Dasypus_novemcinctus Locus DDEF2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus DDEF2
Dasypus_novemcinctus
DDEF2
GeneScaffold_4523
SNORD78
97880..97944
120752
TATGATCAAAACTCACAATATCTACTTGTTATTGAGTACCTGCTATATACCAGATATTG
GGCTAGGTGCTTTCCCTTGCAGCTTTTCATTGCCTCTGCAATCACCCTGGTATTGCTATC
TGGGCTAATCAGATGTTCTGTCACTCCCATTACAATAACTAAAAGTTGACACACATTATT
CTTCTCTACTATGTTATTTAATTGGGTTGAAAGGAAATTTCACTCCTGTGCTTTTTGTGA
AAGTTCCATGACACTACCCATATGTGGGCTCTTAAGGTTTTCTCCTTTCTTGGCTGAACT
ATGCCTGTCTTTGGTAGATGCCCTTACCTTTAGATACAGGCTGCAATAATAAAATACCAG
CCCTTTCCTTTTAGCATAGTGTTTGATGGTGTTTGGTATATACTTCCACATTCGTTGCTT
AATAGATTTTCTGAAGATGTATTTCCAGGTCTGATTAGCCATTGGGCAAGTATTGTTTGA
ACATCTACTATGTGCCAAGCACTGTAAGTGCCATGTGAATATTTGTTGAATTTAAATACA
TAAATATATTTAATACATGAATGTAGTCACAGTTGTTTCAATCTCTGCAGTGGTAAGGAG
CACAGGCACAATGGGCAAATCCCTGGCTGGCAGGCAGCTTATGGAGCCTTGCTTGTGCAC
AGGGAGAATTAAGACTTGGTAGAAGCAATGTGTGTTCAAGTTAACAAATACAACTGCAAA
AGGCTAATGTCCAGTAGGTGCTGTTGGTATGAGGTAGCTCATATGCTTCAGGTGGATGGG
ACAGACGATGAAAGAGTTGATTTTTAGCGATTACCAATAAGGCTTCTGCTTAGCACAGTT
AGAAAACCAATCTTCCACATCATACTGAAGATTTGTGCCATAGTAATAGCCTAACAAAGT
TGAGCAGGGAACCTCCAGAGTGGCTGTTGTGTGGCTGTTCTCTTGTAGTCATGGTCTAAC
TGCAAACACATATTTTAATAAATTTATTATCTATATTTTAGGCTTTGGATGTGGACCGGA
TGGTTCTTTACAAAATGAAGAAATCTGTGAAAGCAATAAACATCTCTGGGCTAGGTGAGT
ATTCATTCTTTCCTAGGGGTTTCTTTGTGGGAAACATTGTATCTGAAGTTCTAATCCCAT
GATTTTAGAGAGTACTAAGGAATATTCAACCAAATTATTTTTTCTAGGCATGCAAATTAC
AGAGGTGAGCTGGGGTGCTTTTTTGTCAAAATGTGTTTTGTTTTGCTAATTGTCTATTTC
ATCTTCTGTTTTCCCTCCACACTCTCCCATGTTGTACTTCCTGTTCTCTAAAATGTAGTT
GAGTTTCCCATGACAGCCCTTACGTGAACCTACATTGTCAAACTGGTTGACAGAAACACC
AGACTCATTCCTGCCTCTCTTACTCAGCTTATGCTGTTAATCATATCTGAATGCCCTTTC
CATTTCTCTCTTATCTGTATAATTCTTGCCTATCCTAATTTGGGAAGAAAATAAATGTAA
AAGTGTAATCACCTAGTCAAAGTCATATTTGATCTAGACTTATAAATGTGTTTAAAAACA
ACAACAAAAACAAAGCCACTACCACTTTGGGCTCAATTAAAACTGTGAGTGCAAACTCTA
GTAACTGCTTTTGCCTTTCCGCCAGTGCGGGCAAGACCATGAAAAGCTTAGTTGGAAATC
TCAACTACAGAGATGATTTCATAATCAGAAATTACCAAACTTATTTAAGAACAGACTTAA
CAAAAGATACGCAAGAAAGTGTAAAACATAATATAAACTATAGACCAGGCTTAGTAGCAT
TGCTTCCGTATGTTTTTATCAATTGTAGCAAATGTACCACACTGATGAAAGAAGTTGTTG
ATGGAGGAAGGTGTGGGAAAGGGAGGGGTGGGGCATATGGAAATCCCCTATATTTTTGAT
ATAACATATATGTAATCTAAAGCACCTTTTAAAATAAAGAAAAAAAATTTTTAAGATGTG
CAAGAACTCTACATTGAAAACTGTTAAATATTGTCAGAAATTAAAGACATTAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTACATGGATGGAGACTCAAGATTA
GATATCAGTCTTCCCTCACTGATCTCAAGATTCACCACAAACGCAATCCATTTGGGGAAA
TTGACAAGCCGCTTCTAAAATTTATATGGAAATGCACAGGTCCTAAAATACCCAAAGTAA
TCTTGGGAAAAAGTGTGAGTTGGAGGACTTAAACTACCTCACTTCAATTCTCACAAAGTT
ATAGTAATCAAGATTGCATGGTACTGGAATAAGGATCAACAAATAGATTAATGGAACAAA
CTAGATTCTAAAAAATAGACCCACATTTAAGTGGTTTTTTGATTTTTGGCAAAGTTGCCA
AGGCAGTCCAATGGGGAAAAGAAACTCTTTTCAACAAATGGTTCTGAAAGAACATTGAGT
TGCTGGCACTACTGAATATTTATATGGAAACAAATGAATTGTGATCTTCTGTATAGCTCA
CACAAAAATTAATGTGAAATGGATCAAGAGTTAGGTCTAAAAGCTTAAACTATAAAGCTT
CTAAAGAAAATATAGGAGAATATCTGCAGCTTGGAGTAAGCAAAGGTTTCTTAGGTAGGA
GACAAAGCAATAACCATAAAAGAAAAAAATTGATTATACTTCATCAATATTAAAAACTTC
TAATTTTTTTTTTTTAAAGATTTTATTTATTTATTTAACCCCCGCCCCCAGTTGTCTGTT
CTCTGTGTCTATTTTTCTGCGTCTTGTTGTCTTGTTTCTTTGTCTGCTTCTGTTGTCGTC
AGCCACACGGGAAGTGTGGGCGGTGCCATTCCTGGGTAGGCTGCTCTTTCTTTTGCGCGC
TGCGCGGCTCCTTACTGGCAGGCGCAAAAAGATAAGGGAGGTTACTAAATTACTGAAATT
GGGAAAGGTACTAGTGAAAAAGAACCAGGGAAAGGCTTAGAAATTTAAAAAATTTACTTG
TTGAAATAAAAACTAAAAGTTGTTATATGGTAGGTCACACACATTTGAAGAGGTGATTAG
TGAGGCTCCAGATTTCCAGAGCACAACACAAGGAGTGATACAAATGGACAGTATAAAAGG
TAAGTCAGGAGACATAGAGGCTAAATCCAGAAGGGCCAACAGCACCTACCTGGAAGTAGT
TCCAGAGGAGAGAAAATAGGGAACGGGAAAGAAGAAATTTTTAAAAAAAGCTAAAAATTT
CCCAAAGTGAAGAAAAATCTTTGGGATCTGATTGGGAGAGTTCACTGTATGTATGTGTAT
ATGTATGTGTGTGTCTCAAGTCTTGTCATATTGAAATTTCAGCACATCAGGGATAAAGAG
AACATTTAAGAATTACCAAAAGTGGGGAAAGCCTATGTACAAGGAAAAGGATTTTTGGGA
ATTATGCTAAAAATAATTGTCTTAGGATTTTAGCTTTACAGGTATTCCCCCCCCCCCTTA
TGTTGTATATTTTATATATTGTGATTATATTGATCTTACAGTGATTAGACAGTTATGAAG
TTGTTTATGATAAGCATGAAATGAATGTGAAATAAGTTCAGGAAATCAATGGGGCAGATT
TAAGTTGTTTTTGACCGAGCCAATTCCCAACTAAGTTTGCAAGGTTTCTGGACCTAAGTT
TTAGTGTCCTGGAACAAATCACTTAAGACTTTTAGTCCCTGTTTCTTGTCTCTGAAATGA
TAGGGTGGTTTTGCCCCCTGGGAACATTCTGCAACATCAGATATATTTTGATTATCATGA
CTGAGGGGGTACTACTGGCATCTAGTAGGTAGAGGCTAGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCATTTAATGTTCTTCAAAGCCCTCTACAATTTTGATAAAAC
AAAATACTACCTCCTACTTTCATATATAAATATGATGATGACTACTTGACAACTACTGAT
TTGTAAAAGGAGGAAGCAGAATTGTTTTTTTGTGATGACACCTAAGTGGAAGTAAATATG
TAGAGAAATTCTCTTTTTTAATTTAAAAATGAACAGAGCAGAGTATGCAACTCTTTTTAC
TTAATACAGACCCAAGATTTGCTAAAGCAGATATCTGACTGTCCAAAAAGTGGTCATTGC
CTCTAATTTTTCCCCTGGATGAAGCGAGGGGAAAAGAGAAAAAAATAATGATAGTTTTTA
TTTATTATTTATTTATTTGCACACTTAAACTGTGTGTGCCTTGTGCTTTTTATAGGTTTT
CCTGATCTTACAGCAGACCATCCTCATTATGCAAATGAGAACTCCAGGAGTCAGAGAGTT
ACAGGACTGCCCATGATATTTGGTAGAGCCAGAACTATAGCCCAGTTTATTACTGCTAGT
TCAGGGTGGTGTTTCGTGGCCTGCTCTGTTACATAGCCATCACATGTCTTCACTGTCTAG
CACACTCAGTGACTATCTTCAAGATGTCAAGAAATCACTAAGAAATGAGATGCTCAGTTT
TGTTGGCAAACAGCAGGTTTTGAAAAATGTCTTAAATTTAAAAAAATTTTTTTTAATTCA
CTTGGGCTTTTTGAGTTTATAGTTTAAGGCTAGTATAAAAGAGGTATTTTATATCTGATC
AGGTTCCAAAATGTTTTTGTCATATGTTGGGGAAGCTTTTCTTATCAGAAATAAAAACAA
AACAATCTGTTTCTTGTGTAAACATTGACTTCTGACTGCTGATAGTCTTAAGGAGGGAGT
TGTGTTTCTTCGAAGGATAAGCCCCAGCAGCATAGCTTAAAGACAGACAGAACATTCTAT
GAGATGACATAACAGATTTTAGTGTCATAATCTTTAAGAATCTTTAAGAATCTACTACTT
AACACTAATTTGCCTTTCTGACCTATATTGCTGAGTATGTACTACAGATCTTTTTTTTTC
ATATGTTCCCCTGACCCCAGAGTAATTTTCTAAAATACAAACTGAGTGATGTTACTTCTC
TGCCTAAAACTCTATAGTATTTTCCCATTATTCACAGTAAAGTTCATGAAAGTGTGTTCC
AAGGTATGGGTTTCTGTGGCTTTAGAAATGTAGAGAAATTGGTATCAAGGGCAGTACACA
TGTTTCTTTATATAGGACTATTCAAAGATTTTAATAAGCTCATGTGGATTGTGAGGAGAA
TAGCATTCTTAACCTTTTCTAAATAGATTTGTCTGTGAAACTACTACTGCCTTCCCCTAA
CTGCCCCCAAAAGAAGGCCTCAGGTTAGTAAATACTATATAATATCTAAGGTCCACGCTC
CTGGGCATTACCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTC
TGCTCAAGCAATATGTGTAGCTTGTGTCTTATATTCAGGCACACAGATTGATAAAACTTG
GTCTCTATCCTCTAAGAGATCCCAATGTATTGGGGAACACATTTACCAGAAATTTCACTA
CAACATGCTATGTGCAAGGATAGGAAAGATGCTAGACCCAGCTACCCAGGTCACAGGGGT
AGAGTCATGGAAAGCTTCCTGGAGGGTCTAGAGTAAATAGGAGTCAGGGAGGGGAGGGTC
ACTGGCAGAAGACGAATCATAAGCAGAGACTTGGAGGCATTGAGCTTTTATTACCCCAGC
GTGGTCTCTGTTGCCCACCACTGTTCCAACTTTGAAAGAAGTAGCTGCGGTGTGTACCTT
GGAATTAGTATAGTCAGCTTCAGGGTGGAGAGGAGCAGGGCATCTCTTTTTACGTTTCTA
GGAAAGGCCTGACTCTGTTAAGTTGCCTTGCGACTTCTGCCTTCATTTGGCTAAGGAGGA
GTCAGAAGTGGAAAGCATTGAGAGGTCCTGGGTGGGAGGGCTCTTGACCTGTTCATCGCG
CTTGTTTCTGGGATCTCTTGCTGACACATTCAGTTATTGTTAGTGTAAGAAAGTTACATC
TGTTCCTGGTACCACGTGACTTCTTTTCTGCTAAATGTTTGATTTTATTCACAACTAAGA
AGAACTTGGTGGGGAAGGAGGATGGCCTACTGGTACCTTAACAGGGCATCTCCCATTGCC
ATTGTAGCTCACGTGGAAAATGAAGAGCAGTACACCCAGGCTCTGGAGAAGTTTGGTGGC
AACTGTGTGTGCAGAGATGACCCAGATTTAGGAAGTGCATTCCTGAAGTTCTCAGTGTTT
ACAAAGGAGTTGACAGCGCTTTTCAAAAACCTGGTAAGTGTTCATTAGGCCTTTGTAGCT
ATCAGTCAACTGTGAAATGCTTGGAGTTGCTGTAGATGGAAAAGTAACTCAATGGATAAT
TAAGGTTTGTTTGATGAACTAGATAGAAATTGTTTCATAGCATACATGGTACCTAAAGAA
GTTAGAATTCTACACACACTAAGCCATTTTGGAATACAATTTCATAATTGTAATTTTTCT
CTAACAAGACTTTTTAAATTTGGCAGCATTTTAAGTCTGCACAGCTGTGGGACAAATGGT
TAAATGCATTCATCTTAAGGGCCTCTGACTTCAGTGTTTAATAGTTTCTAAACTGTGTAG
AATAGTATCTGTTTCTGGTAATTATAGAAGGCATTTAAATTTATAATATTTAATAAATAT
GTTCAGACCCGTCTTACACAGCAAGGTAACCTATAATCAAAGCACAGAAATTACCATGAA
TATTTAAAGGGTTTTTATGCTCCCAAATGCTGAGCCTAAAAAAAAGCAGGCCTGAAAGAA
ATGTCTTACGTTTTAAGCAAGTGAAAATGTGGACTTGGTGTTTATTGCCTGTGGTTAAGG
GCTTGGTAATGTTGGGTGAATTGAGTTCTTTCTTGTGCTTGGCAGCTCTGGCCTGTCCTC
GCGTGGGAACAGAACTCAGAAGAAGTGGGCAGCCTGAGAGGACTGGGCTGTTTGTGACCC
TGCCTGGGTGATTTGTTCCACATGTAGAATGTGTGCTTGGGATCTTCCCAGCAACTCTTT
TCTGTTTCTGTCCCTCAGCTTCTCCTAAAGGTCATGGAAGACCAGGTCAAGTGCTCCATA
ATGCTTTCTGTATAGGTCACAAACAACAGTCTTTTTCATTTCCCCTATCAGTACACTCAT
AATAAGTGAAGAAAAAGCTCATCATTCTTGAAATGGTGATGACAGTGGGTTTGTAAGTCT
GGCCTTAGAAAGGCAGAAAACAATGGGAATATAATATACGAGTTAATAATAGAAAGCGGA
AAAAACAAGATCATTACGCTTTTGGTCTCTCTCTCCCTGTCTTCACTTGCAAATATTTCA
GTTGGAAATGGTAACAATGAAAAGTTGTTGCTGTGCTTAATTTTTTCACTAGATTTAATT
TGAGATCTCTTGGGTCCCAGAGTTCATCACCCTTTTATTACTGCCAAAACCAGGATGAAA
GCCTGAATACTTAACAGTAGAGCCCTAGCTCCCTTTCTCAGTCCCAATTTCTAAATGTGT
ATTAGGGCCCCAGCATCAACTCAGGAAAGACTGAAAGATCTCTTTTTTTTTTTTAACTGG
ATAAACTGAATGGTTCCATGTAAAAGATCTGTAGATGCTGACATGTCTTCCAGTCAAAAA
TTCAGCTTGCTGTTTAATTGCCCTATGTTAAAGCCCATTGGTTGATAAGCCCCTTCCAAG
CATGCAAAGCTGCCAGCGTCTTAGAGCCTGATGTTTAAATATGAATGAACAGCCTCCAGA
ATGAAAGAGACCAAGAAGAAAATAACTTGTAGGCAACAGAGACAATACGGAGAGCAGAAG
AAAACTTTAAGGAAATTCTCAGAAATAGGAAAAGATAAATACAGGAAAAATGGGATGCAG
TTTGTTTTTAAAGATGGGGTGGGGTAGTTAATGGAAGAAAATATACTATAAAAATTTAGT
TAGAAGGGTTGGAGTAGAAGAAATTTCTCAAAGTAGAACAGAAAGACAAAAAAATGTGGG
AAATAGATAAAAGAAGAGATTAAGGATTAGTCCTCAAGGTCCAGCATCCAACTGACAGGC
ATTTCATAGAGAATATACAAGTGAAGAGGTGGATATATTTTCAATGGAACAATATAAAAG
AAAATTTCTAAAACTGAAGGATTCAAGCCTCCAGATAAAAGGGACTTGCAAGCACTCAGT
GCAAAAAAGGAAAAAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
CTGATGGAGAGCTCAAAATATTCACAGACGATAAAGAAACTAAGAGAGTATGCCAACAAG
AACCCTGACTTTTAAGAAATACTGAAGGGAGTTCTGTAGGAAAAAGAAAAAAAAAGAGAG
ACAGAGTTGGAGGAGAGTGTAAGAGCAAGTAGAAAGACAAAAAAAGAAAAAATCAAAATA
TAACAAACATAAATCCAAAGAAAATATGGTTAATTTAAGTAATTCCTTGAAAGTAATAAC
AATGAACATCAATGGATTAAACTCACCTGTCAAGAGACTCAGACTGGAAGATTGGATAAG
GAAATATAACCCAACTATATGCTGTCTACAAGAAACACATCTTAGGGAAACGGACTTTGG
CCCAGTGGTTAGGGCGTCCATCTACCACATGGGAGGCCCGTGGTTCAAGCCCCGGGCTTC
CTTGACCCGTGTGGAGCTGGCCCATGCGCAGTGCTGATGCACGCAAGGAGTGCCGTGCCA
CAGAGGGGTGTCCGCCGCATAGGGGAGCCCCACGCGCAAGGAGTGCACCCATAAGGAGAG
CCGCCCAGAACGAAGGAGGGAGCAGCCTGCAGAGGAATGGCGCCGCCCACACTTCCTGTG
CCGCTGACAACAACAGAAGCGGACAAAGAAACAAGACGCAGCAAAAAGACACAGAAAACA
GACAACCAGGAGAGGGGAGGGGAATTAAATAAATAAAAAATAAATCTTTAAAAAAAAAAA
AAAGAAACACATCTTAGACCCAGGGATTCAAGGAGGTTGAAAGTGAATGGCTGGAAAACA
ATGTTACAAGCAAACATTAACCAAAAAAGGACAGGAGTAGCTATATTAATATAAAAAAAA
AAACAGACTTTAAATGCAAGACAATTACGAGACATGAACATGGACACTACATATTAGTGA
AAGGGATAATCTTTCAAAAAGAAAAATCATAGGGGGAAACGGACTTTGGCCCAGTGGTTA
GGGCATCCGTCTACCACATGGGAGGCCCGCGGTTTAAGTCCCGGGCCTCCTTGACCCATG
TCGAGCTGGCCCACGCGTGGTGCTGATGCGCGCAAGGAGTGCCGTGCCACACAGGGGTGT
CCCCCGCGTGGGGGAGCCCCACGCGTAAGGAGTGCACCCGTGGGGAGAGCCGCCCAGTGC
GAAGGAGGGAGCAGCCTGCCGAGGAGTGGCGCCGCCCACACTTCCCGTGCCGCTAACGAC
AACAGAAGCGGACAAAGAAACAAGATACAGCAAAAAGACACAGAAAACAGACAACCGGGG
GAGGGGAGGGGAATTAAATAAAATAAAAATAAATCTTTGAAAAAAAAAAAAGAAATCTCA
AGACTTTGGCTGAACTGTGCCAGTGGCCAAGAGGTAGGCAGATGACCTCAGTTTCCTCAT
CTTAAAACAAGGATGAAGGACCAGGGTTCTATCCCTGGGGCCTCCTGGTGAAAAAGAAGA
AGAGAAAGTGTGCCTGTATGGCAAGCCAGTGCCCGTGGGGTGAGCCGAGTGCCCTCACAG
CAGTGTTCGCACAGCGAGCCAAGTACCTGTGTGGGGAGCTGAGTGCCGGTGTAAGTGCCC
TCGTGGTGAGCCACTGCCAATGCAGCGAGCCAAATGCCCCGCACAGTGAGCCAGTGCTTG
CGCCAGTGAGTCACGCAGCAAGATGATGACACAACAAAAGAGACGAAAAGGAGAGTAAAG
GTGAAGCGCAGCAGAGACCAGGAACTGAGGTGGTGCAATTGACGGGGAACCTCTCTCCAC
ATCAGAGGTTCCCAGGATTGAATCCCGGTGAATCCTAGAGGAGAAAGACGAGAAGAGAAG
ACAAAAAGAGAAATAGATAGAAAAGATCACACAGCGAATGGGCACAGACAACAACAACAA
CAACAACAAAAAAGGCAGGGGAGGGGAGGGGGAGGGAAGAAAAACAAAACAAAACGAAGA
TGATAAAACTCCATGTGCCTCACAGGATCATCATCAAGAAAAATTTAAGCACAAAAGGGC
TTTTTGTAAACTAAAAACCCATCACAGATTGACATTTTAATATTATGATATGTTAACTTA
TTAAAATCCTGCGATAGTAGCGTCAAATACATGTAATTGCTTTAGCTTCAGATTTTACTT
TAGAGTTAGGATTACTGATTCTGTTTCCCAGCAAAGCTCAGAGAGAAAGAAAATCACTTA
TTTGAGTCAAAATTAGCATTCACCATGTCTGATTTTCTAGGCCAGTGCCGGTGTTGAAGT
TGTACAACCATAGAAATGCAAAGCGGTATCTTCTAAGAAGCTGTTGCTGAGAGTGAGCTG
ATTATAGGAGACTTCTCCTCTTCTGATATATTTTGTATACCATTCTTATTCCTATTTTTG
GTCACTTCTGACTTATCTCTTATTTTTGAAGCCATGCTTTACAAGCAAAACATTTTAATT
GTATATAGCTAAGATTCTCAATTCTACCCCATTGTCCAGAGAGAATAGTAATTACTGCCT
ACCTGCTTTGTGGCATGAAAGAATGTTTATAAAGCAGTTGGAATGTCTCCAAAGAAAGGG
CAACTTACTATAAAGTAAGATTTTCTTACTAATGGGTGAGATTTGCACCTTCAGAAAGTC
TATATTTTCTCTGGAGTTATGCAGGATAAAGGAGAAAACAAGGTACCTCCAGACATATAA
TGTGTGAAATTTAACTGGTTATAAAGTCAGCCCAGCTTCTTAGGCACTTTTCCTTTTACC
AGAAGGATGTGAAAATCTTGAAAAGATTTTTCAAGGGCCATTTCTTTGTTGAGAATTGGC
TTTTTTATATTAAGCTGCATTAAAGGACAGATTTATGAAAAGTTAATTAAAGATTGTAAT
TTCTGTCCTTGATTCTAAGAAACTGGTAGCAAAAATATGTACTCAGAGTCTGTATAAATC
TGCTCTATATCAAGACCAGCATCAAATGAAAGCTGGGCCAATCAGTGCTGAGCAAGGGTG
GAGTTCACTGTGACATCCAGGAGTGGCCCTGTGGCTGAGGAATTTCATTTTACACACATC
CAAAGAGGAACCAGAAAGTTCCAGCAAGCCACATGCATATAAATCATGAATGTTTTACAC
AAATGCTCAGAGTTAAAAGACATTATGGTCATAGTATAAAGGGAGCCAGTAAGGTTCTGG
TTAGGATGAACGGTAACTTGTGGTTTTGTCCATACGTGATGTGTACAGTCTCTCTAACAG
AGAAGTGTTTTCACCTTGCTGCATTGGTATTAACAAAGTAGTGCTCTTTTCCCAGTATCA
CCAGTCTAAGGTTAAATATGAGCTAATAAACTTATTTCATGACTTAATATAAAGATCTTA
CTATAAGAGGTTCTCACTCTGGATTTACTTCCATCAACTTTCTTTTCTTTTTAACCTTAT
TTATTGAAAATGTCTATTTTTAAATGTCTAATATACTTTCTTATTACACAGGGAGATTGA
TCATAATTTCATCTTTAGGAGGGAGGGAAGACTTAAATCATTTTCGGGGCATAAGTTATA
GAACTGTTGTTGAAATCTACAGAAACTCTCAGTAGATTGTGGTATGTGGGAATATCTGCC
CCTATATGGGCTATTTGTGTTTTTTAACTGCTATCAGATTCCTGCCTCTGAAGTTTCTTT
TTCCATTGTGAAATGACTAGAAAATAAGATGACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAACTATCTTTATTGCAGATGGCACTATCTTCTATAT
AGAAAGTCCAAAAGAAACCACAAGAAAACTATTAGAGCTAAAAATTAGTTCAGCAAATTG
GCAGTGCACAAGATCAACATGCAAAAATCACTTGTGTGCCTAAACACTAACAATGAACAA
TCTAAAGAGAATATTAATAAAACAATTCCAATTTATAGTAGCATCTTAAAAAATAAAATA
TCTATGAATACATTTAATCAAGGATACAAAAGACATATATGGTGAGAATTACAAAACATT
GCTGAAAGAAATTAAAGACCTGAGTAAATGACAATCCAGCCCATGTTCATGGACTGAAAG
AGTTAATGTTGTTAAGACATATTACCCAAGGCAATACACAAATTCAGGGCATCCCTGTAA
CAGTTCCAATGGCCTTTTTGGCAAAAATTGGAAAAACTGAGCCTCAAAATCATATGGACC
TTCAAGGGTCCCAAATATCCAAAGCAATATTTAAAAGAAACAACAAAGTTGGAGGATGCA
CTCTTCTGATTTCAAATTTTACTTCAGAGTTACAGTAATCAAAAACAGTCTGACACTGCC
ATAAAGAAAGACAAATAGATAAATAAGACAGAATTGAAAGTCCACAAACAGACCCACACA
TCTGGCCAGTTGATTTTCCACAAGGGTACTAAGTACGTGCTAAGGGGAAAAATAGTCTCT
TAAACAAATGGTGCTGGGAAGACTGCATGTCCACATGCAAAAGAATGAACTTATACCCTT
ACCTCATACCAGATACAAAAGTCAACTCAGAATGGATCAAGGACTGAAATAAAAGAACTA
AAACTATAAAACGCTTAGAAGATAACATAGGGGGATGTCTTTATAGCCTGCAATTTGATA
ATGGATTCTTAAATATGCCAAAAGCACGAACAACAAAAAGTAGATAAATTTTATTTCATC
AAAATTAAAAACTTTAGTGCATAAAAAGAAATTTTCAAGAAAGTAAGGACAACCTACAAA
ATGAGAGAAAGTAGTTACAAACCATGTATCTGATAAGGATGTCATATCCAGAGTGTATAA
AGAACTCACAGCTCAACAACAAAAAGACAAACAACTCATTACAAAATGGGCAAGGGACTT
GAATAAACATTTCTCTAAAGAAAATGTACACATGGCAAAGAAGCATGTGGAAAGATGTTC
AACATTATTAGCCATTAGGGAAATGCCAAACCACAATCAGATACCACTTTACACCCACAA
GGATGGCTATTATTATTATTTTTTAATTGAAAATAACAAGAGGATACAGAGAAATTTGAA
CTCTGGTATGTTGTTGGTAGAAATGTAGAATGGTGCGGCCTCTGTGGAAAGCAATATGGA
GGTTTCTCAAAAAGTTAAATGTATAATTACCACATGACCCAGCAATTCTACTCCTAGGTT
ATATACTCAAAGAAAACTAAAACAGTGTCTCAAACAGATTTCTTGTACACCAATGTTTAT
GGCAGCATTATTCCCAATAGCCAAAAGGTGGAAACAACCCAAGAGTCCATCATCAGATGA
ACGAATAAAATGTAGAACATATACAACAATGAAATATTATTTCACCGTAAGAAAGAATAA
AAGTTGTGAGACATGCTGCAGTATGGAAGAACCTTGAAAACATTTTGCTTAGTTAAAAAG
CAAGATACTAAGGACAAATCTGTATATCACTTAGATGACTAGAAATAGCAAATTCACAGA
GATAGAAAGTAGATCAGAGATTACTGACTGGGGGCAATGGAGGGAGGCAGAAGTACAGGG
AGTGTTGTTTAAGGCAATAAACTCTAATAACTCACTGTCTGGGAGAGGCAGAGTCTTTAA
TTGTAATGCATTGTGTGCTGTGATGGCCGCTGTCCAAGGTGTCACAGAGGCCTGAGGCAG
GGGAGCAGTGATTCTCAGCTTCTGGACCGTGTACCTTTGGATTTCTGGGGGTGGAGGTGG
ATCAGGGTCTCTATGGGTCATCACAAGGTGACCTCAAATACATGTGCATACAGTATGATT
GTAATGTTTACAAACAAATGCCTTGCCTGTATCTTTAACAACTTCTCAAATATATTTAGG
AGATGGTGTTAGAAGATACTCATTTGAAAGTATTGGAACTCAAAACCATTTTTTTGTTTT
GTTTTGTCATCATGCATTTTCTCAAATGTTGTTTGTTAAAAGTACTGCCACAATGTAAGG
AACCTCAGACTTTCAAAAACATTTTTGGCCAAATCTAAGAGATAATATATAGAAAGGTTT
GAATAGAGGATGTGAATGAATGAAGGAAGGGTCAGCTGCATCCTGGCACAGAGAGAGAAG
TGTGGGAAGAGATGCCCTGATTGTTGCTGTTGGCTTTTATGATTAGGAGGCCATGATGAC
TTCTTTTCTGCCTGTTTCTTTAAAGGCAGAAGACAGGTTGTAGTAGCATGAGGAGACACA
TCAGGTGAAGGAGAGACTGCAGGTGTTTGCTACTCTGTGGGGAGATTTGATAACAGAAGC
AGAAAGCTAAAGGGAAGAGTTTTTAAAATAAGACATACTTGAGCCTATTTTTAGGCCCTA
GTGGAAGGAGCTGGTAGTTGGAAGAGGTTAATAGTATGGAAGAGAGGGGGCTGCTGAGCT
GCATAGGCTCTATGTCCCTTTGTCTCCTATTGGTGAGATACTCATTGAAGAGTCGATCTC
CTGCCTCACTGAGAGTCCTCAGCAAATGTGTGTAGATAAATTCAAGGTTTTAGCTTCTTC
CCTTTCCTTGGGAATTTTAGATTGTTTATTAATCATACCTTAAAATCTAACACTTGGCAA
AACACATTAATATTGCAGATTCTAGTTTACCAAGTACTTAAATGTAGGTTGTTTTCTTTT
ACACCCCCAGGAACCCTAGTCTTGATCTTGAATTGGCATTGGAATCACCTGGGTGTTTCT
TAGAAATGAAGACTCTCAGGTTGTCCTCTCTCTACACCTATTGAATCAGAATCTTCATCC
TGATGAGAGTCTCACGTGATGAGTTGGCACGTTCAAGTTTGAGAAGCATTGTTCTAGAGC
AGTGGTTCTCAAAGTGCTGATCAAAGTGCTGACAAGCAGGACCAGCAACACCTGGAACTT
GTAGGAATAAAAACTCACGGTCCCCACACCATAACTACTGATTTATTGTTCTCAAACTTT
AGTGCCTCAGCATCACCTGGACAATTTGTTAGATCACACAGTTTGGGCTTCCCTCCCAAA
GTTTCTGATTCCATAAGTCTCAGGTAGAGGCTGAGAATATGCATTTCTCATAAATTCCCA
AGATGCTGATATTGCTGTTCAGGGACCATACTTGGACAACTACTGCCTTAGAGGATAACC
TCTGTTCTTACCCTTGGGGAAATGGAAATGTAAGGTATCCATGGTCTAGCTAAGGCCAGA
ACAGATATTTTCTAACCTTGGATTTGTGGATGTAATAAAATTTGAAAAAGTGCTTTCATT
TTTGGTTGATGGCTTAACTAAACATTTTAACATCCTATGGGTATGGGTTTTAGAAGAAGC
TGTGGACTGGGTATGCTGTCCTTTGTTCTCCTTTCCCTGTCTCCTTTGCACTTAGAATAG
GCTTAAGGGGGAGTTTCAGCATGGTGTAGTAGCTGAAATGGACAGTTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGGGATTATTCATGTTTAT
AATCTACCAGTACCCGCATCACCTTCCATTACTAAAACTTTCCCATTCAGCAGAAACTCT
ATACCCATTATGCCTTACCTATCTGTTCCTACTGCCCCTGGAAACCTGGACTCTAATTTG
TCTTTATGAGCTTGCGTTATTCTCTAGTATTTTCTTTGTAGTAAACATGGGGCTTAAATA
TAACATCTTAAATCTATAACACTCTCATTTGCTTAGAATATCAGCTTAACTTTAGTGGTA
TACACTAACTATGTTCCTATCCCATGCTGTTCCTTAGCCTTGAATGTACTTCTCAAATGT
CGTAAATTGCATGTTTACACATTTTAGGCCCCCAAACCACTGATTTCTTATTACATTTTA
TGCATTTGCCTTTTTTGTCCTGTAGGGAGTAAAAAGTAGAGTTACAAACCAAAACTGCAG
TAGTACTGACATTTATTTTTACCCATGCTGTTACACTTACCCAAGATCTTTATTTCAAGT
GGCTTGGATCTTTTGTCTAGTGTCATTTCTTTACAACCTGCAGAACTCTCTTTAGCATCT
CTGGTAGGGCCAGTCTCCCTCAATTATTGTTAATATGGGAATGTCTTAATATTTCCTTCA
TTTTTGAAAGTCAGTTTTGCCAGACGTAGAATTCTTGGTTGGTGGTTTTTTGCTTTTAGT
GCTTTAAATATGTCATTTTACTGTCTCCTTGCCTCCGTTGTTTCCAATGAGATATCAGCA
CTTAATCTCAATCAGGCTCCATTGTATGTGACCTACTGTTTCTCTCCTGTAGTTTTCAGA
ATTCTCTCTTTGTCTTTAGTGTTTGGCAGCTTTATTATAATGTATCCCAGTGTGGGTCTG
TTTGGATTTATCCTGTGTGTCTTTTTGGATTTATCCTATGTGGAGTTCATTGGACATCAT
GGATGTGTATATTCATGTCTTTTGTTAAATTTGGGGAGCTTTCAGCCACTTTTTCTTAGA
ATATTCTCTCTCCCTTTCTTCCTTCTCCTTCTAGAGTCCTATAATGTGTATATTGTTATA
TTTTATGGTGTCTCACAGGTTCCTCATGCTTTGATCACTCTGTTCACTTTTTTGATTTTC
AGACTAAGTGATTTCAATAGTTTTATCTTCCAGTTCACTGTTTCTTTCTTCCGCCAGCTC
TAATCTGTTGTTGACTCCTTCAAGAGAAATTTTAGTTTCTGTTACTGTGGTTTTCATCTC
TTTTTGGTTCCTTCTTGTAATTTCCATCCCTCTGTTGATATTCTCTTTTCACTTATCATT
TTCCTGATAGTTCTTTTCCACACGTTCCTTTCTCTCTTATGATCAGATTTAGGATCTTTT
TTTCTTTAACATCCTTGGTATGTCCCAGGTCTGAGCCTCTGGTTTCTAATACTTCTTTAA
TTTTCTTCTTTGCCTGCTTCATCCCTTCCTCTTTCTGTGTAACTTTAGTACTCTTTTGTT
GAAATCTGGACATTTTGATATTTTAATGTATCACTGAATTTTAAACTCTGAGGCATCTGT
TCCTTAAGCTTGTATCCAGCTAGTATAGTAAGCTATATAATGCATATATAATGCATAAAT
GCATATATCCAGCTAGTTTAGTAAACTATACTAAAAAATAAGAAGCGATGGCCCAGCCAA
AGGAACAAACCAAAAGTCCTGATGAGATACAGGATTTAAGACAACTAATCAATGATAATC
ACACAAATCTCCTAAATCAATTAAAGGAGTTGAGGGAAAATATGACCAAAGAGATAAAAG
ATGGGAAGCAGACTTGGCCCAATGCATAGGGCGTCCGCCTACCACATGGGAGGTCCGTGG
TTCAAATCCTGGGCTCCTTGACCCGTGTGGAGCTGGCCCACGCTCAGTGCTGATGTGCGC
AAGGAGTGCCATGCCACGCAGGAGTGTCCCCTGCATAGGGGGAGCCCCACGCGCAAGGAG
TGCACCCGTAAGGAGAGCCCGCCCAGCGCGAAAGAAAAGTGCAGCCTGCCCAGGAATGGC
GCCACCCACACTTCCTGTGCTGCTGACGACAAACAGAAGCGGACAAAAGAAACAAGATGC
AGCAAATAGACACAGAGAACGGACAACTGGGGGAGGGGGGGAATTAAATAAATAAATAAA
AATCTTTAAAAAAAAGACAAAAAAGTAATAAAATAAAATAAAGAAGACAAAAGTCAACAT
CAAAAATGAAAACTATATGGATGGAAAAAATAGGCCAAATGTAAGCTATGGACCATAGTT
AGTGTTAATAGTCTGATGATGTTCTTTCAAAATCTGTAACAAATGTTCCACAACAATGTA
AAGTGTTGGTAGAGGGGTGATATATAGGAATTCTGCACATTATGCATGACTGTTTTGTAA
GCTCACAACTTCTCCAAAAAAATATTTTTTAAATGAAAGGGGGCAAATTACAGAACCAGA
AGCAATTAAAAATGTATTTAAAGAACACTACGTATATCTTTAGTAACAATAATTTTGAAA
ATCTGGTGAAATGGATAATTTCCAGGAAAATAAGTAATTCAGAGTGGCTTAAGAAATAGA
AAATATAAAATAGACCACTTAATCTTAGAAGAGTGCTGATTAAGGTAATCAATAATCTAT
CTAAAAAAAAAAAGTGGCTCTCCTTAATCTGCTCACAACGATGAAAACTGTTGGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCTTATTAACTAGCAGTGAATGACTACCAGTAAGGAGGA
GGGAGAAGAGGATATATTGGCAGTGGTTTAGGCAAAAAGAAATTTAGTAGTTGACTGTTT
CTGAGCACCTTCCCACATCTTTTTTGGACTGCACCACACACGCCTGGGAGATCACTTGGG
TGGGCTTAACCTGTTGCACAGATGAGAAACTTGTGTGGCTCAAAATGGTTCAGTGGTGTT
TCAGGGGGCAATCAGCAGGTCTCAGGGATATTATCTGTGTTCTTTTTTTTTTTTTTTTTT
TTTAAAGATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGTTGTCTGTTCTTGGTGT
CTATTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTTGTCAGCGGCACGGGAAGTGT
GGGCGGCGCCATTCCTGGGCAGGCTGCACTTTCTTTTCACGCTGGGCGGCTTTCCTCACG
GGCGCACTCCTTGCGCGTGGGGCTCCCCCACGCGGGGACACCCTTGCGTGGCGCAGCACT
GCGCATGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTCCCAT
ATGGTAGACGGACGCCCTAACCACTGGGCCAAAGTCCGTTTCCCATCTGTGTTCTTTATA
CCATATCCTGTCGCCTGTTTCAGAATATATTATATTCTGTAGCGGAGGAGATAGGGAATT
TTGGGGTCCATGTTCCTATAAACCTTTAAGAAAGTACAAATGTGTTCCCTGATACTGGTT
TGGTGGATCTCAAGGGTCCTCCTGATGTCTTAAAGATATCTCCAAGTAAAAATGGTGTTA
ACTCATTTCCATTTAATTTTTCGTTTATCACAATTGCCATTTTGTTTTTAGTTTTTTTGG
TTTTTCTTTTTCTGCTTTATTATAGGGGAAGTGTCTTGGAATTGAATATATGGTGATAAG
GGTCTTAACCACAAAATTGTAGACAATTTTGGGTAAAGAAAGGAAACTGGGACAAAAGAG
CAAGCCATCTAGGATGGTAAAAAAAAAAACCATTCATCCTACTCATCCTCATTCTTTTTT
TTATGCAAGGAAAATTTCATCTAGTGGATTTAGATAGAATGCCTTATTACTGGGAGTTCT
TGGCACTTACTAAAGTTAAACATTTAATACCATCAGATAATCCAAAGAGTACCAAATAAA
AGAACCATTTAGTAATGACATTTAGAATATATTGGTTAAGCATCTTCCATGAGCTCTGCC
CATTGTAAAAGATGTCAGAGAAGTAGATGAGATAATCTCTGTCCTGAGATGCTCATAATC
TACTTACTTCTGTGACATTTGCTTTTCTGTTTTTTTTTTCTAACAGTATCTGCTAAAGGT
CAATGAAATTAAGATTAAAAAAGGAGTGGATTTACTTCAGAATCTGATCAAATATTTTCA
TGCCCAATGCAAGTAAGTTTTTTTTTTCCCTTTCTTATGGTGTTATTTTAAATGTTTTTC
TTTTTTTGCAGCTTCTAGTATTGAGGAAAATAAACATTCATTTAAAAATTATATGATACA
ACATAGATGAACCTTGGAAGCATTATGCTAAGTGAAAAAAGCCAGTCACAAAAGCTGCAT
CCTGTATAATTCCATTTATATAAAACATTTGGAATAGGCAAACCATAAAGATAGAAAGCA
GATTAGTGGTTGCCAGGGTTTGTGTGGGGGGAGGTAAATGGGGATTGATTGCTATTGGGT
GATTATGAGGTTTCTTTGGGGTGATAAGAATGTTTTAGAATTAGACAGTGGTGATGGTTG
CACAACTTTGTGACTATACTAAACAACACTGATTTGTATACTTTAAAAGGGTGAATATAT
GGTATGTGAATAAGATCTCAGTAAAAAATTACACACTATAAAAATGTATGGTAATTATCA
AATATATTTCTTTTTGCTGTTTTATTTTCTTTTTGTAAAGGGGCAAATTAGTTTGATCTA
ACACATGATTCTCAGAAAATCTAAGAAAATGCTTTCATTTATCCCATAAAGCACGTGCTA
GTGAGGCTGTATGTATAGGAGAATGGGAAGCTTATGTGTTCAAGGACTGCTTCAAGGACT
CCACTTTGCCATGCACTTTAGCCCTCCACAGTCTGGCCTGCATTTCTCACCCTTGTTCTC
TTCCCTACTCCTCATCCTCCTTTTACTCTGATCTTGAGTCACTAATATAAATAGACCACT
GCTTATTCACTCATTCATCCCCAAACTCTTTCTTGAGCCTGTGTTGTCAGACAAAGCACT
GGATGCTAAAGATAGTGATGTATAATACAGGTGTATTTCCTGCTATAAGACACCATTAGC
AGAGTTGAACTTAATCAGATTACCAGACAAATTTGTAATTGGACATTTAAAAAAGTGTTC
TAAAGGATAGGAATCTAAGACAGAATATGATAGAAGGATCTCATTTAGAATAAGACTGAG
GGATGAGAGGTTTTTTTTCTGCCTCATTCGTTCTTGTATTCCCCAGCAGCCAGGACACAG
TGCCTGGCATACAGTAAGTACTCAAATATTTCTTGAATTAGCTGCAGGCCTCTTTAATGA
GGAGACATTTATTCTGGGATCTGAAGGATGAGTAGGAGTTAGTGGATAAGGAGTGGAGAG
AAATTCCAGGCTCAGGCAAGGTCTTAAGGCAGGAAAGCTCTTGCATTACAGGTATCTGGA
ATAAGGCAATGTGGCTTTGGCATAGTAAATGAAGGGAAGAGTAGCATGGAATAAAACTGG
ATGGAATGGGAGAGGCCAGATTCTGGATGGCATTGAAGGTCTTGCAAAGAATTTTAGATT
TTATTCCAGGTGTGTTTGGAAGCTCTGGGGAAGTTTTAAGCTGGAGATTCATTCAACAAG
TTTGTATTGAGCTCCTACTATTTGCCAGGCACTGTTTGAGGTTCTTGTGATATAGTGAGG
AAGAAAACAATTCTTACCTTCATGGACCTTCAGTTCTAATGGGAGAGACAAATGGTAAAC
ACATGAACAAATATGCAAAATAGTTCTGGGTAATGAACATGGCTATGAAAAACCAAAGAA
GTTTGATGAGATTAAGAAAGTATATTAATGGGAAACATCAGAAAGGCTTCTCTGAATGTC
TTTCTGTACTGACAAGGTTACGCTGCATTTGTGGAGAAGGAGTCAGATGGAACAAGACTG
AATGTGGGGTGGTTATTTAGGTAGGTGGCTTTTGTCCTAGAGCAGTCTGGGTATGATGAT
GTGTTGGCCTAGACTGGTGACAGTGGTTGTGAAGGGTAGTGGACTGATTTGATCGTCTTC
TGGAGGTTGAATCACCACACTCATCTGCTTACCTTTTGTGCCCCCACATTGACATACCTT
TGCATACATTGTGTCCTTGTCATAGAATGTCCTTCTGTTCCCTCTGTGCCTTCCCCCCAA
CTTTTACTCATCCTTAAGACCGAGCTCAAATATAATTTCTTTATTTTAAAATAAACTTTA
TTTCAACTTCAAAAAATAAAAGAACAAACAAAAGGCAGCTTAACAAATGAAAGTATTACT
TTAAAAAATTCTGTCCAGGCACATTTGTCTCATTTAATCCTGAAAACAAACTCAGTTGTT
TCTCCATTATTCAGAAAGATACATAAATGAGCACAGATTGGTTAAATGACATGACCAAGG
TCTCCTTGTTAATGAAGAAAATAAAGAAAAATAACTTAATCATATTCATATCTCATAAAA
CTAAACCGACATATTCTTTTTTTACCTTTAGCATTGATATAGTACCTTCTTTTCCTTTGC
TACAAAAATATTACAATATAACTGTTAAATATAGTTTGTAAGTTACATTAGTTGTATTTT
TCCATGTGTCACCATATTCTTAACATTCTTGTATTTATATTATTAACCAAAATTCTAATC
TACCACCAAAATCAGTTATACAGCCCCTAGGTTATTCTCTAGCTGTCCTTTAATTATCAT
TAACCTCCCTAGACTACCCCCTTCAGCCACAATCATATTTATAAATCAGCACTTAGACTC
ATTTTAATGTTACCGTCAACAGTGTAATTATCTACTTTGAAGCCATTCTTGTTGTTTTCC
TCAGTAGAATTGCTTCTCTTCCTACTGTGTTGCCAGTATACTCCCACGTATCTCTAAGAT
GGCAACTATCACATTGTGTCTTTGTCTCCTACTAACCTACATACTCTTTAAGGGAAGAGA
CTGTGCCATTTATTTTTTTTATCTACAGTGCATGATATGTATACCAGGCATGGATTTGTC
AGTGCCAGTTGCACTGTTGAACTGAACTCAGGTCTGCTTTGGAATTTTTAACACATCCTT
GATAACATTGTAATTCTGCAGTTGAGATGGAACAGCAGAGGATGATGTGCTGAGTGGCTC
ATCCCAGGTTAAAAGAAGAGCTTTACCTTAGACTTAGAAGTGGAAAAGGGCCCCTAAGTT
GTAGTATATTCAAGCTGAAGTATTTTAAAGAAACTCAGAATCCTAACTTTCTGATTAACA
TGCAAGTTTCTTTTCAGTTTTTATCCTTGTAACCTTATTGAGACACTTTAGGAAGTGGGT
CACTTCCTTACTGATATTTAATTTTTAAGAAGAAGCTATTCTGGGATTTCCTTTTTTTTT
TCCTTTATTTTTCCCAAACTGATCAGTTGGGTAGCAACAGACTACTTGTGGAAAAGTGAA
ATAGTTGGCCTTTTATGGGCATGAGCTCAGTAACCTTTAAAAATAATGAATCTTCCATTA
TTTCCTATTGGGATATGTGTATTTATGTGTATATATGTACATGTGTATGTGTATTATAAG
CTCTTGAAGTCATTTGGACAGTTTTGACTTTAAAATTTATATTTTTGGGGATAAAATGGG
GAGCTTGAGTGACTGAGCCATGAAACAAAAAGAGCTTGTAAGCATATATAAGTTTATTCA
TGTGGTAGTTCCTTCACATTCCCTCATTTAACATTCACATCTCCAGTTCTCATTCCACAA
AACACAATTTGATGTTTTGTTGTGCCCTCTTGGGTAGGGACATGCCAACTTGGCCAGCAC
CTTTATCTCAGTCCTTTGTGACTCTCTGTAGTTATGAAGGAGCCACTTGGTCTGAACTAG
ATTCTATGAGCCATGTTTGGGTGTTGACCTTTAAAACTATTTGGATACACATTATTTTGC
TTTTTCCCTCATTTTTGCTTTTTAATTTTTGTGTTATTTAAGAATACTTCATGTTCTTTA
TCTTTTCTCTAATTTAAGGGAAGTATTTGCATCTCTGCCTCGTTCCTGGAATATCCTGAA
GATTGGTCTCATTATTAGCCTTTGCTGCTGCTAATTGAGAATCCTATTCTCTAGTGGAAT
CTAGAAATAGAGAAATCTTTAAAAGCAAAATAAAACAGAAAAGGTCATGTTCTAGAAGGT
GGTAATGAATGTGTATTGAACTGGTTTGTTCTTTGAGCACATAGCTGCTGATAACCACTA
TGACTAACTGTTGCTTGATGGATTGAGATACACAGTTGAACAAGACATGGGTCCACATGG
GCTGGAGAAGTGAGAGGTGGGGCAGGGCACAGACAGGCAGATATGTCAGCATAGCGGGAT
GTTATGAAGATTGGAGGAGGATTGGACAAGGTGCTATGTGAATCCAGAGGAGGGAGAGGC
CACCTCGGCCTGGGGAGTTTCAGTGGAAACTTGAATGAATCTAAGTGGTTATATTTTGAA
GCCTTGAGAATTTGGTCAGGCAGGCTAGAATATATTTTAGTAGAAAACAAAATTTGATAT
TTGGTGATATTGATGGTAAAAGTTTTTTGAATGAAGTTTTAGGAAAATGGTAATGCCATC
AACTTAGAGAAAACCTTACTGGGTATTTGTTCTTAGGAACATCACTGTGATAATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGTGACACTGCTCCTTTGCTTTG
CTTTTCCTAATGCCAGGATGGATGACATCCTGAAAGGTATTCCTATGTACTAAGACTGCT
TCAAGGAGGGAGGGTATGGAGAGATAGGAATTTTGAAAACCGGTGTGGGGCATGTTTTCT
CAGTAGATTATCAAAGTTGGCTAGGTTTTTACAAAATGAACCCCAGATCTTCAACCCAAA
TTTGGATTATTACTAAATCTCATTTCCCGTTGTCACACTGGAAATAATGTCTGTGAAAAA
AGACCCCTCTCTGAGCACTTGGCACCACTGCAGGGCTCTCTGTCCCTATAGGGAGAGTTG
CAAGGTTGCAAGGATTCTTAGAACTGTACACCTATTCCCTTCCCCAGGAGCATTTCTGCA
TTAATCCTCCTATAACATTTTTCCTACTTCTGGTCCTAGAACGATTTCTCTCTCTTATGT
TCTCTCACTCTCATTCTTACTCTTTCCCCAAGAATTCAAAGTGATCAAGGAAATACTTCC
ATAAAGAAAAAATACAAATAGAACAAAGCATAAGACCCAGAAGAGGGAAAGGCTCAGTTT
CTTCCCCTTGCAATTGTGTGATTGTTCTTCTGAAATTCTGTTTCATTTTTAAAGGAGCAC
CTGCTCTGTGCCCTTCACTGTGCTAGAAGTTGAAGGTGGAGAGCTGAGTAAGACACAGCT
TTCTAACAGTGCAAACAGACGTGTGGATAAATAATTACAACACTCTGAGACTATTGCTGT
ATCAGAAGCATATTTTGTATTCAGAGAGAAAATGAGGAAAAATATAGCAATAAGAAATAA
AGTAGTATGTATATATCAAAAGATTAAAGTAAGAAAATTCTAATAGCCCAGCCTCTGTGA
CTCCTAGTAACCACTAATAATGGTTCATGACACACTTCCTGTGCTTTCCCTTCCCTTTCT
CCTTGGAATTGATGTAATAAGTACCACACTACATTGTTTTCACAATCCCTCCTGTTACAC
ACTTGGTATAGAGAAAGTCCCACAGGACCAGTCTTGGTTCAAAAGAAATAAACATCACCT
GATATGAACACATGTGAAAACTAGATCATTTTTTTTAAAAGATTTATTTATGTATTTATT
TCTCTCCCCTTCCCCCCTCCCCACCCCGGTTGTCTGTTCTGTGTCTATTTGCTGCGTCTT
CTTTGTCCACTTCTATTGTCAGCGGCATGGGAATCTGTGTTTCTTATGGTTGTGTCATCT
TGTTGTGTCACTCTCCATGTGTGCAGTGCCATTCCTGGGCAGGCTGCACTTTCTTTCACG
CTGGGCGACTCTCCTTACAGGGAGCCCTCCTTGTGCGTGGGGCTCCTCTATGCGGGGGAC
ACCCCTGTGTGGCACGGCACTCCTTGTGTGCATCAGCACTGCGCATGAGCCAGCTCCACA
CAGGTCAAGAAGGCCTGGGGTTTGAACTGCAGACCTCCCATGTGGTAGACGGACTCCCTA
ACCACTGGGTCAGGTCCGCCGCCTAGATCATTTTTTGAATGATCGTCTCTTTCGAAGCCA
GTAAACGGCAGAAGTTGATGACTCTCGTGTGCGTAAAATGTTCAGGCTTTGTAGCTGCCA
TGCCTTTACCCTGCAGGAACTTCAAATGTTTAATGGGGGAATTATGTTTTAAATAATCAC
ACTAATGAATACACAATTGCAGTTTATGATGCTTGGGAACAAAATACAGAGTGCTCTGAG
AGAATATAGCGAGGAGATCTCGTTTAGGGCAGAGGATCACAGAAGACTTCAAAAAGAGTC
AATATTTAACTGGAAGAAGGACAAATAAGTGGGAGTCAGCCAGGCGAAATGAACACGCTG
CACACCGATCCTTTATGAAGCACAATCTATACTCCTTTAGGGAGAGGTGGTAGGATATGC
AAAGGGCCAGATGCAGGCAGAATTTGGGGGTAGTGGAGGACTAGCGAGAAGGTCGATGTA
TCTGGAACTTGATGACATGAACGAAACGGGGAAATGGTGTGGACTGAGGAGACAGACAGG
GAGGGCCCAGATCCCATAGGCATTAGAGCCTTGCTACAGATCTAAGCCCAACAGGAAGCC
TTCTCTTCATTCCTCTCGAAAGCTTTATACACAGCACGTCTCAGAGGCCGAACCCAGCCT
GCTGCTGCTGCAGAAAAACTTGTTTAGCTTCTGTTGCCAGTTGTTTTTCTTGAATCATTT
GTTATAAATGACTTCACAAGCATTGGCTTCTTTTTTAAAAAGATCCCTTTTGATATTTGA
TCTCAAGTTTTCTTGCTTTGCAGATAGAGCATGGCTTCATAAGTATCAAAGTGGCTTATA
TTTTTTCCTGCATTCTTTCAGTTTTCCACTTAACTATTGACTGTTGAGGAAAATTCTTTA
GTGTTTTAGCCCTTGTTGTCACCCCGTGTCCTTTCAAACCTCAGATACTTCCACTTGAAT
ACATAGAAGTGCTCCCTTCAGCCCAGTGCTTTGCTGCTGTTTGTCAGTAGAATTCTGTTT
CCCATTATAAACTGATAATTTAGGACTCATTTTATGTATCAAAAAATTCATGAACACTCA
GGCATACTGCAGTTGCCTTTCTGTTCACTTCTCATAATTTTGAGTGTCAGTTTATTCTTG
CATTGCCTGATTGATACATTAAGGTTCTATTGTTACTGTCTCCCTCTTCTCCATCCCCAG
GAATCACAAACCACTTCAGCACCTTCCTTTGAACAAGTTTTCTCTATCTAACAAAGTTAT
TTTCTCTTTTATGAAGCACAAGCTAGGTTACTTCTTTTTCATTCCCTAGTTTTTCCAGGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGTAACTTCCCTCCCCAT
TGGTGTTGAAGCAGTTTTTATCCAACAAATGTTTTCATTTAAGTGTTGCTTCGATATAAT
CTTGTGTTTGCATGCTGTGCTACCCTGAAACTAATAGCCCTCTAGTGCCACGCAGAGTGG
GTGGTGGAGTTCCTATTCACATCCTCTGTTTTGGGTGCAAGGAAGGTGGAAGCTAGGGAG
AGACTCATTTGTTGCATTTATGTGGAAATGCCCTGTGAACTCAGATATTTGTTCCTCAGT
CTTGTCTTTTCTGTTTTTTGTGTTTTTTTTAAAGATCAAACAGGCCCAGGATGAAGAAAG
AAGGCAGTTGATACAGCTTCGAGATATTTTGAAATCAGCATTGCAAGTTGAACAGAAAGA
GGTGAGGGGATTTAATTTTGAAAGATGGCTTATTTTATACCTTTTTCTTGGATGCTTTGG
GACTGAGAACTGTAAAATCCCTATCTTCTAGGTGCTCATAGTTTACTCTGGGGCTTAACA
AGTAGAACGAAAACATTCAGTTTGTTCTTTAAATTTAGTTTTATAAAACTATCCTTTAAG
GTTTATTTCACAAAGGACACATTTATTATAGCCATGACCTTAATGGCAATGTGGAAACCT
TTTTTGTTCTGTCGGTTCATGGATGAGTAGCTCTGAGTCTCTCGATCACATAGAATACTT
GTTATCATGCCATTTATTTATACCTCTGAAAGTTTTTGGTTTTTCTGTCCTGACATATGT
AGACTCTTTGCCCAATGAGTGACCACTGGAGTCTCCTCCAACCCTGAGATTGTACATTCA
GTAAATATGAGGAGTTTGGTTCTCTTCCAGTCATGTTCTTATGGGTCAGATGGGTCAGAA
AACCTTAGTTTCTCTTGCATCATTTATTTCATATCATCACGTCTCTGTAAGTTACTACAT
CAGCAGTGTTTTGGCTGTTCATTTAAAAACTATTAAAAGTTAAGGTTTTAAAGTGATTTT
ATATTTAGCAGTGTAGCTATTATCATGAGGATCTTAAAACATAAACCTACCTTGTCAATA
AAGGATGTGTCAAGTTGGGTATCTAGTAGATTGTAGAAAAATAACTCAAACTATTTAGCA
GAGCATAAAGTTTACTATTGGCAGGTTAGTATGCACTACTTTGTTTTAAGTTCCTGTGCT
ATAACTGAATATTGTTGTTTTTCTCCCAAATGCATTTACCTTTTGTGACCGAAGTCTAGG
AGAGTAAGTAGTTCAGTATTTTAACAAATTGGAGAATTTTGCATGCTTTCTTCATGAATG
TCAAAAAATAGATGTTTCTTTCTCCTGTATTTTAATGACTAGCAACATTTTGAATTTTTA
ACCTTCCCCTTTCAAAAGCAGCAGATTTTAGTAGAGACTAAATATTTTGAATGCACAAAT
ATTAGTGGGAAATTTCCAAGATTACAGCTCACACTTTCAGCATTGCTCCTTTGTGAAGAT
GAGGCAGCTTGCTCTACCCTCTTAATTGCATGTCTGAATTCTGTTCATCTTCTAGTCCAT
CTTAAGGCCCACCCTTGGAGAGTTGCCTTTGATCATCCCAACCCACAGTGATCTGAGTTC
ATATAGCAAGTTCTGTTTGAAAGACTTATTTCAATTAAAATCTATTCCTTTTGGATTATT
GGCTCTGTCATCAAGAGTGCAGAAGTCTTTTCTCCAGCTGGTGTCTGAGCAGCTTGAGGA
TGTCCCCCTGCCTCCTGTGCTTTTCCTGCCATCACATTGTGGTACCATATCTCTTACTTA
GCAGGTAAACACAGGTCAGCGAAGTGAAAGATGGGCAGATTGAGGTTATATCTAATGCTA
GATATTACCCACAGCATGCTGACTTCCATTGACTGGGAATGGTTGAGAGCTGCTTTTGTC
TGAGGAGGGGAATCAAACCAGTGAAGCAAAATGGCAGGTTTTAAATAAGACAAAACAAAA
GCTGGAATTAAGGAGCCCTCTGGGTATAGTGCAAGGTCTGTGTTTGCTTTGGCTATACAG
AATCAGGAGATTTGGGAAAACTGGCAGTTGTTAGGGAGCTGGTTGTTGACAGCTTTGCAG
AAAAGTCTAAAAAATTTACCAGCACAAAGCAGAGGTCTTTCATGGTTTGTTGTTTTGGTG
GTTATTATTGACAAGCCCGTCTGATTCAGATTACACAAAGGAGTCGAATGAACTTTCTTT
ACTGCTCTTCTTTGCCTTTATACCCAACTGACTACTCACTAAGACCAAACTCACCAATAT
CAAAGTTGTGATTGTGTTGGGTTTTCCGTATTATCGTGCTCTGAATTGCTTCTTAATGAT
GGTATTCTATAAATTAGCTGTTTGATGATGGTAGTCTACAAATTAGTCTACATACACAGT
TGTAAGTAATAAGCAAAACTGTATAAATAAGTTAAATTTAAAATATTAAAAGTAATCTCT
GTGATTTGGATTATTATTGGAGTTTATCTTGTGTCCTTATAATTACAAAGAGAACTGAGC
ATTTGGGCACATTGTTGTTCAGGCTGGTTTTTCCTTTGGTTAGATTTTTTTCTCTGACTT
AGAAAACTGAAGGTATAGATGGTTTTCATTTAGTGTTATAAAAATTCTAATTCTGATTAT
ATAAATACAGATCATTAAAGAAGTAGGTGATGTGACCCCCAGGAAGCTGAGGTTGGTAGG
AGCCACTGCTCCTCATTTCCTTCCCGTAAATCTCAAACATCAATCATTTGCTCTAAATGA
AGAACACGACAATTACAATATGGTGGCTTCTGGCTGCTTTTCTTTGTCATCCTGTGGCTA
TGCTTTAGTATGGAAACTGTGTTTGTTACTTTGATTCCAGTGTACTCTCACAGCTCTGGA
TTACTGACATTCATGTATATTATGATCTTGATATTTTTCTACTTTCTGTGAAGAGGATAC
TACCTTTTGGTTTTTCTAGTAGTACTAAATTTCAAAGTGAAGCACAAGTTTAAAGAGTTG
TACAGTGAATGCCCGCATATTATCAATTCTGGAACAGACAGAGCTAAAACACTTACATGT
TGCTAATGTTTGCGTGAGCTTCCTCCCCATCAGCTTTACCTTCTCCTGCCTTCCCCATCC
CACGGGTGTCATCTCAGTGGAGTTCTGCTGGGACAGATACTGCTGCAGTGCCAGCTGGTT
CTGTCCCAAACCTCAATGTTTGCATGCTCTCCGGGCAGCCCCCCCCCTCAAGCCCAGAGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAGTGCTGAAATCGCAGTG
ATATTTCCTTTTCAGAGATCTCAAGTGTGACCTTTTTGCCATCTTTGCTTCCCAAACCCT
TTTTAAGTGTCCCTGTCTAGTAGGATATGTTACATACTATCCATGAAGCATAAGTCAGCA
ATGGGCCATAATTTTCTTCTGTCTCTGGCTTTTCTAGTCTTGGTTTACGTATCTTATCAT
GTCCAAATCTGACCTTGGTCAAAAGCCTAGTGAATGCCTCTGGCCAGGTGTGCACTTCCC
TGCCTCTTTACCAGGCTCTTGGCTGACCTAGCTCTGGCCTTCATTTCTGCCTCAGAAGAA
GACTCATTCATTGAGTCAAACATGCAGCAATCTCTCTAGGCCAGACACTACACATTCACA
AGAATAAGATAGGTCCAGTTTTACCTCTTAAGAGGCTCGTAATTTGGGGGTGGGGTCAGA
AAAGTAATCGAGAGTGCAGTGTGATTGATGAGAGGCTATCATGTTAGGAGTTCAAGAAGA
GGTATCTCCATTGGGGAGGGGGGAAGCGACAGATGTTTGTTAGGAATGGTTTCCCCAAAT
CCGATACCTGAGCTGTGGGTTTGGAGGATGATCAGAAGTTACACAGATTCCCAGCAGGTA
GAGACAAGTGGACCAGCTTCTGGTTAAGACAGGAAGTTTGTCTGGGTAGCTGTCTAGCAG
AGGAGAAAGTGCATAGATCTTAACTGTTTTAATCCTATGTCTTCTGCTTCCTACCATTGT
GGCTTTGGGAAAGTGATTTGACCTCTCTGTGCCCTGTTCTCCTCATCTAAAACAGGAATG
TTATTGCCTATCTCATAAAATTGTTGAACCTAACCCTAACCCGCCCCCTTCCTGAAAATT
TAGGATATTAAAGCTCCTTCACATCTGGGTTGTTTCTGTCTTGGCAGAAGCCAAATGATA
ACACTTCCTTGGTCCTCATAGAATTTAAGATTATGGGTGGGGCCTGGGATCGGAGACGTT
GTCCGGCTGTCACGGAGTAGTGGATACATGGCTCTTTTATGAGAGCCTTCTGAAGTTCCA
TAAAGGGCCCATGTGACTACATCCTTCAAACAAGCAGTCTCCACATGGTAAAGCTATCTT
AATCAAGTCTTCAGTTGGCCTCTTCTCTCTCAGGGGAAGTCAGAGTACACTGGAGAGTCT
CGAATCAGGGCAGCATGGACTGCCCTAGCCAGTTGCCTCTCTTATATGTTAGATTCTTCT
CCCCAGAAAGAGAGCCCCCTTTCCCTTGAGTTGTATTCCATTAAATTTGAAGTCGTGAGA
AAGGGCTTGGTCATGTGAAAGGACTGACTTCATTTGTCGACCCTTCGCTCGGTCAGGCAT
TTTATGCAGGTGAAGGAAGGCTACTTCTGTTGGGTCACCTAGAGGATGCTGTATTAATTA
GTTCTCCAGCAGGTTCAACTTTATATGAACAGATACTATTTCTCTTATTTACACATTTAA
AATTTTACATGATAGCTTGGTTTCAGATTTGCCTGCATTTTTTTATTGATCCAGGAAATG
CCAGGTTTGAAGAAAAGAATAAAATGGAGCGACTTCTTCCTCAACTTCTGGAATAGGGTC
AGGTTATGCTGAGAAGATGACTGTTATTTATCCTGTTCATAAGACCTGTAAGGGTTCTGA
TTACTATGCTTGGCAGGGATATTTTTAGCAGTGTTGTCACTTGATTTCACCACTCATTTT
GTGCAGGACTTTTTTCCTCCCCAAATGAATAGGCTTATTTCTTTGTTGTACAATTTAGTC
TTTTGGCAGGCTTATATTTAATCAATTACAGAGATTCGTATAGGGAAGCAGCAGTATTAC
TCTGTTTCTCATCTACCACCTTTATTCTCAGCAATGTTTACAACTGGGTTTGCTCTTACT
TTCTAGTGCTAATATACTGCCATTTGTCAATGAGATGTAGAAACTGGGACCATCCTCATC
CCATGAATGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTAAGTACATTGATAATTGCTCAGATAAAA
CTGTTTCTGTTCATTTGTCCCATGTCAATTGCAGAGTTTAAAAAACCACTGCTAGACATC
TCACATTCGTGGATTGGAAGACTTAATTGTTAAGATGATAATACTCCCCAAATTGATGTA
CAGATTCGATGTAATCCCTCTCCAAATCCTTGCTGCCTTTTTGCAGAAATTTACAAGGTG
ATCCAAGTAGAGTCTTGGTTACCGGGGTCTGGGATAAGAGAGAATGGGGATGACTGCTAG
TGGTTATGAGGTTTCCTTTTGGGGTAATGAAAATGCTCTAAAATTGTGATGATGGTTGCA
CAATTTTATAAATATAGTAAAACCACTGAATTGTACACTTTGAAAGGGTGACTTTTGTGG
TATGTGAATTATATCTCAATAGAGCTGTGTTTTGTTGTTTGTATATGTGTGTGTGTGTAT
TTTAAACAAAGCAGAACAATACTTTGCTGCTGGGAGTTTGCTCAGGGTGGAAAAAGATAT
CTAGAGATTTTTTTAAAATCAGTTAAAAGAAACCAAATCCATAATAAAGTGGTGCATTAA
GGGACAATGGGATGATTTTCTAGGATTCATATCTCCCAATAGCTACAGGTTCTCCTAACT
TTGAATATGGTCAGTCAAGAAGAGTTGATTGAGCTGCAAAACATGAAAGTCTTTCTCTGT
CTCTCTCAGTATCCATCCTTTCTATCCCCCTTAGATGTGCACCCCTTCTCAGTATTCCTG
TTTTTATCAGTGATGCCCCTAGAATCCTAGTCCCCTCAGCTCAGCCTCGCACTAATTTTA
TTGTTCTATTTTACCCATTTCAGCTCCAGTGTATCACAAGAGCCTGGCACTTCTTTCTTC
AGAGACTAGGGGTTCTTAACTTCAAGGGTGTCTACTACCACCCCCAGTAATATATGACAA
TTTTGTGTAGATGAACATTTTTCCAAGGAGAAGGGTTAATGGCTCCAGAAGGGAATCTGT
AGTTCCAGAAGATTAAGCACCTCTCACCCACCATTAGATTTTTACATTGTACATGTATTA
CCGAGGCAACCTCCCATTTGGTTCTCCAGACTCTAGATTCTTCTTTAGGTTGATTCATCT
TTTGCCTTGCTTTTTGGATAATCTTATTTTTTAAACAGTCAGGGATCCAACTGGTTCACA
GTTGCTTTTAAATGAAGTTGAAACTCTTAGTCCAGCCTATCTATCCTTTCTACTACCTAA
TCTGTTTCTAGCTACAGTGTTTTCCATATTTACGTGGATGAGCCCCCATTTCAATCAGTT
TCACCACCACAGCTTTCTCTTTCCTCTCTCCATGTCTTAAATGTGTGCTCCCTCCGCCTT
GACTGTGCTCTTGTTCTCTTACCAGTGCCTTCCCCTTTGAAACAAACTTCTTCCAAACTC
TCCTGTGATTTTCTCCATTTGACTGTTCAATCCTTAAGTACCTGTATTCTCAGTCTGAGT
TGCACTAATTTTCATACGTTGGCTCTTTTCATTGTGTGGGCATGTACTTAGTTTCCCCAA
GGGTGTTCAGCTTTTTGATATTGGAGATGAGGCTGGCTTTAGTCTTCTAGGACATCCTCT
GATGAGGCAACATGGTGTAATGGAAGGAGCACTAAAGTGGGAGCCCTGTCTGCTCTGGCT
CTAGCAAGCTTTGTATCTTAAGTGAATCACTTGATTTCATTGTGTGTCTGCTTCTTACAT
TAAAAATGACCTGGCTCTTAGGAGGATGAGGGGCCAATAAAGATACAGACAGATCTTAGT
CCTTTCCTATTTGACCTGTGAATTACTTGTTCATATCTAGCTCCCCCTTGTTTCCTTTAG
GTATGCCAGAATTTCCAGCCACTAGAAAGGTTCATCCCTGTCTACTCCCTTCAGGGCTTT
AAAAACATATGTTGAGCACTTGTTGCTTGCCAGACTTTGGACTTAAGCCCTAGGAATTCA
TTGAAGGTTCTTGTCCTCAAGAAGTTTGCAGGCTGGAGTTTCCCACTCTTGAGGGACTCA
ACCAGAGCAGGAGCTGGCCAATTCGATGGGACTTCTTTGAAGTGGCTGAGATTCCCCCTA
GTCAGTAGTCTGAAGCAATTAGGTTCAGTGCAACAGTTCTTTCTCTGTTTGGGTTTCATA
GGATTAGAAAGTGAATATTTGTTCAATACCTGTTATGTACCAGGTGGTTGCACATCTAAT
CTTCCTAAGTCATTATTATTTACTGTTCTTACAGGGCATTGTTTTCCTATTTTGCAAATG
AGGAAACTGAGGCAGGAAGCTTAAGTAACTTGCCTATAGTGAGAAGCAGAGCATTTTGCT
TTTTGCCTCAAAGCCCTTCTCTTTCCATATATCATGTTTACCTTCCTTCTTGAGGGCTGC
TTTTGCCATACCAGGAACTTCTTGGCAATATCAGGAATATAAGGGTCATACTTAAGTAAA
GCCTTGTAACATTCAAATGGCTCATTCTTTCGACAAGTTTAGGGATACTCATTTTTGACA
TTTCTTTTTCCAGCCCAATTAAATGACACTTAAGAGTTTCTGGATATGAATTTTATGTCC
CTTTTCTGATGTGGTGTGGAGAAATTTTCTTACTTAATCTTTAAAAAACAGATTTTAAGG
GTGTAAGTTTCCATTGTGTACTGCTTTTTTAAAAATTGGGATCAAGACATCATTAAAAAT
AACTTCTTGACCATTTTATAGGATTCACAAATTCGCCAGAGTACAGCTTATAGCTTACAT
CAGCCTCAGGGAAACAAAGAACATGGGACAGAACGGAATGGCAACCTCTACAAGAAAAGC
GATGGGTATGTTAGATGGTGTTAATAGAATTTAAATGTTGTGTTCATTATCTCATATATA
TATCCAAAATTTCTAAATTCTTTTTTGTCCCCATTTATCCATAAGAATCAGAAAAGTGTG
GCAGAAAAGGAAATGCTCAGTCAAAAATGGTTTTTTGACCATATCTCATGGTACTGTAAG
TATTCTCTTTTAATTTCCTGGTCTTTGCTCTCGTGAGGGGTGTGTGTGTGCATGTGTGTT
GGAAGCTAAGTGAGAGGACAAAGGTGTTTCATATATGTTTACAGAGTGAAGTATGTATTT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTACATTTGCACCATT
TCTGCTTTTTTAGCTAGAGACAACCTTACCTTTCACTGCCTATTATTGTCATGAATAACT
GGTGAGCCAGGTTGTCTTTATTTAGAAACCTGTGACGTCCAGACACACAAAACACAAATC
TTTATCTCTGGGAATTTAACATCTCGTTTGGGAAGATTTTACCTTTCCCCTTGTAACTCA
TCTTTTCCCTTAAGGAAAATTGGTCAGGACTCTGGGAATCAGAAATCTAAGAGAACAGAG
ATTTCAGTACTTTTACTATAGAAATCAAATATGAGGGCCCAACCTTGATCATGCCCTTTT
CCTGTCATCCTGTTTGTACAAGCTCACAGCCTGCGTAAGAAGACGGCCCACACGCCCCAG
CCCTGGGCCATAGGATGTTGAGCCTCTTAAAAAACTGATCTGAATAGAATTACTTACTGA
TCTAGCTTTCAAAGACTCAGAAATTTTTTTAAGTAAACTTTATTTCAACTTCAAAAAATA
AAATAACAGACCAAAAGCAGCTTAATAAATTATGGAAACATTACTTTAAAAAATTCTGTC
CAGGCACATTTATATCATCTAATCCTAAAAACAAACTCAGTTGTTTCTCCAGTGTTCTGA
AAGATATATAAATGAGCGCAGATTGGTTAAATGACATTACCGAGGTCTCCTTGTTAATGA
AGAAAATGAAGGGGAAAAAAAGTTTAATCCTAAAGACTAGGAATTTTAGTCATAGCTACA
AATGCAACTCTCCACACTCTAGTGTTCTTTTCCACAGTGACATTGGGCATATGATCACTT
CACCTGGTGTGACAGGATCTGTGAAAACCATGTAGGTTGGTAGACATTTTTGAAACCGTA
AAGGCTGAGCTGGTTCCTACCTTGTTCGTGAGAACTCTGACAATGACTTGCTTGTCTTTT
CCCCAAGCAGGAGGCCTAATGCTCCGTGTGCATCAGCATCCTCGGTGGTGTTAGTGGGTG
GTGATGGAGAGGACCTTGAGTTGTTACAGTGACTATAACCCCTTCCTTATGAAAGACAGA
ACTGGCAGGGAGCCCACACAGGCTCTTCAGGCACCTGTGGAGAGGTCGTCCCTCAAAGTG
AGCTCCAGGAAACATCCCTTCTCAGGACTTGTGAGCAGACATCTAACTGATGGAGTGTCA
CTATGGCATGGGTTGTGTTCCCCCGGAGGTCACTTTATTTTCTCCCATTCCTTTATAGGA
AGGGAGAGAGGGAGTAGACCTAGCACATATCAACTATGGTCTGTGAGAATCTGTGGATCT
CTTGGGATATCTGGCTTGGGATTTAATGTGTCTCTTGACTAGGCAAATAAATATTGTTGC
TCCTTTCCAAAAACCAACTTTGCTGGCCTTATGATCACTAGGTCACTCATGGGGCAATGC
ACTTTAGATCGTGATATCATGTTCTTTCCACATAGATGGATGCATAAGTACTGTAGACCA
AGGGAAGCAAATTTATTTAGCCATTACTCAGCTTTAAAATTAGGAATGTTAGACTGGGTA
ATGGCCTGTTTCCTGTCCTGATCTAAACACCTGTGCTTCTGTGGCTTACTTTTAAATTGT
TTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTCACTACTGACTGCATCTATAGAATGTTTACATGTGTGACGTGAATTAACTA
TACCAAGAAGAGAACTAAGAGATGCCTTTATTTTTCCATTCTTTTGTGTTTTGGCGGGAA
GTGGAATCACAATGTGTTTTTACACTGTTAGGAAAAACCTTCCCAGGAAGCTGGTTGCCT
TTGGAAAATGAAATTGTCAGATTGCTCCCTCCAGCAGAAGGATAATGATGACATCCAGGG
GCTAATTTACTGAAAGCTTAAATTGGTATTCCCTGTTAGCCAAGACTAATTTTGTTTTCT
GGCACTGGGAGGAAATGATTCTTGGGACAAAATAATCCTAATTAGCTAACCTTTTTGCCA
AATTTCTAGCATTACTACATCATCAAAGGCTGGGGGCTGTGCTAAGATGGAAGAAGTATC
TATTGATTCTTATGCAATCTAAAACTTTAAAAATATACATCTTCAATTGAATAGAAAAAA
GTATACAGACTTACCTTTAAAGATCTGAAAAATTGGGAGAAAATGGAATCGAATGATTAA
AATGGGAGAACCACTTAATAATTCATGCCTTCATGGCAAACACTGAGAATGGAGGGTCTT
TTCTTCCATTCCTTCCCAAGTTTTCTATTAAACTAAGGGTTTCTCTTATTAAGTTCTTGA
GGAACACTAGTATCTAGTGAATTAGAGACAGCATAGCTGAATTTACTGATAACATATTTT
CCACATTGCAGCAGGGAGGGAATTTATGGATAGAATTTTCTGTTTAAAAATTTTCTCCTT
GCATGGTTTTTCTGTAAACCTAAAACTTCTCTTTAAAAATTTATTTTCTTTTGGATGAAT
TGTATGCTTTGTTAATATATATCAATAAGATTGATTTGTTACGAAAAAGAATACATTAGG
AATAAATATTCTATTTGGCTCTTAAAAACAAAAACAAAAAAGATTTATTTTTTCCCATGA
ATTTTTCTTAGAGCTTTTTCTGTTAGCTAATACTTAAAATAAATAGCAAACAATTATTAA
TGCAAGCTTTAGAATAGCTGATATTGCATAAGATTTAAGATTCTCAACTTATGTATTGTG
GACCCGTTCTTATGATTGTCATTTTATAATTTAAAGTAAAAAAAAAATCTGTCTTTGGTG
GTGGGTATCTCACTAGAGAATGAGTTTTCCCTATACTAGAGGAGGAAAGAATACAAATTG
GGGATGGGAAAGAAAAATGCACGATTCCAATTGTGATTCTTTACTATACTAAAAGATATG
TAAAGAGAAATCGAGGTAAGTAACCCCACCTTTTGGGTAGTTTCCTGCAGCGGGCAGGAG
AGTGCAGTAGTTAAAAGCCTGGCCGCTGGAGCGGGTGCCTTCTTCAACTCCACTGCATCT
AAGCTGTATAACTTGATCAAATTATTTAGTCCACCTAGGCCAGTTTCTTTATTTTTAAAA
TTGGAGTTGTTCCTACTTTCAAGGGTGATTAGAAAAGCAAATTAGTTAATAAAAAGTGCT
TAGACCAGCACCTGCTATATTTCTAGTAATAATAGAACATAATAATAATAGCTGAGTAAA
TGTACCTTATTATTGTTATTCAAAATTATTTCCTGTGTTTATCAAAGTACATTATCCCCT
TTTACTGCTCCTGTATCTTTAGACTCAGTAGGCACCAGCAATGTGGAAGTAACCCAGGAA
CCTCATCTAAAAAAATGCATATTTACAGTGTGTGGTCACAGTGTGTTAAAGTGGCTTGGT
ATAACCTCTTACATGTCATTGTGAAAATAAGTCATTTGACATCTTGGTTACCTGGCAAAC
CAAGTAATCCTCTTGAAAGGTCCAAAATTTTTGGGCTTTTACTTGGAACTGTCAGGGATT
GCCAGATTTCCAGGTTTGGAATCTTCTAAAACTTATTTCTTATGATTAAGAGAATTCTGC
TAGGTATCAGCAGACTATGGAGAGATCGAGGGACTTTAAAGGAAGTGTGGTCAGCACAGC
CATGAACCGGGAAAGTCTAGGATGACCTTATTTATCCAACTTCTGCTGTCCACACTTCCT
TTTGTCAGACCCAAATCGTTCACACCGCAAGGATCTGCCCAGTTTTAGTGGAATCTACCG
TGCCTCCTCTATCCACCCCTCCCCTGGGAGAATTAGTGAAAATCTTCTGGGCCGTATTCA
TGAGGCTCTCACAGTTCTGCCCAGGTACATGTGCACATGTGCATATCGGGGTTAATCTAT
AACCCAAGCTTGTACAGTATCTTGAAGCTGCTGGTGACCATGGGAAGTGGTGAACAAGAA
TAATTTAAATTTTGTTTTTATGTGATCTTTCACTTAGCAGCTTGGTTAGGTGGGTGAGAT
AAGCCCATTCATATTTGGAGATTTCGCTAAGATTTCTGAGAGATATTTTACCATTCAGAA
GTTATTTTCTTACATTATTGTCTTGCCTCTGACCTTTGCTTTTATGGACTAATTATGATA
CTTCTTGAAAATGTAATAAAAGTTGACATTTTTGAAACTTCACTGACAAAAATAGGTTGT
GATCTCTCACAAATATTGCTATCGGTTTGTATGTATGAGGATGGGGGGTAGATGAGGTAT
GTTTTATTGAAACTTAAATGTTTTTTTAATCTAAAAAATATGAGTCTACTATCTGTCTTC
ATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGGC
TAGACTTTGATAGGTCAGTCTGGCTCAGCCAAGTAACATTTGGATCACAAAATTAAGTTC
ATTTTTCTGAACTTGAAGCAGTTTTCCTATCCTGTTTCTCTCCTCCGAAACAGGGTGAGG
ATAGAGGAGGTAGAGTTCTCTTTCCCCTGGTGTTAAAAAGAAGAAGAAAAGGTAGAATGG
TGTAGTAGAAAAAATACAGATTTTTCTGCCAATGGCTTTGTTCCTTTTTGCAGCTTAACA
TCTCTGAGCTTTAGCTTATTCCTACACAACTTACCACGAATTGTTGTAAGAATCAAGGTG
TTTTCAGGAGGATGCTATTGGAGAATGATGTGTTAGCTCATTTTTAGCGGCGCAGATGTT
TATTGTATATCCCCATGAGCAGAGTCTCTGCTTGCTGCTCTGCCATCTGGAGAAGCTAGA
TCTCCTTCCTCCTTTACTTTTTTGATTTTTACATTTAATTTTTCTTCTTTTTAATTTGAA
TTGATTTTAGTCTTGCAGAAAAGTTATAAAAATGCTCCCAAGAATTTCTTAATCTTTCAC
TCAACTTCCCCTAATGTTACCCTCTTAGTATAATTATCCATAGTCCATATTAGCAACTAT
AGTCACAGTTATCAAAACCAGGAAAGTATCATTTACATGATGCTCTCAACTAAAGATTTT
ATTCACCCTTTATAACTTTTTCTGTGGAAATCCTTTCCCTATTCCAGGATCCTACGTTGT
ATTTAGTCATTATTTCATGTAAGTCTCCTGCAGTTTATCCCCGTAGTCTTTCCTTGTCTT
TTGTGACCTTAATACTGTTGGAAGGGTGTTGATGAGTTATTTTGTCAGATGTCCCTCAGT
TTGGGTTTCTCTGATGTTTTCTCCTGACCAATTTGAGGTTATGCACTTGGGACAAGAACA
GTACGTGATGATGCTGTGTCCTCAGTGCCTCCCTCCACACCTTCCTGCTGTTCCTGTGCA
CATCCCCAGAGGTTGGCAGTCTGGCAAAACATTTGTAAATGTTGCTGACATCAGCTATAT
GTGAATTTAAGATTTTACAATTGTTCATTATTTAACAGTATTCTATCGCTTCAGCTCTAT
TTAGGATTTCTCACAGTAATTTTTTCCTAAGAAGGCCAGAAAATGTCTAAGATATTTGCT
TTATTCATTATTCAAAGGACTTTAACAATTGCTTTTTAGGGCCAACCCTGTAGCGAGTTT
TAAAAATAAAGCTTTTAAAAAGATGATGTTTCTCTTCGAATAGCTTCAGTTTTGGAAAAC
TGCATCTTTTTAGACTTTAATGGCAGAATAGGGCAGGTGTATCAATTTGCATTACAAAGC
CACAATTACTGAGCAAGGGCAGACATTTGAAGGACGGGAGGGAGTGCTTGATTTTATACA
AATCGTTAATTGCCTAGCAGAGAGCTAAGATTATTCCTGCGGTTAATTATAAACCATTTT
CTTCTGGAATTGCGTATGGATTACTGTCTGGGCTCACAACTGATGAGATTTCTCTTGTTT
GCAGATGACAGAACGTACCACTTCCAAGCTGAAGATGAGCAGGAATGTCAAATGTAAGTT
ATATGGAGCTGGGACTGTGAGCTGGGACTTAGCAGTTCTCAAGATTTAACACAACTTCGC
TGTATTTTAGATGGATGTCAGTGCTGCAGAACAGCAAAGAGGAAGCTTTAAACAATGCAT
TTAAGGGAGATGACAGCACTGGAGAAAATAACATAGTACAAGAACTGACGAAAGAGATCA
TCTCAGAAGTGCAGAGGATGACTGGCAACGATGTGTGCTGCGACTGCGGAGCGCCAGGTG
ACCTGAGGCTGCCCGCGCACCGCGGCTATTCAACCCATTCCAAGTCACCGAATCCATTCA
TTGATTGTCACTTTCAGTTCAAACACAAAATGAAGTGCAGCTCAGCCTGAGTTCATCGTA
TTACACAAATGTTTAATGAACCGTGTGCAGACTCCATTGGGGGAAAAGGGATGGGAAGAT
GTTTGCCTGCAGGGCCCTCACAGCAGGACAAAGCAAAGATGGCCTGATATAACTTAAAAG
ACTTAAATGCTTTTTGAGAAATGAAACCTGAAAACAAGGTCTTCCAGTTATTGTATTTTC
TCGAAGTGGCTGCATACGTATTTCTTTTCCTGGGATTTACTCCTTCATCTCTTTATACTA
CTTTTTAGAATTTCTAAAGAAACTTTAAGTCACTGTCTAGTTCTCTGATCCTGGTAGAGG
CACTACACTTTTGTTAGAGGTCAGTTTTCTTATATATAAAATAAAGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTAAAGCTATGTACCTTGCCATTTTAAAATGCTGTGACAAATAGTTGATATAAAATCTGG
TTTTAAAGTCAAATAAATTTATACTGTGTACCTACTATAAGCAAAGATACAGTAGGATAG
GTCTAGTGAAGTGAACACACAGATGCCCAGAAATATTTCTTAACTTGGGTGACATTTTTT
ATAACTTGGATGTTTTTTAGATTATCTGGTGAATAAGATTACAGTATTTACCTGCTGTGA
ATCAGTCTCTAAGGGCAACAAACAATGCTAAAGGGAATTTTGCTTATGGGCCATGAAAAT
GTGCTCAAGTGTATTTTATTTTAAATTCCCTGTTTTTAGTAAATTCAGCATTTCATCTGT
CAAGCATTTTTCCAGGACCTTCTGTATGCCAGACACTGTGCTAGGTGCTGAGGTTACTTC
TGTGAACAAGTAAACAAGCTCTGAGAGAAACATTGGGGTAATGTGAAAGTGTGGGTTTGA
GAGAAGATAAGCATGAGGCCAAAATCTGGCTCAGTTGCTTATTTGCAACCTTAACCTCTC
TGAGCATTGTTGAAATAGAAAATCTGTATTTTGAGATTTAAAACAACAACAAACCTGCCC
TAGCCATCTCATGGGACTCTTGTATGGTTAAATGAGTATTCTTTAGTAGTGCTCTGTTAT
TGCTGAAGCTCTTGCCGTGTGAACTATTACTATTGCTGCTACCAGAGTGCTGACACAGCA
TGTCTTAAGGGCTAGGTGTATTTTCTTTATTATTATTATTATTATTATTATTATTAGCCC
TTTGTGACAATATAGACATGTATATTGTAAATATTTGCACCTGTAGCACTTAACCTTTGG
GTCCTGTTTTTTCTTGTTGCTCTCTTGATAGTATGACTAGGTTGGTTATGGGTATGGTCT
GTGTTAAGGACTGGCCCTTGAGTAACCCATGGTCACTAGAGTTTATGGACTGTGTCTTTT
TTATTTTTGTCCCCATAGCATATGGCACTTAGGAGTGTTTGATAAATAGATGGAAGAACG
GGGGTGGGGGAAGGAGAACAGACATGCTCGTTTTTGTGTATTGTATATAAATTGGTGGTA
TTTAGGGATGAAAGAGGACTTCAAATGTGTTGAAATTTAAAAATTGTGGGAACTCCATGT
TCAGAAACTGCAGGGAAAAAAGTTCTAAGCCCTGACCTTCTACTTATTGTAAGCTCAATT
TACCCTGTTCTCTTTGGCAGATCCCACGTGGCTTTCCACCAATCTGGGCATTCTGACTTG
CATCGAGTGTTCCGGCATCCACCGAGAGCTAGGGGTTCACTACTCCCGGATGCAGTCGCT
GACCTTAGATGTATTAGGAACATCTGAGCTCCTGGTAATTTTCAAATCCTTGGTTTTGGG
CTAGAAATAAATAAACTGAAGGCTTAAGTATTTTTTTTTTTTGGCATTCTAATCATTGTA
GTTTCTTGAGATTTCAGTGAACTGGCGATGGTTGATATATGTTGCCAGTTGGGTTTGGGC
AATTAGAAACTCACTCCTCATCTATTAGTAGTTGAGGGCACTTCTTATTGCAGAGCTTTG
TTCCTAAATGAATAAAGTGAAGTGAAACCATAAAGGAGCATTGAAGCTAGTGTAAGATTC
TGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAACAAATCAATTTTACTGATAAATATAATAAAGCATACAGTTCATCAA
AAGTGAACAATCACTGGTATTCGTTATAATTGCATAGTCGTACACTCATCACTTTAATCA
TTATAGCGTAGAGACGATTGAGTCGCGAAGAATTTTCTTATTTGTCCTGCGCTTTTTTCT
TGCTGTTTATTAGTATTATTATTGAAAGTAATGAAAATGTTCTAGAATTGTAATTTTTAA
TAGTCGCCGTATTTACAGCTGACTTACAAAGTTCCTAAAAATTTAACAGCTAGTGCTCAT
GAGCTCGAAGTATTCTGACTCCAACCCATCTCTGCTGTAACAGCTTTAGTGTGTCTCAGA
AATTTAACTGACGCAACTTCATGACACTATTACCTACTAAGAAAAAAAAAACAAAGAAAA
TTTAAAGGAATATATTGTTTCCATCCTGATAGAAAGATGAGATGACTTTTCATTCCTAGT
TCAAATCTCATTTTCTGTCTCCCAGAGCCTCTATGTCTTCTCTTAGAAGTTTAGAGTTTG
ACCAACACTGAACCATTATAAAGAAACCCAGCAGAGCCTACTTAATTAATATCTAGATAG
AGATATTTTCAAAATCGAAATTTCTGCCATAATTTTCAGACTTCCCTTGCTAGCCTTTTT
TCCTTAGTGCCCATCAGAAAAACAAAGGGAAGAAAGCCCGTGAACTGTGTGGGATTGCTC
TCCCACTCTCTGCTTGCCTTGGTCTGGCTGTCTGGTGGCTCCCAGGATGTGGTTGTGGGA
TTGGGATTCTTACTCCATTCCCCATTTACAAGGTGATAGGACCATTGGCTGATGTTATAT
CCAAAACCCTTTTACCCCTCAGCTCTTAAGATAAGCAGTAGACTAGCATATGTGTCAGAT
ATTAGGATGCATTTTTTTTAAATCATGGAAATCCCAAGCCTTTTTAAAGCACCCAGGGTT
TTTATTTTATTTTGCTTAGATAATCAGATGCGTGAAGAAAGGATTTTCTGAAGGCTTGAC
ATATATAAAGCATTTAAAATTATGCCTGGCACATAATAAGAGCAATAAAATATGAGCTAT
TGTTATTATCTCCTCTGAGATGATTTCAATAAAATCCTTTGGAAAGATGAGCCACAGGAT
CCATATGAAGATTCCACACATTCTACTCTGGTTGTCTGCTCTTTGGATGACCCTTTCTGA
AATTCTTTGAAGCATTTCAGATTCATAGAGCAGTGATGATGCCATTTAGTTAATTAGTTC
ATTATAGTATCATTTCTTGTGCAGCAAGTATTAATTAGACCTCTTTGTACCCTAGTAAAG
GAGAAGGTGGACTAGGATAGAACTTTACTGGAGTGTGCACCAGCACATAGTTCTTTCACT
GGAGTGGTTTTCAAACCACTGGGGTTGATAAGCCAACATGTGGGCTGTCTTCTCGGATAA
ACCAGCAACATAGCCCTCACCTCAGGGTGATGTAGTATGACAGGAAAAAGATTTTTAAGT
GGCCTGAATGAGACAACAGATAAATGAGCAGGATCTCATTTGATTGCATTCTCAGTTTCT
TTCTGGCATTGTTCCCTTCAATAGACAGATGCTCACCCCATTAAGTGGACTTCTGTCCTC
CCATATGGCCTCACATATTCCTCCTAATAAAAGTCTTTTGCTTAATTCCATAAATTATTT
TCTGGCCTTAGGTTTTGCAGACAGTTTCACTGGATGGTATTCTGTCGTCGTTTCACCATT
TCCTTTTTAATTTGTTTTGTTTCAAAGTTTGCTTGTTTTCCATACTAACTGAGTGGATTT
CAGCCATATCTATGAAGGTGACTGGTTGATAATAAATTTTTTTTCTCTCTACCTGCTTTT
AGAATCTCTTCTTGTAAAATGGAATGAAACGCGGGTAATTGAAGTAATAATTTGTTTACT
TTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAAAAATTCTTTGCAGGGCATTTGCTTCAT
GGTTGACAGGTGCTATCACCTTCGTGGGGTGCCACCCTGACCACTAAGTCTTATCTCTGG
GGGAACAGAATGAGCCCACAGAATGGGACTGAGGAACACAGTCCCGAAAAAGAGAGTTGG
TTAGTTTGTTGGGTCTGTCTTGGAAGTTTGGTTCTCCTATCAAAAGCAAGGTAAAATTAG
GAAAGCTCATCACCCAATTCTTAAGCTACCGCGAATGCTGCTTTTGTCCTATTTTTTAAA
ATACCTTCAGAATTCTTCACTGTCCTATTTCACTGTTTAATGTTATTTGCAACCAGGAAG
TTCTGTTTTACCTTACCTAGATACTTTCTGCTGTTCTTTAAACCACTTACCCCATTGAAA
CAAAAAAGACATTCAAGCAGCAGTCTTATATCCCAGAAAAATCTCCATGAACCCTCTGTC
TACAAATTAATTGAGATTAGAAAGATCAGAACTATCACTAACAACCCCAGTACATCATTT
GCAACATGGAAATTAAAATATGTATTCACTTCCAAACACTGGTTTCATTAGCATTTAGGA
ATCTGATCTGGAAACTGATGTCTGTGTTAGTTACTGCTTTTACTGTTAGAGTTAAGAGGA
ATAAATCTGTGCTCTCAAGGAGCTTCTGATAATTTAAATAAGTCATTCATTCCTTCCAAA
AACAAGTCGCCTTGTTGCCAAAATGACAAACTGTGACATTTATCTTAGTATCTGCACAGA
GCCCGGTAATTAGTAAGCATTCAGTTGAAATGTGTTAATTTAATCTTTAAGGAATCAGAA
GTTGTTAGGCAAATGGAGATCATATACATGTGGAATTAATACAGTGCATTTTTATTTTTT
ATTTCTATTTTTTTTTATAATACATTACCTCTGTTTTCCTTTTCGGAGGTACCAGGAGTT
GAACCCAGGATCTTATTACCTGAGAAGCAGGTGCTCAACCACTGAGCTACATCCACTTCC
CAATGAGAGCTCGTTTTTTTGTTTGTTTTTATTTTAGGAGGTACCAGAGAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCCTCATTGTTAACAGTTGTGTCGCCAAGGTGCTTGGATTCTTACCAGG
TCTAAATGTGAATTATGGTACAGAAAAAGTGCTGCCAGGTGTGGAGTTTTGCGTGGCAAT
GCTAATAAAAAAAAAAGCCCCAGAATATGAGAATAGAAAGTGGTATCTGAAGGATCCAAC
TTCTGGTGTCTCAGACAAAAAAAGACCTAAGTAGACATAGCTGCTGAATTCTGAGCCCTA
GAGAGCAGACTCTGCGTCTGTGACCCCATGACCACCTTCTGTGGGCCCACTCCACAGGCC
TGTGCTCTGAAACGAACCTCTCCCAGGGAGTGAGCAGAGTGCTCCGAGGTAGAGAGTGTG
TCAGGAAAGAAAAGAGCCACACTTTACCACTGGTCTAAGCCAGAGATTATAAACTAGGAC
GCTGAGGTATGTGTGTTTAATTTGGTTGGAAAAGTTTTTAAAATTTTTAAAGTAGAATGG
CCTTTAGAAAGTATATGCGTATGCAGTTTACCACAGGCCCCAGTCTTCCCAAAAGTTTTC
TTCATTCTGCCTACTCATTCATGGTAACTGCATGGCAGCTAATGGCCAGACTTCAAAACT
CCTTCCAAGTGCATCTTGGTTTCCTGACTATGGGTTGGGGTTTGCGGGGGTACCCTCTAC
CTTTCCCTGCCGTTTCTGGGGGGAGGAGTGAAGAGGTGATAGGCAGGGCAGCCTGGGATC
CACCGTTCTTTCCCGAGGAGCTGGGACTCAGCTGGGCTCATGGCGAGCCCAGATGCCTGC
CCTTTGACAGAGCCTGGTGCCAGCCTAGCACCAAGAACATAGCGGGGTTTAACAAATACC
CAGGCAACTGGCTGATTGATGCCCCTCTCCCTCTATACCTTCTCAAGGGGCAGGAGAGTG
GCATTCTTGGTTTCTTTTCTCCCAGAAAAAGATAGCAAGGAGAGAGGAGAGATTGGAAAA
TGGGGCTCTCTGTTTTGCATTTTTTCCCTGGGAGCAGTGGTGTTGTCTCCTGGTGGTGCT
CTCTCAGGTCCCCACTTGTCTGTCCCTTCCTCCTCGGCATGCAGTGGTCATCCTTTGTTG
CGGGGCTGCCTGCCTTCTTGGTTGGATCGAATGATTTATCTTGCTTCTGGGGAGCACAAG
CACCTTATTTGAATAACATAGTTTTAAGTGGGAAGAAGTTTTGGAAGTCTTCTGAAGATT
CCCCTCTTAACCTGTTTTCAGAGGACATTCCTAGGGCAAACAGGCACACAGGAGACTTGG
GACTCTGAATTTTGGAAAAGTAACTCTCCCCCTTCCTGGCAAGTGTCAAGTAATAAGATG
GAAAGAAAGCTCCAGCTCCTGTCTTTCTGTGGGACTGAATGGGCAAGTCCTGCGGACTTC
CTCGGGCCCTGTCTTTACTCGGCCTCCTGGCCCGACCGGGCAGCCTCAGCCTGGGGGGCA
CCGACGGCGAAGCGGGAAGGATGCCAAGAGCACCCGGGGGGCACACCTGCCCCACCCCTC
AGTCCTGCTCTGCAGCACTTTCTTTTCGGCCTTCTCTGCCTTTGGGGTTTGTTTTTCCCT
ACTGCCGTGCCAGGCTTCCTCATCCGGACAAGCGGGGCTGGTGCTGTGTGCCTTCCAGGG
TCTGCCCCTCGGTTCTGGCGGCTCGCTGCCTCTCCAGTCCACGCGTCCCAGGTCCCCCGC
CAAGCGGCCCCTCATCGCCTGGCCTGTGACTCACCCTTCTTTCTCCTTTCTCCTTTCTCC
ATCCCTTCTCTCGGCCAGCGGGAACCTGGACAAACAGACAGGGAAAGGCAGCACAGCCCT
GCACTACTGCTGCCTGACTGACAACGCCGAGTGCCTCAAACTCCTCCTGCGGGGGAAGGC
CTCCATCGAGATAGGTAAACGGGCAGCGCGGGCTGTCTCCAGCCGTGGCTCCTGCGCTGC
CTTTGCCAACAGTCCACGTGCTTTGGGCTCCTCCTCTCAGAGCTGAGTAGAAGTAAAACT
TGACCTCTGAAGAGAAAAGAGCCTCTTCTTAAATGTCCTTCGAGGCTGTTTGTGGTTTCT
ATATTTATTAGCCCTGTTTGCCAACTGTTAGTAAGACTTTGGTTGCATCTTAAGGGCTTT
TACAGATTATAAGAAAGGTAAGGGATAGGCCCTGAAATTATCACTGATGCTGAGGGCAAT
TTGGACGAGTTTTGGGGATTTTTGCCTCTCGCCCATGGTCCATGAGCCTTATTACGAGAA
ACCACACCTCACGTCAAACCAGCTCCCCTTACTCGGCTCTGGGTTTAGAAGGTCTCCTTG
TGGAGGCGCCAGTTGTTGCCCCTCTCCTGTCATTTGTACCAAGAGATTCTTGTTCTTGTT
TGGCTTCCATCCCTTCCTTCTGCTGGGGGACCCCTGACAGGGTTTTGCCCTGAGAGCACC
CAGCTGTTACCACATTACGAGGAAGTACTTTTGAAGAACCATTGAACAGAGCGTAAAGAG
GGTAAAGAAAAATACCTGCTCAAAAACCATGTGTCTTACCAAAAAAAGATTAGTCAAACC
TCAGTGACTGGAACTTACTTAGAAAAAAGTTCAAAATGTACAAGTTTTTAGATTGCTGAA
AATGTGTTAAAACTTTATTACATTGAAATTTCATGGAACTGGGTTAAGTGTTTCTGTTAG
AGTTTTGTAATGAACTCCTTTGGTTACTTGAACAGTTTTAGTTTCTTGATTAATGCAAAC
CTGATCTTTTAAAATCTTTCTGACAGTTCTTTTCTCCCTATACAAATAGGGCATAAATTC
AACTCTGGGTCTACCTGGGTATCATTAATCTTCTTTAATTTAATTTAGTGCTGCTTTAAC
TGGATTGTTTTTTCTTAATTACCTCTAGAAATCAGACTTTGGCTTGTTTTTGCAGTAATG
CTCGCCTTTCCCTGCCTTGACTTTCAGCTAACGAGTCGGGAGAAACACCGCTGGACATAG
CCAGGCGCCTAAAGCACGAGCACTGCGAGGAGCTGGTGAGCCTCCTCATGGCCCTGGACG
GGCAGTGGGCGCCCCTTCCTGGACAGCGAAGTGGTCCTGCCTGAGGAGTGTTTTCTCTGA
GCCGCTCATCAGGTGTCCTCGATAGGACTAACTAAGAATTGGTCTGACTTGGGGAAGGTG
TCCCTGGAGTCTTTACAAAGGATGTGGCCACTCTCTCCCCCACCTCACCCTTGTGGTGAG
GTTTGGAGCACAATTGAGTTTTGCTGTTGGACATGTCGATAGCGGTACCAGCCTTATCTG
GGGCAACCGGAACAGAGATCCAGAGGCCTGACACGGGTTTGCCTGGCCTCTAGTGTCCTA
AGCTGTTAGCGCATCACTTTACAGTACTCCAAAGCCAACTTTCTGATTTTGTTCCTCAGA
CCCAAATCACTTGGGTTGCTCTACACCATCTTCTCCTTTCCTGTTCCGGAAGAAGAGGCA
GTATGGACCATTGGAAGAGCCTTCTGGGATGAGGCCGGGCTGGGTTTACAGTGGGGTGCT
CCACCATAACTTGGGCAAGCCACTTAAACTCTTAGGACATTTTCTTATTTATAAAATGGA
GCCACTTATGCAAGATGGCAGGGCAGTTGTGAGAATTGTTGTTGAACTCTATAAAGCAAT
AGCAAAGAGTAAGTGCTCATAAATGGAACTTAGTAGGAAGTGCTATCTAAATGTAAGATA
TATCTATATCCACTTCTGTCTATCTGTATCTGGGTACTTTATATCTGTTAACTCATTTAA
TCCTCATAACTACCCTAGGAGATATTTTCTACTATAATCCCCATTTTATAGGTGAGGAAA
CACGCACAGAAAGGTTAATTAACTTGCCCATAGTTAATTAACCTGTGGCCACTATGTGGC
TATGGAGGATAGCCCAATTAAGACTTCTGCTGTATATAATAAATGAACTTCTCCCCTGTG
CATATAGAATGGACCTAGCTATCTACCTTCCTTGGGAGAATAAGAAAATAGTCATTCAAA
TCATTTTTTCCAGGCTTAATTCTGTCAAATTGGTCATAACAAGGAGCCTTAGACTCAGAA
GCTTAAATAAATGAGTCTTGTACTGAAATGTGGGTTCTCTGCTTTCGAAGACAGGCTGCC
TTGTGTGCTCTTTGGGCATTTTGGTGGATACCTGTTACGTGGCTGAGTGCATGAGCTACA
TCACTGACCTTCCCTTTGCTTTCCTTAGCTGACTCAAGCCTTATCTGGAAGGTTTAATTC
TCACGTTCACGTCGAATATGAATGGCGATTGCTTCATGAAGACCTGGACGAGAGCGATGA
TGACATGGATGAGAAGTTGCAGGTTTGTGTCAAATTGCAAAATGTTAAAAGGGTTTTAAT
AAGCCTCATTCAGAACAAAACGGATCCTAGCCTGTAATTACAGCAGAAAGCAGATTTGTA
GCAAAGAAAACATAGTTTTCTTTTTGTTTTCATTGCTTTCAGTAGATTTTTGGTTTGTCC
CTTTCCACTACTACCCTTTGTCTCCCAGCTCCTACATACATTTCATTTAAAGGAATGGTT
AATTATGTAATTAAAGGGAACTGTTCACCTATTGATATGAAGGAAAGGACCTTTGATGCT
AGTGGTTTTTAGAGGATGCCCACTCATATGGAATAATGTCACAGTTGATTATGTTTGACC
AGTCAGTCGTGTTTAACTAGATGATCTTTTAAAAAACTCAAGTGAAATTATTAAGTGACT
CCGCCCCTTGGGTCCAGTTCCCTCCTTTATCAGACTGGGAATTTGGAGCCTCAAGAGATA
AGTTGACTTGGCCAAAGTGAAACAACTCTTTAGAAATAGACTTGGGACAAGAATCACATC
TCTTGTCTTCCTATCCTGCTCTCTGCACACAGTACTCACTGTCTTGCTTACCTTGTTGAA
TCCCAGGAAGGTTGACACCTTCAAAAAAACTTCAGAGCTGAGATTCCAACTCAGGCAGTC
TGATGTCAAAGCCCAAACTCTTAGCTGCTACCCTGTGCTCTCTCCCTGCAACACTGTGTT
ACTAGGTATGCCTGCAGAAGTGTTCCATATTGACATTAGTGGGAAATGCCATGTGCAACA
TATTTCAGTGGTTAATTTTTCTTAACTGCTTTTAAAGGCTTTTAATGTTATAATATGTAT
TGAGGATGCCCAAAGATGTATATGTGACATTTCGGAAATGTATTTGTTCCTTGTTTGTGG
AATGCTTATGAAAGTCTTTACTTACTATTTCTCTAAATATAGAATAAGAAGTGTCCTTGC
TGAATTAGATACCAAACAGCATGAAAGTGAGAGAGCTGCTGAATTTTATACTTACTTACC
TATACCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACCAAAAA
AAACAGAAAGCTGAAACTCACCTCAAAGTATCTCTCATAGGTAGTTACACATCACATCCC
CGTTTTGAGCAAGTGATTAAGGAAGTGACATAATCCATGTTAAAAGTGAAAAGGGCTCTG
CTTCGTAGTCCTCACTCTCATCCACCCCACTCTCTCTTTCCAACAGCATATGGCATTGAG
TGGCTAGCATACACAGTGTACTTCCTTGGAATTAAAAAGTATGTGTGTGGGTCACTGGAT
CTAAACACCCAAACAGAGCAAGAGTAAAAGATGGCAGGCTCAGGAGCTTCCTAAAGGTGC
TCCTCTCCCGTCACATCAGGAGGCGCACCATGACTTTTAATCACTCACCAGAGTGTTGTC
TCCCACATCTTGGCATTGTAAAGGCAAGCACCAGAGGCATCAACAAAGGGAGCAAACCAC
ATTCACTGAAAAACAACTAGAAGATTTGAAGATCTTGTTCAACAAGAACCTGCACTCAAA
CCCTGGTCTTCAGAAAGAAATGGCCTTTAAAATGGGCATACATTCAACCCAAAGAAGGTA
GTATTGCAGGTTTGGTTCAAGAACCATAGAGCAAAGCTCAAGGAAGCAAAATACAAGTAT
ATCTAGCAAAAACAACAAGAACGAAATGATGTTGATCAAACATCTGACCTGAAATGAGCG
TGTAGACAGATTTAATGCTTAAGAAAAAACAAACTAACAAAAAACAAGAAGCTCAACAGC
AGTGATTACTTGAGGAAGGAGTCAAGAGCAGTCCCTCCAGGAGAAACATGGACACACCAC
ATAGAGCCCCTACACATGCTTGTCCTGTTTCCTTAGTTTACACAAATAATTCACTACCCT
CATTCCAACTTAGCACATGTCTCAACTTCAGAGTCCCCGCAGACCACTGTGTTGGTCACA
AAACAGTCCATTTCAGCTACTGCCAAGATCCTAACACATACTGCCTCTATTACATTTTGG
AATCCCAGATTCTTCCCCCAAGCTTGGGTTTTAATTCTTTGGTGTCTTTATCTCTACATA
TCTCCATTACAACTTTTCTGTAAATCTAAAACCGTCCCCAGATTGAAAGTTCATCCTTGG
GCTCTGCTTTTAGGATGTGCAGTCTAGGCCATATCCACTAAAAGATACTTTTTGAAGAGA
GATCACATATCACATGGTAGACAGCCTACTGGGAATTGAGTCATGTCCCTAATAAGACCT
GCTCAAGTCCTAACTCCTGGCCCTATGGCTGTGAACTCATTTGTGAATAGGACCTTCAAA
GCTCCTATTAAGATGAGGCCAAATTGAATCAGGGTGGGTCTTGTCCTCTGTCTAAAGCCC
TTAAAACAAAGGGAATTTGGACATGAAAGTAGAAGCCCCAGGAAGAGACCAAAGAAGACA
GATCACCATGTGGCAGAGGCATGCACGCCACCATCAGAAAACTGTATACTTCTGAAAAAG
TGTGGCCTGCCAATACCTGATTTCAGGCTTACGGCCTTCAGAACTGCAAGACAATAAATT
CCTGCTGTTTAAGCCAGCCACCTGCAATGTATCTCATAACAGTCCTGGAAAACTAAAACA
GCCAGAGCCAGGTTTAGAGAGAATTTGTTGGTCTTAATTGAATATATTAGAAAAAATAAA
GGCTGATAATAATGATATAAGGACGTATCTCTAAAAATTAGGGTGGGGAAGCAGTAATTA
AATCCAAAGGCAGAAGAAAAAATGATGGAAGAAAATAACAAAGGTCAAAGTGGGTATTCA
TTAAAATGAAAAGGGTGACGCAGAACCCTTGCCTGGTGGGTAATGCTCTGTGCCTGCTAC
AACTAGAGATTTCAGGCTACCTGTCTACCAACTAGGAAGAAGTGTATCACCAGCTTGGAA
AATCCCCAAACATCAACACAGTCTATAAAGTCCAGCAAACCTCTGAGTGATGCTCCTTAA
GGAAGAGAAATAGTTGCTGCCCTGCCTTCCCTTCTCTCCAGCTCCTAGCACTGACTTGCC
TATGCAGCCTGTCAGCCAAATTTGATTAAATTTTATTGAAGTATTCAGGAATTATTAATG
GTGAGGAGAGGATTATACACCTTTTTCACCTTCCGGGCCAACACTCACCAATAACCTTCA
CTGTAGTCCAACTTTGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTAATGCTGCGTCATTGGCCAGAGATGCCGCGAGCCT
TGCCAAGGACAAGCAGAGAGGTTTTGTGCCTAGCATCCTGCAGAATGAGACATACGGAGC
CCTCCTGAGCAGCAGCCCCCCACCCACCCAGCCTGCAGCCCCCAGTACCACCAGTGCGCC
CCCACTCCCTCCCCGGAATGTCGGCAAAGGTACAAAACTATTAGCAGCTCCTTGCTGATG
CTGAAAGGATTTTGTGTTGTTTTTTGCTTTAGGAAGTTTGTAGTTGCTTTGACCCCAACT
ATATGGCATTTGGGCCAGTATCAGGATGTTTCTTTTTCATTAGGGGTCTTTCGTTTCGTC
GTTATTTTCTGTTTACTTTGTAAAGAAAGATTCCATGAGTCTTAACATGCCAAGGGGTGG
TATCTCATTCTGGGCAGAGGTGTTACGTCCGTACGTGATTTGGGTATCCCACCAGAGTAG
CCTTCAAGATGATGGGCCACTTCTTGAGGCTGGAAGCCATGAGGTGTTTTCCCGTAGACC
TTCTTCCAGTTTCGTTTCTCTTTAACTTTCACCGCTCACCAAACCCCCCTTTGCCTTTTT
TATTTCTCCTCTGCCTGCACTGTAGGCCAGCCTGTGGCACCTGCTGTACTTCTTTCTTTC
TTTTAAAGCAGTTTTATGGAAATATATTCCTACCATACAATCCATCCAAAGTGTACAGTC
AGTCTGCCTGTATTTCTTACCTCTATGCTCCCCACAAAATCAAGGATAAAAAAGACTAAT
TTTGGGAATAAGGCTCAGCCTAATTATAAAAATACAAGCTAGTCTTTGAGGGCACTACCC
ATGCCTTCAGTGTAAAAAAGCATGCTACATTTACCTCAGTTGGTCTATCACAGCACATAG
TTGCTGTACTTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGCTTTGCGAGGCAGAGCAAAGACGTGTGGAAAAGGAA
ATGCTCGTTCGTTTGTGGGTCACTGAACCTGCCTTACTTCTGGCCAACAATATGTTTGCA
GGGGGTCAGTAGGGAGCGTGCAGATCAAGTCACTGCCTGTGAACAGCACTGACTCCTGTG
GGCTCACAAGGAGGGGCTTGGTGGAAGGATAAGGAGGAGCTGAACTTCCATGTGCAGGAG
ATGGGTATTGGTTATTTCCCTCTTTAAAAAACATTTGCATTTGAAAAATAAAATCTGAAA
ATTTTCTTAAAACATCTCTGGTTTGGTAAATGTCAGTGTCTATCTTCCAGATAAGAGATA
AGCACCGTAATTTTAAAAAATAGCATCCTATGTGTTCTCCTGATGCTGTTCTAGAAGGGT
CGTGTTGACCATTTTATAAGGGAGAGGATCAATAATGCAGTGTTTTGTTTCTGTTTTTGT
TCTGTGTGTGTGCATGTGCGTGTGTGTGCTTGGGTTTAGTTCAGACAGCCTCCTCAGCTA
ACACCCTGTGGAAGACAAACTCTGTAAGTGTGGACGCTGTAAGCCGGCAGCGATCTTCGT
CAGATCCGCCAGCTGTCCACCCACCGCTGCCCCCTCTTCGCGTGACATCTACCAGTACGT
GGTTTCCTTTTTCCTTTCTTGCCGGTGTGCTTTGTAGGTCTGGATGGCAGGGGATGCTTT
TGGCAGCCAGAGGGGGAGAGAGCCGCAGATCCCCTCACTCCATTGCTCCACACACGTGCC
TGACCCATGGCTCTTCTGCGTGTGGCCACCCCAGCTCTTCTCACCCCCGTCCTCCCCAGC
TGCAGGCTCCTGTCTGTGCCCACCCACACCTACCCCAACGTGGCCCACGCACTCTCCTCC
TCTGTCTTCCTGAGCATTTTAGTAACATTTCCTCCTTCTGCACATTAACCCAGGGTTTTC
CTTTTGTTGGTTTTCGGTATTTGGGGACAGTCATTTGGATCACAGTCTGGGATGTGGTTT
ACTTCACTGTCAACATGTAGTCGAAAGTCAGCAAAAACTAGGGTAGGGAGGCTGCGGGAA
GAGGGTTTTCCCCACCACGCAGAGGCAGAGGCTTCCACTGGGTCTTCACTGGATCGGTAA
TGCTGCTGCCTTTTTCCTGCTCTGCGTCAGCTGAAGGAGGGAGGCAGGGTTCTGTCATCT
GCTTTAAGGATGCTTTAAGGGAAATTAGAGTACTCCTAGGTCAAGGTGCTTGTGAACACA
CACTGAATTTAGGAAAATAAATTAGAGAAGAGAAATCCCAGCACAAGCTACAGTAAGAGC
CATATGTGTCTAAGCTGGGCCTTGGAGCAGCATCAGCTCCTTCCTTTTTTGTGACGTTGG
TGACAAAACCACTGAACAGAGGGTGTTCCAGGGACGCCTGAGACCCAGAGGTGGGTGTTG
GTGGGGAGCAGGGCAGAGCTGCAGACAGACCGGGGTCACTGGGCAAGGGGGCAGTCAGGG
GGAGCCAGGGCCCACTTTCCTGCCCCTCAGTCTGGTGCCCCTGGCACTGTAGATTTTGTG
TGCTAGGGTCTACCTTTCATATTTCCTTTGAAACAGAAAAAAGAAACAAGAATGAAGAAA
GAAAAGAAAGACTGTACACCAAATTCCTTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 6307..6452, 31221..31295, 31396..31445, 31546..31675, 42106..42191, 49489..49494, 49500..49569, 49894..49980, 57681..57784, 57885..57954, 63105..63192, 64804..64852, 64930..65096, 67640..67773, 91200..91294, 91395..91584, 91685..91770, 93618..93733, 94767..94834, 96028..96141, 117274..117342, 117445..117628, 119619..119752
1001..1073, 6307..6452, 31221..31295, 31396..31445, 31546..31675, 42106..42191, 49489..49494, 49500..49569, 49894..49980, 57681..57784, 57885..57954, 63105..63192, 64804..64852, 64930..65096, 67640..67773, 91200..91294, 91395..91584, 91685..91770, 93618..93733, 94767..94834, 96028..96141, 117274..117342, 117445..117628, 119619..119752
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved