Dasypus_novemcinctus Locus SF3B3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SF3B3
Dasypus_novemcinctus
SF3B3
GeneScaffold_1419
SNORD111
5111..5190
62204
AGACTTTTGCAGTTTAAACAAGAAGATGCTCCTTTGTCACATGGAGAAGGGGCAGGCAC
AAAGGCTCTTTTTCTGATCACCAGACAGTAGATAAAACACATGGGGAAGTCGCAAAGCTT
AAGTTTTGGCGGTAAATGTACATACACAGTTCCTAAATGCGAGGGTTTTGCTTTGCAGCT
AATTACAAGCGATTGGGAAAATCTAAATGTTCATCTAGGATATTGGTTAAATGAGTTATG
TTCACTTAGTGGAACACTCTACAGCTGTAAAATAAAAATGAGAAAGCTCTTTGTTTATTG
TTACTTCCAAGATAAAATAATAACACCTAAAATGTATGTTGTGAGCGATTAACCTTTGGT
TAAAAGCGGGCGAAGCAAAGTATAGTTGCATATATATATAAATATATATATATATGCATA
AGGCTTCCGGAAGAATACCATATAACCTGCTAAAATTGTTCTCCCAGGGAGGCGAAGTAG
GTGTCTAGGGAATGGGTTGGAGAGAGCCTTTCACTGTACTTTGAATTCTGAACTGTGTGA
ATGTATAGTTTATTCAAGTACAAATAGACATAATCGTATTTAGTAGCTATGACAAAAAAG
CAAAGGCGCAAATTGCATAATGATGTAAATCCCTGCTCCTAACGTGTCCACCATCCATTG
CTTGTTATATGACCTTAGACAAGTCATATAATTTGAGCCTCTATTTCTTTATCTATAAAA
TGGGTATAATGCCATGTACTGTATAGAATTCTTGTGAGGTTAGAGATAAAGCATGTAACA
TAGTACCTAGCATATTGAAGGCATTTTAGTGTTTGTTTTCCTCGATACACCTTGCTTGCT
TTTGCCAGAAGTTTCCCTGCAGAAATATCTGTAAAAACAATTTCCCAGCTAATATTTTTC
TTTTTTCATATGCCTATAGCTTGCTTTGACTCAGTACTGCTGGTGTACTCTCAAGACTTG
AATTGTGGAGTTCTTCTGGGTGGCTCAGTTTTACTGCTACCATGTTCCTATACAACTTGA
CCTTGCAGCGAGCCACTGGCATTAGCTTTGCCATTCATGGCAACTTTTCTGGTAAGTTTT
CTAGTTGCTATATTTTTGTGAATTGAGGTGAAGTCATATATGTTTTGCTTATATTTTTGG
AAGGAAATGTTTTCCATTTACAAGACTAACTGAAAACAGCAGTTGGTAATTGTGGGTGAA
CCAAATCTGTTTTGTAATCTATGAGATTTGTTGTGAAATTGAGGTGCATTATCTACCAAT
TTTATGTGCTTTCCTAGCTGGCATAGTATAATAGTTTTTTAGCATGAATGCATATTTCCT
GGTTACCTTTTTGCCAGGTTTTGTGCTTGTTGCTGTGAGGAATAAAGTGATGTATAAGAT
ATGTTCTTTGATTTTGAATTTAACATCAGATTGGATGCAAAGAATGTCTAACAGTGTCCC
GTTAACAAAGGAGAATAGTTTAAGGAAAGGGAGGGTGAACCTTGGTTTGGTGTTTGAAGG
AAGTGGGGGTTGTACAAGGAAAGAGAAGAGAAAGTTCAGTTTAGGTAGAGGGCAGTGCTT
AAGTGGAGATCATTTAGCATGAGATCTTTCACTAATATTGACCTCCTACTTGTGCCATGC
CTAGTAAGCCAGAATGGTGGGGTATATGTTTGGAAAAATGAATTAAGGCCAGGTAGTGAA
AAAATTTGATGGTCAGTTTAAGAAAAGAAATAATAGGCAATAGAGAACTTTAGAAAAGGG
TTACTAATATATATAAAAATAGAGTTCTTATTTACTCTTTGCAGATTTGACATTTGTGGG
TTATGTTAATCCCACGTAATGCAGAAAGTCCATTATTGTCTGGAGTATTAGGTCATTTTG
ATGAGGTTCAAATCTACCAACCTACTGGGTGCTGACTGAGTAGGAGCCTAGCTGACTGAC
CAAACGGAATTCACAATTCAAGTTGGCATTATATTCTGTGATTATTATGACTCTTATTAA
GAGATGTTTTCATTTGAATAATTTAGTTATCCCTTGCTGTGTATAGTTTTGGCATACATG
AATGTGGGTATTTAGTAGTACATAATGCAGTGGTTCTTAGCTGGGTTGGAATAGGGGAAT
TTTTGCAAAACCAATTTTAATATTCCTAACTTTATATTTGAAAACTAAACATATTTTTTT
TTCTAAAATTATAGAAAGGGAGATTTCTATTTGTTAAAGAACATTGTAATTTATATAATG
TTTTACATTTTGGGGTACTTGATCTTATCTGATCCCCAAAGAATCTTTGGAAAAAAGATA
GCAGGAACTTACACAGCGAGCTGACACAGCAAGATGATACAATGAGGAAACACAATGAGA
GTCACAATAAGCCGGAAATGGAGGTGGCTCAAGTGATAGGGCTCCTCCCTCTCATATTAG
AGGTCTCAGGTTCGGTTCCTGGTGCCTCCTAAAAAGATAAGCAGACACAGAGAGCACACT
GACAGGGAGTGCAAATAATGATCGGGCCGGGGGCGGTGGAGGAGAATGTGGATAAATCTT
TAAAAAAAAAAAAAAAGGCTTGAACTAGGGCAGTGTGAATGAAAGAAAATGGGGGGGTAT
GAATTTCCAGCATGGGTGAAAGAAAATAATGGTAACATTGACAATAGGTTAATTGAGATT
GTAGAGGAAGTTTGAGGAAGAAGAACTTATTTATTTTAAATATTTAGTTTAAAGTTAATG
ATAACTTACCTGGGTAGAATTACGTATCAGATGGAGAGATGAGGACAAAGTTGAAAGTTA
GCTGTTATGCACTTGGTGGTGTTGACTGCAGTTATGAAAGCAAACGAACTTTTTAGGAGT
GAATTTAGAAATAAATTTTTTAAAAATTTCTCTCCCCTTCCCTGCTCCCTGCCCCCCAGT
TGTCTACTCTCTGTGTCCATTGGCTGTGTGTTCTTCTGTGTCTGCTTGTATTCTTGTCAG
TGGCACCCAGAATCTGTGTCTCGTTTTGTTGCATCATTTTGCTGCATCACCTCTCCATGT
GTGTGGTGCCACTCCTGGGCAGGCTGCACTTTTTTCACACTGGGTTGCTCTCCTTACAGG
GCGCACTCCTTGTGCGTGGGGCTCCCCTACCCACTGCTGGTCATGGCACTCTGTGTGCAT
CAGCACTCTGCATGGGCCAGCTCATCACACAGGTCAGGAGGCCCTGGGTTTGAACCTTGG
ATCTCCCATGTGGTAGGCCCTCCCTATCCATTGGACCAACTCCACTTCCCATAAATTTAG
AAATAGAAATATATTAGATGACAGCCTTAAAAGGTCTTTGAGACACCACTTTAAATTGCA
GAAAGTTTCTATGATAATTTCTTAGAAAAACAGCCTTAAAGATGCATAAGAAAGAAAAAG
CTTTTGGAAAACTTAAGTCTTAAAAAACGAAATATTACATGGTAATTTCCTTTGCAGACA
AGTCCTGATTCTACAGATTGATGACAAATCTCAGGAAGTACCTTGTGTGACTATTTTGAA
AAAGCTGTCTTTGATATTGTTTTTTGTGTATTTTTTTTGTTTCTTTTACTTTTTTGATAG
TGCTTTTGTAAAATCATTTCAATTCTAGTAGGAATACCTTTTCAAATACGTTAACGTAAA
ATACTGAGCCCCTTAGTTTTAATTGTCTACTTTTTTTTTTTTTGGCATTTATTTATTTTG
TTAGAGAAGTTGTGGGCTTACAAAACAATCATGCATAATGTGCAGAATTCCCATTATCAC
TCCTCTACCAACACTTTTTTTGTTGTGCAATATTTGTTACAGTTATGAAAGAATGTGATC
AGGCTGTTAAACCACTATGATCCATAGCTAAAACTTGTTATATTTTTTCCCTACACCCCC
TAATATTAACACTATTTATTAGTGGTGAATGTTTGTTATAGTTTATGAGAGAACACTCTC
ATATTTGTACTGTTAACCACAATCCATTTTCTACCACATGGTTCACTGTGTTATATAGTC
CCATGCCTTATACATTCTATCCAAAGCGTACACTCAGGGAAGCAGATTTGGCCCCATGGA
TATGGCATCCGCCTACCACATGGGAGGTCTAAAGTTCAAACCCAGGGCCTCCTGACCTGT
GTGATGAGCTGGCCCACGTGCAGTGCTGATGTGTGCAAGGAGTGCCATGACACGCAGTGA
TGTCCCCCGCATAGGGGAGCTCCACGCGCAAGGAGTGTGCCCTGTAAGGAGAGCCGCTCC
ACACAAAAAAGATGCAGCCTGCCCAGGAGTGGCGCCGCACACACGGAGAGCTGACGCAGC
AAGATGACGCAACAAAATGAGACACAGATTCTGGGTGCTGCTGACAAGAATACAAGCGGA
CACAGAAGAAACACAGAGCGAATGGACACAGAGAGCAGGCAGCTGGGGGGTGTGGTTAGG
GAAGGGGAGAGAAAAAAAATCCAAAGTGTACACTAGGTGTCTCTCACTTCCATCACAGAG
TTGTGCAGTCATCAGTCACCACAGTAAACCTTCGGACATTTTCCTTAGTCCACAAGAAAA
AATCCCATACTCCCCTATTATTGACCCTTAATGTTTATATAGTGCCTTTAATTATGTTTG
CTATTTTTGGTATTTTTTATCCATCCAGGTTACTTTTTAGACTAGTTCTGGTTACTTACA
ATCTTCCGTTATCCTTTGGCGATCTAGGAACCAAACAACAGGAAATTGTTGTTTCCCGTG
GGAAGATCTTGGAGCTGCTTCGCCCTGACCCCAACACTGGCAAAGTACACACCCTTCTAA
CTGTGGAAGTGTTTGGTGTTATCAGGTCTCTCATGGCCTTTAGACTGACAGGTGGCACCA
AAGACTACATTGTGGTTGGCAGTGACTCAGGTCGGATTGTAATCCTAGAGTACCAGCCAT
CTAAGAACATGTTTGAGAAAATTCACCAAGAAACTTTTGGCAAGAGTGGATGCCGCCGCA
TCGTTCCTGGCCAGTTTTTGGCTGTGGATCCCAAAGGGCGTGCTGTTATGATTAGTGAGT
GACTTTTCAGTTTCCCTTCTTTTTGGAAATAGGTATTTTTCAAGTCAAACCAAAATAATT
TCTTAGTTTACTCCCCCAAAACTGCGGTGAATTATCTTGTATTTCTAGACAGTGAATATG
GTTGCTTTCATCAGCCTGAAGTGATGATTCACATTCATGTCTCTTCTCTGATAAATCTCT
TGAAGACAGTTCTGTGTATCTGATCAGGCCTCTGGAAGGAGACCCTCTCTTAGCAATTCC
TAAAATCACTAGATCTCATTCAAATAATATAACAATTTTATGAATTATATATAGTTCAGT
TTCCCAGTATTCTTAAGCGTGTAGCATATTAAAAGTTTAAGAGCGCTGTTAGGCAGTAGG
AGGCAAAATAATGCTGTTGGTCTAGTCTGATGACATAGAGCAGAATTCTTGTGTAAATAC
ACTTAGAGTTAGTGCTGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTATCTTG
TATCTGTCCTGTTAGCAGATCTTCTGTATTCCAGATATCTTTACTGAAATTCTTTGGAAT
GTTTAGAGCTTAATTGACTATAATATCACTTTGTTCTGATATGAATAATCTTCCTATGGA
AACAAGACATTTATTGGGAAAAGGTTTATGAGAAAGGAGGTGGGAGCTATATTTGGAGTG
TTTTTTTCACAGAGATGTAGTAAAAGCCAGAACATACCATGCTTTGAATTGAAGGCAGTG
TCCTTTAGTAGAGGGAGCCCTGGATTCAGAATTAGGAGGCCTGGGGTTCTTGCTTCAGCT
CTTCTATTACGTAGTAGTGTGAACCTTGGCAAACCATTTGGCGTCTGTGGACCTCTTTAC
TCTTTTGTAAAATGGAGGCAGGCATCTGGAATGTCTTTTCCAGTTATAAAAAAATTTTTT
TTATTTTATCCTACTGATTAGTCTTTGTGTCACTATACTTTATAGGAAGCAGACAATGAT
CCAACAGGAGAAGCAGCAGCTAATACTCAGCAGACGCTCACATTCTATGAGTTAGACCTT
GGTTTAAACCACGTGGTCCGGAAATACAGTGAACCTTTGGAGGAACATGGCAACTTCCTT
ATTACAGGTATTTTTCTCTCAGAACTGCACCGTACACTCTTGTTTGGCTCATTTTATGCC
CAAACTTAGGAGAGTTTACTTAATAGAGTGTGAAAATTCATATATTTGTAGTAAACCTGA
GTGCCTTGTTTTGTGTTTTGGCTAGGTTAGAAGTTCATGTAGGGGAGTAGGTCTGGCTCA
AGTGGTTGAGCACCTGCCTCCCACATGGGAGGTATCAGTGTTCATTCCTGGTGCCTCCTG
AAAGAACAAAAACACAATAAGCACAAAAAGCATGCCTGTGCGGCAAGCCAGTGCCCGCGC
GAGTGCCATGCTGTGAACCAGTGCCTGCATGAGTGTACCTATGTGAGTATCTGTGTGATG
AGTGAGTGCCCCGTGCAAGTGAGTCAAACAGAAAGATGATTACACATCAAAAGAGAGAAA
AGGGGAGCGTCAAGGTGAAGCGCAGCAGAAACCAGTAACTGAGGTGGTACAATTGACACG
GAACCTCTCTCCCCATCAGAGATCTCCAGGATCAAATCCCAGTGAATCCTAGAGGAGAGA
AAATGAGAAGAGAACACAGCAAAAATAGCAGGGCGGGAGGAGCAGGAGGGGAAATAAATA
TTTAAAAAACAACAACAACACAACAAGCAAAATAAAAGAAAAAACCAATTCAGGGAAGCG
CTGTGGCTCAGTGGTTGAGTCCTGACTTCCCACATAAGAGGTCCAGGATTCAATCCTTAG
CTCCAGGACCTCAAAAAAAAAAAAATTCAGGTGGTATGCAGTATTGTGTGGATAAAGAGA
ATCAGTTTCTTAGTTTCTCATATTCTAGTGGTGGCAGGGAGGAACAGACTAGGAGAGCAC
TCGGCTTGCAATATTGATCACTTTTTAAAAAATATCTATTTCTCAAATATACTGGATACG
TATAATTTTTTGAATCATACAATATGTTGTATTATATGTTTGGTTCATAGTAACACAGTC
ATACAGTATTTGTCCTTTTCTGTCTGGCTTGCTTCACTCATAATTTCTTCCAGGTTCATA
CATGTTGTCATAAGCTTTAAGACTTCAATTTTTCTTTCACCTGCATAATATTCCATCATG
TGAATACACCAGCTTATCCCTTCGTTGGTTGACGGACACCTGGGCTGTTTCCAACTTTTG
GCAATCTTGAATAATGCTGTTTTGAAAATCAGTGTGCAGATGTATGTTCGTGTATCAGCT
CTCAGTTCTTCTGGGTATATAACCAGTAGTGATATTGCAGGGTCGCCTGGCAAGTCTATA
TTCAACTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGTGAT
AAATGTGTTCGTATAAGAAATAATCTGTTAAAGGTATAGAGTTTGCTGTTAGGCGTGATT
TTCAACTCTTCACGAAGGGTCTTGGAACACATTGGTCACGGAAAATGAGGTCCTACTGTC
CTTGACTCTTGGGCTAGTTCAAGCAACTCGTGTGAAACCTCGTTATCTCTGTTTCCTTTT
TTTTTTTTTTCCCCTGCTTTAGCCTGAACTAGTAGTCTCCTTATTAAACTACATTGTATT
TCCTGCAAAACTAAGCAGAGAAGACACAACTGATGAAATCATTTCCCCCAAGTTTGCCAC
TGCATTAAGAATGTATGCAAACCACTCAACTAACCTAATGCTCAGTTTTCTCATAATTAA
AATGAATATTGGCTAGAATTCTATGATCCTGTGCCACTTCTGCTTTGTCACCATCTGTTG
TCTTGTATCCCACCCATTTTGAACTGTTTTCCCTTTTACTTTTCTTTAATTAGGAATAAT
TTAAGGATTCCTTGGGAACATTTATTTAGGACTCGTCTGTGTCTGGCACTGTTCTAAATT
ATTTTCTTGTATTAGTTTGGGGAATTGGTCCAGAAAGCATTTAAGAAACTTCACTAAAAT
CACACAGCTAGCTCTAACTCTGGCTCCATAGTCCCTTAAGCTTGGCACTCTAGTGCTGGT
TTATTAAGATTGAGCCAGAGTAAACTTTCCTGTGATGGAGGTCATGAACCCAGCATCCTT
TTGGTTATTTGGCTGTTACTAGAATACTGAAGGTATATTGGATTTGGCTTAATTTAAGGC
TGGGCTTAACTATATAGATGTCTTGCCTGAGTATGAAGCTTGTATTAACTTTTTATATGT
GTGCTGTGTCTTCTCAGTTCTATTGTAAATCTTTTAAGGATAATAAGCTGTTTTTCCCCC
TTCATAATTTAGTATAGATTATGGTATGTTTCCCAAAAGTTTAAACATTGTGGTTTGTTT
GACTTCATTTATCGAGTACTTTGTGTTTCAGTCACTAGTTTAATAATCATTTTGTCCTGC
TAAAAAGCTGCACTCAGAGTTATTCAAAATGCTTGATATTGAAGGTCTGCTGTATTGCTT
ATACCTAAGCATGATTAATAGGCTGGCGTTTGATTTCTTTTTTAATTGTTGTAACATATA
AAACAAAATTTGCAATTTTAACCACTTCTACATATACAGTTTATAGGCATTAATTAGATT
TGCAGTGTTGTGCTACCATCAAAACTATCCATTGCCAAAGCTTTTTCATCGTGCTGGTGT
TTGATATTAATTGGCAGCTTCTCAAAAGCCAAGTGTAATCATATGGTATGTGAATATATC
TCAAAACCGCTGAATTAACAAAAAAAAGCCAAGTGTATACTTATGATGGTGTAGTTATGT
TGGGGACATTCAGGACAGCGCTTGCCTTCAGCAATACCAAGGAGCACATAATGGCTGCCA
GAGCTGATACAGTAACGGTCTACAGTATACTCAGCCTTCTTCACGGAAGAAGCGGGCCCT
TTCTAGCCCAGCCAACGCCTCATGCAGTCAGTGCGACCACCAATCAGTAATTGCCTCCTA
ACCTTACTTCTGCTATTTCCCTCAGTAACAGCCAGAACCAATCACCTTACCTCTGCCACT
TCCCCCAGCAACAGCAGCTGCCAATCCCAGATCGCCACCTATCCTTACCCGCCACCCCCC
CTCCTCCCTAGAGTATATATGCTCAGCCCCTTCAATAAAATTTTGCGGCAGCTTCATCTG
AACTCTGTCTGGCTGTCGTCCTTCGTGTCTCTTGTCCCATAACATTCCTCCCTGACCGGT
ACTCAAGCCCCCGTCAGTGTCCCACGGGCCGGGACGACCTTCACAGCTGGTGCCCAACGT
GGGGCTTGACGGCCACACCAGGACAGGAACGCCACTTCACCAGTGAGGGAGAGCGCTCTC
CAGACTGCTCGGCCGAGGAAAAGGCCAATCTTCAGCAGTGGAAAGGAAGACTACAGTTTG
CTGTTCTGTAGCAGCAGAAAGAAAGGCAGTTCCGTAGCAGCGGAAAGAAAGGCAGTTCTG
TAGCAGTGGAAAGAAAGACTAGCGGAAACTCCACAGAAGACTTCAAAACAGGTAAGCCCC
GCCTTCATTATGGGACAAGGATCCTCCACTCACCTGTTGTTTATTAGTCAAGTAAAGGAA
GCCCTCAAGACACGAGGAGTTAAAGTCAAGAAAAATGATCTTATTCGTTTCTTTGATTTC
ATACTCAGAACCTGCCCTTGGTTTCCCCAGGAGGATACTATCGATCAAAGGTGCTGGGAG
AGGGTAGGAGACTGTTTAAATGACTATTATAGAACATTTGGTCCAGAAAAGATTCTGGTA
ACAGTCTTTAACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCTTC
CCACATCAGTGTTCTTTTGCATGATCTTTGCATTGCTTGTAATTTGGTAGGTTTGGCCTA
CTTATTGGTGAAAGTAGAAAATGGTTATAAATTTTCTTTGGACTTTTATTTTATATACAC
TGTGCTTCTAGGTGCCATGTACTGTGTTCCAAGTTCCTAACAAATACTAACTCATTTAAT
GCTATGGGGAAGTACTATTATTTCCATTTCATCAGCAAGGCAAAAACAAGTTAGACACAG
GAAGCTTAAGTAATGAGCTAAGGTTATATGGCTAGTTAAAGGACAGAACTGGGATTCAAA
CCTAGGCAGTCTAGCTCTAGTGACTGCTTTTAACTACTCTGATACTAAGATCCTTTCATT
GTACCAGTTGATGAATTCACTAATCTATTTTCTTTGTTCCTGTTCTAGTCTTAAGGAAAA
GGAAGAAAACCCAACTCAGAAAAGCAGTGATTTCAAACTATAGATGCTGACTTAGTAATG
CATATTATTAATACATTTGTAAGAGTGCTTTATGAGCATTATGCTGGCGTCAGACATTAT
CTTAACATACTGAAAATGTTTTAACTAAACTCTCTTCCTTATTTTCCCCCAGTTACTTAT
ATCAAATCGCACATCTTGGAGATGATGATGAAGAACCTGAATTTTCATCTGCTATGCCTC
TGGAAGAAGGAGACACATTCTTCTTTCAGCCAAGACCACTGAAAAACCTTGTGCTGGTTG
ATGAGTTGGATAGCCTCTCTCCCATTCTGTTTTGCCAGGTGTGGGCCTTCGCATTCACCT
CCATAATGAGCAGAGCCAGCTAACTGTATTCAAATCAAATTTAATGAGGTTCAAATTTTC
CTCCAGTTAAAGTAGGGGCTGACCTATGAGACAGGTTTGTTAGCATCTCTTTGGAATCAC
CAAAGTGTAATGGTTAAGCAGCTAGAGGTGAGAGTTTAGGAATGAAACCATTATGTAAAT
CCTTGGACTTTTATTAATATATATGTGTTTATATAAATTTTTTATCTATTTATCTACCGC
CTATCTATTTATTATATAAAACTCATGTTTATTGTAAAAAATGCAAACTATATAAAAGGT
GAAAAAGAGGACTGTCTTCTCAGCCTTCCGCTGTATTGAGGCAGTTGCAGTTAACTTCTT
GTGATTGCTTCCAGGTATTTTCTCTGCATCTGCAATGATGTGTATGTTATAACTTTTTTC
TTTTTAATGTAAATGGGCTCATACACTATATAATACTCTAAGATTGATTTTTTAAATACT
TAAATCTGTGTAGCTGTATTTTATGTATCTCATTTTGATATTCAATTTCTCTTTTCAACA
TTGCTGAGACATTGTCACTAATAGCAGCTGAGGTGACTCAGAATGGGGATTGTTACCCCC
ACTATTGGTGCTCAATTGTAGCAGCTAGGAGTGTTACCATGGCATTGTGTCTTGGATTGC
TGAGATTCTAGTGATTTTTTTTTTAAGATTTATTTATTTATTTTTATTTCTCTCCCCTTC
CCCCAACCCCCCTGCTCTCTGTGTCCATTTGCCGCGTGTTCTTCTTTGTCCGCTTCTGTT
GTCAGCGGCACGGGAGTCTTTCTTTTTGTTGCGTCGTCATGCTGTGTCAGCTCTCCATGT
GTGCGATGCCATTCCTGGACAGGCTGAACTTTCTTTCCTGCTGGGCGGCTCTCCTTATGG
GGCGCACTCCTTGCACGTGGGGCTCCCCTATGCGGGGACACCCCTGTGTGGCATGGCACT
CCTTGCACGCATCAGCACTGCACATGGGCCAGCTCCACACGGGTCAAGGAGGCCTGGGGT
TTGAACCACAGACCTCCCATGTGGTAGACGGACGTCCTAAGCACTGGGCCAAGTCCGCTT
CCCTCTGGTGATCTTTTGAGATCACCCTGTTATTTGATCAAACTTCTAGATGCTTGGGTA
CTGTGTGCTCGGTTACACAATTCAGCGTTCAGGCACTCTCCTGGTTATGATTAATGAGGC
TGAAGTGAACTGCTTCTGTGCTCCTCCCTTTTTGAGAAAGGCGTACTTTGAGGGTAAGAA
AAAATAAGTATGAGTAATTCCTAATTTGATTATTCCAATTTACCTCCCCTTCATTGGAAT
TTGAGGGAAGTAATTTATAGATCAAGAATGAACTTTGGGGGAAACCGGACTTTGGCCCCA
GTTGTTTAGGGCATCCATCTACCACATGGGAGTTCCGCGGTTCAAGCCCCCGGGCCTCCT
TGGACCCGTGTGGAAGCTGGCCCATGCGCAGTGCTGATGCGTGCAAAGGAGTGCCCGTGC
CCACCCAGGGGTGTCCCCGCGTAGGGGAGCCCCCACGCGCAAGGAGTGCACCCATAAGGA
CAGCCGCCCAGTGCGAAGGAGGGAGCAGCCTGCCCAGGAATGGCGCCGCCCACACTTCCC
GTGCCGCTGACGACAACAGAAGCGGACAAAGAAACAAGATGCAGCAAAAAGACACAGAGA
ACAGACAACCGGGGGGAGGGGAATTAAATAAATAAAAATAAATCTTTAAAAATATATATA
TATTACTGTTAACTATTGTCCTAAGTTACTTTAGTTGTAGTTTTCCAATGTATCATCATA
TTCTTAGCATTTTGTAAAAAAGAGCATTCTTATATTTATATTATAAACCACAATCTCCAT
CCACCACTGAAATCACTGTTTTCATACCCTAAATTATTCTCTAGTTTCCTTTCAATTAAC
ATTCACTTCCACATGCTATCCCTTCCAGCCACAATCTCATTTATAAACCAGCAGTGTTAG
TTATACTCACTATAATGTATTACCATCAACTCTATTCATTTCTACACTTCTGCAGTTAAC
CTTATTAATAATGCTACACACATCAAGCATCACCTCCCATTCTCCACCCACCTTCTATTT
CCCTGTAAACTATTCTCTGTGAGTTTACTCATATTATTTAGTTCGTATTAGTGAGACCAT
ACACTTGTCTGGCTTATTCATTCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCA
GCGCGAAGGAGGGAGCAGCTTGCCGAGGAATGGCGCCGCCCACACTTCCCGTGCTGCTGA
CGACAACGGAAGCGGACAAAGAAACAAGACGCAGCAAAAAGACACAGAAAAAAAAAAAAA
AGAATGAACTTGACAGGAAGTATCTATAGGACTTCTTAAACATTTCTTTTTTTTATGCCA
TGAATTTCTTTACTAGTATGATGAGACATCTTTTCTGAATGTTTTTAAGTGCATGTAGTA
ATAATATATATGTAAATGGAACACATTTTTAAGTTGTGATAAATATGTGATTTTAAAAAT
TTAACTTTAAAGATAACAAGATAGGGCATTTAAAGTGAGTGCACCCAATTTTTTTAGAAG
ACACCAGTGAAGGCTGTATGCACTCACTGCCCAAATGCTCATCAGTGTTACTCTAGGCTG
CATTACTTTTTTTTAAAGATTTATTTCTCTCCCCTTCCCCCTGCTCCCCCTGTTGTCTGC
TCTCTCTTCCATTTGCTGTGTGTTGTTCTGTGTCCACTTGCATTCTTGTCAGGCAGCTCC
GGGAATCTGTCTCTCTTGGTTGAGTCATCTTGCTGTGTCAGCTCTGTGTGTGTGCGGTGC
CACTCCTGGGTAGACTGTGCTTTTTTTACACAGGGTGGCTCTCCTTGTGGGGTGCACTCC
TTGCACGTGGGGCACTCCTATGCGGGGGGAACCCCAGCATGACATGGAACTCCTTGTGCA
CGGCAGCACTGTTCTTGGGCCAGCTTACCACATGGGCCAGGAGGCCCTGGGTACCGAACC
CTGGACCTCCTATATGGTAGGCAGACGTTCTATCAATTGAGCCACATCCGCTTCCCTACA
CTACCTTTCTGAGAGTCAAAACTTTTTTTGGTATTTATGTATCTCATTTTAATATTAAAT
ACAATATCTGCAATACAAATAACTTCCCTCTTTTGACTTACTGATTAATAATTGGACTGG
AAATAGCTAAATGTGCACTATCAGTATGAGAACACATGGCTTCCCTGTTTGGTGGCTGAA
CAGCAGCTAGGTACAAAGTTACACAACTGTCCTTCAGCTGTATTATAAGAAGCATCTGTA
GATATGTAGGTAGGACAGTTGTCATGTGCAGTCAGGCAGCAGGTCTAATAGATACAATCT
TTTTTTTTTCACATTTATTCTTCCCACCTCCCTTCTTGTTGTTTCTGTGCTCGCTGTCTG
TCTGTCTGTTCATCTCTCTTTCATGCGTCATCTTGCTGTGCCAGCTGTCCATGGCATGGA
CCGTAGCTTAGCGCTCTGTGGTGCTGGCCGTCAGCTCTCTGCGCATGTGCCAGCTTGCCT
TTACCAGGAGGCCTTGGGCATTAAGCCTAGGGCTTCCCAAATGGTAGATGGGAGCCCAAT
CACTTGAGCCTCATCTCTTTCCCTAAATATAATCTTGAAGTAGTGATGAGGGTAAATGAT
ATAAATTTTAATATGGATATGAATGAATATGATTTCTATTGGTAACAGTCACGGATACTG
ATACTGCAGTTTGTTACCTTTTTTTTTTTTTTTTTTTAAGATTTATTTATTTCTCTCCCC
TTCCCTGCCTGCCTGTTTTCTGCTCTGTCCATTTGCTGTGTGTTCTTTTGTGTCCACTTT
CATTCTCAGCAGCACCAGGAATCTGTCTCTCTGTTGTTCCATCTTGCTGCATCAGCTCTC
TGTGTGTGTGGTACCACTTCTGGGTGGGCTGCGCTTTTTTTGCATGGGGTGGCTCAATGC
AGGGCGCACTCCTTGCGCAAGGGGGCTCTGCTACGCGGGGGACACCCCTGTGTGTCAGGG
CACTCCTTGCTCACTGCACTGCCCTGTGTGGGCCAGCTTACCACATGAGCTGGAGGCCCT
GGGTTTGAACCCTGGACCTCCCATGCATGTGGCAGACAGATGCCTATCAGTTGAGCCACA
TCTGCTTCCCTGTTATCTATTTTTTAATTGAAGGAAATACTAAATTTCAGTTGGAGGTTA
TCATATAACATTTCATTTTGTTGATTGTAAAAGGTGCCTTGCTTACCTAACTGATTTAAG
CCCTTTATTGTTGGAAAAACTTGCTACTTCAAACTGATTGCTTTTTGGAATGTTGAGGTT
TTTTTTCCCCCGTTGTGCCTCTAGAGTCAGTAGATAAGTTTTGCAAACTACTAAAAATAG
TTTGTCTTGAGAGTCAGGGTTGAATGTGAAAACACAGCACAAGTAGACATTTTTTTCTTA
TTTCTTTATGCAGATAGCTGATTTGGCCAATGAAGACACTCCACAGCTGTATGTGGCCTG
TGGTAGGGGACCTCGGTCATCTCTTAGAGTCTTAAGGCATGGACTTGAGGTAAGATTGGA
ATTTCTAGATCACCTGCCAGGCTTGAAGGGAGGCATGGACAAAGCAATCTATGGCTATAC
TCTGATGAGATCAAAGATAAATTCAATGTTTATGTGGAAGGAAATTTATTTTTCTTTCTC
CCTTTTTCCCTAAAGTTTAGAGTTTAGATTTCTGGTTCCCTAACATGTTAGTGTGATATG
CATACTTTTTAAAAAGTAGGCAAATGGGAATAAAAAGGGAAAACATACCTGTAATTAACT
CCAAGCTTACTAGGCATTACACTAAGGAAATGCATATAAAACATTTTGTTCTATTCTCTT
CTGGTCTTGATCTTTATTCAAAATGTTTGGGTAGTTATTTATGGTAAACTGTATATATGT
ATATTTGTATCTTATCAAATTTATTCCTTATCATGCTAAGTGACATCATTTTTAATGTTT
GTACAATATTCCACCTAAGTGGATGAATCAGAATTTATTTAATGAATCCTTTATCGTCGG
TTCTTTTAGGTGAAATGAACTCTCAAAATTATCCTTTCAGATTCCACATCCTCTTCTTAT
CTTGGTCTTAGTGTTGATACCTTTTAGCAAGGCCTTGGACTTAATTTTATTAGTAAAATA
AAGCTTACGGTGACAATTTGCTTTCAGAGCTCGGGATTGGCATACTATATAGCCTACAGG
CAAAATCTGACATGCTGTCTTTACTTTATAAGTTTTAATTGAAACACAGCCAAGATGACC
TTGGTTTTTGAATTCTGGCTCTCTCTCTTAATAGCTGTTATTAACCTTTGTTGACTTTTC
TGTAAAATGGACTTAATGATACCTGCCTTAAGGGGAAGGAATATGTCAGAATTAATATAT
ATGATGATGCATATGAAGCACTTAGCTCAAGGTCTGGCATATATAAGCACTCAGTAAATG
TTAGTTAATAACGTTATCTTGTGAAGTTTAAAAAAATGTTGACTCTTAAAATATTCATGA
GTGTACAAAATTTACAATGATCTGAACCCAGTTTATCAGTTAGGTCTGTTAGCAATTTTT
CCACTTCTCAGAATAAGAAATTGTGGGGCATTTAAATAAGACATGAAGGGAAGCCGATGT
CACTCAAGTGATAGAGCTTCCGCCTACCATATGGGAGGACCCAGGTTCTATCCCTGGGGT
TTCCTGGTGAAAAAGAAAAAGAGAAAGCATGCCTGTGTGGTGAGCCAGTGCCCGCGCAAA
TGCCTGCGTGGTGAGCTGGTTCCTGTGCAAGTCAGTCACACAGCAAGATGATGACACATC
AAAAGAGTCAAAAGGAGAGTCAAGGTGTGAAGTGCATCAGAAACCAGGAACTGAGGTGGT
GCAATTGATAGGGAACCTCTCTCCCCATCAGGGGTCTCCAGGATCAAATCCCAGTAAATC
CTAGAGGAGAGAAAATGAGAAGAAAACACAGACAGAAAAAACAGCAGGATGGGAGGAAAG
GAAGGGGGAAAGATAAATAAATCTTTAAAAATAAAAAAATAAGACATTACGGTAAGGTGT
TATCATGAACTTGATTTTGATTAGTGGTTTATTTAGTTATTGCTCTGTGGATTCCGTTGA
GCACCTGATGAAAGCTAGGACTAATACAAAGAAGGCATATATGCATTTAAGAGAGAATTT
TGTGTACAGTGTAATTAAGAGATGATTCAATTAAGAATCCTCATTTTTTAGTTCTCTGCT
CCCCACACACTTTTTTTTTAAATTTTTTAATTTGTTTTTTCCCCACACTTTTTCCTAGCT
CTGCAAACAAATCTGTGATATATAAAAAGATTTAAAAGTTGTTGAATATTGTGTTCCCAT
GTCCCTATTGTATCTTCTTATCAATGACTCACTCTCGCATATGTGTGTGTGTGTTTTTTT
TCTTTTTAGGTACCAGGGCCGGGGATTGAACTCAGGACCTCCAATGTGGGGAACCTGTGT
AACTTAGTGGTTGAGTTTGTTTTGTTTTTAGGAGGTACCAGAGATTGACTATGGGACCTC
ATACTTGGGAAGAAGGTGCTCAATTACTTGAGCTGCATCTGCTCTCCTATGGCTATATTT
TGTTCTCAGTTGAGCAGGGTCAGTCACTTACTACATTTGGTATAGGGCATAGTGTAACTG
ACTTGAAGTGTTCGAGGATTCTTCTGTAGTTATGCTCAGGCTTCTTCCTCCTGTTACTAT
ATCCATAAACTAAGAAAAGGTTAATGCCTTTCATGAATAATATACTTCTTAAAAAAGGGA
GTTACATAGCACAGTATATTCAGCTGTCTGATATCTACTGTCTTTAGATCATATCTTTTA
AAATGTTTAATAATGTTTTATTTAGAATGGTTGTAGACTTAATGGAAAAGGTGTGAGAAC
AGAGAATTCATGTGTAACCTGTACCCAGTTTCTTCCTTTTAATCATTTTGAGTTAATCAT
AGATAGTTCATTCACTTTGAATTTTGAGGGCCTATAGGATATTTAAGGTATTACAGAATC
TGACTTAAGGAGCATAAAAATCTAGTAGAGAATAGTTTCTCCAGTAGCTTTTGTGGAAAT
CAAATGATTGATTTCTTTGAGAGCTTATAGGAAGGAAAGATGATTTTCAGCCAAGGGGAT
AAGGGATTATTTTTCCTTATTTTGAATTGGTCATAAAGAGAGGTGGGATTTGGCTTTATG
GCATCTTGTTAAAGAAATGTGATGCTAATTTAGATGGCCCATTTCATTCCCAAGTGTTTA
TTCCCTTTCCGGGGAGGATGCAGGTGTGTTATACCCAGGGGAAGTATGTGGTTTTGGCTG
CAGTAATGGTACCATTCCAGACCAAGCATGATTTCTTGCTAGTCTGTTACAGGAATTGCT
GCTATCTAGTTTTTTTGTTGTTGTTTTTTTGGTTTCCTAAGTTCTTTTTTGACTAAATGG
TTCTATTCTCTTAATCCAGGTATAGTCCAACTACTTCCTTTGGGACCTTATTATGTAGTG
TAGTTGTAATAAGCATCTGTGTTTCATGCTTACGGGTCCTGTGAATTGCCATTTTAGGTG
TCTGAAATGGCCGTGTCTGAACTGCCCGGTAATCCAAATGCTGTCTGGACAGTGCGCCGT
CACATTGAAGGTAAGCAATCCTTTTCCCAACAGTCAAAATGAGGGTCTGGGTACCATTAA
GAGGCTCTATTCGTAATATCCTATGTCACTTCATCTAGCCCTATATACTAGAGACTTCTG
ACCCAACACCTTGTTGCTTTTGAGACTCTCCCAATCAGGGTGTCTTCACCTATTACTTTT
GTTCATATTCAAGTGGGTGAGTGTACATAGTGTGTGGCTGTTAAGGTTCTCTATCATGGA
ATGTCATGTGTGATGTTCTTTGACTTTATATCATCTTCAAGGCACTGTTACCATCTCCTT
TTAAGAGGTGTGGTTTGAGGGAAAGTTGTTGCTGATTATTCATTTTTCTTCAACTAAGTT
TTTCGTATTGTACTGAAACCGAAGTACGCAGTGAAATTCAAGATAGTGTTCTAGGTGTTA
AGAGACTTGTTAAACTTATTAATTATAGTCAGTCCTGCTCCATGAGTAAAGTTATGCTTA
ACTGAATAAAATCAGGAGAATTTTAAAATGAGGGGTAGGGGAAGAGGAGGGAGTCTGATT
TCCTGAATAAAAATGTTCACCTCATACTAAAACTGGCAGTCGTATGAAAAGGCACTGTAG
TGCAACAGTATAGCAGTCTCTTGAAAATTAAGTTTCAGTCCCATAGGAATAAAACCCAGT
TCTCATTTTCTCTTTTCCCTAGAGCTCATTTCCCTCTTAATCCCTCAGGAATGTGGGACT
GGCGAGTAAGATCACCCTGGCCCAGTATACAAAGCATTTTCAAGAAATTATCTGCAATTT
TTCTTGATATTTAGATGTTATAGTTGTACAGAACAAATTAAGGGAGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCCCCCGCATAGGGGAGCCCCACGTGCAAGGAGTGTGCCCCATAAGGAGAACCGCCCAG
CATGAAAAAAGTGCAGCCTACCCAGGAGTGGCGCCGCACACACGGAGAGCTGATGCAGCA
AGATGATGCAACAGAGTGAGACACAGATTCCGGGTGCCACTGACAAGAATACAAGCGGAC
ACACAAGAACACACAGCAAAAGGATACAGAGAGCAGACAACTGGGGGAGGGGAAGGGGAG
AGAAATAAAAATAAATCTTAAAAAAAATGTGAATAGGAAGTAAGGCTCGTTTTAGATGTG
AGACTAGGGTACATAAAAAAAGGTAATTATCAGATAATTGGTTTTGAAAGATTTACGAAT
TGTTAGCTTGGTGGCTTTATAGATGTTGCAGCTCTTGAAAACATTGCCTAGACTGAGTTA
GGTAGATCTTTTGAGGTAACTTAAAAGAAGTAAAGACTTGCAGGAGTTAATTGACTTTCC
CAAGGTATTACCTGTAAGTAATAGGGACTGAAAACCCTGTCTTTTGAATCCAAGTCCAGT
GCTCATTTTGACTAAACTGTGTCTGGAGTCTGAGTCTTGCTCATTTTTTTCAAGATACCT
TCTATAACTGTAACTTGGAATCAGTTGCGTGCCCACCACGTACTCAGAGTGGTTATGTAG
GATCTCTGCCCTCACAGCACTTACCATCTAAAGAAAAATATACAATAATATCTTGTGTCT
GATGTAATGAGAGGCACAAGCATGTTGCTTGGAATGGTCTGAGGAGAGGGAATGTGCATG
TTTGAGAATCCCAGAAGGCTTTGTGGAAAGGCAGACTTGATAAATATCAAAGTCTAGGAG
ACGATTACATCTTGATAAATTATATTCTTTTAGAAATTCTAATATTGGTGATCACCCACA
AAATCAGGTCAGGTTCTCTGTTCATTCTTTTTCCAGATACCCCAAGTTACTTTTGTGTGA
ACATTCTTCTGTCCACACATGCTGCAGTCTTCCAGGCAAATACTAACCTTGGCTGGTACT
TGGTGATGCATACTACCAATACCAAGCCTTTTTTTCTCTTCCACAGGTGGCTGGTGAAGG
TGCTGATCACCACAGGTGTGTACCTACTGCTAGGGTATACCATGGGGTCTTGTAGTTTAC
CCAGGGAGAGGGTCCTGCACAAAATGTTGAGGCTGCCCTGACAGCATCTTTCAGAGGGTA
ACTTTGCAGTTGGACATCCCATGTGCATTATAATGATGCACGTCCTTCTGCCTGTATATT
AAATGGTTTGTGGTAGGAATCAGGTTCTCTTTCTTTTCCCCTACAGAACATATGATTAAT
TTTTCTTTCACTAAGCTGAAAGAGCCTGTAACTAGAAAATGTTAGCTTCATATTCTTTCT
TAGACTTCGTATGTTCCAGATGTACTGATTAAAAGATCAAGCTCTGGAGAAAGCTTTTGA
GTGTATTCAAGAATTGTGCTCAGGCAAGGCAAGCACCAGGTAGTCTGAATATAAAGTAAG
AATGAGGTATAGGAGGCTTAAATCATCTGGGTTGTTGCTCACTTTACCATTTGGCATGAG
CTGCTTATTGAGCCTTAAATATTAAGATGGGAAGAAGAGTAAAGCATTCCCTCCTCTAGG
GAGTGCTTCAGCAGTGACCAGATGGATAGAAATCCTAATTAATCAAGACCTAAAAATTCC
TTCTCATGCCCCAGTAGGTTCTTCACTGAGATATGGACTAAAGTTTTTATGAGATATGCA
ACCCCTAGAAAAAGGCAACGTGGATATTTATAATTCCTTTGTCATTTACCTTCACTGAAA
TTATTTGGAACTCCCAATTTTTAACCTGTATCATTAGGACATTAAGAGCAACTAATCTGT
AGGTCCTCTTACTTATAGAATGGGGCAGGTGGAAGTTATAGTATGCTAAGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTCCCCAATTTTAACCTGTATCATT
AGGACATTAAGAGCAACTAATCTGTAGGTCCTCTTACTTATAGAATGGGGCAGGTGGAAG
TTATAGTATGCTAAGAATTCATAGGGATATGTTGAAGAAATCTGTGATAGAAGTTTTCAG
ATACCATTGTTGAATTTACTAGCAAAAGCATGATACTTTATTTAAGTCCACTGAATATCT
CTTTTTCCTTTATATCTCAGAAGTCTGGGGCCTCAGTTAATAAAAGGAAGGTAAGGGCTT
GGGCAATCTTCCCTCCTCCCATTCTCTTGGATATAAGTCAAAGGTCTGTGGTCTCTTTCT
GGAGACCATTTTTTTCCCCTTGACTGAGGGAAGAGACTAGAAATTCTGACTAGTTAGAGC
GTTTTGTTTGCCTCTGATTTTTTTTTCTGGCCCAGCTTTTCAGGTATAAGGTTCCAGTAA
TGGGAATGTAGGAAAGGAACAATATTTGTATAATGGTAAAATTAAGCAATTCCATCATTT
TGCACACCAGAAATTTCCAATTCAGAAACAGCCAGAAGAAATAAAAATTTAAAACAAAAC
AAAAAACGGCTGGAGTAAGGCTCCAGGTTTGGTGTCACATGGAGACCAATTTTGGTTATG
TTTTAAGCTATTCAGACACTCATTCCAGGGACAACCATGTTCTTAGTCATATTTTATAAT
GATGCAGTCATAATAAACCAACTCTTATGTTGTCTGGTGTTACTCCTTATGATTTGGAAA
TTGAACCCTTACTCTGGATTCATGATCCAGCTATATTAGAGCACACCCATTGGGAAAGCC
TTGCCTGTCAGCTACCCAGTATAATGTGTATTAACTGAAATAAAAGTTTCACAACTTACC
GTTGCTATTTAAGAAGCAGTCTCCTGTATTCTATTTATTTCCATATATTTATATTTAAGA
ATTCTGATTGCTACCTATCACATTGATTTTATATCCTTCTAATAGGTTAGAACGCTACTA
TAGTCTCCACAAATGATGTATCTTCTCTTAGCCCTTCTTTCTGGTAAAGAATGATGATTA
TTTTGAACTGATCTAGTAACCTTATTTCAGCTGAACCACATTTTTTGAAACTAAAACTTT
GTTCTTGATGTTGGTGACATGGAACCAACCCTGTGGCATTGAGCTGTGACAAGGGCTCGT
GCAAATACAGGGCTCTATAGCTCCTGCTGGGAGTGAGTCTATCCCTTTACCTAATTTTAG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCCCTTTACCTAATTTTAGGGTATGGGTGGAATTGCGGTAGAAGAGATTCACATGAA
GTAGGAAAATCTCATCTCTTCTTTATAAATTAAATGTGGCTTTATTCAATTTTTACCAAG
CTTTATGGCCAGACATTGTACTGGGGGCAGAGGACACGAGGCACACAGGGACTGTTTCAT
GTTGTAGAGTGGGTTATATGGGAAGTAGTTTGGCTTTTAACTGGGATTTTTAAGAAATTT
TTAGCGTTGCCTTTATGCCTCAGGTCCTCTGACCTCCTTGAGATACTCATTAGCGTTTGT
TTATCCAAATACATTTTGTGAAATGAAAAGCAAATCCAAACGGTATTGCTCATGATTACT
GGGTAGTTGTATTTTTAAGTAATGAAAAACCATAGAGGTCAAGGGCTAACAATATGAACA
ACTTGTTCCCTTCTCCCTCCTGCCCCCACTTCTTGGTTGTCTAATGTTCTTATATCATTT
CTCTTGGGACATGCTAGGATTCTGTTTCCAACCCTAGAATGACTTCGTTTCATGGAGGCT
GGTGTATCTCTATTTATTCATTAGAGCCTGTATTCCCACATAAACTGCTTTGGCAGAAGC
TAGGGATCTTTTCCTGGTTATAAGGAGTATCTCTTCTTAAGAATGAGTTGTGATTGGCAA
CTGGGCACAAATAAAAGAATTCTAGTTTCAATATATGTAAACTTTCTTTTAAATTTCCTT
ATGTCTCTGATTTCCTTGCTTTGTCTTCTCATTTCTCTAGTTAATGTCTCAAGAAAACGC
GAGGTTTTAGAGGTGGACATAAAGTACTCTGTGTATATGGGTATTTAAAGAGGCAAAATA
TATCTGTAGGCTGTTATGACCCTTGATTATCTTTTGGATCATTTTGTCCTCTTGGCCATA
TGACTGTGTGTATGATCACTACGCATGGAAGAAGTGACTTGGAAGGTTTCTGAGAGAAAA
CTTTGTGTGTCTCATTTGGCTTTGTAACTAATGAGTTCTTAGCTAACCAACTCGTCTTTC
CTTTTTCAGATGAGTTTGATGCCTACATCATTGTGTCTTTTGTGAACGCCACCCTTGTGT
TGTCCATTGGAGAGACTGTGGAAGAAGTGACTGACTCTGGGTTCCTGGGTACCACCCCAA
CCTTGTCCTGTTCCTTGTTAGGAGATGATGCCTTAGTGCAGGTGAGGATTATCTATACTT
ATCTAATACTCAACTTGCTTTATCCTCTTTTTGTACTCATTGTGGTATGGACTACTGTGT
TCATGGTTTTCCCACCCATATACCTGCCAGAAAGCCTTAGGTTGGGAACATATTGTGTTG
TCAGTCTAAAGAATTGCATTGAAAAATAGGTCTATCAGATTTTGAATAACTTTGCTGTTC
ACTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTTTAAGTTAATTCCTAATGACGTATACAACCTAAAAAACTGATGGA
GCAATGAACTTGTCAAAGATCTCTTGATTCTCATTCTCATTAGTATGAGACCTGTTTTGC
ATACCCATTAGCCTAAATTCAGCCTTGGGACCGCAAATAGAGAAAATTTTTGGTTGGTGA
CTCTAGTAAGAGGAGAGAGAGAAAAGGAGAAAAGAATCTAAAAACCCTTCCCTGGTGTCA
GAGTTTGGAGGTAAATTTGAGTGTCTTCACCTATCCCCATGTGATTGGTGATCTCTTTCT
GTCCTCACTTCTGTAGTCAGGACAGCTGAATGAGTACACAGAACGGAAAGAGATGTCAGC
AGATGTAGTGTGCATGAGCCTGGCCAATGTGCCCCCTGGAGAGCAGCGGTCTCGCTTCCT
GGCTGTGGGACTGGTAGACAACACTGTCAGAATCATCTCTCTGGACCCTTCAGTGAGTGT
CACCCTCAACTTCAGGGGTCTTTCATTTGGAACCTGAGCACCTGGCCCACTTCTTACGTC
TCCGTCTGAGATCAGCTGGACTGGACCCTGAAATCTATCCGCACCTGTTGCCTCCCCTGA
TGTATTATAGCAGCACACCTCATGAGTCTTCCTACAGTAGTTTAAGAACACTGTCTGAGG
GCACTAACTGCTATTTTGGCTAAGCCTTAACTTCCCTTTTATGGTTAAAAAAAAAGTTGG
CTTGAAAGCAATTGAGCTCACTCCAGGTCCTTAGGTGACTTTTAGGGGTGGTATCCTTTG
TTAATTTACTCTTTGGGGGGTGTGGGAGAAGGTTGGTGGGGAACTGGGGACAGATATTGA
ACCTAGGACCTCACAAGTGGGAAGCCAGCACTCAACCACTGAGCTACGTCAGCTCCCCTG
AGTTGGTTTTTTGGTTTGTTTGCTTGTTGTTTGTGTTTTTTTTTGTATTTAAGAGGCACC
AGGAACCTAACCCATGACCTCACATGTAGGAAGCAGGCAAACCACTGCTTGAGCTATATT
TGCTCCCGTTAATTTACTTTTTTTTTTTTTAAGATTTATTTTATTTATTTCTCTCCCCTT
CCCGCTATTGTCTGCTCTCTGTGTCCATTCGCTGTGTGTTCTGTGTCTGCTTGCAGTCTT
GTCATGCGGCACTGGGAAACTGCGCTTTTTTTTTTCGCGTCATCTTCCTGCTTCAGCCCG
CTGTGCGGTGCCATTCCTGGGGCGGGCTGCACTTCTATTGCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCCTAGGTCAGGTGTTTTCAGCAAATATTAGGCCCAGTCATACGGCCTCTT
TTCTATCTTTTTTTCCTTAAGATTGCCTTTTAATTTTCTAAAATTCTTTTGGAAATGCTG
ACTGAAATTTGAGGATAGGGTTTTTTGTTGGTATACCATGTTTCTGATTTTTTCCTAAGC
TCATTGAAGATGTTTTTTTTTTACTCAGGTATTGGCCATGTCAAGTCGCTCATGGTTGAG
CTATTCTTACCAGTCTCGCTTCCATCTCACCCCACTGTCTTATGAGACCCTGGAATTTGC
ATCTGGTTTTGCCTCTGAACAATGTCCTGAGGGCATTGTGGCCATCTCCACCAACACCCT
GAGGTAAGTCCCAGGGCTGAAGCCAGCAGGAAGCCTTTCTCACAAGGGCTTCTACTGTGC
TTCTGTCTGAGTATTGAAGGAGGCTGTGAAGAGAGAGCAGAGAGCCAGCTCTTCACTATG
GAACTAGTGTGTTGAAATTGAAACCTTCTTTTGGCTCCTGTTCAGGGATTCAAGAACCTG
GTAGCCAGGTTTTGGTGTTTGGAGTCATAGCTTCTGTTTAGATGTCCAGGGCTGAGTTGT
AATACTTAGCAGTGCAGTCTTCTTGAGATCTAAGGTGTTTTCCAGTGGAAAAACAATGCC
GTTGGAGTAGTTTTAGAGCAGACACTGAATCAGTAGTACACTTTTCTCACTTTATCTTGT
CATTTCCAGTATTACATCTTTAAAAGTTCAATCTCAATATAAATTGTTTAGAGGTGTTCA
TGTCCTGGTTATAACTATTGGCTCCTCATACTGGTTTATGGCCTCTTGATGAATTAGTTA
CTGTTGCTTTTATCTCTATTTCTTCACCTGGAATGCTTCCCCATATACAGTTGTACCTGT
CAAGGTCCTACCTGTCTTTCGAGGCCTAGTCTCAGTGTAGCTTCTTCCATGGACTCTCTC
ATTGTTTATATAATTTGGCTCTTAAACTCCTCTAAATTTTTATAGATTTAGACTGTTTTC
TAGCAGCAGAACTTTTTTTCTCCATAAAACAAAATCTTTCAGGGAGGGCACTGCACGAAA
AAGATAAAAGCACAGCTCTTTGGGGCATAGTTTAAATATCAAAAATAGTGGTATTTAAAC
TAATCATAAAATTTTATAAAGTATCTTTTATGGTCATTTTCAGTCAACATATAGAATAGT
TTGTCTAGTAGTTCTAAAATTTTATGAGGGGCAGAATAATTTCTATCTTAGCCCTTTCTA
TGGCATAAAAATGATCACCATGAGACTTGGACAAGTTATCTCTAATATCACGTGGAATTT
AAGAAAATTGATGGAAGTTGTGGGATTAGATTTGTGAGGGTCTAAATAATGGATTTGTGT
TTGTGTTTTAGTCTTAAATTTGCTCTCTAGTACACGTGGTTGTTATACTTAAAGGTTATT
CAGGAGGAAGGAAACATCACAGGGCAATACGGAGCCAGTGGGCCTCCCTTTCTGGGTCCC
TGACCTTGTTCCAACTGGGAGAGACTGACTAGGGAAACACTTCTCTGAAGTGTTCTCCCT
TCCAGAATTTGTTCTACAGGCAAAAGCAGCTTGATACAACTCAAGTAGTATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGACAAAATAGCCCAATTAACCTAATGGG
CAAGTTTCTTGAATAGCATTTCTCCAAAGAAGGTATACATGTGACCAAAAACCACATGAA
AGGGGTGTGTAACATCATTAATCCATTAGGAAATACAAATCAAAACCACAGTGAGCTACT
ATTTCACATGCACTTAGAATAGCTACTATTAAAAAAGGAAAATTGTAAGTGCTGGAGAGA
ATGTGGTGAAATAAGAACTCATTCTTGTTGGGAATGTAAAATGGTGCACCTGCTGTGGGA
AACAGTTTGCTGTTTCCTCAGTTAAGTGTAGAATTTTTTTTTTTGTTTAAGATTTATTTT
TTATTTATTTCTCCTCCCTTCCCTTCCCTGTCCTCTCTCTGTGTCCATTTGCTGTGTGTT
CTTCTGTGTCCACTTGTATTCTTGTCAACGGCACCAGGAATCTATTTTTGTTGTGTCATC
TTGCTGCGTCAGTTCTCTGTGCCCAGCGCCATTCCTGGGCAAGCTGCATTTTTTTCGCAC
TGGGTGGCTCTCCTTACGGGGCACACTCCTTGCACATGGGGCTCCCCTGTGTCGCACGGC
ACTGTGCATGGGCCAGCTTATTGCACAGGTCAGGAGGCCCTGGGTTTGAACCCTGCACCT
CCCATGTGGTAGGTGAACACTATCCGTTGAGCCAGATCCGCTTCCCAAGTGTAGAATTTT
GATATGAAATAATTAAGGTAATCAAACTCATAGTGTGAGAATCTAGAATTATAGGATCCA
GGGACAGGATGGGAGTAGGAAATAAGGGAGTTGAAGGCATAAAAGGTATACAAGGTTTCT
ATTTGAGACAATAGAGAAATTTTGGTGTTGGTGATGACGATAGCACAACATTGTATATAT
AATTAATTAACAGCACGGAATTACATGTTATTATTTAAAGGGGAAATTTTAGGTTGTATG
TTAACTAGTATAAAAATATATTTTTTTTAAATCCATGGAACTGCACAATACAGTAAACCC
TAAGTTAAACCATGGAATGTAGATATAGTTAATAGTAGAATTATAGTAATGTCCTTTCAT
CATTGTATTGTGTACCACACTTACTGTGTTATGGTGGTGCATGGGAATCCTGTATTTTAT
GCGTGATTGTTTTGTCAGCCCATAACTTCTCTAAAAAAAAAAATAGAAATAATTTTCTTT
GGATGGGAATGAGCTATGTAAAGTCATGACTGGATAGGTAATAAACATAATTCTTATGTT
TAATTATTTGGGGAACTATCAAACTGTTTTCCAAAGTGGCTCAACATTTTATGTTACATG
TATGGAAATTTAGATTTTTCCATATTCTCCACAACACTGTTATCTGCCTTTTTGATTGCA
GCATCCTAATGGATGTGAAGTGGTATATTATTGTGGTTTTGATTTGATTTCCTTGAAGAC
TGATGGTGTTGCATGTTTTCATGTGCTTGTTGGCCATTTGCATATTTTTGGAGAAATGTT
GATTCAAATCTATTGCCCATTTTTTAATTGAGTTATCTTTATTGAGTTGGAATAGTTCTT
TTTATTTTTTAGATGTAAGTTCCTTGTCAGATATGAATTGTAAATATTTTTTCCCATTTG
TGGATGGTCTTTAGCACAAAAGGCCATGATGTTTTCGTTTTGTTTTGGTTTTTAGTGATT
TTTTTTACTGTGTGTAGCAGTGCTCCAAAATGTATTCATCAAATGCAATGAATGTGCCAC
ACTGGTGAAAGAATTTGGTAATGTTGAAGGGGGGCCTTTATGGAATCTTCTTATATTTTT
TAATGTAACATTTGGTATGATCTACGTATCTTTAAAAACTTTTTTTAAATCTATACGAAG
AGAAATTCTTACAGTCACATCAAAAAGACAACCCAACTTAAAAAAAATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGTATTCTTGTCATGTGGGACCAGGAAACTGCTGCTTTTTTGTTATCGTTATCTTGCT
GCATCAGCTCTCTGGGTGTGCGGCACCACACCTGGGCAGGCTGCGCTTTTTTGCACGGGG
TGACTCTCCTTGTGGGGTGCCCTTCTTGTGTGTGGGGCTCTCCTACGCGGGGGACGCCTC
TACGTGGCACGGCACTCCTTGCGCTTGGCAGCACTGCGCGTGGGCCAGCTCACCACATGG
GTCAGGAGGCCCTGGGTGTAGAACCCTGGACCCTTCCATATGGTAGATGGGTGCTCTATA
AGTTGAGCCACAACCGCTTCCCTACTTTTTTTTTTTTAATAATACTTAGATTACATAAAA
TGTTACATTAAAAAATATACCCCACTCCCCACACCTCCCTGGAGCAATTACTTTTGAATC
ACAAGGATGTGAGTTTTGGGGGCAAGTCTCACCAGAGCATCCAAGGCCTAACTCAGAATA
AGTGTCATTGTATATTTAGAGGAGGGAGGAGACTGGGGAGGATCCGTGTTTCAGTCGAAC
AGATAGTCCAGTTTCAGAAATTTCAGTTTGTAAAGAGTATATAGGGAAGCAGACTCGGCC
CAATGGATAGGGCGTCCGCCTACCACTTGGGAGGTCCAGGGTTCAAACCCAGGACCTTCT
GGCCCTTGTGGTGAGCTGGCCCATGCACAGTGCTGCCGCACGCAAGAAGTGCTGTGCTAC
GCAGGGATGTCCGCACATAGGGGAGCCCTACGCACACAAGGAGAGCCACCCTGTGCAATT
AAAAAAAAAAGCGCAGCCTGCCCAGGTGTGGTGCCACACACAGGGAGAGCTGACACAGCA
AGATGATACAACAAAAAGAAATAACAGATTCCCGGTGCTGCCAAGAAGCAGACACAGAAG
AACACATAGTGAATGAACACAAGAGAGCAGACAACGGTGGGGGGTGGGGGGAGAGAACAA
AGAAAATCTTTTTTTTTTTAAAGTATGTATTCTCAGTCCTATCAAAAGCCCTTTGGCTTA
GCAATTCTACTTTGTTGGACTATTTTTTTTCCTTCTTGGACTATCTTAAACAAACGAATA
GTAATGCCACTATATTTATTTAGTCTCTCATGGAGGGATGTAATTGGGAAGTGGAAAGGA
AAAGAGATTCAAGGTGAATTTTTAGGTAAACCTGAATGTCCTCTTTTCTTTAATGTAAGA
GAGCCATTGACAAATTATAGAATGATATGATCACTTGGCTTAAGTTTTAAGTGGATGTCT
TTCTTTCAAGCATGTCCTTCAGCTACTCACTTTCCCCTCAATTCAAGGCAGTCTGTGTAG
TTTCTTTTGTCTTTTATGATGTGCTTATGTAAGCAATTATTATTTTTTTTTTAAAGATTT
ATTTTATTTATTTAAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTAGGTAGAAAAATATATTATGAGCTCTCCCCCAGAGATCTTTTTCCTACTTA
ACCCATTTCTTATGCATAACCCATTTTTAAATACACTGACGACTCCTTGCTTTCTGGACT
TAGGAAATGGTGGAAGCAGCAGGGGAGGATGAGCGGGAGCTGGCTGCAGAGATGGCAGCA
GCATTCCTTAATGAAAACCTCCCTGAGTCCATTTTCGGAGCTCCCAAGGCTGGCAATGGG
CAGTGGGCCTCTGTCATCCGGGTGATGAATCCTATTCAAGGGAACACACTGGACCTTGTC
CAGCTGGAGCAGAATGAGGCAGCTTTTAGGTAAGAAGCCCAGGGCCTTCAGGGTTTTATG
AACTGGAACAGGGATTTTCTGGATTGTGACTAACACCTGACTGAGTGGTTCTTTCTCTTT
ATACAGTGTGGCCGTGTGCAGGTTTTCCAACACTGGTGAGGATTGGTATGTGCTGGTGGG
TGTGGCCAAGGACCTGATACTGAACCCCCGATCTGTGGCAGGGGGGTTTGTCTATACCTA
CAAGCTTGTAAACAATGGGGAGAAACTGGAGTTTTTGCACAAGGTAGGAACCAGCCTGTG
GTTTTTCTAGATCTTTGGTCCCACTGAACTCTGAATTTTTGCTTCATTTGTGGATCACGT
CTTCTGTTGATTACTTTGGGAGTCAACTTACTGATTCTGTCCATATCCTGGGAGCATTCA
GAAAATAGTGGGGCTGAAGGCTCTAGTGATACCCTGATGCCTGTCCATAAGTCCCACAAG
AAACATATGTGCTGTCCACTCACCACAAAGATACATACTGAATTGGCCCCTTGTTTACTA
GGCTTACTAAGCAGGCAGCAGTTTGTGGCAAATTCAGCAGTTGTAAAGAATTAATATTCT
GTTCCACACTGACAATACATAAATATGATTCCTTCAGCCCTATCTTAAATGGAGCATCCT
AGGAAATTTTAAGTCACAGGCCCTTTTTTGTGTTAAAATTGTCTCACTCTTAAAACTAAG
ATAGATCTATATTATGCCTACAGATGTAAGGATTAGGCAGTATTTCCTTTTAAATATAAA
TTTCAAGTGATTTAATATGTTAGCAGGTGGAAAGGGCTGATTTCTGAGCTACAGAAGATA
TAGGAAATTAATGTCTCATCGTTTTGAACTCTATAACCCCTTAGTCACTTTTCAGTAGCA
TTCATTTCCCATCCCTCCATAAACAGCAGTGACGTCTTAGATATCAAGGTTCTACTTCTG
TTTAATGGAGCCAGTTAAACCAAGCATGGGCTCTGAGGCAGCATTCCCTAGGCTTCAGGA
CTTCTTTTCACTTGTGACACTGATCCACTTGCTGGGCAAAATGCAGTGTGTAGGACCTCT
TGCCCAAACACCCTGTTTCATCGTGTGCTGTATGCATGGTTTATTTCTCTGATGAGAAAG
ATTATCTTTAGCTGTCTTACTGCCAGATGTCTGGAATGGATTCATTTCTGGGACAGGGCT
AGGGCTAATGCCTGTATGTCCTCTAATAGTTGTATTAACCTGTTTTTCTCTCATAGACTC
CAGTGGAAGAGGTCCCTGCTGCCATTGCCCCATTCCAGGGGAGGGTGTTGATTGGTGTGG
GGAAACTTCTGCGAGTCTATGACCTGGGGAAGAAGAAGTTACTCCGAAAGTGTGAAAATA
AGGTAAATATGCTGGTAGAAGGGCTAGGATCTAGCTAATGAGACTAGAGACATTGACATT
AACTGTTAAGAATCATGGGACTTTGTTAAAACTGTGTTGTATTCCCCTAATTTCCAGGCT
CAGAATTAGCTCTGGAGAGTTCAGAAGGGCAGGAGTAGGACAGGCTTCTTCAAACCAGAA
CTAAATTTCTAGCTGTTTGCTTTTAGAGGATTTCATCTGAGTAGCTTATATTTCTACTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTAGTTAACTAGTTCTTTTCTAAGGTTT
GTCTTAGGTTTATGCTTCTCCTAAAGACATTAATTTCTTTAACATTTCTTTAATAGACTC
TCTCTGGATTATATAAAATAATAGATCCATTTTAAAGTTTAAGTTTAGTAATTGCTGTTT
TTATAATCTCTATAGTTTCCAGGTTTCTTTATTGTAAACTTTGTAATTTAACAAAGCAGT
TTTTAGATAATTGCATATCAGAAATTATCCAACTTCTCAATATGTTTGTGAGCTACTAAG
CTTTTAAGTAAATAAAAACATTTTTAAAAATTTAAAAATTCTTATAATGTTGTTTGAATA
TTAAAAGATGGTGAAATCTGCCTTTTGGTGGCTCTATGCCTGGGACTTCAGAAGAGGCTC
CTGGGGGTACATTCAGTTACTAGTCTGTTTTTAACTTGCAGGCAGAGGTGATCATGAACT
ACCACGTGGGGGAGACAGTGCTGTCATTACAGAAGACCACGCTGATACCTGGTGGCTCTG
AATCACTCGTCTATACTACCTTGTCAGGAGGGATTGGTATCCTTGTCCCTTTCACTTCCC
ATGAGGTGAGAGTTCCGTACCACTCTGGCCTTTACCTTCCCAAAGTTGTTTCTTACTGCT
GAATCTGCATAAAAGGGCAAATTTGTCCCCGTCTGTAGCTAATATTGTTCTGAAAATTTT
GTAAGACAACAGTCAGAAGTGCCTGGGCAGGTGGGAATCCTGATTTTTGTCCTTAGGGAA
ACCAGTGTTTTACTATACAAGGGTTTGGTTCATTCCTGATATGGTTACAGGGTTAGTGTA
AGACCAGAGCCCCAGAACCAAACCCCACAGACTAGAAATAATGGGATGGTGTTTACCGGG
CACTGATTGCTTCATAGAGTCAACTCTAGGTTTGGCTAAGGTTGCTTTGTGTTATTCCAC
CCCAGAAGCTGGGATCAGGAGTCTGACCTCACACACCACTCGTTTCTAATGGTATTCTCT
CTTGTACTATAATTGCAGTGAGGTCCCATTTGGTTTTTAGCTATCCTATCTTAGTAGGAA
AACCTGCAGTCATTAGAGGAGTGGTTAATTATTTACCATTTCTTGTCCAGTGGGGGGAAA
AAAAAATCGATGGCTTGTCTGTTTGCTGTGCTTCTGGAAATCATAGAGAAGTAGTTGAAA
TTACTGTTTGACTTAGTGACATTCTCTGTTTATTCCTCCAGGACCATGACTTCTTTCAAC
ATGTGGAAATGCATCTACGGTCCGAGCATCCCCCTCTTTGTGGGCGGGACCATCTCAGTT
TCCGCTCCTATTACTTCCCTGTTAAGGTAGGTTTTCCTTTGAGAAATCTGGGTTGAGTAA
TATTATCCTTGGCCCATTCAGTCAGTTTTTTGGGGGGTGTATTAAAAATCTGAACAATTC
TGAAAGGAACAGCAAGGCAATGGATTAATGGAGACAGTGATGGGGGGAGGGTAATGTTTA
GTGATACTCAAGAGTCCTCTCTCCCACATCCAGAGAAGAGATTTCACCCGAGTCTGCTAA
TCTAAACTCAAGGCTATCAAAAGTCAACTTAGAATAGTGTTCCTGGCTCTACAAATGGAG
TTTAGGTATCTGAGAGAGAAAAGAAGGCTTTAGCTGCAACTGCTACTTTGACATGTGCCA
TTTTCTTTGAGTATCTAACCTTTTTCTTCCTTTGTCACTTTTCCATGTCTTAGAATGTGA
TTGATGGAGACCTCTGTGAGCAGTTCAACTCCATGGAGCCAAACAAACAAAAGAATGTCT
CTGAAGAACTGGACCGGACTCCACCTGAGGTGTCCAAGAAGCTTGAGGATATCCGGACCC
GTTATGCCTTCTGACCTCTTCATTTACCTGTGGGCCTTGCCCGAGACTCTGTGTTTTATT
TCCCCCACTACGACCACCTGGCTCTGGACCCATACGGCAGAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 4647..4973, 5709..5881, 6645..6786, 8150..8262, 8363..8500, 8601..8704, 29032..29197, 33793..33888, 36897..36969, 44769..44920, 45226..45381, 46936..47091, 47962..48105, 48206..48328, 48628..48782, 53548..53722, 56583..56788, 56886..57042, 58016..58141, 59119..59331, 59432..59530, 60701..60844, 61481..61585, 61973..62113
1001..1070, 4647..4973, 5709..5881, 6645..6786, 8150..8262, 8363..8500, 8601..8704, 29032..29197, 33793..33888, 36897..36969, 44769..44920, 45226..45381, 46936..47091, 47962..48105, 48206..48328, 48628..48782, 53548..53722, 56583..56788, 56886..57042, 58016..58141, 59119..59331, 59432..59530, 60701..60844, 61481..61585, 61973..62110
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved