Dasypus_novemcinctus Locus ENSDNOG00000019759
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000019759
Dasypus_novemcinctus
ENSDNOG00000019759
GeneScaffold_5617
SNORA3
1714..1844
4603
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGAACTCCGGGGCCATGTAA
GCCATGGCCACGGCCGTATCTGGTAAGTTTCAGTTTTCCTTTCCTGTTCAGCCTTGGGCT
ATCCTGCCGGGTCCCTAGATAGCCGAGAGGTAGATAATTTAAAAGTGGGTTAGCGAGAGC
TTTATGCAGTCGAGATTGAATTTAGCCGTTAGTCATTGACTTTCTCTTTGAGGATTCTCT
AGTACTCCAATTTTAGAGAATTTCGCATCGGTGGGGGGAATAGATAAAAATCGAACAGGA
GTACAAATGTAGGATTGGTTGAAGGCATGGAATACCATGAGTTAAATAATATGGAAAACA
ACAGAGATGTATAACCTGGAGTCTTAAAGGCATAGCAGTGGTGAAAGAGATGTTGTTGAC
TGTACACAGCATAAGCAAAGGTACAAAAGTGTGGGAAAATGCTTTGGTTTTTTTGCGGGA
CATAGTATTGAGGGTCTGTATTAACTTTGCATTCTTGCAGGCAAACACCGGAAGCATCCA
GGAGGTCGGGGTAATGCTGGTGGCATGCATCACCACAGGATCAACTTCGACAAATAGTCA
GTGTTTCTTGGGCTATGCTTTGACTGATCCTGACAGCCTATGACTTAGGGGCAGAGAGGG
TTGATTCAGAACATTTTCAGTTTGAAGCTTGTTAACACATATCTTAATACTGGCTTTTGC
CACAGTAACATTTGATGTGAACTGAGAGAATCTCATCGAGGCTAGAGTCATGCTTGGGTA
TTGGCTTGTTGCCTTAGTGTGCTAGAGTCCTCGAAGAGTAACTGCTGACCTTATTCACTG
GCTGTAACCCTCATGGCATAGTCAGTCACCAGGTCAGTGACAAGTACCAGATTGACCTGT
ACAGTCTATTGCAGGACTGTGCCGAATTTCCACAGAATGTTATCAAGCGGTTTGAATTCT
GAACCGATCTATGATTTACATTGGTCCTGTGAAATAGGGCTGGGTTTTCCTCGTTTGGTA
GCGTTCTTAAACTCTAGTGACTGCTGTATAATACTGTACACCAGTGAACAGCTTACATCC
TAATGGGGACAGATAAAGACTATAAAGATGATAAACATAGCTTCATAATGTTGGGGTAAG
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGGGCATCTTT
TAGGGAGTTGGTATTTGCTTTGTTTTATTATAAACCTTTTTCTCTGTTCTTCTAGGGTTA
CTACAAAGTTCTGGGGAAGGGAAAGCTTCCAAAACAGCCTGTCATCGTCAAGGCCAAATT
CTTCAGCAGAAGAGCTGAGGAGAAGATTAAGGGTGTGGGGGGAGCCTGTGTCCTGGTGGC
TTAAAGCCTTATGGAGGGAGGTTCATTAAATACGTGCTTTTCCCTTGTGGTCTGAGTGTA
GACTCTTTGGCACCTCTACATCCCAACCTGTGCAGCTAATGCAGAGCATACTCAGCATCA
GGAATCCACCATAACCAGGTTCTAGGACAAAGAATGTGGAAGTCTTAGCCAATTAGCAAA
TTTGAGTCTAATATTTATAAGGATGGTAACCTATTAATTTTAGTTGAACACCTATTTGCA
TTGTTTACAGTGGGTGGAGAATGAACCCTTACCGGTTTCAGTCTCAAAAGAGAAAATGGG
TGGCCTCTACTGAGCCGTGGAGTTGAGGCAGTTCTATAGGGCTAAATTCCTGATCCTAAG
GGTTTCTTCCTGGGTCCCTTATTTTGGACCAAAGCTTTTTAATTTTAACCAGAATGTAGA
ATTAATAGTTTATTTTTTTTTTAATCTATTGGAAAAAATTGGGAAATCCTGAAGGCCAGA
AATGGGGTCAAGTTTTCTAGGGTTTATGTCTTCCTCTTGAAGCTAAACAGTGATTAATAA
CCAGTGCTTGTATGCAGATAAGACCCTTGGAGTCTGTGTAAATTATTTGCTACAGTTTTT
ACAGTTCTGGAATTTTAGACTTGACCCAAAATAAAGATGTCCAAAACTCTGAGCAAAGAA
ATGATTATGGTGCTTACACTAGGTCTAGACTTGTTTCTTTTATGCTCTGTGGGGTCATAC
ACAGGCTAGGAATCCTTTTATGTGGGAAAGGTGGGGCATGTGAACTTTAGAGGCTGTTGG
GGGTGATCAAGTCACATTTAAGGAAGGAGGCCTAGGATAAAAGGGTGGGCTTGGATGAAT
AAGAATGGGAGAGGGAAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGTCTACCACATG
GGAGGTCTGCGGTTCAAATCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCATGCGCAGT
GCTGATGCGCGCAAGGAGTGCGCCCGTGAGGAGAGCCGCCCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1041..1041, 1480..1555, 2667..2841, 3475..3603
1001..1039, 1041..1041, 1480..1555, 2667..2841, 3475..3600
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved