Dasypus_novemcinctus Locus SGK1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SGK1
Dasypus_novemcinctus
SGK1
GeneScaffold_2406
SNORA68
86123..86247
126468
GGATTCCCAGTCAAGATATGCTCGGCCGTCCCAATTTTTTAAGAAGCGGGTAAGGCCCA
GGTTTGGTTCTGTTTCTTTTGTGTTCTGCTCGCCTCGCGCTGGCCAGAGTTCAGCCCTGG
GTTCGAGCTGCCGAACCCGCGGTCAACCCGGTGTTTCTGGGAGCCGCGGTCAGAGCGCGG
AAATGCACCTGCGGGGATGCAAATCTGTGGGAGGGGGAGCTGGGGAGGAGTTGCCCGGGG
GGGGGGGGGCATCTTGAAAGGGGCTTCGAGCCCGGAAGGGGACTCTCTCAAAGTCACCGC
GATTGCGGGGCGGGTGCCAAGAGCCCCGGGCCGAGCACGACGGTGGCCGGTCACTCCGTC
AGGGACCCAGTCCCGAGCTCGCTCTCCGCTCGCCTTGGAAGGGTTCAACTTTCTTCCGCA
TCTTTCATTCACTCCCTCTCAAGGGCTGCATTATCATCTTCATCCATCAGAAGCAGCAGC
TCCTGGCCTCCCCAAATTCATCCAGCCAGTAATTTGCTGCGTCTCTATTTATGGCATAAG
TAGCTAAGGACGGGAGTGACCTTTTGCAGAAATGGTGGGATTCAGCGTTTCAAGCCTCAG
TGGCAAGTTGCATCAATTTCTTTAAGGAAAAGCCGGTGGTATCTGAGCAGGGCTTCAGGG
GTAGCTGGTGAATATATTAATTTTTCGGTTTCCTTCCTTAATAATGTGACCCTGGCTGTA
AATGGGCAAAAAAAAAAAAAAAAAAAGACTTGACTTTTTCTTTTTTTCCCCACAATAAAC
TAGTTCATTGTAATGGCAACACTGGTGGTCGATGTAAATATGCACATTTATACACCAAGT
GGGAGGTAAGACGTGACTGATTGTTCAGAACTGAGGACGGACTGTCCGCTGGAGACACAG
CGGAAGCCTCTTCTCAGCCCCCGGCTGTCCAGTCCCGTTCAATCCCCGCGGCCCTTTCCA
TGAAAGGGTCCTCTCCATTCACCCTTCCCGCCCTCCATTCAGGTCCTTTCTGTGCCGCGC
CAGAACCGCAGCCCTTGGCTTACCGCCTCCTCCCGTGCCCCCCCCCCCCCCCCCAGCAGG
GACACAAAATAAAAAAATCCAAGGCGGGCCGTGGGGGTCCCCGGGAGCCCAGGGTTCGAC
CATGCTCCCTCCCCCCCTGCCCAAATGTCCTTAGGATCCAGGGCGCCCTCAAGCCTAAAT
CGGGGATTAAAAGCGATGAAAACCCCCTCCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTACCCCTTTAAATACTCCCCACCCAAAAAACCCTGG
GGTACGGCCATTAATATCCATTTCACAGATTAAGAATTCAGGGTCAGGCACTAGCCTAAG
TCCTACAGCTGTTAGTGTAGGTTCTGGGTTTGGATCCAATGCCTGGTTCCAGAGTCCATA
TCCTTAAACCCTACACGTCCCGCCTGCCTATGCTCAACAAATTCCAGGGTTGAAGTCAAA
GAACTGCGAAGGGTGTGACCACCCTATTACACGGACAGATGCAGGACATTATATATCCTG
CCATAGCCCACTGAATGGATTGGGAGAGTGTAAACTACAATGTAAACTGTAATCCAGGCT
GTAGAGCAGTGCTCCAAAATGTATTCACCAAACGCAATGAATGTGCCACACTGATGAAAG
ACTTTGGTCATGTGGGAGGGGTGGGGGGAGGGGTAGGAAGTGGGGGAATAGAGGATCCTC
TTATATTTTTTAATGTAACATTTTGTATGATCTATGTATCTTTAAAAAAATAAATTTAAG
AAATCTGTTTTTTAAATAAAGGCTTCCGCATGTTTAGCAAAGAAATGAAGTAAGCACATC
TCAAGTGGTTGTCCTCCTCATTGGCTCCGTTAGCAGGAACCCTCTGCGTTCCATGTGCCT
TTGCCCTGTTTTGTCTGCTTAATGTATCAGAATTGGAATGATCACAAAGCCCCTTTTCTT
ATGCAAAATTCTCGATGTCTTCCCAAAGGGAGAACGTTTATTGCGAGCTGCAGCACTTTG
CCCCAGGGATCCTCACAATAACCCCCATCTTATAGCCCAGGAAACTGAGGGTCAGAGAGG
TTCAGTAACTTGTCCGAGGCTGCAAGAGCTTGTAAGTGGTGCAGCCAGAGTTCCAACTCA
GCAGTGGGCATCTGCAAGGCCAGTTCTGCTCATTTGTGTAGCTCCAGCCTGCAGCTAGGA
CAGCTGACACTGGCGCGGCTGGCCGTCTCTGGTTGGAAACCGCGCTCGGGGAGGCGAGCC
CGGGGGTTTTATTTTTATTTTGCCACAGCTATGGAGAGTATGGGAGTCGTATTTCCAAGT
GACTCCCCAGGGAGTCACATTTCCTGGTGACTCCCGAGGGCCACAGGAATGCTCTCCAAC
AGATGAGAATGCTGTCTTAGTTTTTCCCAAGATAAATCTGATCATCCTTCCTGGAACTTC
CTGGAGACTCCCAAGGGCTTCTGCTGTGCTTTCTTCAGAAGTAGCTAAAGTCTAAGCTGT
TGCAGCCCCTCCGGAGCGCTCCCACAGCGCAGTGCCACACCAAGTCACGCCCCGCTGTAA
TATTAGGACTGTTTACTTGCCTGTGGCTCCCACGGGGCTTCTGGAAGGTCCTGAAGGGCA
GGGATCCACTTACCTGCTCACGACCTATTTGTCAAGTCTGGCTTGTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCCCTGTACGATATCTG
CATTATGTAATCTCCCTCCCAGAACCCTAAAATCATCTTTTCAACAGTTATACTCCTTCA
TTTTTCAGTGTGGTCTTGGGAGCCACCGAGCATGAAAAAGAATTGAACTCAAGATGCCTT
TTCCACTTGGACCACCAAGTCCCAGGTGTGGGACTGGACTGGGGGTGGGGGGGAGGGGGG
TGCTCTGTGGCTAGGTTTACTAAGCTGGGGAGTTGCTTTTCCATCCAGCAGATTGGGGTT
AGAACTATTAGACAACCGAGATGGCTCCCGCCATCAAAGCCCTGTGTTAGGCTCTTACAC
TGCTGGAGTGCTTGGGAAATGTTTTGAATGGATGTGTAGCAGATTTCCTTGAAAGTTCTA
TTTTTTCAAGAACAGGTGTTGAAGTGTTGGTGCTATATAAACTACTGGAGTAAGAAATAT
TCTGAGCTCACCCATCTTTTATATGGTCTATGAGGGCTTAACACTGTAAAGTACACTGAA
AATGGGGAAAGCAGCCATGGAAGTGCATGTCCTCAGTGGAGATTTCAGATTATAAAAGCT
GAAGGAGAAGAATTGCAAAGGGAATTGGATCAATAGAAAAGTTTAATTAGTCATTTAGGT
CAAGCTAAAGATAGTTCACTGGAGGAAATGTTGTAGAATCATATTTCTAGAATGGGAGCT
CTTTAAAACAGACATGAGTTAATATTTTAGAAGTGTATCCAAAGATTTAATTAGGAAGTA
TCAACAGTCTTTAATTGGCAGGTAAGGAGACACTCCCCCTTTAAGCAGCTAGCTAGGAGC
CTTGGCTTCTAGCTGGCCACCAAGTCTGCGTCTGAAACCATTGGCTCCTCTCCAGCGCTG
GGCTGAGGACTTTTACACCTTCCATGGGGTTTATGAAAGTGAAGCTCGCGAGCAAATAGT
TTCTCCTAAGTCCTTGAACTTTGGAACCATCTCTCTAGGCATCTGCATCTTTCCTATTGG
TAAGGCAAACTGTCCAGCCCCTGGTCCCAGGGCATTCTCCTGGCCCTGACACGAGCAGGA
CAGTTGCAGCCACCTGCTCCTGTTTCCCGTTTCAGGTCTGAGGGCAGGCTTCCCCAGCTC
ATGGCCAGGTTTCTCTGGCAGACCCCATAGCGATGCAGGCAAATTTATTAAAACTTGTGT
GGGGGAGGAGGAGAAGGAAAAGAGAAAAAGCGGAGAGCAAGGCAGGTGTTTGGCATCGTC
CTCCTATGCTAGGCATTTGGAGGTAGAATTACTGTTTTGGTTACTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCGTTAAATTTTAAAAAGTATCCGTAAACTCACGCCTGTGGAAACAG
AGAAGCATACTTTCTCACTCAGTGACTTTCGGAACACCTTGCCAACTCTAAGTCTATTGG
AGAAGGTTTAGTTTCTAGAAATAGCAAGGTGGGAAAAGTTCCCAAATATTTAAAGCATAG
GAAAACTCAAGTCTCTATAGGGCCCAATGTTAAAATATTCCCAGTAGAGACAAAAAAATT
TAACTTAATACTTGGAGAATTAAAAATAAGAGGCAACAGATGTAGTTAAGTGTTCGAGCA
CCTTCTTCCCATGTCCCAGGTTCCAGGTTCAATCCCTGATACCTCCTAAAAGCAAAACCA
ACAAACAAATGAAGAAACCAACTCTCATTGGGGAGCGGATATAGCTCAGTGGTTGTGCAC
ATGCTTCCCATCTGGGCTCAATCCCTGGTACCTCCTTAAAAAATAATAAAGTACATATTT
TTTTCCAATATTATTATCTACAAATGTAGTGATTTTTAACCCTGTAAAATGAGCTTTCTG
AAAATTGACCAAATATCTTTTGTGTTGAATCTCTCTGGACCAGTACTTATTTGGGTTCTA
TTATAGACAAAATTATGGGAAAGAAATTTATGAGGCTATAGCTTCCTGGGTAATTAAAAA
GATCAGGGTAAGGCTAAGTAATAAAACTGTGAGTGGAGCGGTATTAAAATCTATAAAAAC
CTTATCAAAGAATCCTCTCTAGAGTCTCATTTGGCTTCACAGAAACCTAGAATATAAACT
CCCTGAGGTCAGGGACCTTGTCTGACTTGTTTTCAGCTCTGAATAGTGCAGTGCCTGTAC
ATATAGACTCGCGATAGTACTCATTTGTTCAGTGAAATAATAAAAACAATTTAATCAGGG
GGCTGGGGAGAAGGGAACACATGTAACTGTAGTGTCACTACCTGATTCAATAGAGAGGGT
ATTGATGAAGCAGTAAGAACTTAAAAGCATGTCTTGGAGTGATTTTTTTTTTTAATGTTA
CATTCAAAAAATATGAGGTCCCCATATACCCCCCACACCCCTCACCCCACCCCTCCCACA
TCAACAACCTCTTTCATCATCGTGCCACATTCATTGCATTTGGTGAATACATTTTGGAGC
ACTGCTGCGCCCCATGGATAATGGTTTACATTGTAGTTTACACTCTCCCCCAGTCCACCC
AGTGGGCCCTGGCAGGATACACAATGCCCAGCATCTGTCCCTGCAGCACCACCCAGGACA
ACTCCAAGTCCTGAAAATGCCCCCACATCCTAGCTCTTCTTCCCTCTCCCTACCCTCAGC
AGCCGCCATGGGCACTTGCTCCACATCAATGCTACTGCTTCAAGAATGCCAAAGCTGGCA
TTCTAACAAATAAACATGACGAATAAGAAACTAGTATCTTAATGAAATAGTATACTCAAA
AGTAGAGAATGAATTCACATTTATGTTTGGTCAGGCTTGGCAGAAACTAGGTTGGAGCCC
TAGGTTCCATTTTGATGACTAATTTGGCAATTTTACGATACTAGATGTCAATAGTTAAAA
AGCAAAAAGCATTTTGCAACACATTGGGCTTAATTTATGAATACTCATCTATTTCCGTCA
GTTTTACTATGATTAAAAAGAGAAGATTAATGAAAATATTAATGATTTACTGGAGAATGT
GCTTAATGGAATTATAAAGCTTAAGAAGTTAAGAGAGATATCAAAGAGTGTTTTGTGGCA
TTTAATCATGGAGGTAAATTATAGAATTTCTAATCTATCTTTTGGGCAGAAAGTGGTAAA
AGTGTCTGAAAATGTCTCTGATTTTTCACAGGAAAATCAAGGTATTTCCTTTCCTGACTA
TTAAAGCCCCATTTCTATCTGAAATGAAATAGCTCTTCAGGCTGGGCTCTAAGACAGGAT
TTTTAACTTTGTTAAAATTATCAGTAGTTCTGGGAAACATCAAATATTGCAGAACATCTA
TAACATTATAGATCAGCAGATGGAGCAGAGAGGTTTGGCAGACAGGAGTGAAAATTTGGC
CCTGAATGCTATGGAACAAAGTTTAAGGAACTTGACAGCTGATAGGATGTTTAGTATAGC
ATTTTGCAACTGAGTAACAACTACCCGTAAATTAATTTCTCCATCATACTCCGTAATGAA
CATCAATATAATTGCCTTTCCTTTCAGCCACTTGACCTCAACGATTAACTGTTACATTGT
AACAACTAGGACATGGCACTCATTGTGCTCAGGGCCTTAACTATCAGTTTTGGCAACACA
GTCATATCTAATTTATTTGTCTATTTGTCAACTCTTACGTAAAAGGGCCTACACCTTCTC
TGCATTGCCCTTACTAAGATGGTGAACATTGCTAATAATTAGTCTTCTTGCACAAAAGAG
CACGTCAGAGCAGGCATTTGAGATTAACCCTTCAGACTGCCTCCCAGTCACATGGAATTT
CAGAACTTGTGTGATTTACCACTTGCGTTGTCTATTTCATTCTTTTCCAAAACACAAACA
AACAAACAAACAAAAAAACCAAAGCAATGCGCATTTCCAATAGTGCCTTCTTGCCTAAAG
TAAGTATCCTTCAAACCACAGATGCACATTTTATTCAGAATTCCTGTTAACCTTTGTTCT
ATTTTCATCCTCAACAGCCAACAGGAATAGGGCTCCTCTGCCTGTGTTCAGCATCCTTGT
AGAGAAGGGATGTAGAAATCCAATCCTCTCACTCCCCCAGCCCACCCCGGGCCGGCCACT
TGGACCCTGACCTGCTCTTAGATAGCTTTTAGCTCCCTAAACTCTTTTTTTTATAGCATC
TGTCAATTTGTAATTACATATTTGTGTGGCTATTCAATTAATGTCCTTAACATTGATTGG
TGCCCTACTGGACTATGGCCAGTGACAGCAGAGACCTTCTCTCTCCTTTGCTTGCTGTCT
CCTACCATTGTACCTTCAGGGCCTGGCGCCTGGGGCTTATCAACAAATATTTGTTGAAAC
CAGTAAAAAGATAAGTGATTATGAAATTCTGACCTACAGAGAGTTCATCTAAAAGCACAC
ATAGAAATTCAATTCTTTTACATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTGCCTAGCAAACTAACTGAATA
GTAGTAACCAGAACCACCACCATTTTATTTACTGACGATTCTGTGGGTTAGGTATTCTGG
TTGATGAGTTGGACTGTTCCGCGGGTGCCCTTGGCTGGAGCCATTTCATTTGTCTGTATG
TAGCTGGTGGCTGGGTGGGACCAGGGAGTCCAAGAAAGCTTCCCTCTTGTGCCTCAGTGC
GTCTCTGGCAGATCTCTTTCTCCATGTAGCTTGGGCTCCCTCACAGCTTGGTGTCCTTTT
TGGATTGCCACTGGCTTCTAAGAGGGAGCTGTCCTGAGAGAACAGACAGAAGATGCAGAC
CCGTTAAGGCCCAGCCTCAGAAGCTATAGCATGTCACTTCCACTGCATTCCGTCATCCAA
AAAAGTCACAGGGCCAGCCCAGCCTCAAGGCAAGCCAGGCGAGAAGGGCTAAACTCCCCC
TCTGAAGGAATGTGTGACTGTTTCTGTTCATGCTACTCAAACATAATTTTCTGACTGTAC
TGAATTATCTGTGCCTTTCTATTTAAATGAAACTATTTCCCATTAACAGTCAAAAAGTAG
GAGAAAGTATAGACTAGTTTGGTTTTGGTTTTTTTTTTTACTTTTTATTTTTAAATAACT
CAAACTTACAGGGCTGTTGCAAAAATAATACTAAACCCACACAACTAACTCCAACATATC
TCCTACCCAGATACCCAGATCCACCAACTTTAACATTTTTCTACATTTGCTGTATCATTT
TATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTGTCATCTATCT
GTCTGTATCTATAGACTGGTTATTATAGACTCATCTATCATCAGACATACCCAGTTGGAA
ACTTAACTATGTTACTTTCTAGCTTTGTGACATTGGGCAAATGGCTTGATGTTCCCAGCT
GGCTTGTTCATCTGTAAAATGGGTTAAATGATAGCACCGACCTCACAGAACTGTCGTAAG
AGGATAAATGGCAGACCGCAGTAAAGCCTCTGGCTGGTGCCGCGTGTACTAAGCCCTCAA
CACATGTTAGATATTGCCAAGCAGACGTCCAGAGTATGAACTTGTGTTTTATGGCCTCCT
CTCTGAGTTATGTTCTTGAGTATCCTGGCAGACAGGCAGCCCTGAAACCTCTCTGCTTTG
GTATTTTATTGTTTAAAGGTCATTTCTCAAAAGACCTCTGCACTGTCAGCAGGTTCAGAA
TTTTACTGAGTTGTTTCGTTGTTTCCACAGGCTTAGGAACCAGTGAACATAATTAATTTA
TCTTCTAGAGATGCTGTCCCTAGAGCTACTGCAAAGGTCTGGCTTCGTTGCCAAAAGGGT
ATTTCATTTCTACAGGATCTCATTAAATCAAATGACAGCAAATTAACTCTGTTTTCTTGG
CTCCATATGCACAAAGCACAGAGGGGGAAACAAACACCAAACCCTTAAGTTCCAACCTAT
AATCAGCTATTGATGAGCTTCTATTTGAATTTAATGAATTTAATGTGAAGTTTTGTTCTC
TAATCTGCCTTGCCAGTGCCAAGTCAAGACTTGAAACCCATTTAAAATTCAAAATCATAA
TCCACATGACTCAACAACACTTTGAAATGGCCTTTAAAATCCTTCTATTGTTGCCCTTTC
ACCAAAATATTTCTTACTGAAGGTTCAGAAACTTGAATCAGGAGGCGCTGCATCCCGTGA
TTTTCTTTGACTCTGAGATCAGGCTCTTCCACTTTGTATTTCTTTTGTCTTGTGGACACT
TGTCTGTCCCATCGTCCCTTTGCTCTTCTTGGCACACCCCACTGTGGACCACTCCCCAGG
CAAACACAGTAGTAGTTGCTGTGGGCCGGGGTCCCGAGGTTCTCCTACCCCAGGGCTGTG
TCCTGGCTCCCTTTGGGCTCCTCCTGCTCTCACCAGCCTCTAGCCCCGGGCGGCCAGCCG
CTCTCCCTCCTACCGCCTCTTTTCCCTCTCCAGTTCTTCACCTTTCTCATCTTCTCACAC
ACTCTCTAGCCCTCCCCACCTACCACACACACACATAAATTCATTCATTTGTGTGCTTTA
AACACAACCAATTTATCCTCCCATGTCTATCGGCTCCCTCAATGCCCTATTTCCTGGTCC
CAGATGTGTACCTAATAGTCCCCTTGAAATGTCTCACAGACACTGTGAACTAATCACATC
CCAGATTGAGCTCTTGATTTTCTCCCCTACCTATGTTCCTTCCCTCAGTTGTCCCCATCT
CTGTAAATGAACTTTGTGGGAGCTGGAAATCTATAAATCATTCCTCCTTTTCCTCTGTTG
AGCATTCATTTCATCAGGAACGTCTATTAATTTTACTTCCAGAACATCAAAAAAAACCTC
CTCTCCGTTTCTAGGACCTACGTAGCCGTACAAGTCACCATGATCCTTTTCTTGGGCTCT
TTACGAGATTCTCGGCCTTTCCCTTCCATGTCCTCTCTTCCCCTGCTTTCCCCTTCCTTG
CCTTTCCTCGGAGAGACCACAGCACTTATTACGATGACCAATAGTAGTATGATTTTGCTG
AAGAAACAAGGCTTTGAGAGAAGAAAGTACTTCCCTAGAGTTTTATAGAGAAACAGCTAG
CATGAAATCAGAGCTTTCCTCATTTGGGGCAGTAAACCCTCCTGCTCACACAGATGCCAA
TTGTTTGCTTGTAAGTTCTTCTAAATTAAAGAACCATTTTATTTTAAAACGAGTTAAGGT
GCTTGGATTCTCCTTAGAATAGCTGGTGCTAATATGCTTTAGTTTAAATTATATTGTTCA
TCCCTGACTACCTCAGGAAAAAGAAGTCACAGGGACTGGAAAAAGCTCCAAAATCCTGCC
AGAAAGAAATGACCAATTTCTTTCTTTGAAACTAGAAGAAATAAACATAGCTGAACTTCT
CTGAGTATTTCCAGACTGGGATTCTTTTTTTTTTTTTTAATGGTTTACTAGAAGCTTTCA
TTTTGAAATAATTTTAAACTTACAGGAGAGTTACAAACATAATACAAAACCCATATCGAG
AACTCCAATATACCCTCTACCAGACACCCAGATTTACCAGCTTTCAACATTTTGCCACAT
TTCGTTCTATCATTCTATCATCATCGTCACCATCATCCATTATCTATCTTCTAAACATTT
GTGAGTAGGTTGTACCCATCATGCTTTCTTGAACACTGAATACTGCCATGTGTGTTTCCT
AAGAACAAGGACATTTACTTACTGTATCTTAAGTACAAGAATTTTAGCCTTGATATAAAG
GTTGCAGACTATATTCTGATTTTTTTCATATGGCCCCAATAATGTCCTTTTGGGCACTTC
CGCCTCCATTATTAGAGCCAGCCCAGGGTCGTGCATTACATTTAATTGTCACAATAATCA
TTTTAAGGACCATATTTTTACTCATGTGTTTTACTGTATGCCAGCCAACCATTCAGTATA
GTTTCCAAAGTCCTCCAAACTCTGGACATGTCACCACACCTCACCCTACCGCTTCCCCTC
AGCACACCCCTCTGCCTCTGTTACCTCGGGAATACCCTATGCCACCACCCTCATTCTCAC
TGTTCTTTCAACCTGAAATGTCCTCTTCTCCCCCCAACTTGGCTAAATCCTACTTACTTT
CTGGTCCCCTTTGGCCCATGACACTTACCCAGTTTTTAGGAATTGCACCGATTGCCCTCT
TTAAGTGCCTCTTCAACTCATAGTTATTATTGACTTGTTCCACCTTCCCTCTTCTGATTG
ATATCAAATATAAACAAAAAGTCACATTTTCTAATCACTTGATTGATGCAAGGTTCAGGG
ATTTTTCTCCCTTGCAATCTCACAACTCAAGGAATGAATCCTTCCCATATTTTCTTATTC
CACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATAACATGAAAATCATTTTAACAGG
TTTTTAAGTGTGTTCACAATGTTGTGTAGCTTTCATCACTATTTCCAGGACTTGTGCATC
ATCCCAAACAGAAACTCAAACCCATTTAGCATTTACTGTCCATTCCCACTCCCCATCTCT
TGCCCCTCAACCCCTGGTGAGCACTGTTCTACTCTTGGGTCTCTGCAAATTTCATAGAAG
ACAAACCATAAAATACTTCTTTTGTGTCTGGCTTGTTTCATTCAATACGATGCCTTCAAG
TGTCATCCATGTTGTACAGCGTGTTTCAGTACTTTATTCCTTTCTACAGCTGAAAAATAT
TCCATTCCATTGAATGTCTTTACCACATTTTGTTTATCCATTCATCTGCTGATGAACACT
TGGGTTGCTTCCTGGGAGGAATTTAATGCAACAATTCATTAAACCCACAATAATGGGTGC
ATCATTCTCCAATTTAGAACAGATTACATGATTCTCAGACTTTGGTTATTTTCTTAAAGT
CACCACAAATCAAGAAGACACTCTTTGACAAATAAAAAGAATCTCTATTTTGCTTTCTTA
TGGTGATTAAACGATGAAATAATTCCCTGAAGTCTCTCCTTTTAGATAGTTGAGTGTCAA
GAAGTGGCAGAGGCTCTTAAGTGCACAGGCTGGGAGGACAGACCATAATTTTGTTCACCT
GACATTTCCTGATGTGGATTATTTTAGAGAGGAGGCTGTTTAATCTCCGCCCCCCCTCCC
CGCCCCCAACACCCTCATCTATCAAAATGGAGGGAATTCATGCTTGTCATCTAATTTCTT
CCCAGGAGTTTTCCAGTAGTTTGCCAGTGAGGGAGATTACAAACAATCTTTTTTCAGTGT
GAACATATGTGTACATAGTTTGCCGATCAGCCAGCCAGATCTGCCACAAGCTCAAGGTAT
GAATTTAGGCAAGTTGCAAAACCCTCAAACACCATATGATGGGCTTAAGTTAATTAACCC
TAAACTCTTTTTAGTCAGAAATGCTATGGTGGGAATTTGATGACCTATAAATGAAACTAA
GCTCCAAATTTGACGTGCAAAAATAAAACATAGAAAATGAGGTGAGAACGTTTTAAATAT
AAAGGAGGCAAATAAAGTGAGAAAACTTTATGCAAAATTGTTTTCTGACTTTAAAACTGG
TACATTCTAGGCAGTGGACTTGGTCCAGTGGTTAGGGTGTCTGTCTACCACATGGGAGGT
CCGCAGTTCAATCCCTGGGCCTCCTTGACCTGTGTGAAGCTGGCCCAAGCGCAGTGCTGA
TGCATGCAGGGAGTGCCCTGCCACTCAGGAGTGTCCCCTGCGTAGGGGAGCCCCACATGC
TAGGAGTGCACCCTGTAAGGAGAGCCGCCCAGCGCGAAAGAAAGTGCAGCCTGCCCAGGA
ATGGTGCCGCACACATGGAGAGCTGACACAAGATGATGCATCAAAAAGAAACACAGATTC
CTGTGCCTCTGACAACAACAAAAGTGGGCAAAGAAGATGACGCAGCAAACAGACACAGAG
AACAGACAACCAGGGTGGGGGGTGAAGGGGAGAGAAATAAATAAATATATCTTAAAAAAA
AAAAACTGGTACATTCTAAATGCTATATTGAATAGCTGTTGTATTAGTCAGGGTTTTCCA
GGGACAGAAAAGAGATTTTATGTATATATATATATATACAAAACCTCATAATCAATATGA
GATTATATGAATTTGTTTACAAGCCTATAGAGTGTGGCAAGTGTGAATTCCCTCACGAGG
CAGGTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATAGAAATGCAAAGAAAAACTGGAAAATTCACACCCAAAGGGAAATCAAAC
TTTTCCCAGAAATGGGCAGTTCAAGAAACTAAAAACACGCAGAGGATTTTGAGTGATCCA
ATTAATGAAACCTCATTTTTGTAAAAATTTATGCCGAATAAACAAAGAATACACACTATT
TTAAGCATACATAAAACATTACAAAATCAGGCCGAGTATTAGGTCATGAAGCATATCTCA
TCAAATTCCAAAAAGCAAAGCAAAAATCATGCAGGCCATGCCGGCTGATCTTAATTTGAT
AAAATTAGAAACCAACAACAGGAAGAGAGTGACCTCTGTCCCCATCCTCTCCACACATCT
GGAATTCACAAACACCCTTCCTAATAACTCAGCTTACATAGGAAATAAAAAAGTAAATTA
AAAACAATTTTAAGTGCTCACATCACAAGGGAAATGCAAATTGAAGCAATGAAATCCCAT
TTGTTTTTAATCCGTCAGGTTGTCAAAGGTTGAAAAGGTTGAGAATGTCGTGTTGGTAAA
AGCAAGGGCAAAGATAGGTTGGTGGGAGAAGTTTTTGGCAATACTCAACTGAAATTGTTA
AATCTCCTACCTTTCGATTTAGCAAATCTATTTCACATCTATCCTAGATAAACCCTTGCT
CATATGATGTTAGGAACAAGTACAAAGATATTTGTTGCAATATTGGAGATGGGACAAAAA
TGGAAATATCAGTGGAGAATAAAATTGCAAAGTATTAGAGAACGATTAAGCATGGCATAA
CCATATTATGGAATCCTATTCAGCAGTGAAAAAGAATAAAGTAGTTCTCTATTGTACTGG
CAAGGAAAGTCTCCAAAGTACATTTAGTTAGAGATCAGCCTGAAGATGGATACATGCACA
GCATTATCAAATTTATTTTTAAAAATACTGTGCGTTTCTCTAAGTGTGTTTCGTTGTGTG
TGTCTGTGCCTACATATGTGTGCATGTAAATGCAAATTAAAAGACCTGGAAGGATATATA
GTAAACTGAAAGGGCAAGGACCACTTTCTAGGGCCTGGAATTAAGAACTGAAAGGTGAGG
AGGTAGGAAGAACAGTCAAGAAGGATTTTAGCTTTTGTCAAAATTGTTTGAATTTTTACC
TGTGGGTTTGGAAAAAACACCCTGTCTACCAGAGACTCACTCATAGACAGTGAGTAGTTA
CAGCTCAGCCCTGTCGGTATAAAGTCAGACAATATCACAGAGAGGTTTCTGTCGCTGCAA
AGACAGGCACCTGGAGAAAGAAGGAAAACACAAAGCATTTGTGCCCCCACCACACGTCGC
TCATCTTTTCGCTCTGCCCTCTGTGATGCGCGTGTGTGCCTGCCCCTTTCTTCTCAAAGC
TCCACCCAGTCAGGAAATCCACGCTCGTTTTCTCATCTCCTCCCAGGGCCTTGCGGACAT
GCTATTAAGTTATGTGCTCTTTTTTCACTTTGCCCTTATGAGCTGAAACCCAAATTTTGT
TCATGCAATTTTTATTTAAGTTTCGTCTTAGAGACGAACATTTAGTCTTAGAGACTAAGA
AAATTCTGCAGCCGGTGCTGGTGGTAAATCACATGCCTTCCAGAGCGGTTGGAGCCTCAC
GCTGATTCTCATTCAACTCTCCGCCTCATATGGAATAGATTTGGCTGAGCGAGGCCTTCC
TCGGGCTCGTCTGTCTTTTGGACTGGAGGCAGCTTGAAAGGTGCTTAGTCAGCTGAAGTC
AGGCGCACCGTGTGCTGTTTTTCCAGCCTGGTGAAGTCAGTCTTCCGAAAGCGTGTCCAA
CTCGGAGAAGTTATTAGCCCCTCATTGCAAAGAGAAAAATTCACCGAGTCTTTGATATGA
TAAGGTCACTGCTTTGTCTCTCTCCTCGGCAAGTCACCAAAGACGATATAAGTGGCTTTT
TTTTTTTAAAGATTTCTTTCTTTCTCTCCTCTTCTCCCCCCTTGTCTGCTCTGTGTCCAT
TTGCTGTGTGTTCTGCATCTGCTTGCATTATCTGGCGGCACTGAAACTACGACTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAAGCTTTCCATCAATATCTTG
CACATGGTAACAGCACTTAAGGTGTTTACATAAGTGCATATCCTTGTCAGTAGGAAATAT
GCATGGCAGGGTGTGTGCAACTTACATTCAAGTGTTCAGAAAACGGATGGGTGGGTAGAT
AGCAAGCTAGAAAGCTAGAGAGCTAGATAGATTTGGCAAATGTAGCAAAATCTGTGGATC
TGGGGAGAGGGAGGGGAGTATGTTGGATTTCTTTGTATACAGTTGTATTATTTTTATAAT
TGTCCTCTTAAGTTTGAAAGTATTTCAAAATAAAAAGTTAAAACAAAAAAAAAGCACCAT
TCCTCCAGGACCTAGCCCTTCTAAATGGTTTTAGCTCTTCCTCTCTTGTTTGAGCTCTTT
TTTTGCCCATTCTATGCCAACTCAGACCTCTGCCATTTTTCCTTTCTCCTTCCCCTGGCT
CCCTCTAACTCAACCTTCAAGACTTAGTTCAACAATCACTTCCTCTGGGAAGCCTTCCTT
GATCTCTCCCCACTGGGTCAAATAGGCCTCATTTTTGTCCTATGTCACTTTGTAGAAAAC
TCTTTTGAGGGGGTTGGAACCATAACTCTAATAACAAATATTCACCAAGTGCCAAGTGCT
GGGTTTTACCTGCCTCATCTCACTTAGTCCTCACAAAACCACACTGAGGCAGCTATTATT
ATCTTCATCTCACAAGTGCAGAAAACTGAGCTTTCGTGGCAGGGGTGCTGCTGGGCTTTT
CACCCAGGCAGGGTGGTTCCGGCCTCATGCTTTATTGCTGTGTGATGCTGCTCACTTAAC
ATGCTACCATCGCGCCACCAGCTCCCGGCCAGTCCCTTCTGAAATGCCAGCACCCTCACT
CAGAGACTCTGTTACCCTTCTTTGTGTCCCCACCATGCAGCATAATGCCAGGCAGATCAC
ACTTGAAACTGTGTGGGAAACTTTAAATGCCGAGTGTGCAGGTGCGGTGTGGACTGAGGA
GCAGCCACTGGACTTGGCCACGAGGTTCCTTGGCACCTCGGTGAAAGCAGTTTCAATGGA
CTGGGGCTCTTTTGGTCTTGTCGCATAAACTGCAATGGGTTTAGGAGTCAATGTGAGGTG
GGGAAAAGGAGATCACTTTTCCTGGACCTTAAGAGGGTTGGGACTGCAGCAAGTGGAAGC
TTCTGGGGCATGGGAGTGTTTGTGGGTGGGAAAGGGCATGGTTTTGTTTGCTTGTGGCCT
TGCTTTCACAGATATTGAAAGCAGCATATTTAATACGGTGAGAGAAAGTAGCCAAGGGAG
AGGAAGAAGTTAAAGAAACCAGGACAGGGGATTTTTTGGAGGAGACCAGAGAGGAAGGTT
TCGAAGCGCTGATGGATGTGCTGTGGTCAGGCTGGCCAGGTTCTTTCCCACGGATCCACC
CAGGGTGTCTGTTTCCCCTGAGCCTTACTTTCCAACTGCAAAAGCAAATATGCAGGCTGC
CCCCTTGGCAATGTTAACCTGGAGGAATTTCCTCATACTTCCTCTTTAAATATATATATA
TAAAATAAAAAATAATTTTAAATCTGGGAAAGACTAGTTCAAACCAGTCCCACCATTTAA
AGGACTAAGGAAAACTTTACCTCCATTTCTAAAGAAAGACCATGTCAACGAATTCCTTGG
CTCTTTCTATTGAAAAATTGGAGGGGATGTGGGCTGAGAGTTTTAGTGGGGAGAAGGAAT
AAGGGAACTTTATAAGTGTAGTCAAATATGGAGAGCAAAATTTGCCATTTTAATCATTCT
GAAGGGTACAATTCAGGAACATGACTATCCTCACAATGTTGTGCAACCATTGCCGTTATC
TATTTCCAAAATTTTCCATCAGCTCTGATCTCCTGACCTGGAAATACAGCGCTTGGTGTC
TTAGACAATCTCCTGCCTATTCTAACACTCACAGCAGAATGGGGTGGAGGTGGAGGCTGC
AGGTGTAGGAGGATGGGGTCAGGGTGCTGTCCCTCAAGTGCAGCCAGCAGCAACCCAAAA
AAGAGTAGGGAGACATCTCCTCTCCTTCCTTCCTCTTCCCCGTAATCTTCCAGCTGGAAA
ATCCCAAGGATCACAGCCTGGAAGGACTGGGAATTCCAAAAGGCACTCAGTCGCCTGAGG
GGGGCTGCTGGAGGTACAGTAGGCTGGGCGAGGGAAATAGCTAAGTGGAGCTCAGATGTG
ACCTCAAGAGAGGACGTCAGCGAAGCACGCTGAGATCCACAAGGAATGAAGATGGTTACG
GTCACACATCATCAGGCAACTCCCATTCTGATTGCTTATTATTTGTGAGACCATACACTA
GCCTCTGGGGAATTGGGAAGGAAAAAGAAAGTCTAAGAAGCTGTGCTTTGGGAAGCGGAT
GTGGCTTAAGCAGGTAAGCGTCTGCCTCCCACACAAGAGGTCCTGGGATCGGTTCCCGGT
GCCTCCTGAAGAAAATGAAAACAAACAACAAGCAAAACAAACAATAAAGCCAACTCAGGG
AAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTTTATTGTAGTAGTGCTATATTTTAGGACATGCTG
TGAAGTGCACCCAGGCTCCAGTGGGAGGGGAGTTTGCTCCCAGCAGCCTCCCCTGAATAG
CACTCTGTCCTAAATAGCCCACCGGCAGTCACCCTCTGGAAAAGGAGTAGGTGTGGGAAG
GCTCCTTTTAGAATCTGTTAAATGATGCAAATACTTTCACTAGTCAACTGTTTGACTATC
TTAACTTGAGCTGAAAGTGGTGGCATATAAACAAAGTCAAAAAAAATTTTTTTTCCTTTG
ATGTACCAGGGCTGGGGATTGAACCCAGTACCTTGTATACGTATGTGGGCAGCCAGGACT
CAACCACTGAACTACATCAGCTCCCTCAAATTGGCTTTTTTCATCTGTTTGTTTTTAGGA
GATACCGGGGATCAAACCTGGGACCTTGTACATGGGAAACAGGGGCTCAACCACTTGAGC
TACATCTGCTCCCTGATAGTCAATTTTCACTATTCAAAAAAAAACTTCTTTGTAAACTGC
AGAAACTGTGGCCGACTTCAGGATCACTTGGGTTTTAAGGAAGAAACAGCTTTTCCGCCC
CTGAGAAACGGAGGGGACAGTGAGCGAGCCTTGCCTCATGAGTTAACGCATAAATACTGT
ACCTGAACATTCTAATTTTATGCATCAGTTGATATCATGATCAGCTAAGCCATTTTAAAT
TAAGAGTCATATCTGTTTACTATTATATAATTGGGAAAAAGAAAAAAACCACAAGTGGAA
AATCCCTACAAGTTGCCAATCTCTTTAATCACATAAGGCAATTTTCTGGTCTGAGGGATT
ATTGCTTTCTGGATATCATTTTTTGTTTTGTTTTTCAAATAAATTAGTAAAATGAGGGCA
GACTGGAGAATTTGGCTGACTATGTGTGCACACTGTTCAGTAAGATTATGTGTGGTTAAA
AGGTCCTTCCGCTATCAACACGCTGATGGCTGGAGAGGCAGTTGCTTCGAGAAGCCCACT
GCAGTTTGGAGAGCCCGTTCTTCCAAACCCCACGAGGAGTTCTTGATTTGTTCAGGCTGA
GACAGATGACTCCCCCAGGCCTGAGTTCTGAATAAACGTGTATCCAGGTGGCGGAGGAGA
CAAGGAGCCGGGGCCTGCTGGTATCCAGGCCTTCGTTTTGCTCACGCACACAGGGGCTCA
GTTCAAAGCCGGCCTGGTGGCTGGCCGCTGAAGGACTCCCAGAGCCCCTGCTCAGTCAGC
TACTCCCTCCAGCCAAGCAATTCACTGCCTGAAGGAACACAATGGCCCGCTTGTGGTCTG
ACAGGCCCAAGGGCCAAGGGAAGCTTTCTCCACTCAGCAGTTTTGGAGGTCGCTATGTCC
GCTCCAAGGCCAGAGGGAGGGCTGGCACTTTCACTCTCATCACTTCTGAGGCTACGAAGT
GCGTGAAAATGGTTGAAGGAGTAGCTGGGAAGGAACCTTGTGAAGCTGGTAAGAGCATTC
AGCCACACGAGATAAGACTTTTCAAGACAGAGCACGTAATAAATACCAGCAATGGTTCCG
TTACAAAATGTATTGCTGTATCTGTTGTTGTAAGGAACACATTTCTCCCTGATGCTTCTG
GAGAAATGAAATATTTCTAAATTTCCCTAGCCACATTGTTTGTGGAAAGAGAGCCATTGT
CCCTAAGGCTCAGAATGGGTCAATGTGTGGAAGATTATTTGGAGTCTTGGAACTTTGTAA
TGAAATTTCTCCCCCACCCACACTTTGTCCCCAGAGGAATGAGTTAAGGCTGCTTGAGCC
ACAAAACACAAAGCTTAGAAGATCTGGATAAGTCGTTTATTTCAGGACGTTTAAGAGAAA
TAGAGTAAATTCTAATAATTGAAGCCTAAGAAATAGGCGTTTAAGACCTAGGCAGGTACT
TCACAAGCTGATCCATGCCAGTCACACCCCCCCACCCTCACCCCGGAAGACTTTCAGTAG
ATTACAGTCATTTGTTCCAAGTTCAAGTTTCTGTCTACTGCCTGGATCTTTCTCCTGAAG
GCAGCCTTAATGGTCCAGCTGCTATTTACTACATCAGCCAGGGGCTGCCCTCGCCCCTCA
GGCCTTTCCTGAAGAACCCCCTTCTCCGTGAGGCCTTCCTTCCTTAGGCATTTAACACAG
AAGCCCCCTCCCCTTGATCCTGACCATCCCCTCTGTTTTATTTCCTTCTTACATGCTATA
TGGTTTACTTATTTATTTTATTCATTGTCTCTCTCCCTTAGCCATAACTAGGCTCCACAG
GGCAGGGTTTTTCGGTCTGTCCTGTTTTCTGCTATATTCCCAATGCGCAGATCACACATA
GTAAGGCCTTGGTAATGAATGGTAAATGAAGGAATGAAAGTGAAAATGTTGAAAATGGCT
GGATTGCTTTTAAACAGTTAGACCATATCAAAGCTCTTAATTTCTACCCCATTTGAAATC
TTAATCCCCTAAAGCTAGTTATGCATTCTATAGAACCATGGAGGCCGGAAACAACGATGG
TCTGATCCAAATGAACTTCCTTTAATAGAATAACTTCAAAGGTCAAATGGTGACCCTGGA
AGGTCACAGGGTAGATTTAACTCACATTGGTTAGGCTGGCACTGTTTGTGTGTTTGTGTT
TTTTAATTTAAGTGTAAATGCCCTTAAGCAGGCATATATCCCCACATTGCCACAGTCCCC
AGCACTCCCTGTTTTACACACTGGCCACTGGCCAGATACTTTATACCTTCGCTTTTCTTG
CCAGCCTCTGAAGGCAGTGGAGTTGGCCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTTTCTATAACCTAATGGAAGATTAAATTCAGTAGCATGGACATTCTTATTAAAA
ATTTATGTAATATAAAAAATAAATAAGATTTATATTTTGGTAAACCAGGATTCTTAATCA
GTAAGGCTATAAACCTACAAATTCATTTGAAAATAAGTCTATTTTAAATCCTGTTCACAG
CAACCAAAGTTAAATATGCTCGGCAAAGGAGGCATATTGGAAGAAAGCCAGAATAAAAAG
ATTGATTGTAATATGCAAGGTTGGGAAATGGGAAAAAAAAAAGAGAAAATTTGGAAACTA
AGTAGGAAAAATCACCAAACTCTAAGTTCAAACCCTCTGAATAAAAATAATAAAAAATAT
TTTCCATCTCTAATGAAATTTAATACATTTTAGCTTAATCAAAAACACATTTGGTACTAA
TAGCAGGAAGACAGATCCTGTGTCATCTCAAACCTTTAGTTTCATTTAGACTTTCAGTAA
TGAATCAAACACTTTTGAATATATGTAGAAATATGTTTATGGGGCGCTACAGAGTAAAAC
ATATTGATCCCCTCCCCCAAATGTTAGTATTAAGATAGTCAACACTAAAAGATAATTTAA
ATGACTATTTATTGGAAAAAAATACATATAAATAAAGCAGTTAAAGGACATATGTGGCCA
AAGAAAGAACTATGATGATTTTTAGTTGCTTAAGATTCCTATAAAACTTAAAAAAAAAAA
ATCCTGAAAAGATGAAAGGAAAGGATGCTGTGAAGAGGGAAAAATAAAACAGCCATAGTC
CTAACGATGAGTACAGCAATTTCTGTTTGTCTGTTATTTCCTTGCTTTGTCCATAGTTAA
ATTTATTTTTATATTTGTAATCAATAGTGATTGAACAATTCCATATTTGGCTTTTCTCAT
GTAATCAGGTTCTAATCATTTTCTGTATTGTCACAGAGTCTTCATCATACTTTAACAATG
GTATAATATTCCATCAAGTGTTATAGCAAATTACTTAAATATTCTTCTGTTATGCAACTT
TAGTTTATTCGCTTTTTTCATGTAATCAGGTTCTAATCATTTTCTATATTGTCACAGAGT
CTTCATCATACTTTAACAATGGTATAATATTCCATCCAGTGATATAGCAAATTACTTAAA
TATTCTTCTGTTACTGCAACTTTAGATTATTCTCAGTGTATTTTTAAACATTTAATTGTA
GTTTTACCAACTAAGCTTCAGTACTGAGATTTTATTTCTTCCTCCTTTCGGTATATGCTC
ATTTCACTAATGGGGTAACCATAAAAACCCTCAGGAGTCTCGAGGCCCCTGGAAGCGGCA
TATTAAACCAAGCTAAATTTCTAACATTTTTTGACCACAAATCTTACACGTGCTCCAGAA
CAACTACATGATTGTAAAGGTGCCGACTCTGGAGTCAGTGCCTGCATCTGCCTTTGCCTG
ACACCAGTCCTGTGTCCTGGCAGAGTTGCTTCATTTCTCTGTTCCTCTGTTTTCTCTTCT
GTAAAAGGGGAAGAAAAAGCATTGCCTAACTTGTAAGAGTGTTCTTGAGAGTAAACAAGT
TGATGCATGTCATAACACTTAGAACTGCCTTACACGTTAAGAGAGCTGTGTAAATATCGG
CTCCTTTAATTTGTGAACAGCTTTATATTTTTTCTGTACCTTTCCACAGCTCTATATGCA
AGCAAGAGAAGTGGGGAGGTTTAACTGAAAAAACAAAGTTGAGATTACTTCTGAGCCAGA
AACAACTGCTTTTATAATCAAGGTTTTGCAGTAGTGAAAAATGTGTCAATGCACTTAGCG
CCAGTCGGTCCTGAGCTATGACGTTTGTCTTTTCGCTGTTTATAATAACCAGCCATCCAC
CTTAGAAGTTGGCAAACTATCATTCCATCAGCATAATCATAATAGTAAGAGTTAGAGTAA
AATAGTCATCATCTATTGAATGCCCACCAGATGCAAGGCAAAGAATTTTTACATTCAAAA
ACATTGCAAAATCTTACCCTGGGCGCAAATAGTGTGACCTGAGTCTAAAAGATGACTCAG
GGTGATTAAATGACCTGCTCCAAAATACATATTCCTAGAAGGTGGTTTGATCAGCACTGG
CCAATTAAGTGTGTTAAGACTAGAAAGGCAAGAGGTCATGAGACTGAAGTCCCCCTTTGT
GAGTGTTCATCCCACCAAAGTTTCCAACAAAGCCTAGTTCAACATCAAAGGCGGCTGACT
ACATTTGTTTTTTTCTTCTCTTGTGTGTGATTCAGGTACGAAGGTGGATCAAGAGCCCCG
TGGTCAGTGTGGACAAGCATTCGAGTCCCGGCCTGAAGTACACAGGCCCCTCCATGGTGC
CTGTCCCGCCAGGGGAACTGGACTTTGAGCCTCCCTTGTGTCAGACCTGCCTCGGGGACC
ATGCTTTCCAGAGAGTGCTTCTCCCGCAGGAGAAGGAGCCCTGCTCGTGGGACCCCCAAG
CGGGGGCTGAAGTAAGTTCATCTTGGCCCTGGGCCTGCTTTTCCCGTAGTTATGCTCTAG
CACCCCAAAGCGGTTCTGCTGTGCACACGGAGGGCTTCTGAGGAGAACAGGGAATTGGGC
CTTCGTAAGGCCCCTGTACCAATTCCGTTTGCTCTTCAGGACTGACCCACACGGCGTCGG
TCACTTGGCCATCCTTCATAAATTGTTTGGTCAAACAGAGCATCGACTCTTGTACGATAC
AAGAAATAGGTGGTAACCGACAGTCTCTAGGGCTGCCATAAAAACCTATGACCAGCTAGG
GGGCTCGGGACCACAGAAATGCATCATCTCCCAGTTCTGAGGGTGCAGGTCCGTGCTCCC
TGACACCTGTAGGCGGACTCCCGGCGGGTCTGCCGGCTGGCCCTGGCGGTCGTCGGCTGG
CAGCTGCAGCCCTGCCATCTCGGCCGTCCCTTGTCCCCTGTGTCTGTCTGTGTCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGATTTCAAAATTTCAAGGTTTTATTTTTAACTTATACCTCTATTG
GCTCACATATATTTTGACTTTTTAAGCCATTAGAGAAAATGTCTATTTTTTATCGCTATC
TTACTGATATAAAAAATGGAACATTAAGATAACGCGTGTTATTACTAAGTAGAATTAATT
TTAAGTTAAATGCCTCATGAAAAGACAAATGATAATACCCCCCCCTTTTTTAATAAGGTA
AACATTTTCCAGAGATAAAGAAATCCTTTTTGCTGCTCAAGTAAAAGAATGAGGATGCTT
GAATCTGAGTTCCTTGTAACCCTGAGATGTCATTCAATGTCTCTGAATGTGCTTCCTCGT
GGAAAATTTGTACTTTCCCTGCCTTTTTCTTAAGGTTATTGGAAAGATCAAATTAGATGA
ACACATAGGAAGCACTTCATAATCTCTAAAGTGCCATACAAATATAAACCATTATTTTTT
TGGGGGGGGGGAGGAACAAAGAATTTATTTTTGACCGGCGGGCTTGGACCATTACTATTT
ATGCTTGCTGATTTGCGTGTTAGCTAAGCCTGTGAAATTCTAACACTACCTTATACCCTA
TGACTGGGCTAGCACTTTGCTGACCTATAAACTCTTGTCCCTGTGCATTTGTCATGTAAC
CAGACAGTGCATCAACTTTACATGGATTATAAAAGGCAGTAAATATCTGTGAATGCAAGG
ATTGGCAAACACTTTCAAAGAAGTCCAGATAGGCACTATTTTAGGCTTTGTGGGCCCTAC
AGCCTCTCCCTTCTAGTTAACTCTGCCCTTGGGGTGAAAGCAGTTTAAACATTATGTAAA
TGAATTGGGCGTGGCTGTTTGAAGAGAGCTTTACACCTGCGGCAGGTCAGCAGGACATCA
TTTGCCACTTTGACTCCTTAGAGTCTGAAGAACTATACATGATGCAGAGGCGGAGAGCTC
TACATATCCTCTCCAGAGCAGAAACATATTCTAATGGCTGCTTGAGAGCCCACTCTGTGG
CCCATTTGCCAGAAGCTGGGGATAGGCTAATAAATAAGTGGAATTCCACACCAAAGGAAA
CAATAAACAAAGAGCTGGGAGGAAGTTTGGTTTTTTGTTTATTTCTATTTCCCAACTGTG
TGGCCACTCCCGGTCTCTCTCCATCTCTTTTTAATTAACTTATTTTTACTGTCCCAAAAT
ATACATAACATGAAAATCATTTTAACAGGTTTTTAAGTGTGTTCACAATGTTGTGTAGCT
TTCATCACTATTTCCAGGACTTGTGCATCATCCCAAACAGAAACTCAAACCCATTTAGCA
TTTACTGTCCATTCCCACTCCCCATCTCTTGCCCCTCAACCCCTGGTGAGCACTGTTCTA
CTCTTGGGTCTCTGCAAATTTCATAGAAGACAAACCATAAAATACTTCTTTTGTGTCTGG
CTTGTTTCATTCAATACGATGCCTTCAAGTGTCATCCATGTTGTACAGCGTGTTTCAGTA
CTTTATTCCTTTCTACAGCTGAAAAATATTCCATTCCATTGAATGTCTTTACCACATTTT
GTTTATCCATTCATCTGCTGATGAACACTTGGGTTGCTTCCTGGGAGGAATTTAATGCAA
CAATTCATTAAACCCACAATAATGGGTGCATCATTCTCCAATTTAGAACAGATTACATGA
TTCTCAGACTTTGGTTATTTTCTTAAAGTCACCACAAATCAAGAAGACACTCTTTGACAA
ATAAAAAGAATCTCTATTTTGCTTTCTTATGGTGATTAAACGATGAAATAATTCCCTGAA
GTCTCTCCTTTTAGATAGTTGAGTGTCAAGAAGTGGCAGAGGCTCTTAAGTGCACAGGCT
GGGAGGACAGACCATAATTTTGTTCACCTGACATTTCCTGATGTGGATTATTTTAGAGAG
GAGGCTGTTTAATCTCCGCCCCCCCTCCCCGCCCCCAACACCCTCATCTATCAAAATGGA
GGGAATTCATGCTTGTCATCTAATTTCTTCCCAGGAGTTTTCCAGTAGTTTGCCAGTGAG
GGAGATTACAAACAATCTTTTTTCAGTGTGAACATATGTGTACATAGTTTGCCGATCAGC
CAGCCAGATCTGCCACAAGCTCAAGGTATGAATTTAGGCAAGTTGCAAAACCCTCAAACA
CCATATGATGGGCTTAAGTTAATTAACCCTAAACTCTTTTTAGTCAGAAATGCTATGGTG
GGAATTTGATGACCTATAAATGAAACTAAGCTCCAAATTTGACGTGCAAAAATAAAACAT
AGAAAATGAGGTGAGAACGTTTTAAATATAAAGGAGGCAAATAAAGTGAGAAAACTTTAT
GCAAAATTGTTTTCTGACTTTAAAACTGGTACATTCTAGGCAGTGGACTTGGTCCAGTGG
TTAGGGTGTCTGTCTACCACATGGGAGGTCCGCAGTTCAATCCCTGGGCCTCCTTGACCT
GTGTGAAGCTGGCCCAAGCGCAGTGCTGATGCATGCAGGGAGTGCCCTGCCACTCAGGAG
TGTCCCCTGCGTAGGGGAGCCCCACATGCAAGGAGTGCACCCTGTAAGGAGAGCCGCCCA
GCGCGAAAGAAAGTGCAGCCTGCCCAGGAATGGTGCCGCACACATGGAGAGCTGACACAA
GATGATGCAACAAAAAGAAACACAGATTCCTGTGCCTCTGACAACAACAAAAGTGGGCAA
AGAAGATGACGCAGCAAACAGACACAGAGAACAGACAACCAGGGTGGGGGGTGAAGGGGA
GAGAAATAAATAAATAAATCTTAAAAAAAAAAAACTGGTACATTCTAAATGCTATATTTA
ATAGCTGTTGTATTAGTCAGGGTTTTCCAGGGACAGAAAAGAGATTTTATGTATATATAT
ATATATACAAAACCTCATAATAAATATGAAATTATAGGAATTGGTTTACAAGCCCATAGA
GTGTGGCAAGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCACA
GAGCACCACCTTGTACCCAAATTGACCTTTTCCCTCACTGGTATCCTTCCTGCAAAGTCC
ATCTCACCACTGAGCTGGGGAGCCCTTGAGAGCAACAAGCCTTCCCCCCATTGCCAGTCC
CTCTGCAGCTCTTCTTCAGACCCGTGACTTGTGGAGACCAGTGCCAGGAAAGTTGCTTCA
GGCAAGGCAGTCCCCATGCCCAGTTTTGAACTCTCTCATCTCTGGTCAACCTTTTTTTTT
AACATCCCCCCCCACCCCCCAAGATGGCTCCCTCATTTTTTTGGTCATTGTTTTTGCTTG
TTGTCTTTGCTCGTCGCCTCCCTATTGTTTTTTGCTCATTGTTTGCTCATTGTCTGCTTG
TTGTTTTGTTGGGTCTATTTCTTCAGGAGGCAGTGAGAACTGAACCCAGGACATCCCATG
TGCCTGTGTGGGAGGTGAGCACTCAACTGCTTGAGCCACATCCACTCCCCTCTGGCCTAT
CTTTTTTCTCACTCAGTCACACAACCAAACCCTTCTTATAACATCCTCTGGCACTCTTGT
CGGGAAACCCCATTATACCATCAAACGTTTCCTCAAAACTGTCCCTCTGCCTTCTCATCT
TATTTCCCAAAATGTGTTCCATAGAACACAATCATGCAGATTCCTAAGAAGTGTCAAAAA
AGAGTTTGTTGGCCAAGTGTGGTTTATTTATTTATTTTTATTAGAGAAACTGCAGGTTTA
CAGAAAAGAAAAAAAAAATGTTTTCTGCAATTGTAGAGCTCCATATATATGTCCATTAGG
TTATTGTTGCAAATTGAGTTGTTCAAATCTATATCCTTCCTGTTTTGGTTGAGTCTATTT
TTTCTCCCTTGATTCTATCTGTTTTTGAAAGGTGCACTAAAATCTCTGGTTATGACCGTG
GATTTGCCTATTTCATTGTATAGCTGGTTCTGTCCGTTATTGCTTTACCAAGTACATTTT
GCAGAAGCCAGCATAGCGTCTGCAGGGAGGACGTCCTGGAGTCTTCATGTGGGCAACTTG
CCCTGTGACTCTCCATGAGGGACAATCCCCTTTGATAAACTGGACCACAGAGCCTCTTGT
AAGAAACATCTTTTGGGGATGTGCTGCCTTAATCATGATTTGGTTTTCTTCTCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTAGATAAAGGTTGCAGAATTTA
CCTATGACCTTTCAAACTGAGATTTATTTCACGCATACTTCCCTGGCTATTTCTTATCTT
CCAGGTTGCCTGCTTTGAGAGCCAGGTCAGTTGGTGAATGCTTTGTGCTCTTCTCTTTTT
CTGGGTCACTCACCAGATGAGAAGCTGGTTGTGTTATCAGAGGGAAATAGGGCCGACTGC
TTCTTACAGCAGAACAATGAGGTTCTTTCTGCCGGGTGGGACATTTTATCCAGATTCCCT
TTGCTCCAGATGGCTATCCCCTCAAGGCCTGGGATCATTAGGATTCCAGATGTGCTTGCT
ACCGGCGATCTGGGCAATGCGACTACAGCTTTCTTTGTGCCAAGTGTGTGCTCAGCTGTT
AGATGATGTTAAAAAACGGTCGCTTGGCACGTTTTGAATATGTTTGATAATTTTTATCTT
CAATTTTGATTCTCAAAATAGGCATGAGGCAGTATCTTAAAATATTTGGAATTGAAGTAG
TTAAATCCCTGTTGTACAAATAGCGAGTTCTAAAAATGTATTGGCGAACATCTGAGGCAA
TCTAATTCCCAGCTTCCAGAATTCCATGGTGTCTCCTTTCCTAATAAGTCAAACTAGTTC
TGAATCCAATTATACTCTTTCCATTTTGAAAAAGAACTCATTTTGTGTGTTAGTAGAATG
TACTTTGATATTAGAAAAAAAATATGTTTTTACTTTAATGTGCTCCAGATTGGAGCCTCT
TATTGAGACCGGTCTGCCTTATTTCCCAACTGTACCAATTAAAAATACTAATTATTTCCA
TCCTAGTATCTCAGGATCATCTTTTGATGCATGAAAGTTTTGAGGGAATTTAAAAAGAAA
AAAACAAAAAACAACCTTATAGGCCTGGGGAATCATGTGAGAAAATTAATATTCTTTAGA
AAAAAAAATTTTTTTTTAAGTTTTATGTCAGTTTATTAGACTTTCCTTTACTACTTCTTT
GGTTTCAAATCTGTCCTGGATTTTTGCTGTGTGGGAAGTAGCTGTCAGAATCTTCTTTCT
TTTTATAGCAGTTAGTGTAATTAATACTAAAATGACATACCCCAAGCCCAATGCTAATGG
GCTTCTCAAAAGCATTTTTCATATCTAATTCTTGTCATTTCTGAGGGCTTATGTCAGATT
TCCAAGATCCTTTCTATAGCTAAAGTCAATAATTCTCTGAGACCTCATGGTCTCTTTCCT
AATTCATAAATCAATCCATTTCTTGCTCTCATGAGAAAGAATCCAGGTGTGCTTAGACAG
GAAGTCATTTATTTTCTTTTCTGATGAAAAGGGTGAGAGATGGAGGAAAGATTTTCTTTC
CAGCTGCAAGGCAATTCTTTCCCAGAGAAAAAGAATGTTTTTTTAAAAATCCTAAACTCT
GGAACAATTATACTCTACGCAAAGAAATAGTAAGTCCTATAAAACGAGGGGACTTCATAG
TGTGGTATAACATTTCCTTTCACTCTTACTTGTATAAAATGTTGTGTGTTATATGAATTT
ATTTACAGTATATTATTTTCACTGACAGGTTTGCTCTAATGGAGATCCTTCTGAGATTGC
AAGCTTATACTCATGTACACTCTTCAGCAACATATGAGCATACCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAATGCTGAGCTACAAATGCTGGCTCACCAGCATTT
GATTTTTGAAGAGAGATTATTGGAGCTCAACAGGTAGAGAGCCATTCCATTCTGCAATTA
GCATAATTATCTCAAAAGTCTTTAGGATCCAATACTTGGAATAAGCCTATTTTAGGTATT
TGAGATGCAGCAAGCTACCCCCAAATAGTCATCTCTCAATCGCTCTTCTAGGCTATTGAT
GAAAACAACAAACTCTGAGGGTGAAGCAATTATAGGAAGAGGAAGTGCCTAATATTAGGT
AAAACGTATTGGGACTTAGTCATATGTAGAACTTTTTAACTTCTTGGCTCTTTGATTCTG
GTTCCCGGAATCCCTCCCTTGTAAGTGACTCACAATCTATTTTGGAACAACCTACCCATA
CTACAGCCGACTCCCCGTATATCAAAATTCATACAGAATAGTCAGAGGCTACTGGAGTAC
TCAGATAAAACAGACTGACAAGGGAGAACCAGTCCTGGGACTGAACATACAGCCTCAAAG
TTGGGACTGAGCTAAACTCTCTGAGTTTTGAAGCCACGTTTCCTAAGTCTGTGTTGAGAA
AAATGAGTTAGAAACACCGGGCTCATGGCTTAAGGTGAAACACTTGGCATCATTCTTAAT
TTGAATATGTATTTTTTCTACTTCCTTCCTGTCAATACTTCTCTATACTTTTTAATAATG
AATTTTATTTTAAAAGAACCCCCTTTATTATTTTTTTTTTTTCCTGAACAGAGTTTGGGG
CTATATTTCCATCGAGATCCCGGTTGCTTTCTCCCTGCCATTCTTTACCATGTTCCACTA
GTTTGGTTTCTGAGCTTACATTAACTCCCTCACTTCAGGAAGGGTTCCAGGGACCTGAAT
CTCAGGCTGGAAGGGACAGGAAAGTTTACACTGCACATCCTTCACATCAAGGCCGAGCCA
CACAAAGAAGCATCTATCTTATTTTCCAAGGCTCTAGAGAAGATTTTACAACCTGGAACT
GCATCTCGTTTTGAACTTACATGTCCTTACTCGATCTAATCAAAGACTTCATACTTTCGA
ATGTAGCCTATTTCCCTTGTTTTATACTAAATTACAGATAGCCAACCATCTCCTTAGAAA
AAGCTCTCTGCAAGCTCAAAGAATGTAATCTGTTGCCAAACTGGGCCTGCTTTTCAGAAA
ACTTAATCACAGTCCCATTTACCTCTTCTCACTGGGCCTTATTTCCCAATCCTTGAATCA
TTTTGCCATCATTGTGGCTGTCTTCTAAATTATTTCCAAAATTGCCACATCAGTCTTTAA
ACATGGACTCCAGAAATTCACATTAATGACAAACACTAAGTTATGATGCCCTAAATGCTC
CTTCATCCAGCACTCATGCTACATTTCTTTATTTCGAATTGATCTTTTTAAAAGTCCTCT
TATTGAAAAAAAATTATTCCATTTTGAATTTGTTTTAATGCAACTGGTTGGTTTCAGATA
AGGGTGTGTAAATGGAATAGATGATTAGTTTAATGCCATACTGGTAAATATGTAAGATTT
CTCAAAGAAGCATTTATAGAAGTTATAACTACAACTAAAACGATTTTATTATTCCTCCAT
TTAAGTTTTTTTCTAATATTTTTCCTCTCTTTAATCTTTGATGAATTTTCCAGTTTTGGG
TTTTTCCAGCAAATTTCTGGCCAAAAGAAAAAGAAATCAGAAACTAGCTGCATTATATTA
ATACAATAACTCCACCAATTTAGTTTGGCATCAGTGGGATTATGAATGAATTTAAGAGTC
TTTAGGAATGTTTGGGGCTATTTCTGCATAGTTAAGTCTCAGGTTTATTGGTTTTTTAAT
ATTTTTTTATTTTATAAAGTAGGCTGAAAACAATTACAACATAGATAAATCTGCAACTTG
TAGTTGAGTTGTGCCTCTGATAGTCCAGGCTTTCAGATACAGTAGCCGAAGGTAACCTTG
TCTGGCATATTTTGTATTGAGTTTGGTAAGTCAACAAAGTCCCTGGCATGCAGATTTTCA
TTTACTTTTGGAAAAAGCCAAGTCCATGGAGAAACTGCAATGGAAATAATGATCCTGGCC
CGTAGGGCTTAAGGGAAAATTCCCACAGGGGAGCTTTGACACTCCGTGGCCCACTTTTCC
CAATGACACAAAATGAATCTGCCATGGGTTAGTATTAGAGAGCCGTGCACAATCCAAAGC
AACTATAAAGGAACACCCAGCTAGAATGGAAGACAGTGGGCAGGGGCACAGGCATTTGAG
TTCACCAATAATTCTATACTAAAGAAAGTATGGGGTTATGGCTTCAAAACATATCATTTA
TTTATTCACGTTTTATATCAGGACATTTTCCAATCATGGGAACATTTGTTATACCACTCT
GTTTCCTAGATACCAAGAAACCTGTCTGCATTAAAATAGGTAGGTAGGTAGATAGATAAA
TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAATAGATAATGGAGGATA
GATAGATACAAAGATACATAGATACATAGAGATGTAGGTAAGTAGATATATTTATAGGTA
CAGATACTAGATGATTTAATTATGAAGATATTATAAAAATATTTTTAAAAGCTCCCGTAA
TCCCAATACTCTGACACAATGAGCATTGTTTCATACATTCACATGTCTGTCCTTTTATAC
ACAATGGAAATGCAGTCTTCCATTGTGATGTCTTCTGTCTAACATGCCATGGGAGAGCAT
TTCTTCTGCTGTTAAAAATGTTCACTGATCCTCATTCAATAGTGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGAGCTGCTGTCTCCAGCCTTGCTCAGCATCCAGTTACTGCACGTTCA
GTTCCTTTTAGTTATCACCCTCTATACATCGAACTCCATTATGCCCTAAATTAAACACCT
TTTTCCATACAGACCTTTTAATGGTTTTAATTTAGGAATAAATAGTTGATTACAGAAGCC
TTGAGTTCAGGAAAGAAATTCCAAAGACTCCAAGCAAAGCTTTTCCTTTTCTCTTTACCT
GAATTTCCCATTCTTGACTCTGAGGCCTTACTCTTGTTACGGAGAATAAGGCTCAGAAAT
GTGCAAATGTGCACACATACACGTACAAACAGGAAATCAGTGCAGATACACATTTTGGTG
TATATTTGCATTGACACTTTTGGAACCCTCAAGAAACTTGACCGTGGCTACTGAGGCATG
GAACTGGGGGAAGAGCTTCTCTCACCCAAGCACTGCATCTGAGGATCAGGAGTTCGCTTT
CCTCTCCGAAGACCAATTTCATATAAAAATGGAGCACTTCTATTAGGGTTCAGAAAAGAT
AGTCTCCTGTTTCCTTTAGAAATCAAACGTCTGTGACCAATATGAATGGAATTGACATCT
TTGTGTGATTATGGAGCAAATGCAACAGGAAGGAATGACTGGAGCAGATGTTCAGATTCA
TTTTGTGTTTACGCACTTGATTGCCACAGGCTTACTCTTGTTGGATTAAAAGACTCAATG
CGGGGAAACAGATGTGGGTCAACCAACTGAGCTCCCGTCTACCATATAGGAGGTCCAGGG
TTCGATGCCCAGGGCTTCCTGGTGAGGACAAGCTGGCCTACACAGAGTGCCGGCCCACGC
AGAGTGCCAGCCCATGCTGAAATGCTGCCCCACACAGCAGTGCCCCCCTCCATGGGAATG
CTGCCCAGCGCGGGAATGCCGCCCCACACAGGAGTGCCGGCTGATGCTGACAGCAAGATG
ACACAACAAGAGACTCAGAGGAGAGAAAATAAGAAGATGTAGCAGTACAGGGAGCTGAGG
TGGGCAAGAGAGTAATCACCTCTCTCCCACTCCGGAAGTTCCCAGGATTGGTTCCCGGAG
CCACCTAATGAGAATACAAGCAGACACAGAAGAACACACAGCAAATGGACACAGAGAGCA
GACAATGGGGAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTACATATCTGGA
GGCAGTGAGGCGGGATGGTTAAAAGCCTGAGCTTTCCCTAGTTACTTCAGTTTCCTCATC
TGTAAAATAGGGAAAACAACAACAACAACAATGCCATCTTTCTCGGGATGTTGGGAGCAT
AATAGTTTGCTAACATAGTGGTCACTACGCATTACCTAAGACACACATGTGTCTAAATGG
TCAAAGATTAAGAAAGACCTCCTTCATGCAGACGTTGACCACAGAGTCTCACCACCATAA
CTTATCTGAAATTAATGTATAAGAGGTATCATTAGCAGGGTCCCTGGAGATCCTAAGTGA
GGTCAGTGATGGATAGACGGTCAGTCCCTTAAATTGTAAACACCCAAGCACATGTGTGAA
AATTCTGAGTAACTCACATTTTTCTCGCAAGGAAACATTCACCTTCTAGGTGTGAAATAT
GAGAACTTCTACATTTTCTCCAATTGGAAAGTTTAACACACTGAATAATATTTTAAATGT
TAATTCTTCCATGCCTCCCCTCCCTAAAAAAAATGGGAATACTAAGAAGGCTCAGAGTTT
TTCTGAGGGTTAAATGAGATAATAAGACAATAAACCACCTGGCCCATTGTAGATTAATGT
TGGTAATTATTATTCTAAGGTAAATAAAGTGTGAGTTGAAACGCTTGGTGTTCTAGGTCC
AGGAAACCATCAATGCCAGATTGCAGTGGCATTTAGTTCCTTTTTGGAGACTACTAAAGT
TAGCATCATTTATTCCTCAAATATCTGGAACATCAAACACAAGGTTTTCCAAATTTGACC
AGATTCTGGATCTCTAATTATAGTTCATAAATATAAGGCTGGACCTGGGCAAAGGGAATG
ACAAAATACAGATTCAGTTCAGGTAAGGATAAAAGACACTCCTGATATATTGCAGTATTT
TCTAGAGCCCTTTGAAAAAATAAATAGAAAAGAAAATTTAGACAACAAGAAAAGGAGAAA
GTGAGATTCTATATGATGTCCAGTCAGAACACCTAGAAAAACCACGTTGAATTGCCATGG
AAAATACCTGCAAAGGGAAGCAACTAATTCAGGATCTTCTTGGAACATTCACAGACTCAC
ATTGTTATTTTCCTTATTTCCCAGAAATTGAGTCCAGTGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGATGAGAATTTTACACATATCTGAGCAAAGAAAAGTTCCAGGCTGGAGTCCAGC
AAGTGCAGTGCGTGAGAAAGTCGTCTTCTTACTTGTGCTGCTCTTATTTGCATGGACATT
ATTCCATTAACAGAGGAAGAGTTTTTAAATGAAGATCCAATCTCCTGCAGCCTCCATTCT
GGATTATTATACTTCTGATGTCAGGTTTAACTGACTGTGGATACTAATAATGCCTACCAA
TGATTGAACCCGAGAGAGAGTTAACTCTAGCCCCAACATTAACCCTAGCCTTAACCTAGC
TGATTTTTCCAATAAAGAGATTAAGCTTAAGCGAAATTATGTAATTTACTCAATGTCCCA
TACACAGTGAAGTGTGGGGTTGCCATATTGTATCCCCAATTAATCTGATTCCAAAGCCCA
TGCTTGAGACAGCTATATCTAATTATTTATAATAATTTTGCTGTAAAACAAATGGGAGGG
TGCTTCTCTTAACCACAGTGGATATATTGCAAACAATGACTTCTATGTGTGTGGCCTCTA
TGTCACTTCACCTCTTTCAGAGTCTGCTTCCCCACCTATTAAATAAGAGGGTGGAACTAA
AATCTAAGTCCTTCCTAACCATGAAATACTGCGACTCGGTGTACATTAACTCTGGCTACT
TTAACAACTTTGGAGTCTTACCAAATCAGTGATATAGTAAATAAACATGCATTGATTGCC
TTCTCTGAGCCAGGCACAATCTACAAACACCATGCCATAAAGTCATTTTTATTTAAGAAT
TTAATGATGTGTTTGGGATAGAATATATTAAAGTTTGACCTGGATATCTTGGTCTTGTAT
AGACCAGGGGTTGAAACTTAATTGCTTACAGGGCCAGGTAGGAAACGTGAATGAGTGAAG
TGAGATGGTTGAATGGACATGATTCTGTCTAAACTCAAAACAACCATATTAGAAATGTTA
AAAAGCAGTGTTCTCATCAAAACCAAACTCTATATGTCTACTTTGCTTCGTACTTTAACT
TACAAATACTGATAAGTGATAACTGATATTGGTGATACAATTGAAAACTTTGTAAGAAAA
TGGACTCCCTTAAAGCATCTAAAATAACTACAGATCATCTCGCTCCCTTGTCAGGTCATC
CTGTCCATTGACTCCACAGCACTCATCTTAGTCGCCACCATGGAAAATTAGTTCCAAGGA
GTAGGGACATGCCTCTCTGATCCTTATCTATGTCCGAGGCTCCAGCCCTTGTGCCTACTC
TATGATAAGTCATCCTTAAATACTTATTATATGAAATGAACAGCATCTTAATTTTAAATA
GAGGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCACAAGGGCCAAGGAACTCAATATCACAATATCCACAAGGGCCAAA
TCGAAAAATATCACAACCAACCAGAATATAAGTGAAATAAACCTCCACAAGGAACATTCG
TCCAGGGTCTTGGAATCACAGTCTTTCAGGGCTCAAGAACAGTTCCTATGCTCCACGTTA
AATGGATTCAGTCACTGTTAAGCAACTGAATGAGCATAAATCATCAGCTCGCAGATGCCA
AAATGTAAGACTCCTGCTCTCTGACCCCGCACTCATCTCTTGACCAGACGCCTGCTGTCA
TTGTCCAAACTGCCCTGATGATGAGGGCGGAAGCTGCCAATATCAGATAGGCAGGCCTGG
GGATACTCCCTGCAGTGAAAAGGCACAGGCAGGTGTGAAGAGGAGAATGGTAGTCCAGGG
ATGGAGGCAGGAGAAACCTACCACCCCGTGTGAGTGAAGGCTCACCACTAAGCACCCAAA
GGTGATGTGGTCCCATGGGTGAGAGGTGGAGCAAGTGCTCCCAGGACAGTACTCAGTGGT
CCCAGCACAGTACTCAGGCCATGCTGGCTCCGTGGGCTGCCGCGCGATGGCCTGGTGCCT
CAGCAGCAGTTCACCGTGGACGGCTTGGGCCACACAGATCCCCGTCCTGGCCCTCAGGTT
GCAAAGCTCTGAACTATTTTGGACTCCTTCATCTTCCCTTATTTAGTCGTTCGTCGAGTC
TTACCAAATCCCTCTTCCAGCTGTCTTTCACATCCATTCTTTGCATTTTCATAGTCGCCG
TGTGGTTCACGTTCTCATCAACTCTCCTCTGGCATCACAGCATCTACCTAAGCCTCTCAA
TTCTGGTCTTTTCCAACTCCAGTCTTCCCCACACGGTGCCAGGGCTCCTGAATTCCAGAG
TGAAGACCACGCTGTTGTTCAGAGCTCTTTACCATCCGACTACACCAACTTACAATCGTT
TCTCCTAGGAGTATCCTTTTTTTTTTAAAACATTTATTTATTTATTTATTTCTCTCCCCT
TCCCCCCTACCCCGCCCCAGTTGTCTGTTCTCTGTGTCCATTTGCTGCATCTTCTTCTTT
GTCTGCTTCTGTTGCTGTCAGCAGCACGGGAATCTATGTTTCATTTTGTTGTGTCATCTT
GTTGTGTCAGCTCTCCGTGTGTGCGACACCATTCCTGGGCAGGCTGCACTTTCTTTCGTG
CTGGGCGGCTCTCCTTATGGGGCACACTCCTTGCGTGTGGGGCTCCCCTACATGGGGGAC
ACCCCTGCATGACAGGGCACTCCTTGCGCGCATCAGCACTGCGCGTGGGCCAGCTCCACA
CGGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTCCCATGTGGTAGACGGACGCCCTA
ACCACTGGGCCAAGTTCACTTCCCAGGAGTATTCTGTTCTCATAAAATTGTTTGAGAAAC
TGTTGCCCAAACATCCCTTTTTTCTTAACAAATAAATTTTATTGATTCATATTAATAAAG
CACACAATTCATCCAAAGTGTACAATCAATGGCATTTCGTATAATCACATACTTGTGCAT
TCATCACTTCATTCACCATTAGAACATTTTCATTATTTCCATAACAGTAATAATAATAAT
AATAATAAAGGCAAACAAGAAAATTCTTTACCTCCCAATCTCTCTATGCCAAACATGCCT
TAAGTTTTTTAACAAATCAATTTTATTGCTACATATTAATAAAGCATAAATCCATCCAAA
GTGTACCCTTATTAAGTTTTGCTTCCTCTCCTTGTTCGTACTTTTCCGCCTTTTTACTGC
CTCCCCACTAATCCAAATGTTGCTAGTATTTTAAAAACCTATTCATGTCCTACATCCTCT
TAGAAGCCTTGTTCAAAAAGTCTTCCATGGGAAGCGCATGTGGCTCAAGTTATTGGGCTG
CTTCGGTCTACCATATGGGAAGTCCAGGGTTTGATTCCCAGGGCGTCCTGGTGAAGGCAA
GCTAGCCTGCATGGAGAGCTGGCCCAAGCTGAGAGCTGGCCCAAGCAGAGCGCTGGTGCA
GCAAAATGATGCAACAACAAAAAAGAGACACAGCAGAGAGACAATAAGAGATGTAGCAGA
CCAGGGAGCTGAGGTGGCACAAGAGATGGAGCACCTCTCTCCTATTTTGGAAGGTCCTAG
GATCAGTTCCCAGTGCTACCTAAAGAGAAAACAAGCAGACACAGAAGAATGCACAGCAAA
TGGACACAGAGAAGAGACAACGGGGATGGGAGGAGATAAATAAATAAATAAATCTTTAAA
AAAACAAAACAAAACACTCTGCTCACATTGTTCTTCCTCCTTTAAACTCTAAGTGTAATG
GCTATACTATAAACTCATTGAGAGGGTTTAACACTATTTCATATGTTTTGAGGATGCCTA
GGTCATGCTCTCCAATCAGAATGTAAAATCCTAAAAATCAACAAGAAATCTTTGGGTCCT
GACAGCAGCCAGGGTTGCATCTTGGGTACCCACTTTTTGGATGAAATAACCCCATTCAAG
GTAAATAATGGAAGGAGACATTTTCCCTCCTGGACAGAAAGAATTGAACTCAAAATTAGT
ATTTGCAGACTGACATTACCTTCTGTGATATCGTCCAAAGGACCTTTCCTTGGGCCTCAC
TAAAGCAGTTTAAGAGGCAAAATTTTGTTCCCTTAGATTTGCTCCTCCTTATCTTTGACC
AGCACACAACAAGAGATGGGAGAGAACCTACTTCCCTAGTTAATAAGCAACAGGCATTCG
AGGAATTTCTGTTGTATTTCATAAAGAACTAAGGACTTTGGCCTAAACTGCTAACATGAT
GTTATGAAGAGTCATATACAAATTACTATGAGTAAGTAAAANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACT
ATTGATGATTTATTCCCAGGGTCATTCCCCAGAGCTTGTCCAAAATTTCTGGACATCTGG
CATCCCCTACATGTGGTATTCTGATATACCCTACCTTCTAATGTTCAAATTGTAACCTAT
CACTGTACTTCTAGATGTCAAAACTATAGGTTAGGTGTTCAGCAATTTCCTTCTAGGAAC
AATCCTTTTCCTACCGCCTTCACATTCCAACACGTTCAATTCTGTCCAGGAAGGAATTTT
TCTCTCCTTTCTCTCCTGGGACTCATTGGAAATTAATTGAAAAATAATAGCACTTGTGTT
GGAAAAACGATTTTGTAAAAGATGTCCCCAGAGGTGCCAATGGCAAGCGAATTTCGTCGC
CTTTGGGGGCTGTGCCGCACCCCTTCCGGTGAATGTGGAGGATCCACACCCCCAGGGGGT
GCTGCGCGGTGCGTGGGGGTGCTGACCGCGCGCCACGAGGGCCGGGCACCGCGCGCCCAC
CGCGCGCCCACTTCACCCGGAGCGTGCAGGTGGAGGAGGTCGTGGCCAGCGCCTGCGCCG
GCCACGGTCGAGCGGTGCCAGGACTCCAAGGTCACGCTCCCGCTGGCCCACCGCGTCTCA
CCACCAAGAGACCCAACAGCTTTTTCTAGGGGCCCCCGCGTGGGACCAGCCCCATTAAAT
CAGCACAACTGCCCCTCCAAAAAAAAGATGTCCCCATTCAAGGGGAAAAAGAACAGAAAA
CATGAGGTTTTAGATTTGTGAATATAAGTTCCATTGATTTTGTGGTGCTTACAATTTTAA
AGGATGTCTTTTAAAATCATCAGTCCCAAATTATTCCATTTGAAAAAGAAATACTCTGAT
TTTCAGAAGGTATGTGTCCACCTATGTTAAGCAAATTTTAACAACCTTATTAAACTTTAA
TAATCCACTTATTGTTAAAATTGTTGTGTGTTGCTTATTTTAAAAAGTCATCAGTTAGGG
GAAACGAATGTGGCTCAAGCAATTGGGCTCCTGCCTACCACATGGGAGCTCTGTGGTTCC
CTTCTGGTGCCTCCTAAAGAAGACAGCAAGCTGGTGCAATAGGCAGGTGTGGCACGCTGA
CACAACAAGATGACACAAGACACACAAGAAGAAAACCATAATGAGAGACACAACAAAGCA
GGGAGCAGAGGTTCCCAGTGCCTCCTAAAGAGGACGAGCAGGACAGCCAGCTGGAACGGG
GATGGCTTAAGCTATTGGGTGCCTCCCTCCCACATCAGAGGTCTGGGGTTTGGTTGAGGT
GCCTCCTAAAGAAACAAGGAAAATGAACAGACACAGCAAGTGCAAACAATGAGGGAGTGG
AGAGAGATAAAAAAAAAATAAAATAAATCTTAAAAAAAAAAGTCATCAGAAATGCATTCT
AAAGAGTTAAAGATGAAATGTCATGATTTGGGGGTTTTACTTTAGACTCAGGGAACAAAA
AGAGTGGGGGAGGGATAGATAAAATAAGGGAGGCAAAAGGTTGGTAAGTGCTAGAGCTGG
CTGATAGGGGTTTATTATGCTCTTCTCCTTACTTTTGTGTATTTTGAAATTTCCCACAAT
GAAGTGTTTTAAAATTCCATAAGTTTGTTTTGCTGTTCTTGTCACATCATCACCCTTTTG
CCCTTCCCCAATCACGCTTGCAAAGTGTATATCCTTTTGGAGAGCTTTTCCTGAGTCTTC
ATCCCAGGGAAAGAAGGAAAGAACCCAAGAGCCGATTGTGGATTGAGCCAGGAGTCGACG
CCTGAAGGGCTGGTGGCTTCCTCAGCGCTCAACTCGCTCCAGAGCCGCGGGAGAGGTGTC
TGAGGAGGACTTGGCAGGGTGACAGCTGATAATGAATTTTCTCTCTTCTGTGAAGTACCA
AAGCCACAGGGGTTCGTTATGGGACACTGCTTTAAAACTACTGCAGTGTGTAAAATTTTT
TATTGGCTTAAAACTTACCATATCAGTTCCCTGGATAATTTGCTGCGGGTGCTTTGGCCT
CCAGGAACCATGAAGAATCGCATGTCACACATGCTCAATAACAACGCAGAGAGCAAGAAG
ATCCCGAATTTAGCAGGAGCAGCCTCAACATGTGGAAGACTTTTTAAAGCAACAGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAACTTTGTAAA
GATGGAGGGGGTAAAAGAGGAGCCTATAAAACCATCTTCGTGTAGTTGCAACTTTAAAAC
GTGTGTCCCAAGTAGGATTTGGCCTGCAGATTCCAGATCCCCTGCTGCCTCATCTCAGAG
CTTGGGCAGCTGGGTTGCTGGACTTGGAGGGGCAGTTGGTGTCCAGTGGATTCGCCTGGA
CAGAGTAGAGGGTGTAGGGAGACAGGGCTACAGAAAAGAGCCCCGCTAGAAAAAGCTCAA
CCACCTGCTCCTTGCCAAAATGCTGGACATTTCATCAGTACAAATTCATTTCTTTGAGTT
GACAAATTGCCTTTTAAAATGCAAATACCTATAAATAAAGATGTGCCTAAAACATATAAT
GTTTTCAGTAGGCCCAACGTCCTCTTGAGTTCAGAAAGGCACAGATAGTATTAAATTTGG
ACTTAAAAATTTCTCCAGTTTACTCTTCCATCCAGATCAGGTTACCATCTAGAAATTTCC
CTGGACTTTATTTTCCCTGAGGGTCAAATATAAAACTGTCAAATAGTGCTATTCCTCATC
CTTCACATTTTCTTCTAGTTGGCTGTTGTTTTTTTAATTTTTATTTATCGTTCTTTGGGT
TATGCTAAGTCAGAATTGACAACTAACCAAAGGTGGAGTTTTCAGTCTGGCATAGGTCCA
CTGGTTTGTTGCTATGCAGATTACCCATTCCTGCTCTTTCAAGAACTACCATTGTTCTCC
CCAAGAGTATTTGATTTCTCCCCTGAGTAAAATCAGACATTTACTATAAAACCTTGCCCC
TTCCCTCCACCACCCTTGCTTTCTAGAAGAGATGAGTGAAGAACATTGAAAATATTACTA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGGTCCATACAGGAGCAGCGGCAGTCCCCCAGATGCAACAGTA
AGGACCAGGAAGAAATGAGGGTTCAACAGTGAGCCCCTGATACTAATGACTGCTTGTAAT
CCTATACATTTGAAATAAGAAGAAGACCTAGAGCAGCACTGTGCCTAGGAGTTCCCTCCT
GACAGTCACCATGTTACCCAAATTGGCCAGTCTCGAAGCCAAACTCAGCAAGTAAATGCA
CTGCCTTCCCCCCAGCGTGGGACATGACACCCGGGGATGAGCCTGCCTGGCACCGAGGGA
TCACTACCAAATACCAGCTGATGATGCAACTAGAAAATGACCTTGAATTAAAGGTTCAAC
GCGGACCCAGCAGAATATCCCTGTCTACATATAATAACAGGAGTTTAAAATGCTGTTTGA
CCTAATGTAAGGGGGAAATGGAAAGGAGAAATGAGTTTATATGGCTATGAGTCTCTAAAA
AAGAGTCTGGAGGTTGTCAGAAGGATTGCCCTTATGCACACCTGAGCAGAGTCTCAGAGA
CAGATAAAGTAGATACAACCCCAGGTATTGGTTCTTTTGAGGGCTAAAGAGACCCACGGG
TTCTATGGTCATGGCAGATGGGGTTCACTGCCATGTCAGTTGGCCCTTCTTTGGAGCTGG
TGTTTCTGCGTAATGGAACTGGACTCAGATGGGATCTCTTTTCTCAAGACTTTCATGCTA
CTTTACTGGAATTGTAGTAGGTGCTGGGGTTTAAGATATATCTAGGGGATTTGAATCTCT
GGACTGACAATATGATAGCCAGGCCCTGAGCCTCAACAGACTTCAACTCCTATACTCTGA
TTTATTGGACTTACCCCACTCAGCTAACATGGAGTTGAAGAATGCCAACCACCACACCAT
GGAGACTAGAGTGCCGACAACTGAAAGCAGGAGGATTGCATCCAGTATCCATGTGGAATC
TGAGCCTCCTCTTGACATAGAGGTGCAACGGACACAACCAATCCAAGGTCCACAGAGAAA
ATGTGGCATTGGTGTGGGAAAAGTGGCCATGGTGGCTGCTGGGTGCGGGAATGAGAGGAA
GAGATGAGATGGGGAGGCATTTTCGGGACTTGGAGTTGTCCTGGGTGGTGCTTCACGGAC
AACTACGGGACATTGTAGATCCCCCCAGGGCCCACTGGATGGAACGTGGGAGAGTGTGGG
CTATGATGTGGACCATTGACTATGGGGTGCAGCGATGCCCAGAGATGTACTTACCAGGTG
CAATGGATGTGTCATGATGATGGGAGAGAGTGTTGCTGTGGGGGGAGTGGGGGGCGGGGG
CGGTGGGGTTGAATGGGACTTCATATTTTTTGAATGTAATATTTTTTAAAAAACGAATAA
AAACAAAAGAAAAAAATGAAATAGTTAAATGAAATGTTGTTAGTATATATTTCCTTTTAT
AATTGATGAATTTGACAACATAAGATGATACTGATTAAACTACTTTCAAATACTTATATC
TAGTTTGATTTTCTTTCCTCATCATTATAATTAATATCTATGTAACAGAATGCCTGGTAA
GGTGATGCATTAAACATTATAGTGTTATTACCAAGAACCTGGCATTGAAACCTCTCAGAA
TCTCTAGATCTAACAACAGAAACTTAAATCTCTTATACTACCATCTTTGTATGGGGGGAA
ATTTCTTCTGTGGCCTCTATTATATAACAGAATGCAGTAAGAATCATTTACTTTCCAGGT
AGTTTTTAGCAGCTTTTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCATTTTCTTTTTTTTATGAATACTATAAAAAAGGAA
ATGCATTTGATGACAGGCTCCACACAAACTGATCCATTTAGTGCTCTCTAGAGTAATGAT
TATGTTTTCTGGTATGTCAATGTCCTTTTTTGTATGATCCTCCAAGGACAATTTTCTGGA
AACACCAGTATGGGCACCCAAATCATGTCTAAGACTGTTCTGGAATTTATGTACTTTAAA
CAATGCAAAACAAAACTATATATATATATATACACACACATACATATATATAATGCCTTT
TATCAATTGAAAATACTATGTCTGGGGAGTTAAAACTGCCACAACAGGAATTTGTCCCAT
GGTTTGCGAGGTTGGGAGTTCGCTTCCTCCCAGTGTCGACAACCTTCCGGCTGGCTGGCA
GTCCTCGGGGTTCCTTGGTTTTGCAGTCACATGGCCATGTCCCTTCCTTTCTCTTCTGGG
TTCTGTTGATTTCCGGCTTCTGGCTCTCCCCAGGGGCTTCTCTCTTTTAAGGTACAGCCT
CCAGTAACAGGATCAAGATCCACCCTGGTGCAGCTGGCCACACCTTAGCCAAAAAGAAGG
TCTTTGGAAGGTCCTATTTATACTATGGGCTCATACCCACAGGAATGAGATTATAAACAC
ATTTCCATTCTCGAGGACCTAATTCAGCATACCACACCGTTCAAGGGTGGATAGAGTTAA
GTGCTTATAAGAATATTCAAAATATTTCCTCTCCATTGAGAAATAGCTGTAATTTGTTTC
CTGAGCCTTTGACTGATACGGAAAAAGTCATTTCTCCGTAAAGCTTTATGTATTAGCATC
GATAGACCATCCTGAAGGAGAAATAAAGTGGAAGAGAAGAGCAAAAATGATTTTCTGAGG
GATTTAAATACATATAGGCTGGGAAATGTTTTGTTTCGGTGCAAACTCTGCACATGGGTG
CATCATTTCCATTTGGGAGTTTGTGATTGCAGTTTCTCCCGCTTGGAGGCATAATGGGAG
AAGATTGGCTTGGGGGAGTGGGGAGGAAATGAGCCCGTCTCATCTCGAGCCGTCGACATT
TTCTATGACGGCGCAAGGTGCTGCAGAGAAATGATCTGGAATTCATTAAGCGTCAGGAGG
GGAGGGGGGCGGGGGGGAGCACGCCTTCAGGAGTGGTTCTCTCAGAGACCGCGATCGCCC
TCTAGGCTGCATTTACCAGCACGCTTGGATGACGCATCTCTGGCCACTTCGCCGCCAGGG
CGGCAGGGGGAAGGGGCCGGATGCCTCCCGGGGCGAGGACTGCGTGGACCAAAGAAAGAG
GCTGGCGACAGGAAGGGGAAGGAAGAGCTCTGGCCAGCGTCTGAACAGCGGCCGCAGGGC
CACCTAAACCGTGCAGTACTAACAAGGCGCGCGTCACACGCAGCCTCCCCCCGCCTCGGC
CACCCCCTGCGCCCCGGCGTCCACCGCCGCCGTGTGTCGCCTTCCTGTTCGGAAGTCTTA
GTGGGTTGCTGGGACAGAACAGGGGGCGCCTGTCCCACCCTTCAGGTATCCGGTTGGAAG
GAAAGCCAGTCTCAACAACTTGCATGGCTCGGTTAAATGATCAGTTTAGCAGACCATCCG
TCTCCAACCGCTCAACTTTTGGGTAGGGGGAGGTGGAGCTCACCCGCGACCTTCCTTCTC
TGACCCAACCACAAATCGCACCGGGGCGCCGCTCCTCTCTTCCACTTAGGCCCTTCTAAC
TTAAATTCCCCCGTTCACGGCAGCGCTTCTTTGAGAAAACGAACCTTGTGCTTTGGCTTT
TTTTCTGGACCTTATTTGTGAGGATATCAGTCCAGTCACATTTCTTGTGTGCCTTGCTGG
GAGTATAATAAACCCAGGACACTGGTGACTGCAATTGTCTGGGTGATGTTGCAACGGGGG
GAATAAATGGCCCAAGATTGAACTTTGCAGTTTGCTCCTTTCCTGTATGGCGTTTATATA
AAGCAGGGTTCACGACAGAGCAGGACAGCCAGGGGACCCTGGCTCGTGCTCCGTTGTTAT
CTGGAGCGGGCAGCCTTATCACAAACTTTCAGCAGGGAGGCTGTCCTCACTCTCTTTGGG
CTCTACCTCAAACCTCCAGAAAATAATCCCCAACGCTCAGACCCCCGGCGACCTGAAGAA
TGAAAGAGGATACTATAAAATCCCCTCTGAAAGGTCTGTCTGCTCTTATTACTGTAATGT
AAAGATGCTTCAGAGGATTTCAGGTGGCTTGGTATGGGGTGGAAGCAAGAAGGCAGCAGT
GGTATGGGGGGAGGAAGCGCGGAATCGGATGGAAATTTCCATAATTTAATACTTTAAAAC
AATCAAACAGAACCCTTTGTACGGGTGGATGTTTCTGGGGCACCAGATGAAAACGTGATC
TCTCCAGGGAGGAGGGAGCCGGCTGAGATGCTCTAGCTCGTTGAAGATGAAGCATGGTTG
TGGGACTGTCGGAAGAATCAGTCGGTTTACAGGAAAACTTCTGTGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTCCCGCATGAGGGGGATGGTG
GCCATCCTCATCGGTGAGCGTGGGGCGAGGCCCGGCGCCCGGGGTACGCGGCGAGTGGTT
TTTTGAAGGTCGCGCTGATCCAATGAGCGTGTGTGGTGTGTGATACGTGTAGCCGACTGA
ACATTTATTTTTCATTTCATCCGTAAACGTGCCTTTGTTTCTCCTCTGTAATTCGCAGCT
TTCATGAAACAGAGGAGAATGGGCCTGAATGACTTCATTCAGAAGATCGCCAATAACTCC
TACGCATGCAAACAGTAAGTTTGGGGGGGATTTGAGGAAAGGAAAACAGTGTCGTTCGGG
TTGACTCGTTTTAAGACTCAGTAAAGCGTTGGTCAGGAAGAGGAGGTTTCCCCGGGAGGA
GCAGATCTTTTTTCACCCAAGGTTCCCAAATCCTTAAAACATTTTGAACATTAATTTACC
GATTTGGCTCATTACGGGCATGTAAGATAAACCTTTAACATTTGCCCAGCTCACGCCCCC
TCTCCACGAACAATACGAATTTTTGTGTTTTACGGGATTGATTCTTCCCTTGAGCTGATT
TCTTTTCAACTAAGTTAGTTAGATGCTTTCAGTTTAAACACCCTGGAAAATGTGAGCCAG
ACACTCATTGGTGACGCTCGCGTGCCCCCCCGTGGCGAGAAACGAGGTTCTAAATTGTTT
CTTTAATCTGGCAGCCCTGAAGTTCAATCGATTTTGAAAATCTCCCAACCTCAGGAGCCG
GAGCTTATGAACAACAACCCTTCTCCTCCCGTAAGTATCCTTCTTGTGATGCATCTGTGA
GGAAAATTGGAAATGAGTCAGTCAGTATTCCTCCATCGATGAATTAAAATAGCAGGAATG
CCTCATTAGTTCAGGGCATAACAAGTGACAGAGGTATTGAGTCAGTGGAGTATTTTCAAA
GGCATATTAGATTTTTTTTTTTAACCTGCCTACAGTAACACTGGACTATTTCCATGCTGT
CATTTGAAATATTGGCTCGTGTGTTTGGAAAGTAGCTTTCCAGTATGCTTATAGCTGTAG
GACAGACACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCCACGAATGTCAAGACTAATTATGTGCATTGTGAAAAGGCTTTGGCA
ACCCTGGCTGACTTTTGCTCCTTCTCCTGCAGTTGTTCTACCACCTCCAGAGGGAGCGGT
GCTTCCTGGAACCGCGGGCTCGTTTCTATGCTGCTGAGATAGCCAGCGCCTTGGGGTACC
TGCACTCCCTGAATATCGTTTACAGGTGAGCGTGGAGGGGTGTAGTCCTGGCTTCCGGTA
GATCTTTAACGTAATTATCTCCTAAAACCACGCTTTCCCTATTGCAGAAACTGGCTCAAA
CCTGCCCCCAGGGAATGAGCTGGCCAGGCTGGTTTCTAATCCAGACTATAAATTAGCAAA
ACCAGGGCCTCCTTTTGCATTTGCTCAGCAACTGCAGGGAATTGAAAATGCTTCCAGCAG
TCTTAGGGGTGACCTGGAATCAGGGCTTTCTTAGGAGGTGAAATTAAAGTAGACCACTGC
TTTTGATTTTTTTTACAGAGACTTAAAACCAGAAAACATTTTGCTAGATTCCCAGGGACA
TATTGTCCTTACCGACTTCGGACTCTGCAAGGAGAACATCGAGCACAACGGCACGACGTC
CACCTTCTGTGGCACCCCGGAGGTGAGAGCACTCTCGATGTGTTGCCGGGAGAGGGACGG
GCGATGATGCCCTTCCTGTTACCCAACAGACTGTTCTCAGACGGGTTAGTGCACTTCAGT
GCAAGAAAATAGATTGGCTGCTTGATGCAACCCGAGCAATTCCCGGGTCTGCATTGCTTT
ACTTAAAACGAGCTGTTTGCCGGCAGCCATAAAAGATTCCTAAATTCCCAAGTAAGAATA
TTGCAAGTCCAAGAGCTTCCCAAATGCCAGGACCTATAGGTGGCAGTCAGAGTATAGCAG
TTTTAATGGGAAGTAACCTAGCGAAAGCTCTCTCTGAGGTTCTCCCGGCCCTTCAGATAC
ACACCAGGTCTTGGGGGGTCTCTTGGCCTCACGGGCTCTCACCTCCCTTCCTCCTACTCT
GCCTTTCAGTACCTGGCCCCAGAGGTGCTTCATAAGCAGCCGTACGACAGGACCGTGGAC
TGGTGGTGCCTGGGCGCCGTCTTGTATGAGATGCTCTATGGCCTGGTGAGTGGCATGCCG
GGATCATGGCTGTCCAGGTCCCTAGACATTTACTTTCCCGACACTCCACCTGGCAGGCTG
TTCATAACGCTTGCCCTTGTCAGTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGATGCAGTTATGTCGGAAGACTTGTGGAAATTCTCACTGTCTGATGGCTTGA
ACCCCTGCTTTCTGCACACTAAACCAACAAAGTTTTTGAGAGAGTTGTATGAACAAAACC
ACTGTCAGTTTGGACTAAAAGGGACATGGAAAGGAGAAATTAAAGGAGAAACAGCTTTAA
GAGCAAAACCATTGAAATTGAGATCTGGAATTAAGACATTGCCTTGGGCCAAGAGAGGGA
CCCCACCCATATGTAGAGAAGGGGTGAGTTTGCCCCAGCAGTTGAAGAGGGTGGATGTTC
CCATCCCATGTCCCGGGAGAGTTTGCCACCCTAGGGTACAGAGAGGGTGGAGCACATTCC
TCAAGTGGGAGGTTAAGGTCAGAACCCCATAGGTCTGAGAGGGGTAGACCTGCCCGCCAT
GGATTAGGGAAGGCCTTGCTCTGAGAGGGTTGAGCTTGATACGCCAAAGGTTAGGGGGAA
TGTTTTCTTCACGTCACTGTACTAGGGAGGTTAAGACTCCAACCCAAAGATTGGGTAAGG
TGTGGCAATCACTGCAACACTCTTTGAAGGTGACGTCTGGAAAGGGTGGGTTTCTATAAG
GCACCAAGAAGAAACTGTGGTCTTAAGAATGACTCTCAGACTTTGACATCTAATGAAGCA
TGTCCTGCAGGTTTCCTGAAATGTAGAGGACCCGCGACTCATATTTTTCTCCCAATTACT
CCTCACTGTAATGAATTTTTATTTATCCTTTTTCTGTCCATTTGTGTATTAGAAGCAGAT
AAATTGTTTTGTACTTTTAGAAGTCTACATCCAGGAGGGACTTTGCCCAAAGACAAACTG
TATTTCTTTAATTTGATTGTGATGTGTACTTGGATTATCACTGATTTAAGGTTTGTTTTA
ATATTGTAATGTGTTTTTGGAATTCTGAAGGTGGAGTGTAACAGTTTGATATAAATAGTT
ATGAGTTCTAAAAATAGATATTGGGTTATGTTTGTAAACTTGTCTGTACCTGGGCATGGT
TAAATTATGATTAGGGCTTTGATTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
CCTGGGGACTTTAAAGGTATATGAGATGTGCTGGTCCCTAGGGGTTGCAGAGGCAACATG
GGGGACGAGAGCTGCTCAGGTTTTGCTTTGGTGTCTTTTGCTTTCCATGAGAGAATTTAC
TTCTCTTTTGACTGAAAATTTCTTTTCTTTCCTCCTTCCTTTCTTCCCTTTCTCTGTTTC
TTTTTTCCTTCCACCCACAGAAAAAATATATGGAAAAATGAAGATGAGGAGGAAGATGAC
TTTTTCCATCCTTTGCACCTAGTTTGGGGTTCCCCCCCTGCTCTAAGACACGACAAAGGA
TTGAAAAATGATCCTCCTGTAAGTGAAGCCGCAATCAAAAAAATTGCTGCCCTTGAAGAT
GAGCTCACTTTTCTTCGTTCCCAGATTGCTGCGATTGTGGAAAAGCAGGAACTGAGAAGC
AGTACAAATGCTGGCAAGTGACCTGTGGGGGTTTTGTTGCAATTAGATGCTACTCTTCTA
GTATTTAAATCAGTAAAGCTCTTAATAAGAACACTTGATAGTAATATATCTTGTGAACTA
CAATAAATTTATCACAAAAGAAGGTTAATATATAAAGTTATGAGGGATGGCTTTGGTTTA
AAGAAGAGCTAGCTATACTGCTGAAGATTGTAATTTTGTGTTGAAAAACCTTGTCTTCTA
TACACTTTTCTAACTCTTCAAAAAAGCATTGGAAATTAAAGAGGAAGGATACATTTGTTT
CAAAGAAGAGTACAGGGTTCATATATCTGTAGTTTAAAGTTATGAAGTTCAGGTGAACGA
GGATGTCCAGATGATCTTTTTGTAAATTTTTGGAGATGTAAGTTGCTTTAAATATATATA
TATATATATGTATGTAAGTGTATGCATACATATATGTGTATGTATAAAATATAAAGTGAG
ATAGGTTCTGAGCACTTTTCACAATCGAATTGCTCCTGAAAGGACCGTGTGTAAATGCAA
TTACTTAAAAACTAAATTACATAATGTGTGTGTGTGGAGTGTGTGTGAGGGTAATAGATA
TACACATACATATATATTCATATCTATGCAGGCAAACCTGTAAGTTATATAGTATGTACA
ATACTTATATACAATTTACAATTTTTATATATTTTTAATATGTAATTTATATATCAGTAT
ATTATGTAATATAAATACAGTGATATACATATATACACATATATACATGAACATACAGAT
ACTTAATTTTTCAATCATATTTGCACGCAATGCTTTTGGAGCATATCTATTATGAATACT
CATCTCGGTACTCATCTTAGGCTTTTCCCTAGAAAATAAATGCTTGGGTGTTATACAATG
TCACTATCAAGTGGATATACCGGTTTGAGTGTATCTAACTATAAGTTGTTGGTTGTATTT
TACCTTTTTTTAAATAGAGTATGAAATTCAGATTTTATGTATATTACTGAAAACACATCC
CCCCCCCCTTTTTCTTTTAATTTTAATAGTATTTATTTAAATATGTAGGCATAAAATCTT
GTCAAATAGGGTAAAACAAGTGAGCTGATTTGAAGAAAACCACTTGAAAATAATAGAAAT
GATATGTGGCTGCAATTCATTGATGTTCCAGAAGCACTGGTACAGTGGCTAAGAGTAGGG
CTCTGGAGTCAGAGAAACAGGACTTGTCCTTGTTAAAAGAAAAAAAACAATGTACAATAT
AGATTGAGAGAGAGACTGTTTGCGAGCCCGGGGATCTCAAGCTGAGTGGAGTGAGTCTTG
GGAACCATCCGGTCACAGCTGCTTATAAAAGCATTTAGAGGATTTGCAAATGGGAATTAC
AATATTTGGCTGACAGTTAAGTTCTTCATTACCTACCTACGAGGGTCTTACAAAGCAGGG
AACAGATATGCATTAGTTAGTTGGTATACTCGTCCGTTTCTAATATTCTATCCTTATGGG
ACTGAGACCGGTTTATCACTACATGTCACTCAAATTGCACCTTTATAGGGAATGTTCTGC
TCTCTCTGAAAGTCCCATCCTTGTGGTCAGTTTTAATTGTCTGTAAAGTCCCTGCCATTT
CTCGGAAAGGGCTGCCTCTAGCAATACCAGTGAAGCAACAATCTTATTTTATTTAATCCA
CTTAACTTTGGGCAAGACTTTTTAACTTCTGAGGTGGGTTGTGGTGAAGATTAAATAATA
ACATGCATACAGCTGCTGAACATAGTGCTCGGTACTTTTTCCCTCTTTAAAATGCACACA
CACACCCCTTGTTTTAAGGTCCCATGTTGAACTTTCCTAAAGGAATTAAAAGTCAGTTTA
CTATTTGGCTTGACTTAACAGAAATTATTAAACAGAAGGGAATTTGCTTTTCCTTCTTGG
TCACCCATTTCATTATTTTAATAGTAGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAG
ATAATCCCTTCTAACTTCTGGTGTCTCACCTACACTATTTTTAGAATGACACACTTCTGC
TGCTATTTCTTGATGTTTTAATTATATTTACTTCCCATAGTAGAAGATTAGGAATATGTT
CTCTGAGACACTCCAGCCCCCTAATACACATATGTTCCCAATGGAGTTAAATCATAATCT
TGAGTTAAGTCAGTATTCAGAATTTCCATCCTTATTATAATGGTAAGCCATTTTGTATGC
TATGATTTCCTTTTGCTTCTTGAATAATTTTATTTTTCACTGGAGTTAATAATTGCTTCT
ACAAGTTCTACTTTTTTTCCTTCTTGGGAATTGCCCCCCAGTAACCTTCTGTCCTCCTCC
GACCTCACTTGCTGCTCTTGAGGCTGCTGCATTGCTGACATCCTAAGTTTCCCTTCAGTG
TTGCCAGGCGCATTCTCTTCCTCTTTCTCCTGTTTTGTGTGTCACCTGCTTTCTGGATGT
CTTCTTCCTGTAGCTTCTTGAGAAATGGTGCCTATCATGTAGATTGCTTTGAAGACCTTG
CATGTCTCAAATGTTACTATTTTATTCTCACACTTGATTGCTAGTTTGGCTGGGTATATA
ATAGGCAGAAAATAATTTTTCTTCAGAAGGAAGACATTGTTTCATTGATCTCTAGCCTCT
AGGTCCATGTTGAAAAGTTGATGTCATTCTGTTTCTGGTTCTTTGTATGAAAACTTTCTT
TATTTTTGAAACATTTAAGATCTTTCCTTTAGTTCCAGTGTTCTAAAATTGAAGTGCCAT
GGAGAGTGCTTTTTTGTTTCTCATGCCAAACTCTTGTGGGCTTAATCAATCTAGAGTTTC
ATGTCCTTTATTTTTGGAAATCTTTAAAAAAAGTTTCATAATTTTCTCCCTTCTTTTCCC
TTTGTTCTCTCTTTCTGGAACTCTGATTAGACGTTTGAATGCCAGAATTATTCCTCTGAT
TTTCATATCTTTCCTTTACACTTTCTTTCTCTTTGCCTTTTTATTGTACTTTTTGAGAAA
ATTTTTTTATCTACCTTCCAGCTGTTCTATTGCATTTTTTCCCTGCCATTGTATTTTTAA
TTTTTAGGAGCCATTTCTTTTTTCTCTGAATGCTCCTTTTTCATAACTTCTTGCTTTTTT
TTTTTTTTTTTTGAGGATAGTATCTATAGTTCCATTTTCAGTTTTTTCTGCTCCTGAGCT
ATCTCTTTCCGCCACATTTCTTTTTTCTTCTTGTTGATTTTAGTCACTGTCTTTCATCTT
GGGAGACTTTACTTACGTAATTGTTAATTGGCTGCACATTCTATTCAGAAGGAAGGCAAG
CAACAGTAAGTTCTTTGAGGTGGGCTTTATCCTGCTTACCTCCCTTCCAACATTTTGTTG
CATTTCTTATCTTCTGTTCCTCTTGGAATCTCTCTATCCTTCTGCGTATACATCTTTTTC
TTTTCTTTACTCTTATTTTAATAAGGTTTCACAAGGGATCTGTGTGTTTATATGGAAAAC
CCTCACTGAAGTTTTTGGTGAGTCTAAATATATTTCCTATATGATAGTGTTAAGGTAGAT
GAGTCATTTCATTATTTATTATTATTATTAAAATAAGAGACAAAAGACAGCCTAACAAAT
TTTGGAAGTGTTACTCTAATATATTCTGTCCAGGCACATTTATTTTATTTAATCCTAAAC
ACAAACCTAATTTTTGTTTCTCCAGTGTTCAGAAAGATAAATAAATGAACACAGTTAAAT
GATATGACCAAGGTCTCCTTGTTAATGAAGAAAATAAAGGAAAAAAAGTTTAATCATAGT
CATATCTCATAAACTAGACCCTAAATTCTCTTTTTTTTTTTAACTTTAGCATGGATATAG
TACTTTCTTTTGTCTTTGTTACAAAATTTAACAATATTACAATTTAACGTGGGACCTCCC
ATGTGGTAGGTGAGCGCCCAATTGCTTGAGCCACCTCTGCTTCCCAGAAATTACAAATTT
TAAAATAGAGTGCAAGAGTGTTCCCCCAGCCGCTCCTGTTGCCAACGACTCCCTGTGCAA
CTTCTGTGGTGATGACGGTGAAAACCGAGGCTGCCAAGGGCACTCTTACTTACTCCTGGA
TGAGGGGGATGGTAGCCATCTTCACCACTTTCATGAAACAGAGAAGAGTGGGCCTGAATG
ACTTCATTCAGAAGATCGCCAATAACTCCTATGCATGCAAACACCCTGAAGTTCAATCAG
TTTTGAAGATCTCCCAACCTCAGGAGCTGGAGCTTATGAAGGCCAACCCTTCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCATTTCCCTTTCCCGACACTCCCAC
CTGGCAGGCCTGTTCATAAACGCTTGCCCCTGTCAGTCATCTAAAGCTGGGAGGACCAGT
AGCACGTGGAATTAATTTCCTAAGTGCTAGTAAATTACTAGTCAGTGGGACTTTTTTTTT
CCCCTCTAAATTCACATTTTCCTAGCTAAGACCACACTTAACCTGTGAAAAGCATGGTTT
ATTAGCATATACCCTGGGATGTCTAAAGTCAAGGGCAAAGGAAAAACATCAAGGGAAAGA
CACCTTTTCTCAAACCCAGCTTAACGTGGTGCAGTGTCACCAATCCTGTGGACCGTGGGA
AACTCTTGAGTTCATCTGTGGCTCCCCCTCTCTTAGCCTCCTTTCTACAGCCGAAACACC
GCCGAGATGTATGACAACATCCTGAACAAGCCCCTCCAGCTGAAGCCAAACATCACCAAT
TCTGCCCGACACCTCCTGGAGGGCCTCCTGCAGAAGGACAGGACCAGGCGACTTGGTGCC
AAGGACGACTTCATGGAGATTAAGAGTCACGTTTTCTTCTCCCTCATCAACTGGGATGAC
CTCATTCATAAGAGGATTACACCCCCTTTCAACCCAAATGTGGTGAGTATCTCCTTTCTA
AGGAGAGTGAGGCCCAAAGGCTGAGAGTGGGGCAGCCCTGCAGGAGTAAAGAAAATTCAG
AGGCCCATTATTTTCTCTAGAAAAATAAGCGTTCTTGCCCTGAACAAGGCTCACAAAGGG
TTTGATGTATTTATTGGTGCATCAGAAGGCACCGCAAAATGAAGCGTGTTCTCCCTCTAG
CGTTTAAACTTGGTGTGGCCTCTGGAACTTAGTGGGTGAGCTAGGTGCTGGCAGGAACTT
GCCTGTAGAATAGAGAAAGCATCCCGGGTCAGGCCTCCCCGCGAAGTCCTGACGCTGTGC
TTTTTTCCTCCTCTACCAAAGAGCGGCCCGAGTGACCTGCGGCACTTCGACCCCGAGTTC
ACCGAAGAGCCAGTCCCCAACTCCATCGGCAGGTCCCCGGACAGCATCCTCATCACGGCC
AGTGTCAAGGAGGCCGCCGAGGCCTTCCTGGGCTTCTCCTACGCACCCCCCATGGACTCG
TTCCTCTGAGCAGACCGAGGGCCGGGTTGGAAGGATTTCGCGTGTTTCCCGAGGTTTCTG
TTAGCCTTTCGGCAGAGATGCCTGCCGACGGGACATCTTTAAAGAGAATTTGCACATCTC
TGGGAGCTGGGCAGTCCTCATTGCACAGTTTGCTGGAAGCTTCTTGAAGAACACAGCCTC
CTTTCCGGGAGCTCTTCCTTCCACCGTGGTGCTATCCCTGAAATGAGCATCTGAGCGCTG
CCTTAGACAGGTGCAATCTTTCTGTCAAGAAGGAAGACACTGTTCTAGGGAAGATCTGGT
GAAGGTCTGCCTGGGCTCTGATGTGGCTGTTGTGAAATGTGCCTTTCCCATAAGGTGTTC
GCTCCAAAGGTTTTCCTCTTGCAGAGTGTTCTCGTCCTTTCTTTTTCCTCGTGGGTTTAC
TGTGCAAGCAGTGGTGTGAGTGTGGTGTGTGTGATCACAGGTGGGTTTAGCGATGAGCAT
CAGTGTGACACTCGCAGTTGTGGCACATTGTTCACTTCTTCCATATTAGGAAGATAAATT
TATGTGTAGACATTTTGTTTTGTAAGATATAGTTAACTAAAATTTATTGAAATGGTCTTG
CAATGATGTCGGAGTCGCAGACCTGAAGGGTATCAGGAATGAAAGATAAAGAGAGATTGG
GATGAGGGGATCTGAGAGCATTGAAGCCTCAAGCTCATCAGACAAATTTATTAGTTTCAG
GGTCTTGCTTATATACCCCAACTAGGTTGTGAGAAGCAGAAACTATTCTAGATAACTATT
ACCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATGGACCAAT
GCCCCAGTTGTCAGTCAAAGCCGTTGGTGTTTTCATTGTTTAAAATGTCACCTATAAAAC
GGGCATTATTTATGTTTGTTTTTGTTTTTTTTGCATTCCTGATAATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1026..1046, 62352..62567, 97010..97085, 115295..115370, 115791..115866, 116248..116352, 116453..116536, 116637..116768, 116949..117061, 117355..117478, 117886..117981, 125713..125958, 126298..126465
1001..1024, 1026..1046, 62352..62567, 97010..97085, 115295..115370, 115791..115866, 116248..116352, 116453..116536, 116637..116768, 116949..117061, 117355..117478, 117886..117981, 125713..125958, 126298..126462
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved