTGGTGGTGGGTGAGGAAGAGGATCTTTGAATATGAATTGGGGAACTTGAGTTCT
CTTAGTCTTGGCTTTTCCTTAACTTGCTATTTACGTCTTTGGATGTTTCCATAGCACAGC
TATTAAGAGCAGGGATTGTAGAGCCAAAACCCTGAATCCTGGCACTGCCGCTGAATAACT
GCAACTTTAGATAAAGTTCCATAATGCACCCATGACTGTTTTCATTCCAGTCATTTGCCT
GTTTCCATTTAGATCCATTCCCTGTAGTTCCCCTGTAAACTGTATTTTCCAGGCCCACTT
CAGATTATCTTCAGCCAATCTGAGGCACAGGGGGAAGATTGGAGTAAGGGTGACCACACA
TATTTTACCCCCTCTCCCTTGGATGGTGTCTCTGGCCATGACGGTGTCTCCTTGACTCTA
GCTCCTGCTAGATAGCCCCACTTCCTGGCTAATAACAGCACATGTTTTTTTCTCTGCAGC
TCAGGAATGGTAGTGGCTTCTTGTGTTGCTAATCTCTGGGCTAGCTCACCATCCTGTTTA
CTTCTTTTTCAGTTCTTCCAACCCATGTATTTTGTTCTTTTTATTAAATTCCCTTTATTG
AAACTGTCTGTCCTGGGCTTATTTTTGGACCCTTCCCAGTACAGTTCTTTCATGTATAAA
ATAAAGCGAGTAATAGTATATATCCCTAGTATTGTCGTGGTAATTAAGTTGATACATGGA
AAATACTTCTGAGATTGTCCTGTATAAATATTTAATAAATGGTAGCTGATAATTGTACAG
CGTTTCATTATTGGTGGAATTGCAATGTTTGTTTTGGCTTCAGTAGAAAGAATGTAAGTA
TCAAAAGAAATACTAGTTATGGTAGCATTTGGAAAATAAGATATTTGTATACAGACGGAA
GGTGGCATACTACTTCTAGTGAAACTACCTGCTGTGGGCTCTGTTTTCCTGGTCGGACCC
TTACTTTTAAGGAATTTACAGTCTAATTGGGGAGACAGCACATTGTGGCAGGCAGTGGGA
TAGAATGGAAAGAGCAATAAATTTAGAAGAGTTAGAAGGCTTGGCTTTGAATTCCTGTTC
TGCTGCTTCTTGGTTTTGTGCTTTTAGATTTGTGATTTTTCATACTTGACCAGCATCAGC
ATTATCTGGAGGGCTTGTTAACACAGAGACTCCTGGGCCCCATCCCCAGAGTTTCTGACT
TCAGCTGGTCTGGGGTAGAGCTTGAAATTTGCATTTTTAGCAAGTTCCCAGGTAGTAGTG
GTGGTGGTGGTGCTACTGCTGCTGCTGATCTCACTTTGAGAAGTCCTTGGATAAGTTGCT
TCTTTCAGCTTCATTTTCCTCACCTGTAAAAGGGGCCAGTGACACAGGTTCTGCTTACTT
CACAAAGTTGTGCAAATATGAAAGTACTTTTTCTATAAAGAACTGAAAGTACCACCTTCA
TTTTAAAAAAACAAAACTTAGACTCTCAGTATGTTTTCAAGGTAGTAATAACCAGACTCA
TGTAGTGTGAATTAAGTTATGCCATTACAATGAGTAGACTTGAGGATAGAATGATGAGAG
ATCTTTGGATAGCTGTTTTTTGTTTTATTTTGTTTTGAGGATTGAAATGCTTCGAACTGG
ATTTAGAAGGAGGTGAAAGGTGTGAAATGGCAACAAGGAGTCAGGAGGGATATGGAGTTG
AAAGTATGTATAGAGCCGCCTTTGTTCCAGAAGTGACAGCAGAGTGGAGGCCTGATTAAG
GAATAACTAATGCCTCTATTCCTCTCTAGGCCTATGTTCTTAATCTTTTCCATTGCTACC
CTCATCCCTGCCTAAAATGTCTTTCCTTCCAGAAGACTTCTGATCTATTCCACTTAATTA
TTTTTGCTTTATTTTATTCTCTTTTTTTTGTTTTCTTTTTAAGTTTTTAGCTTCTTTCTC
TAGTGGGATTGTCAGCTTCTTGAGATTAGGGCCTTAGTCTTCTCCTTCCATGTCTCTTAA
ATCCTAGCACAGTGTTGGGGATATTTCAAGTACTTAAATATTTGGGATTGTGGCAATCTA
TCCATTACCTCTTGTAGTGTATCAAAAGAGATCTGGGTTTCCATTTCTTGCCTTCTTCCA
TTTTCCACTTACCTGAATATGTAGATTCCCCTCCTCCCTGCAGAAAACCTATATTTGGTG
AGAAACTCATTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTCTTGAGGCATGG
TAGACAAGACTTAGCAGTACTTCGATTTGGCCTACCTTTCCAGCCCTCATGCTCAAGTCT
TCTCCTTCTGTGGAACCGTTTTCTACATCTCTATGAGGGTAGGTAGGGAAAAATAGAAAA
CAGAGCAGTTGCTTCATTTGGCATGCCTAAATGATGCTATTTTCATTTCATTCAACTTAT
TATATAATACAAGAGATATTTGTAAAGTGTATGAGTTATTATTATTATTTTTAATTAATT
TATTTACGTCTTCCCCCCCGCCCCTTGCGGCTTGTTTTGCTGTCTGTTCTCTGTGTCCAT
TTGCTGTACATTTTTTCTGTGTCTGCTTGTCCCCCTTTGTTGCATCATCTTGCTGTGTCA
GCTCTCTGTGGTGCGGGGCGTGGGCTGTCAGCTCTCTGTGGAACGCTGGCTAGCTTGCCT
TCACAGGAAGGCCCTGGGATGTGAACCCAGGGCCTCCCATATAGTAGATGGGAGCCCAAC
TGATTGAACCACAGCCACTTTCATGTATGAGTTATTAATCACCAAAATTAAGCATTCATT
TGTGAGCTTATCACACAATTTAAGAACCAAGCCATTATCCTTATTGACATTTTTTGTGTA
CCCCTCACTTTTTTTCTATAGAGCAGGCTGAGGGCTAGGTTTTACTGCACACTGCTTTAC
CTGCTTTCCTCCCCCTTCCTTTCTGGAAAAGCCCATTAATGTAGGGATTCTACCTCCTCA
TCCAGAGAATGCTGAGATAATGCCAGATTGCTATCTGGTCTTGTTCCAAGCATTCAACTC
TATTTTAAGGTTTGCTGACACAAGTCTTGATGAACAGTTTCTCTGTCCCTTTCAGGTCAG
GCCGGGAAGCTGATGTATGTGATGCACAACTCAGAGTACCCTTTGAGCTGTTTTGCCCTC
TTTGAGAATGGACCTTGCCTTATTGCTGATACCAACTTTGATGTGCTTATGGTAAAGCTC
AAGGGCTTTTTCCAGAGTGCCAAGGCCAGCAAGATTGAGACCCGGGGTACCCGTTACCAG
TACTGTGACTTCCTAGTGAAGGTGGGCACAGTCACAATGGGACCCAGCGCCCGGGGCATC
TCTGTGGAGGTAAGACCTTGATGAAATAGGAGCAGGGATGTGCTGAAGGGGCTGCTCAGC
AAAGTGTTCTGAAGATCTCCAAGTCCCTCTGAATTCAAACAGATATAGCTACCTGATCCT
TGTTTCTAGAGCTTCTGTGCTCCTTGTCCCTGCTTCTTTTTACCCATTCTTCAGTTTCTC
AGGGAATTTCTAGCCCAGGATGGGAAATGGGAAGCCAGGTTCATAGCAGGTAGAAAGCTT
AGAATGGCTTGCTGGGGAAGGAAAAAGACAATCAAGGGAAGCAGGTAAATGAGGATGTGA
AGGTACCAGTCACCATTGCAGGAAGGACTGGAGCCACCCAGCCTGACTTTTGGTACATAG
GTATATGGATACATGTGAACTCTTAGTCACATGTATCATATATCTCTCCTTAGTAGGTTT
AAGATAGGTTTCAATAGTCAGATAGCAAAGATATACTTTTTCTTTTGACATGCTGTTTGC
TTACATTGTAGAAAGTGTGTGTGTGTGTGTATGTGTGTATGAATGCGTTATCTATTTAGC
TTAGCTAAATGAATGTATTAAAAATGGCAAAGAGGGAGTGGGACCAGTGGAAGTCCAGAA
TCTACCATGTGCCCAGCATTGTGTGAGATTAAAACAATAAGCAAGCTAGGAAATGGAAGT
TGCTTAAGTAATTAGATACCTCCCTCCCACATCAGAGGTCCTGGGTTCGGTGCCTTCTAA
AGAAACAAAGAAGACAAACAGGTACAGTAAGTGCAAACAATAAGGGGGTGGGGAGATATA
AATAAAATAAATCTTAAAAAGAAATTTAAAAAATCCATGGGCTTGGATTTATGGCAGGCC
TTTGCCCCTGACCTCTCATAGTGTCCCATGCGAGAGCCCCGAACCATTGCCTGGCCTTGT
CCGTAAGCCTTAGCACTGAAGTGGATTGCACAGTGTAAAAGAAAAAAAAGGAAGAAAATA
AAAAGTTACTACAGGGCCTGCCTTTTGAATGTTTATGATTTAGTAAGAGAAGCAAGGCTG
AAACACATAAACTGTATTTGAAGTTAATCTGTAAAAAATAGCATAAAAGAGTTGCAGATT
ATTCTGGGAATTCAGAGACCAGTAAGATCACTGCTGACTTTGGGGATTGTGGTGCTTCAA
GAGATGTTGCATACAAGTAGGGACTTAAAATGTAGAGACGTGGAGATAGTTGAGACCTAG
GAGGCATCTGAGGCAGGGAAAAGGGCATTAGTGGTAGTTACTGCTCAAACTCCAGGGACA
TCTAGAACCCAATTGCATAATCCTTTTCACCTTGTGATACATCAAGTATTTGCTGAGACT
GACAACCGACTGTTTATCTTTCACATTTCCAACCTTTAGTACAAACACACCCCAACTATT
TTTTATTTTTTGTTTTTTACTTGTTTTTCTTCATGATTACGAGTAATTTTCCATGCTTTC
TCTCCAGTGAAAAATTAGGAGAGAGTAATGAGAAAACCATGTTTCATGTAGGGATATATA
TCCTTTGTTTTAGGGTCAGAGCCCAGGGTGAGAACTACCTTGGGAGTAATGTTTCGTCTT
GAAGAGACTGATGGGCATATGGGTGTACTCTGCCCCCCTAACACATGCACACACACAAAC
ACACCTCTTCCATTTTCTCAGGATTTTCCTTAAATCTTCACCCAGCATATCAGGGACTAG
ACCGAGATAATTGAAAATCTCCCTCGGGGTTTGATAGGAAGGGCTGTGGATTGGCACAAT
TCCAGAATGAGAGTGTCAAAGAAGATGCCTAAAGGGAATCCTTGCTGTTTGGGTTGAGTA
CTTCTGTGGACCAACACTGGGACGATGGGAGTAGGGGGCAAAAGAAGCAGACTTCTTCTT
TGCCTTCATGCTTATTCTCTGTTCTTTTGGCCCTCAGGTGGAGTATGGCCCGTGTGTGGT
TGCCAGTGACATGCTGGAGCCTGCTACTTGAGTTCCTACAGAGTTTTCTAGGCACCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTAGACATGATGCCAGTATAT
GGCCCAGCAGATACCATGGTCCAGTACATGGAATGTCACAAGATCCGCAAGCAGCAGCAG
GTGCCAGTGGCTGAGATTCGTTAGTGACTGTCATCAGAGAGACTCCACAGGAGGAGCAGG
TGCTGCACCCTCATGCCCCTAGACCCCAGAAACTCAGAGCAGATGTGGAGGCTTCTCTTC
TCCATTTCTTAGCAATGGCTTTTGTTCTGGGGCTCTGGACTCTCTTCCCCTGACACTCAC
ACACAGACCCCAAACAGCTGTCTTCTACCAGGCCTTTCTGGACGTGGCCTGCCCTTGAGA
ACAGTAATTATGAAGAGCGGAGAAGTTTGGACCTTTCCTGCTTTAGGGGAAAAGGTAGGA
CAAGGAAGTCCCTGCCTAGTATTGGTGGGAAGAGCAGTTTATATTGCCAGCTGTTGAGGA
TTTTATGTTTGGGCTATGCTGTAATAAAGTTCTCTTTCCTTATTGCAAAGGACGTGGCTG
GGCTTCTGTCTGGAGTTGGGATGGGAGGCAGAACTTGTTTGAATGCTATAATTTTTAGAC
CTGTTTGCTGAAGTGAGTTGTTAATTGACTTTCCTAGGGTGTTTCCTGAGTTATTTTAAT
TCTCCCTCTGACATCTTTCCCATTTTGTCACAAGTTATTAATATCTAAGACACAGGCTAA
GCTGCTATAACAAAGAGAACCGAAAGTACAGTGATTTTACTGCATAGAAGTTAATTTTTC
TCTTATCTAATAGTCTAGAGGTAGGCAGGTGGTCCAGGGCACATTTAACACTACAAGATC
ATCCAAGAACTCAGAATGTTGGCCTTATCTACAAGTTCAAATTGGCTGGGAAAAGAGAGA
AAAACCTATTTTTTTTAAAGGATATGAACTGGAGTTGCTCAGATCACTGTGGTTATCTGC
ATTTTGTTGAAGGAATCCTAGGAGACATAACCTCTTATCTGGGTGGTCATGTGCCCAGTT
AAAACCCAGGGGGTTCTGTAACCAAAAGATGAAGAGAAAAAGGAGGCATTTGTTTATGAG
TTGATTGTGATAAGGACTGAACCCAGAGCCACTTCCAGTTGAGCTGGATTAGTCACTTTA
GGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 3534..3688, 7375..7628, 9517..9549, 9551..9595, 9668..9710, 9712..9803
1001..1014, 3534..3688, 7375..7628, 9517..9549, 9551..9595, 9668..9710, 9712..9800
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved