Dasypus_novemcinctus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus NOL5A
Dasypus_novemcinctus
NOL5A
GeneScaffold_1303
SNORD110, SNORA51, SNORD86, SNORD56
1366..1435, 2179..2310, 3149..3237, 3580..3655
6985
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTCATCTGTTTCTCCTACCCCCAGGTAGAGGAGTGCGTGCTCA
ACCTGGGCAAGTTCCACAGCATCGTTCGTCTCGTGGCCTTTTGCCCCTTCTCCTCGTCCC
AGGCTGCCTTGGAAAATGCCAACGCGGTGTCTGAAGGTGAGTCGTCACCCCAGTTATTCC
CGGAGATGAGCGAGATGTGGATCCTGCAACCGTTAGTCCTACGGGGTTTAGCGGTAGTAT
TTTGTCTTTCTCGGGTTTATTTTTTTCTTAGGGGAGGTATCAGGGATTGAGCCCAAGACC
TCATACATGTGAAGCAGGCGCTCAACCACTGAGCTACACCCATGCTGCTGTTGTGTTCCA
ACCATTTTGTGGGCCGAGTCCTGTTCTTCCCTCCTCCAACCAGGCTTTGCGGTGATGACT
TGCGAATCTGTCAATCCCCTGAGTGCAGTCGCTGATGTCTCCATGTCTCTGAGCAATGCC
GCAAGGGGGAACAGGGTGTGCTGTCCTGGTCTACCCTGTCGCTTAGTTTTGGGGATAAGT
TGCCTTTCTCCCTGGCAGCCTCCTTCAGCATGTTAGTGGGAGCTGTGTTCTTTACTCCAA
GGCGTTGTGCACGAGGACCTCCGCCTGCTCTTGGAGACACATCTGCCTTCCAAAAAGAAG
AAAGTACTCTTGGGGGTTGGGGACCCCAAGATTGGTGCCGCTATCCAAGAAGAGTTAGGG
TACAACTGCCAGACTGGAGGCGTGATAGCTGAGATCTTGCGAGGTGGGTCCACCGCCCGT
TTTGCTCTTGCCATTCGTGACACCTCGCGGGGCAGGGGGGTGTGGGCGCGTCGGGAAGCT
CCCGCTGGCTGAGCCCAGTGGTGCAGGCTCCATCCTTGCTCACAGTCCCGCCCGTCCCCA
GGAGTCCGCCTGCACTTCCACAACCTGGTGAAGGGCCTCACTGATCTCTCTGCGTGCAAA
GCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTGAAGTTTAACGTAAACCGG
GTGGACAACATGATCATTCAGTCCATCAGCCTCCTGGACCAGCTGGATAAAGACATCAAC
ACCTTCTCTATGCGCGTCAGGTAAGGCACAAGGATGGCTCCTGAGCGCAGTGTCTTTGGT
CTGTGGTTTGGCTAATTATGACTTCTGTAATCAGGATTGACAGCTGACAGCTTCTGTGGT
TAGAACAGGGTGGGGGCTGGGCCTCCTGGTGCTTACCACAGGCTGTGTTCTTGCACTGAC
TGTATAGAAAGAGGAGGCAGAGTGAGCTCGCCCCATGTACACCTCAGCCCAGGCCTTGTG
CCTGGTCTGAACTGTGAATGGGGAGACATGGAATTATTGAAGGAGCTTTGGAAACCTGGC
TGTATGTGCCTTTGCTATTTGGGATGTGGCTCCTGGGCTAGGCAGACTGTGCCTCTTTGC
AGGGAGTGGTATGGTTACCACTTTCCGGAGCTGGTGAAGGTCGTCAGTGACAATGCTACA
TACTGCCGCCTCGCTCAGTTCATTGGAAACCGAAGGGAGCTGAACGAAGAGAAGCTGGAG
AAGCTAGAGGAGCTGACAATGGATGGCGCCAAGGCCAAGGCCATTCTGGATGCCTCGCGG
TCCTCCATGGGTCAGTCAGCAGAGCCGGCAGCCAGGTGTGAGACCGCTGGCCTTGGCTGG
CTAGGTCCTGCGTTCACACCTAGTATTTCCTAGGCATGGACATATCTGCTATCGACTTGA
TAAACATCGAGACCTTCTCCAGCCGTGTGGTGTCTCTGTCCGAATACCGCCAGAGTCTGC
ACACTTACCTGCGATCCAAGATGAGCCAAGTCGCCCCCAGCCTGTCAGCACTAATTGGGG
AAGCGGTGCGTGGGGGCGATACTAAAAGGGGAGGAGTGGGAGGAATGTTGCTGTATGTCT
GCACTGCTGCACACTTCCCCAGCTGTGCTTGATGGAGATGTGAGCAGGATTGTGCAGTCG
GTAGACAGGCAGTTTCCACTCCTGACTCTTTCTTGACTCTCTCCAGGTAGGTGCACGTCT
CATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTACCCAGCATCCACAGTGCAGAT
CCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGCGGGCATCTGCCCACACTCAGGTG
CCGCTTCTGGTGCCCGCTGCTTGTTTGGGGATCACAGTGATGGCTGTCCAGGGCTCCCTG
ACCTGTGCAGGCCTCTGCCATGGGGGTGATGATGGCCAGTCCTGGTGTCTGAGTGATTCC
CAGGGCCCAGCAAAGGGACCAAGCTTCAGGTCAGCGGCATGGATACCTTGTCTCTGGGAG
GTGGGGGCGGAGAAAACCTCAGGAGACAAGGGGGGGGTTGGGAGTCCTGGTGTTGAAATC
CACTGACTTAACTCTCTCAGAGCCCTGAAGACGAGGGGAAACACCCCCAAATATGGACTT
ATTTTCCACTCCACTTTCATTGGCCGAGCTGCTGCCAAGAACAAGGGTCGCATCTCTCGG
TACCTAGCAAACAAGTGCAGCATCGCTTCACGGATCGACTGCTTCTCAGTATGGGGCAAG
GGGTTGGCACGTGTGGGAGGGGGTGTGGCCACCTCAGCTTCTACAATGATGGCAATATTT
TTCGTCAACAGCAGTTCACCTATTGCGTGAGTGTTGATTAGTTTGGGTCTGAGTGAAGCT
GAGGGTAGAGGGGGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTGGTA
GGTGGGCGCCCTGTCCACTGGGCCAAGTCCCCTTCTTCCCCTCTGGAACTTGACACGATA
GTAAACGGGTTCCTGTGGCAGCTCATCCTTACCTAATATGGGGGTCTTCTGTGGCTTATG
GGCTTAGGTGGTTTTCACTAACCCCAAATATCCTTACTTGCTCAAATCGGAATGGGTATG
TGTGCACATGTAGTGAACAACCTTCCCCCCCCCTTAGGAGGCAACTGAGAAACCCAAAAA
GAAGAAAAAGCAGAAGCTTCAGGAGGTGCCTCAGGAGAACGGAATGGAAGACTTGTCTGC
CTCTTACTCCAAACCCAAGAAGAAAAAGCCCAAGGAGGAGCTGGTTAGTGGTGATCTTGA
AGAGACCACTGGCAGCTCAAGTGTCCCCAAGAGGAAGAAGTCTCTGCCCAGAGAGGAGCC
AGTTAGCTATGTGGAAGAGGCAGCCAACAGCAGGAAAGCCTCCAAGAAAAAGAGGAAGCT
CTCCTCGCAGGAGGAGCCTGCCAGCAGCGGCCCTGAGGAGGCTGCCACCAGTAAGAGCAG
CTCCAAGAAGAAGAAAAAGTTGCAAAAACTATCCCAGGAGGACTAGAAGCCCCATCTCCT
ATGCCCCAATAAAAACATCCACAAAGCGGATGCCCATGCTTTATTTTATTGACCAGCTTG
CGTGGTGGGGCGGGGCCTATGGGGGGCAGGGCAAGGTGGCAATGACAGCCTGGGTGAAGT
CGCGGCAGGTGGCATAGCCACCCATGTCAGAGGTGCGGACCTGTGGGGGAGAATTGTGGT
CATCCCTCTGCCTGTCCAGCCCGAACAGCCCCCTGCCCCAGTCCCTGGGAAGCCGGCCCC
TGGGTGACCTAGGCTCTGTCTGGGAAGGCGTTCTGTCCACTGCACTGATGGGTGTGGAGG
CTGTATGGTCCTTGGGAGCTTGGAGGGAATAAGGGGCTCTAGACCCCGTGGGGGTGCAGG
TGGCCGATGACAGACTTGATGAAGTCAGACGTGGTGCTGTAGCCGCCCATGTCTCGAGTC
CGCACCTACAGCCACCAGCGGCAACAGCCGTGGGGAGAAGAGAAGAGAGCCCATGAAGGG
GGGCAGGGCAGCACAAATGGAGATGAGTCCAAGGGGAAGGCAGGAGGCCAGGAAGGACAT
GAAGGGCGTCTGCAGCTCAGGACAGGATGAGGCGGCCTTAGAGGAAGCTCAGACCAGGAT
CAGGTGGAGAAAAGGGGGGACCAGTGTGGAGAAGGGACCTCCTAACCCCAGATAAGGAGC
AGCAACTTTCAGGTTAGACAGGATCCAGAGAAGGGACAACTGATGAAGCCAGAGCAAGGT
GGGGAAGGGTATGGCAGATGGGAACTGAGGCAAGGCAGATGAAGATGAAATGGCCAAGAA
GAGGGAGGCAGAGAACAGCCTGGGTGGGCAGGGGCAGCCCAGGCAGATCTTGTCAAGGGG
ACCAGGAGGGCAGCCCCCACTCAGATCCCCGAGAGGAGACCCAGGCCCTGCATCCCACAG
CCCTCGTGAGCTCACCTTGCCGACTTTGATCACCTTCTTCACTGCATCTGCAATCATGTT
GGAGTGATACTCGAGGCTGCCAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1115, 1561..1722, 1861..2059, 2402..2589, 2673..2824, 2986..3086, 3380..3524, 3527..3527, 4355..4476, 4577..4714, 5617..5985
1001..1115, 1561..1722, 1861..2059, 2402..2589, 2673..2824, 2986..3086, 3380..3524, 3527..3527, 4355..4476, 4577..4714, 5617..5982
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved