Dasypus_novemcinctus Locus ENSDNOG00000010783
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000010783
Dasypus_novemcinctus
ENSDNOG00000010783
GeneScaffold_2164
SNORD82, SNORD20, SNORA75
4519..4586, 11561..11639, 12214..12314
14862
CTTTAGCCACAATTAACAAGGAGGGAATTTGCTAGGTGGTCAAAGAGCCAGTCCTGTGG
TCCCCCTGTCCAGGTTCCTCCTCTCCCTATACCCGTTAGAAAATTCTGTGACCGCCAGAA
AGTTCTCTGAGCTTGTTCTGTTCCCCATCAGAGGAAACACCTACCGCACGAGGTTACTGT
GCGATTAAATGTCTGTGCCCTGCTCGGCAGCGCGTGAACACGGTCGGCCTCACAAACACA
TGCACTGTCTTTACTAACGTCTTTCAGGGGGTGGCTGCAGGCCCGGGACCCGGGGAAGAA
GCACCTGCAGCCAGGAGTAGGTTTCTGACCCCAAGTCCGTCCGAGGGCGGGAGAAGGGGG
ACAGCGGAAAGGGACAGTGTGAACCAGGTGGCCCCTGAACTCCAAAGGGCTCGGGGCCAT
CAGTAGGAATATGCTGGAACTCCTCTTTCAGCGTAGAGTGCAGGCCGCAGACGCGTCGCC
GGGTTCCGCAGCCCGGGACCACCAGGGTCCTGAGCCCCTGGGCCAGGCGACACGAGGCGC
CAAAATTTCCCGTCTCACGGCGCAGGCGCGGCGAGTGCGGGCCGCGCAGGAGCTCTGGGA
CCCGCGCTCCACCGCCCAATCAGCGCAGACCAAGCACAAAGCGAGTCCCGCCCCCAGGAC
GCCGCCACCAGCCCCTCCCCCTCCCCCGGCCGCCGCGGCCTTCCCACTCCCGCCCGCGCC
CCGCCCCGCGCTGCTCTCGGATACGGGCTCGCGATTGGTCCGTAGGCAGGGCGCGAGCGC
TGGTTGGTTGAGACGCAGTCACGAGGGCGGCGTCGTCGCCTTTCCAGAGGCGATTACTGG
GCAGGCTCAGTCTTTCGCCTCAGTCTCGAGCTCTAGCTGGCAGCCAAGGGGCGCGCTCCG
GGATCTTCGGAAGCCGCGGCCGCCATCGACGTCGCTTGGGTTCCTCTGGGCTCATCTGCG
CCACTCGTCAGCCCCACACTCCGCCGTCATAAGCTGCCATCATGGTGAAGCTCGCGAAGG
TAAAAGGCCTTGCCTGCGCAAGGACGCCCGGCGCCGTCTGCCTTGCGAGGAGCGCGCGCG
CGCGCGGCGCCGCGAGGAGGGCCTACGCGCCTTCCCAGGCGCGTTCGAGAGTCGCCTGGC
TGAGTGAAGTCTCGCGCGAAGAGCGGGGCGGTCTCGCGGTTTGGGGCTGCATGGCGGCGA
GGTGAAGCACTTCAGCAGGTGCTGGGTTGGCGAGGGCGGCGGTGTAGGACTGCGGGGTTG
AGCGCGGGGAGGGGGCGCTGGGCCTCGGGGCGGAGGCATGAGGCCAAACTCCTGCGACGC
GCGCGAACTGGGCCCCGCCTCCTGACGCACTTGGCCGGGTTACGCGCGCGGCCCGCCACG
TGGGCCCCCACCGCGTGGGGCAGGGGCTTTATGGAGGGGGCTCGGTCCTAGGGCGGGGAG
CGGTGGGGTTGAGTTGAACCGAAGGCCTGACGGGCAACTTTGCCCCGGTAAGGTGGGCGG
ACACGTGGTGAGTTGCGGAGGAGGCGTTGTGCGTGCTTCCTGCGCACATGGTGGCCCTCG
AGGTACCCCACGTGGTTTTGAGTCCGGGCGAGAAGAGTGGAAGAAAGTGCCAGGATTTAC
TAGGGTTTTGGGGGGGGGGGGGTATTTTCCCTAGGGTGAAGGGCTATGAATTGTTGGCTG
GAAAACGTCCATTTGCAAGCTAATGTGTTATTAAAACACTGAGTATGCAGTGTAATATGC
GGAGCTGAAAGTAGTGTTTTCACAAAGGAGGTGTGGTTCAGGAAGACATAAAAGAAAATA
ACCTTTTTGTTCCAGTGTGGATTTTCTGTCCGTAAAATCTGACAGGAAGAATGGGTGGGA
GGTTGAGATTCCTCCTGTCTTTAGTTGCCACCAAGAATGGTGACAGTGTTGACGATTTTT
AAGTTGTGGTATTAACTGAAGTGGATTTCAGTATTTCACTATGGAGAATGGCATGAAATA
GCAAAGAAGGAATAATGTGCTAATTGTGTTTGTTTTAGGCTGGTAAAAACCAGGGCGACC
CCAAGAAAATGGCTCCTCCCCCAAAGGAGGTAGAAGAAGATAGTGATGATGAGGAAATGT
CAGAAGATGAAGATGACAGCAGTGGAGAAGAGGTAATTAACTAAGTCTAGAAATACCTTG
AAATATGAAATCCAGAGTAAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGCATGTAGTCTTGAACCAGAGACATTGTC
AGAAATTGGCACTTATCTGTGGGACCATGGCTGCCTTTATTTTCCAGGTTGTCATCCCTC
AGAAAAAAGGCAAGAAGGCCATGACAGCTCCAGCCAAGAAGGTGGTTTCCCCAACAAAAA
AGGCTGCCATTGCCACACCTGCCAAGAAAGCAGCTGTCACCCCTGGCAAAAAAGCAGCAG
CTGTACCTGCCAAGAAGATGGCTACACCAGCCAAAGCAGTAGCAACACCTGGCAAGAAGG
GAGCCATGCCTGGCAAGGCAGCTGTAGTGGCAACCTCTGGTAAGAAGGGAGCTGTGGCCC
CAGCCAAGGGGGCAAAGAATGGCAAGAATGCCAAAAAGGATGACAGCGATGAGGAAGAGG
ATGAAGATAGCGAGGAAGAGGATGACGATGAGGATGAAGATGAATTTGAGCCAGCAGTGA
TGAAAGCAGCAGTTACTGCTTCTGCCTCAGAGGACGAGGATGATGACGAGGATGAAGATG
ACGACGACGACGATGAGGAAGACGATGATGATGACGAAGATGGTAAGGAGTTCCCTTGGT
AGTTCTTGGGCTTCTGGCTGTACGACACCATAGGTGAGGTTCTGGGAACAGCTCTACATA
CTCCTGTGGCAACCTGAAGTTAGATAATCTTTGCAGGCAATCTAGGCTAGTTGTGGTGCC
TAGGTTTAATTACCCATGCAGAATTGCCCCTGAGAAAATGCTTATGTGTGCCCAACAGCA
CATTCTTAAGAGTATTCATGATGTAGTGTTTTGCTTCCAAAGAACCTGTTAATTTTTGCC
ATTAACACATGGTGGCATTGGCAGGACTGCATTTCTTTGTTTTTTAGATTTTCCTAGTGT
TGGTTCTGAGGGTGTTCTCTGAGTTTCTGATGAAGTAGCTTGTTTTTCATTTAGACTCTG
AAGAAGAAGCTATGGAGACTACACCAGCCAAAGGGAAGAAAGCTCCTGCAAAAGCTGTTC
CTGTGAAAGCCAAGAGCATGGCTGAGGATGAAGAGGACGAAGATGAAGAAGATGATGACG
ACGATGAAGAGGAAGAGGATGAGGAAGATGATGAGGACGATGATGACGATGAAGAGGAGG
AGGAGGAAGAGGAGGAAGGTGATCAAATTACTTTTGAAGTACTCTGACTGGATTTGTTTA
AAGGAAGGCACTTCGGTATGTATGGGTACTCATTGATAGATTGTTTTAAATCTTATTTCA
GAACCTGTCAAAGAAGCACCTGGAAAACGAAAGAAGGAAATGTCTAAACAGAAAGCAGTG
CCTGAAGCCAAGAAACAGAAAGTAGAAGGTAATTTGAGAATTTGGGGAGGGGGGGCCAGG
CTCTGGGGAAGGAAGTATGAGCACAAATGATGAACAAGAAAGGGACTTAATACTGAGACC
TGATGTTACATTGTGATACTGATGAGCTGTTTAGAAAACTCTTATAGTGGAAATTAACTT
AGCTCCATAGGCTAATTTGAATTCCTTTTTGTGTACAGCATTAGAAACGACAGCTTTCAA
TTTATTTGTCGGAAACCTGAACTTCAACAAATCTGCTCCTGAATTAAAAACGGGGATCAG
TGACCTTTTTGCTAAAAATGATCTTGCTGTTGTGGACGTCAGAATTGGTGTGTCTAGGTA
AGTAACATGTCTTTGGGGAACTTGGATTACAGTATTTCACTGCATATTACATGTGGGTCT
GCGGGTGCTTTTTCTACTCCACTTTTTGGAAGGATAGGATTGCCATCACCTACTAGGCAA
AAATGAGAAATGAATATGTAAAAGTTTTCAAAAAGCTTAGGTGTTAACAAAGTGTAAGTC
GTTAGTGTCCTATTTTCAGAACTTCAAAATTGAAATATCTATGAATAACCTTTACTTTTT
TTTTTTTTTTTAAGAATTTGATGCATATATTCTTGGAATTGATCTAAAACTGTTAGACCC
AGGTAGTCATAGGAGTCTCATTTTAAAGTTCAAGCAGCTTCATTTGTGAGGATTATCAGC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGTAATGAAGAAAGAGA
CTTGAATAATACCATAAAGTAATTAGTATATAGGACTTCACTCAACAATGATGACTACAC
ATTTGTCTTCTCAAGTGCCAATGGCTCAGTCTCCAAGACTGACAACATTTTAGGTCACAA
AACAAGTCTCAGTAAATTTTAAAAGATTGAAATTATTCAAAGCATCTTCTCTGATCACTA
TGAAATGAAGCTAGAAATCAATTTCAAAAGGAAAACTGTGAAAGTAAAAATATGTGGAAA
TTAAACATATTTTTAAATAAACAATGGGTCAGAGAAGAAAGTCCCAAGGGAAAGCAGGAA
ATGTCCTGAGATGAATTAAAATAAAAAACACAGGGAGTGGATGTGGATCAAGCATTGAGC
ACTGCTTCCCACGTGGGAGGTCTTGGGTTTGGTTCCTGGTGCCTCCTAGAAAAACAAAAA
CAAACAACAAGCAAAAACAAATGATAAAACCAACTGAGGAGAGCCGATGTGGCTCAGGAT
TTGAGCACTAACTTCCCACATCCAAGGTCCAGGGTTCAATCCCTGGCCCCTGATACCTCA
AGCAAACAAACTAACAACAACAACAAAAAAAACCACAACATAACAGAACTTACAGGATGC
AGCAAAGGAAGTGCCCACAGGGAAATTTATACTATGAATGCATACATTAATAAAGAAAAA
AGATCTCAAATCAATAGCCTAACTTCACATCTTAAGAATCAAGAAAAAGATCAACCCAAA
TAAAGTAAGTAGAAGGAAAGAAAGAAAGAAAGAAAGATTGGAGCAAAGATAAGTGAGATA
GATAATAGAAAAGCAAATGGAGAGACTCATTGTAATCAAACACTGGTTCTATCAAAAACC
TTCCAAAAAAGAAAATTCAGGATCAGATAGTTTCACTGGTGAATTCTACCAAACATTCAC
AGGACAATTAACACACACACACAAAAATCCTTCTGAAACTTTTCCAAAAAATTGGAGGGA
AATCTTCCTAACTCATATTATGAGCCCAAGGTTGCACTAATAACAAAGCCAGATAGAGAC
ATCACCAAAAACCAAAACAAAACAACAAAACTACAGACGAATTTCTCTTAGGAATATAGA
TGCAAAAGTTCTCAATATAATACTGGCAATTGAATCCAACAGCAAAGTGAATGAATTATA
TACCATGAACAAGTGGGATTTATCCAAGGAATTGCAAAGGTGATTCACAGAAAAATAATC
AATTTAATACACCACATTAACAGAAAGAAGGGCAAAAAAAAATCACATGATGGTCTCAAT
TGATGTGGAAAAGGCATTTGAAAAAGTCCAATTCCATTTATTGGTAAAAACACCCAGAAA
AATAGGAATAGTAGGAAACTTCCTTAACATGATAAGGGCACATATTGAAAAACCCACAGC
TAACGTCATACTCAATTGTGAAAGACTGAAAGCCATCCCCCCGAGGTAAGGCACAAGATA
AAAATGCCCACTCTACTGCTCTTCAACATTGTACTAGGAGTCCTTTCCAGAGCAATTAAA
CCAGAAAAATAAATAAAAGTCATCCAAATTGGAAAGGAGGAAGTAAAACCATCTCTATTT
GCAGATGACATGATATTTTATACAGAAAATCCCAAGATTCACAAGAAAGGCACAAGAACT
GATAAATTCAGCAAAATGACAGGCTATAAGAATAACACGCAAAATCAGTTGTGTTTCTAG
ATACCAGCAATGAATATTCTGAGATGGAAATTTAAAAAATAATAATTTCATTCACAATAG
TTTCTAAAAGAATAAAATACTTAGATATAAATTTAACCATGGACGTGAAGGACTTGTGCT
CTGAAAATATTACTTAAAGAAATAAAAGACTTACATAAATTGCAAGACATTCCATGTTCA
CGGACAGGTAGACTTAATATTGCTAAGATGTAAACATTATTCAAAAAAATAATACTGATT
CAATGTCATACCTATTAAAATCCCAGCAGCCATTTTTGCAGAAATGGAAAGCTGATCCTC
AAATTCATATGGAAACACAAGGGACAAAAAACAGCCAATTGTTATTGAAAAAGAAGAATA
AAGTTGCATGTGTCACACTTCTTGATTGTAAAACATACTGCAAAGCCACAGTAAATAAAA
AAAGTGTGGCACTGATATAAAGATAGATATTTAGATGAATGGAATAAAATTGAGATTTCA
GAAATAAACCTACATATCTATGGCCAACTGTTTTTTAAAATAAGAATTCCAGGTACATTA
ATTGGGGAAAGAATAGTCTCTTCAACAAATGGTACTGGGAAAACTGTTTATCCACTTGCA
ACAGAATGAAATTGGACCACTTCCTCACCCCATATACAAAAATTAACTCTAAATGAATAA
AGGGCCTAAACACAAGGGATAAAACTATAAAGCTCCTAAAAGAAAACATAGAGGAGAACT
TTCAAAATCTGGGATATACTAATGATTTCTTAGATATGAAATCAAAGGCATGAGCCAAAA
ATTAAAATTAAAAATAGATAAAATGGACTTCTAAAAATAAAAACTTTTGTATGTTTAGGG
ACACTATCAAGAAAGTATGAAGACAAACAACAGAATTAGAGAAAATCATTGCAAATCATA
TATCAAATAAGGCTTTATTACCTAGAATTTTTTTTAAAAAACTGCTACAATTCAACAGCA
AAAAGACAAATAATCCAATTAAAAAATGGCAAAGTACCTAAATAACCAGTTCTCTAAAGA
AGATAGGCAAATGGACAAAAAGCACATGAAAAGTTGCTCTGTATCAATGGTCATCAGGTA
AATGTAAAACAAAACCACAATGAGATACAACTTCACATCCACTAGAATAGGTATTATTAA
AAAAACAACCAGAAAATAATAAGTGCTGGTGAGGATGCAGAGAAATAGTAACCCTTATAC
ATATTGCTGGTGGCAAGGCAAAAAAATGGTGTAGCCACTTTGGAAAGCAGTTAGGAAGTT
CCTCAGAAAATTGAAAAGGAAATTACCATATGGCTATTCCACTGCTTGGTATATACCTCC
AAAGAATTGAAAGCAGGGAGTTGATGTATATCTGTACACCAATGTTCATAGCAGTATTAT
TCACAATAATCAAAAGGTGGAAGCAACCCAAGCCCTCATTAACAGATGAAATAAAATGTG
GTTTATACATCCAATAGGATGTTATTTATCTGTGGAAAGAAATGAAATTCTGACAGATGC
TACAATATGGATGAATCTTGAAGACATCATGCTGAGTGAAATAAAACATGCACAAAAAGA
TAAATATTGTATGATCTCAGGTGTGTGAAACACCTAGAAGTAGCAAACTTTACAGACACA
GATAGTAGTTTTATGGGTTACCAGGCCTGGTGGCGGAGGGATGGGGCAGGAAGAGAGAGT
TATAGCTTAATGGGAGAAGCGTTTCTGTTTGAGGTGGGATAATGGGTATTCATGATGGTA
GCACAATACTGTGAATGTAATTTCAAACTACTGAAATATACACTTAAATGGAGTTAAATG
GGTATTTTGTTACTATAATAAAAAGTTTATTAAAAAACATTAGAAAGGAAAAATTTTCTA
AAATTAGCAATCAAAGCTTCCATTGTAGAAGCTAGAGGGGCTTCAGGTTGATCAAAACGG
CAGGATAAGCTTTTGCCTCAGTCTCGAGCTCTAGCTGGCAGCCAAGGGGTGCACTCCAGG
ATCTTCAGAAGCTGCGGCCGCCATCGACATTGTTTGGGTTCCTCTGGGCTCATCTGCGCC
ACTCGTCAGCCCCACACTCCGACGTCATAAGCCGTCATCATGATGAAGCTCGCGAAGGCT
GGTAAAAACCAGGGTGACCCCAAGAAAATGGCTCCTCCCCCAAAGGAGGTAGAAGAAGAT
AGTGATGATGAGGAAATGTCAGAAGATGAAGATGACAGCAGTGGAGAAGAGATTGTCATC
CCTCAGAAAAAAAGGCAAGAAGGCCATGACAGCTCCAGCCAAGAAGGTGGTTTCCCCAAC
AAAAAAGGCTGCCATTGCCACACCTGCCAAGAAAGCAGCTGTCACCCCTGGCAAAAAAGC
AGCAGCTGTACCTGTCAAGAAGATGGCTACACCAGCCAAAGCAGAAGCAACACCTGGCAA
GAAGGGAGCCATCCTGGCAAGGCAGCTGTAGTGGCAACCTCTGGTAAGAAGGGAGTTGTG
GCCCCAGCCAAGGGGGCAAAGAATGGCAAGAATGCTAATAAGGATGACAGCAATGAGGAA
GAGGATGAAGATAGTGAGGAAAGGGATGACAATGAGGATGAGGATGAATTTGAGCCAGCA
GTGATGAAAGCAGCAGTTACTGCTTCTGCCTCAGAGGATGAGGATGATGACAAGGATGAA
GATGACGACAACGATGATGAGGAAGACGATGATGACGACAAAGATGACTCTGAAGAAGAA
GCTATGGAGACTACACCAGCCAAAGGGAAGAAAGTTCCTGCAAAAGCTGTTCCTGTGAAA
GCCAAGAGCATGGCTGAGGATGAGGAAGATGATGAGGATGATGATGACAATGAAGAGGAG
GAGGAGGAAGAGGAAGAAGAGCCTGTCAAAGAAGCACCTGGAGAACGAAAGAAGGAGATG
TCTAAACAGAAAGCAGTGCCTGAAGCCAAGAAACAGAAAGTAGAAGCATTAGAAACTACA
GCTTTCAATTTATTTGTCGGAAATCTGAACTTCAACAAATCTGCTACTGAATTAAAAACG
GGGATGAATGACCTTTTTGCTAAAAATGATCTTGCTGTTGTGGACGTCAGAAATGGTGTG
TCTAGGAAGTTTGGCTACATGAATTTTGAATCTGCTGAAGACCTGGAAAAAGCCTTGGAG
CTCATGAGTTCAAAAAGTCTTTGGCAGTTGAATTAAATTAGAGAAACCAAAGTGAAAAGA
CAGTAAGAAAGATCGAGATGCCAGAACACTTTTGGCCAAAAATCTGCCTTACAAAGTCAC
TCAGGATGAACTAAAAGAAGTGTCTGAAGATGCTGTGGAAATCAGATTAGTCAGCAAGGA
TGGGAAGAGTAAAGGGTATGCTTACTAACAAAAGTTGTAAAACTTATCTGTACTTCCTTG
ATTTGAGGAGAATGTCAGCTCAACTTTTCTTCTCAATTGCAGGATTGCTTATATTGAATT
TAAGACAGAAGCTGATGCAGAAAAAAACTTGGAAGAAAAGCAGGGAACAGAGATTGATGG
GCGATCCATTTCTCTGTACTACACGGGAGAGAAAGGGCAAAGCCAAAGTCAAGACTTTAG
AGGTGGAAAGAACAGCACTTGGAGTGGTAAGACTATCGGCTTCTACAAGGTTTTGGAATT
GGACACAGATTCCAATTCCTTTGGGACTTGGTACTTTATAACGACTCATTAATTAGATAT
AGCTGAAGATCAAGCAGGGTGTAGCTAAATTTGTAGTAATTCCATCATTTGAGTGAGAAT
TGTGAAGTCATTTTGCATTGGAATGTACTTGTGAAATCTGACTTGAAATGAATTGATCCA
CATGGGTTTTATAGTTGTGATATTCTAGGGAGACAAACTGTAGTCTGCTTCTTACATAAG
AACGTGAACGGGAGAAAGGCCATATATATGTTAAAGGGATTCAGTTTGTTAAGTAACAGG
AGGTGTTCTTGAATAAGTTATCAGCCATGACTGAAGTTGGAACCTGTTTCAGAGTGTTAA
GAATGGCATTTCTTTATAGGTGAATCAAAAACTCTGGTTTTAAACAACCTTTCCTACAAT
GCAACAGAAGAAACTCTTCAGGAAGTATTTGAAAAGGCAACTTCTATCAAGGTGCCCCAG
AACCAAAATGGCAAATCTAAAGGGTAAAAAATTAACATAGTATCAATTATGAGCCATAAA
TTAGGGGAATGGCTTGCATGGGTCAAAAAAAAAACCAAGCTCTTTTCCTGGTCAACAGCA
GAAACAGAATGGTATGAAATATCTTAGTATCTACTTGGGCAAAAGTGCTTGGTGACATCC
AGTATGATGGGGGAGATACATACTTGATAACTTAGAATGCTAAGTATTTGACTTCATTCT
CAGGTATGCATTTATAGAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAATTCCTG
TAATAAAAGAGAAATTGAGGGCAGAGCGATCAGGCTGGAGTTGCAAGGGCCCAGGGGATC
ACCTAATGCAAGAAGCCGTAAGTTGCTGTTGTGATGATGTGACTGGGGGGTGGCACTCGC
TAGTACTCGCTGAAAGTTATTTTTTTTTCATGCTGGCATCTTTACATTCACCCCCAAACC
TAGAGGTAAATATTTTTCTGTTGCTCCTGAGTAAAAAATACTGGATATGATGACTGATTA
TCTGAGAAATAATTGATGAAATCACAAGAAATTCCTCTAGATAGTCAAGTTCTGATCCAG
GTATCTTCACATCAGAGCAGCACCTTGGCCTGTGACATGCTGCCCTGTGTGGTATTTGTT
GGGGCATTCTTCTCTTGTTGGGACTGTCCTGCTTTCCACAAAGTTCGAGATGGGATCGTA
ACCACTGCACCAGTGATTGTAGATAGTGCAAACTCTGGGTAGGTGTTAGTAGGAGTCCTT
TTCCTTAATTTAGCACTAGTTCTCTAGCTAAATTGCCATTTGCTGCTTTCTGGTATATGT
ATACTTTCTTGAAAAGCTGTTTTCAGCTAAGACAATTCTTGGCCTCTAGTGCTATACTAG
GCATTGTGCAGATTTGGTATCTGGTCAGTATGCATGATTTCAAATATGTGAGGTGTAATT
TTTGTTTTCTCCCCTCCCCCAGAGCCATCCAAAACCTTGTTTGTCAAAGGTCTATCTGAG
GACACCACTGAAGAGACATTGAAGGAGTCATTTGATGGCTCCATTCGTGCCAGGATAGTC
ACTGACCGGGAAACAGGATCTTCCAAAGGGTAAGGGATGGATGGTGCAGTGATGGCTCCC
AGCGTGGTAGGGTCTCCATTCTGTCTAGAGACGTGTCTTCTCATTGAGCTCCTTTCTGTC
AGTTGGTGGCAGTTTATGGATTCGCACGAGAAGAAGAGACAATCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTATCAAGGTGCCCCAGAACCAAAAATGGCAAATCTAATGGGTATGCATTTATAGAATT
TGCCTCATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGAGAAATTGAGGG
CAGAGCAATCAGGCTGGAGTTGCAAGGACCCAAGGGATCACCTAATGCAAGAAGCCAGCC
ATCCAAAACCTTGTTTGCCAAGGGTCTATCTGAGGACACCACTGAAGAGACACTGAAGGA
GTCATTTGATGGCTCCATTCGTGCCAGGATAGTCACTGACCGGGAAACAGGATCTTCCAA
AGGGTTTGGTTTTGTAGACTTCAACAGTGAGGAAGGTGCCAAAGCTGCCAAGGAGGCCAT
AGAAGATGGTGAAATTGATGGAAACAAAGTTACTTTGGACTGGGTCAAGCCTAAAGGTGA
AGTGTCTTTGGGGGTCGTGGAGGAGGCAGAGGAGGATTTGGAGCCCAAGGTGGTGGCAGA
GGAGGCCGAGGTAGATTTGGTGGTAGCAGAGGCCGAGGAGGTTTTGGAGGGCGAGGAGGC
TTCCGAGGAGGTAGAGGAGGAGGAGACCACAAGCCACAAGGAAAGAAGATGAAGTCTGAA
TAGTTTCTTCTGTCCCTGTCTATCCCTCTTCCGTTTGAAAGAAAGGACTCTGGAGTTTTT
ACTCTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACAGTCC
TGTGGTCTACTTGGAAATCTGTAGAGATAACATTTCAAGGGAGATGCCCTGTTGGTTTTG
ACTGGATATTCATATAAACTTTTTAAAGAGATGAGTGATAGAGCTAACCCTTATCTGTAA
GTTTTGGATTTATATTAAGTTTCATTCCATGTACAAAACCATTTTTTTCCTATGAATAGT
TTTTTTGCGTTGGGGAGTATAAAGGAAAGCAGAATGTTTTATCATGATTTTTGCTTCAGT
GACTTTGGGACAAATTAAAAGTCCTAAACTCTGAAAAAAAAAAAAAGAAAAGGCAGGATA
AGATGCTCCGGGGTGAAGTTGCCATAGAAGCTTTGAACATCTACCAAAAACTGGCAGAGC
CATCTTCCTTAAAACTCTGTAAAGCAGTTAAAGGGTTGTGGTAACTGGGGGAGTGCCAAA
TAGAGAAAACACACCTTTAAGATGGCAGGAGAAATTTGTGCTCTCTTCAACAGCAGACTG
GATTTGGCAGAAGAAAGAATCAGTGAACTCAAAGATAAGACCATTGAAATGATTTAAACT
GAGGAACAGAAAGATAAAAGAAAGAAAATAAGTGAATAGAACCTAGGAGATCTATGGCCC
ACCATCAAGCATTCCAATATGCACATTATGGAAGACCCAGAAGAAGAAAGAAAAGAGAGA
GGGGCAGAAGGAAATTCCTAAGAAATACTGGCATAAAACTTCCCAAATATAATGAAAGAC
ATGAATATGCACATTCAAGAAGCCCAATGAACTGCAAACAAGATAAACTTGAAGAACATT
ATGCTCAGGCACATAGTAGCTAAACTGTTGGATACAACGGAAGAGAGTTCTGAAAGCTGC
AGGAAAAAACAACAAGTTATGTAAAAGGGAACCCCAATAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2018..2131, 3227..3701, 4074..4277, 4381..4467, 4658..4794, 10026..10090, 10092..10107, 10111..10131, 10135..10274, 10362..10525, 10939..11062, 11283..11416, 12022..12148, 13563..13680, 13683..13862
1001..1018, 2018..2131, 3227..3701, 4074..4277, 4381..4467, 4658..4794, 10026..10090, 10092..10107, 10111..10131, 10135..10274, 10362..10525, 10939..11062, 11283..11416, 12022..12148, 13563..13680, 13683..13859
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved