Dasypus_novemcinctus Locus TBRG4
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus TBRG4
Dasypus_novemcinctus
TBRG4
GeneScaffold_3431
SNORA5, SNORA5
5016..5151, 5580..5711
11156
AATTCAGTTCTGTGTCAAAGAAGGGAGGCCTAAGTTACCATTTTATTGTTCCCCTGGCA
TTTGACTTACCTAGGTCATTTAATCACGTTAGAGGACAAGGTGGCGGGTTAAACTATTAA
AAGCAGCATCATAGGAATGTGTAACAAATATGGATTAAGAGGAAAGAATCCGGGGAGGCT
AATTGGAGAAAGTAATATTTTGTCCGGTGTCCAGAAGATAAAGGGTGTTCGCTGGGTTTT
TATGGTGGGTGGAACCCAGCAGTCAACACGTGCTGTAAAGGTGTAATAAAATGAAGTGCC
AGGCCTGTTTAGGTTGAGAAAAAGGAAGAGGGGATAAAATTGGGAAGATCGTTCTAGAAA
AGCCTTTTATAATTGAGGAATTGTGTTCTTAGGAGTTTGTTTTTTAGTAAACTGGTAATG
TAATCTAGCTTAGATTTTGGGACATTTACTCTTACGTCTTTAAGTACTAAAATATACCTA
CAGAAGCAGTGAAAATACAAATTATGTCATGGGATCAGCCAGTCTTAGAATATCTTGTTT
TACTGTCTCCGTAAACCAAGGATTCTTAATCCCAGTTGCCCTTGAAATAAAGAATTGAAT
AGCTATAGAGATTCTCATTCATTATGTCTTGGATGGGTGAAGTCTTGGATTATAAATTTT
TGAGCCACTCTCTAGGTCAGTTTGAAACATCCATATTAAAAACCTTCTAACTCAAGCTAT
AATGCTTCTGAGTTTGGATATTTCATTGTGCTCTGTGCTGCTACAAAAATTCTCTAGGGT
TTTTGGTTCAGAAAATCCTGCTACCTTCCTGCCTGTGGGTAATCAAAAAGAGATTCTGGA
TGGTTTTGCAGAGAGAGTACTTGTGACTGCCTTTCATTTGCCGTGTTACTCTCCTTTAGT
TTGTGAGTCCAGAATTGCCCCTGTACCCCCACCCTTGTTTTTCTCTGCAGGGCTTTAGAA
TCATTTGCTAGGAGCCAGGCCTCCCTGCCACCAGGGCCACCATGGCAGCTCGCCTGGTGA
AGCAATGCACACGCCTCCTGAAAGAAGCTGCCCGTCTCACCCCTGCCTCCTCTCCAGTGG
GCCAGCTGAGACTTGCCAGGGTAGCCCGCAGGACTCTGACTTCCAGTTCCCACTTCCCAG
CTTCCTTGAACCCTGTGGAGAAGGAGCCAGTGTTTACTCCCTACCCAGAGCCCCAGGAAG
TGGACCAGCTCATTGAAAAAGCCACCAGTCCAGAGGAGCTACTAGAACTGGTTGGTGGTA
GTCACTGCTTGCACCAGAATCATGCTGTCCTCATCCTCATCCAGTTATCTCGCCTGCTGT
CTGAGAAGCCTGGAGACAAAGTCTCTTTGATACAGGATGTCCGCTTTCAGCAACTTCTCC
ATCTTGTCAACAGTCAGGTGGGTTCTAAGGTATTGTCTGAGGAACACTCAGAGGTCCTGA
AGTCCAAAGCAGCCAGTCACTGATGGGGGCTTTGTTTTATGCTTAGTGGTCCCTCAGTGT
CTTGTAATATTTTTCTTTAATATATTATAGGTTTTGTGGTGCTTTCAATCCTTGCAACAG
CCCTGTTAGGTAAATATTGCTCTTCCCATTTTACAGACCAAAAAAAAGACAAGACTTAGA
AAAAATTAAACAGTAACTAGAAGCACCAGGAAGCACACCTGGTTCTTCTGGTTCATTCAG
TGCTTTTCCCCCTCAGCATAGTTGACTTGGAAAGTAATAGAAGGTCTTGCGCTTAGGTTT
GAAAAAAATCCCTGTGCGTAGAATGTGAAAAATATATATATCAGCAGATGTCTACAACAA
GGATTAACAGGAGAAGGAAGTGTGACTTTCTTGACTCATATTGCTCCCCCTCAAATATTT
GGTGGAGGGCTGGGTACCACACTTGAAGCTGGAATGACTGGAGGATCCCTGAAATGAGAG
CCGCAGATTCTTGAAGGCTGAACATGAAGAAAAGAGATAAGATCTGTTTTGTGGCCTTGG
GGGGCAGAGCTAGTACCACCAAAAAACCAGTTGCTGCTCAGAGTGAGGAAGGATTCCCTT
CAGGCATGTTCTTTCCCTGGGCTCCATTGGTTTTGCTGGCCTGCACAGGAGTCTGGCACA
AAAAGGAATTGCAGAGCCCTGCTCTGGCAGAGTTGGCCTTCTCTCCATGTAGAGGAGGGG
AAGTGGTGAGTTTCCTGTCCCTAGAGGCGCTCAAGCACTGAAACCACCTGTCCCTTTGTT
GGGGGCTGCTCTAAACCAGCATCCTTCAAACTGCAGGTTATAGAGTCTAGTGGGATATGA
TCATCTTTATTTGTAATGGAATAGAGTTATACAGAAAATGTTAGAATTTGCCATGTGCAG
TGAAGGTGAGTACTGTCACATGGGACTTTTTTTTGTTAAATCTTTATAGGTACATGCTTG
CGTGTATGCATGTACTAGGGTCATAGTACAAATGTGTTTCTTCCTGAGAATCTAGGTTTA
AAAAATGGCCTTAATTAGGTCCCTTTTTGTTCAAAGGCTATAGCTCTACTTGTTACTTAT
TGAATATTTTATATATGCACATAGCTGTAGTGGAAGCAACTTTTATAAAACAAGATTAAA
CTCTGTAGCAAAGTTGCAAGCCGATTATAAACTGGGGAAAAAAGTATTTGCAATGTAAGT
AATGTCCAGGCTTTCTTTTAAAGTCTTTCTGCTGTCCTGGAAACTACAGAGATCCAGGCA
CCCTCGAGTCTGCGGTGATACTGAGATGGGTCAAATTGATCACTTTTCTCCTTCCTCCCC
AGCCCTTAAAACTAAGACTTTGCTGCTATAGTTCTCTTTGTGTGTATTCCAGTTCTTTCT
CTCTGTGGTAGTTGCGTTTCACTGGTGAAGAAACAGGCTGAGGTATTAGGAGACATAAGC
AGTGGCAGCTAAGAATCACCGCACGACAGAGCCATGCGGCAACTGAGATGTTGCAATTCC
AGCTCTGGAGCCCATTTTACCAGGAGGGTTGGGTCTGGGCCAGGTGGCCTTGGGTGGCTG
TTGCTGTCACGGGCCTGTAATTCTCTGCAGCCTGCAGACATTTCTCCCTGCAGGTAATGG
CAGGGTCACCCTTTTCAGAAACTGGGCAGGAACTGGAGGAGGAGCAGTGCAGAGAGGACC
CGGCCCTGGTTTTGGACTGCCTGGGTACAGTTTGGCTCTGCCCCTTACACCTGGCTTTTG
GGGAAATGACTTAACCTTGCTAAGCCTTAGATTCTTTATATGTGAAATGGGAGTGGTAAA
CCATGGGATGATGGCATGCAATACATGTAATGTTTAGTGAAATGCTTGCCATTTAGTAGG
AACCCATTTAGAGGGAGAGGGTATGTGGAAACTGCTATCTGCATGAGTTTTATGTAAAAC
CGCAATGACTCTAAAAATTTATTTTTAAATAAGGCCCATTTAGAAGAGGTAGTAGTGGTA
ATTAGCCATTAGGCTCACACCCATAATGGCTTGGGGCTGGGGATGGTCAAGAGTTAGTTC
TTTTTTGCCTTCCTGTAAATACCCACATGTTCTTTCACCACCATCTGCAGGCGTGCTGTC
TTCACCCCCCTCAGCACAGGGAGTTCACTGGCGCTGGCCCTCGGCGCTCAGGTTCACTGT
CCAGGGTATGGTCTGTTGTGTGTTCAAGCAACAGTTGTATTCCTAAGAAACCTCATGTTG
CCGGAAAATGTTATTTGTTGGGAAAAAGTATGTCTTGGGGGACAAAAAATACAGGTCATT
GCAATTATGAGCAGTAAGTAGATTGCCCAAACTGACCTTACACTTTGTTCACACCCCCGT
CAGTTTCATTCTTTTCTCTGACCTTTGGTCTCGACTTCAGTTTGGCTTACAGCACAGGTC
TGTGAGTACAAGATCAGTCAGAAGCACGACCTCTGCGCACAGCTGCAGGGGGTGACTGCT
GTTCAGCCACATTGGGTCAAGAGAAACGAGAATTTCTCTTCTTCAGAGTTCTTGGTTCTA
AGCAGGAGCAAACCACTTTGGCTAACTTGAACAGAACTCTGATTGACCACAGGCTGGAGA
GCCAGGCTCAGAAAACAGGCTGTGAGGATGAGTCCTTCCTCGGGAGCAGCCTGGCACCGG
GCCCTGCTAGGAAGGCCTGCATTAGAGTAGCAGAGTGGAGGGACTAATTTGGTCCTCTTA
TAAGCCAGAGGCAGCTCCTGGCGCAGACACACAGCCTGCCGCCTGATGAAACAGAACTGG
CGCAGTCACACACGTGACCCATGCCCCGGCCCTTCCCTCTTCCAGTTAACCTTGGTCTGG
CACGGGAACCTCGTGCAGCTGCTCAGGAGCCTCTATGTGCTGGCACTGCCCCAGACCTCC
CATGAGCTGCGGTCGGTGGAGCAGGAAGTCCGCTGGCGTCTGCGGAGGCTGAAGTACAAG
CACCTAGCCTTCCTGGCCGAGACCAGTGCCGCCTGCATGCAGGAGCGGGGCTCTGGGGAC
CTGCTGGCCGAGCTGGTGGTCCAGCTGGACAGGCGCTGGGCAGAAATCGAAGACAGCCGC
ACCCTGATAGCCCTCATGGTGAAAGTGGGGCACCTCTCTGAGTCACTCATGAACCATCTA
GAAGACAGGTACTGGACGGTGAGCAGTGGGTGCCTGGGCCACGGGAGCTCTGGACCTCCT
GGGTGACGAGCCTCTGGGACGGGACCCACGAGGGCTCCAGGAAGCAGGCGGTTGTGCTCA
CACTCTGGTCACAGTTCAGGGACAGGCATGCCCACCTCCCTCTCCTGGGAGCAACAGGAG
CCCTGGGTGCAGGCCCTGGAGGCTTCCTCTCTGAGGAACTCTGTTCCTTGTAGCCTTCCC
TTGATAGTGACTCCTAGTAGAGGATGGATTTATCCTTCTAAAATCTCTCCATGCTTCTAC
CCTAGTTTGACCCTCCCAACAACCTTGAGGGGTGGGCATGGCAGGCAGATCCTGAAATAA
CACAAAAAGTCATTGGCTGGACCTGGGCTTGCTTGGGTTCCAGTTAGAATCCTTTCCTAA
AAGTCTTGTGCCTCCCCTTCCCTCAGTGTGAGCCCCTGCAGTCAAGTCAAATTCAGCCCC
TGTTCCTCCTGTAGTGGGGGCTGGCCCAGATGACTGCCACAGCAAGCTCTGCAGCTCATG
GGCCCTGGGTCCTCTGTGCTGGGCCTGGGGATAAGTTTGGCTGCAGACACCACATGCTCC
ACGGGTGGGGGTCCCAGGGCAGGGCAGGGAGAGGCCAGCCCTGTGCAGATGGGCCTGTGT
TTAGTGAGCTCAGGCCCAGTTGCTGTCTCGCAGGGGCTACACTGGATGGGACCCTTGCCC
CCTACTCTTCCCTGACACCTCAGGCCATCGGGCTGACACCCCACACGGCTGTGGTTGACA
GTGCCTGGAGTTGGTGGAGCACTTTGACATTGGCGAGCTGCGAAAGGTGCTTTTGGCGCT
GGCGGCGCTGAACCGGCGGTCTGTGCCCCTGCTGCGAGCCTTCTCCTACCACCTAGTCCA
GAAGCCCTTCCCCTTGGCAAAAGGCACCCTCTTGGACCTGGCCTATGCGTACGGTGAGCC
CCCTGGCAGGGTGCTGTGGGGCCAGGCGAGCTCTGGCCACGTGGGCCAGCATACCGAGCC
TGCAGCTGTGTCAAATTCGGTGCCTCTCCACCTGTGGCAGGCACCGGCCCAAAAGGCTGC
CACAGAAACACTGTAACACATGGGCCCTGTTCCTCTCCTGAGCCACAGGGATAAATTTTG
TTACAGACACCAAGTTTCTGGACCTCGAGCCGTGGGTCGGGTGGCTGGATGAGGGCGGGC
CTGCCACCCCTGCCAGTTAACGCCATGGTCTACTCTGTCCTAAAGGCAAACTCAACTTCC
ACCAGACCCAGGTGTTCCAGCGCCTGGCGGCCGACTTGCTGTCCCACCTGCCCAGCCTTA
CGCTCAGCGAGGTCGCCCAGTGCGCCAAGTCCTTTGCCTACCTCAAGTGGCTGAACCTGC
CCTTGTTTGAGGCCTTTGCCCAGGTGAGTGGGACCCCTCAGCCTGGGGGGCCCTGGGAGC
TGTAACAGCCTCCCCTGTGCCCAGTGTGGCCCTCGGCCCTTATCATTAGGGAAGTAAGAT
CAGCCTGAAAGTGCTCAGGCCTGGCAAACACATAGTCCTCTTTGTCAGTTAAGAAAGAGA
TGTAGCTCTGTAGTGGGAAGAAATGTTTTGATAGGTGTTCCCTCCATTACTCACTGAGCA
CCGTGCGTGTTTCCATCCTGGGCAGCCCTGGCAGGGAGCAGTAGCTGCCCCCTGGGGGAG
CCTGAAGCACCTAGCATGGCAGCACAGAAACCCTGAGACTGTTGCTCAGAGCTGACCCTA
AACCTCACTGCCCCGTGACAGCTGTGGAGAAGATGAGCCCTGTGTGTGCATTTACATGCT
CCTGGCCCAGTGGAGAGTTACTGGTTAAAGAGGGTTTCAGAGACAGGCATTTTCTGGACT
CCCTAAGGGCAGCGACGCCTGGTGCTTTGCGTGCAGTGCTTGTTGGGGTAGGGGTCTGCC
TGGAGGGAGGGTCTGGGCTCTGCACAGCTTCTGCTCCCCTTTCTGGGAGGCCACTGGCCC
CTATCGCTGAGCCTGGCCCTCCCACGGCCTACCCAACCTGGAGCCAGGTGGGGGCTCTTG
CTGTCCCCAGGGGTCGGGAGGACATTGTGTTGGGCAGAGCATATGTGCAGCAGAGCACGT
GTGCAGCCGTGCCCCTCACTCCGGCGCCTCCCCCGCCTCTGGCCACAGCACATCCTGGAC
AGAGCCGAGGGCGTCCCCCTGTCTCACCTGTGCAACGTTGTCCTGGCCTTTGCCCGCCTG
AACTTCCATCCACAGCAGGAGGAGTTCTTCAGCCTGGTACTGTCTCTCCTCTTCCTTGCT
TTTCCAGCCAGTTAGGAGCAGCTGGAGGGGTGGAGGGAAGGCCAGTCCAGACAGCCATAG
AAACCCAGGCTGATGGCAGCGGGGGCCATGCGGGGTGGGGGGTGCCGCAGGGGTTGGCAC
AGCAGTCAGGCCTGGAGGGCTTCTGTCGTGACCTGGTGCTCACACACCCTGGTGGCTGCT
GCCAGACCTGCTGGGAAGACCTCGCAGTGGAGTGTGGGCCAGTTCGCTGGCTGAGAGCTC
CTAACAAAGGTCTCGGGCTCCCTTGGGGTGGCAGGCCCTGGCAGGATGCATCTGACCCCA
CGCCTGCCTTTCTGCCCTGGCCAGCACTTGTCACCGGCCCCTCCCTCGTCCCAGGTGCCC
GTTTAGGGGAAAGTATTGGAGACGTGGCTTGGTGGGACAGACCTCTGTAGGAGAGCCCTA
GCTAAAGGCCAGCGTTGGCACCGCGTTGATGCTGTCTGGACCGGGAAGGGAGTGGCTCCT
GGCGCTCTCACCCAAGGTGATCCTGGCCAGGGCCCTGGCTCCCTCCTAGCCAGCTTCCAG
CCTCTGGCCTCACTGTAAATGGGGTGGTGAGACAGCCTGGGCTTTCTCCACCCACCCCAT
CCCTGTCTGTAGGTGCACAGGAAGCTGGCAGCGGGGCTGGCAGGCCTACCCCCAGCTCTC
CAGGTGGACGTCGTGTGGTCTCTGTGTGTGCTGCAGCAGGTGCAGGGCGCACAGCTGCAA
GCCGTCCTCTGCCCCAAGTTTCACACCCAGCTTCTAGGTGAGTGGTAGCAGGGGCCGTGT
TTGAGAGCTTGAGGCCATCCCCCTTTCTCCCTCCTCTTGTGACAGGGGTCTCGTGCCTGT
GCCTCCTCCCCTCTCCCCAGAACTGCTGTAGCCAGGCCATCTGCCTGGTTCTCTCTGCCC
AGACCCCAGCAAGCAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGCGGGGGCCCCTCCAGCCCC
ACTGCACTCCCATGCCATGCCGGTCCCCACGCCCTTCCCCAGACGCCGAAGTGCTGCTGG
ACGCTGAAGGCCAGTTCCTGGCCCCACGGGACTTCGTCGCCCCTCATCTCACGCAGCCAG
CCGGGAACCAGCCGCTGCCCCCTGGGGCCAAGAGGTAGGGTGTCCCTGGGGGCTGCACAC
ACATGCCTCGCGTCTTACACTTTCCCTGCCGCTTCTTCGAGGGCCAGGGAAAGCAAACGG
GTGTCACCCCTGCCTCTCTCGCCCTCCCAGGCTAGCTTTCCTGCGCTGGGAGTTCCCCAA
CTTCAGTAGCCGGAGCAAGGACCTGCTGGGTCGCTTTGTCCTGGCTCGGCGCCACGTGCA
GGCTGCCGGCTTCCTGGTGGTGGATGTGAGTACCTGGTGTGGGGGTGGTCCAGGCTGGCG
GGCAGTGACCACAGCAGGGAGAAGCCCCCCTTCCCACAGAGGGGCAAAGCCAGATGCAGA
GCCAGGAGGACGCAGCCCTGTGCACAGCCAGGGATACTGGCTAATGCCGTAGTGGGGCTT
CAAGTCCAGCGCTTCTTTTTCCATATCCAGGGTGCTTTTCTTGGAAAAGGTAAGACTGGC
CAGGTGCCCAAGCTTCGTGCCACTGCCTTGGGGTCCTCAGAGCTCTGGGCTGGTAGTCAG
CCTCTGGTTTGTGTCCATCCCAACTAATGAGCTGGAGACCTTAGACCATCACTGCCTCCT
CTTTGGCCACTTCCAGAGGTTGGCACTTTTCTCTAAAGGGCCAGATGGTCCCTATGACGT
TTTTTCTACCTTTTTTTTCTGGTGTTTTTTTAATATAGTCCTAAAATTGGAGAACCATTC
TCTGACTGTGCAGATTGCTGGTCCTCAGGCCCCTTCCGGCACTGGCAAAACCAGGGTCTC
TTCCCCACCTCCCCATAGTGCCTGCAGCTGGCAGTCTTCTTCCTTAGAACTGGCAGGGCT
GTGGCGTGCAGGAGCTTCTGGCCAGTGACCTGGCGAGCATTGAGGGGTCTTCGCCCATCG
GGTGAGGACAGCAAGCAGAGCCCACAAGCAGCCAGGAGCGGGGTCAGAGGGGAGGCGGCC
CGGCCCGCCGTGACCTGCCCACTGCTTCCTGCCAGGTTCCTTATTACGAGTGGCTAGAAC
GCAAGTCTGAGTGGCAGAAAGGTGCCTACCTGAAGGACAAGATGCGCAAAGCTGTGGCAG
AGGAACTGGCCAAGTGATCCTGTCCCCTCAGCATGGACTGCATGCCTGGCCACCCCCTGG
GTGGGAGTGAGGACGAGGTATCAGTACGCACTTCAGGACGGACCTTCTCAGCACCGGGCC
TCAGCCAGAGGTGGGGGTGGTAACCAACTGCCCTGAGTGGCGTTTCCTCCCGTGGATAAT
AAATCTGTAATCTCGGGGTTCAGCCCTGAGAGGCTTCCAGGTGTGGTCACAGTCTCCTGT
TTGATCTTGCACCTGCCTGTGTTGGAGGCTCTGTCCTGCAAGTCCAGGCAAGGCTTGGGA
CATAGGCCAGCTCTACAGCTGGACACCCAGGCTCAGCCCAGGCCGCTTCCTGACTCCCAG
GTCACTCCGGCTGCCTGCCTATCTCCCTGCTCCCCACTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1396, 4245..4565, 5341..5512, 5805..5962, 6708..6815, 7452..7596, 8214..8459, 8982..9093, 9210..9324, 10055..10156
1001..1396, 4245..4565, 5341..5512, 5805..5962, 6708..6815, 7452..7596, 8214..8459, 8982..9093, 9210..9324, 10055..10153
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved