Dasypus_novemcinctus Locus C8orf53
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus C8orf53
Dasypus_novemcinctus
C8orf53
GeneScaffold_4300
SNORA51
5622..5752
12420
GAAGTGGATACTTGGCAATTAGCCACTGGAAATTAAAAATGTTCTGACTCAAGCTAGCC
CCCTAAAAATTATCTAACCTCTGGGAGCTGATGTAGCTCANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAGAGAAGTTCTTGGGTTCCGGTGA
TAATTCTGACACTAACGAACCATATGCCCTCACTTGCTAAAATTCTTGAAGGGAACGCAA
CCAGTACAAGCCCATGCAGTCCTGGTTGTCCAATATATATGCCAGCCCCTTTCATTCCTT
CTCTTGGGAATTATAAACATTAAAAGGAATAATGTACGATAAATCACCCAGGACTGCCTG
GAACACATTAAGGCTCGATATTATTATTTCTTGGTACTGAGAGTCCAGTCTTGAGAGCCT
GGTCCCGCGCTACACAGGTCACGCACACTTCTTCCCTCTGACCCAAAACTGCTCCTGTGC
GATCCTTAGCAGAGCAGCTCGCACCAGAGGTTTCCCAGCCAGGACAGAAGCTCCGCCTTA
AGGGCTCGCCCCTTACGCGCGGGCACCACGAGTGAACCGCGTGCTCGCCCGGCGTGACGT
CAATGGGAGGGGCCCCGGCAGATCCAAGAGCTGGAGGCGTTTGCTTCCGGGTCTAAATAT
GCTTCACTTCCGGGAGCAGCAGGCATAACCGATAGTCAGCGGCGAGCGAGTTCTTTGCCG
CTGCTTCCTGATCCAGCCGCCTCGGTCCCTGTAAACCAGGCATGAAGATCACAAGGCAAA
AACACGCCAAGAAGCATCTCGGCTTCTTCCGCAACAATTTTGGAGTCCGGGAGCCATACC
AGATACTGCTGGACGGCACTTTCTGTCAGGCGGCGCTGCGGGGCCGTATCCAGCTGCGGG
AGCAGCTGCCCCGCTACCTCATGGGGGAGACGCAGCTGTGCACCACCAGGTAGGCCCAGT
TGGGGCTGGAGGGGAGGGGCGGGGCCGGGCAGGTGTGGTTAAGACCAGGGTCTACCACAC
TCAGCAAACGCTGCGAGCCCACGTGGAGCAGAGCGCCCCGCCGGCGGCGAGCTGACCGTT
GTGTGGAAGCGCAAAGGGGATCCTGAAAGTATTTACGTGTAGTTAGCTGGGCGAGTAAGA
ACACGTGCCTTGTGTTCAGAAAGACCTGGCTTTGGATCCGGAAGCCAGTCCTGTCAGTTC
TGTGATTTTGTGCAAGTTATTTAACACAGTTAGTAACTATAAAATTGCTGTAAGGGTTAA
AAAAGGTATCGTGTATATAGAGGGTATATCAGTATTCAGAGTTAACACTCTTTAAATAGA
GGTTGTTTGCGTAACTTTTTCTGGTTTAACCCAAAGTTTTTCAAACCTTACAACTGCCTA
TGAGGTAGTATTTTCGATTCCTAGGATAAGACGTCAGGACTCAAGATTAAAGCAACTGTG
TTTCCAGCCATACGCCAAGCGCAGCTCTGGCCACTGAAGATAACTTCGTGAACTGGACAG
ACAAGCTCTTAGTCCTCACTGCCTGTGAAGTGCCTAAGTCAGTCTGTAATCCGTGTTATT
TGACTCCAGGACTGTTTTCTTGTGTCGTCAAAGTGTGGAAACACTTAGGATAGAACCTTG
AGCGAGAGAGGATGGACTCACTGGAGATTTCATAGAGGAGATAACATTTGAGCCCAGTCA
CATTCAATCCAGAGAACCACTAATGACAAAAAAACAAAGGCATTCCTTGTCTTGAGCAAA
GGAATAGGGTTGTGAAATGCTTTGGAACGAGGTTAGCACACAGAATATAGTTAGAAATGA
AGCTGGGAAGAAGGTAAATGAGGTTAGATCTTGAAGAACTACTGCTGAGAAATTTAGTAG
GGTTTTTTTCATTGTAGAATATTGACTTTTTAAGAAGTGAAAAAAAAAAGTGATTCAATT
CCACCACCTGGGATTAACCACCGTTTCATGGGCTGTGTGTTGCAATCCAATAGTGGACTT
TTACTGTGCATATTATGTTAATGGCCTGCTTTTCTCACATAATACTGCTGCATGAACAGC
TTGCCATATTTGTTCAGAGCTTCCCAAACAGTGTGCCTGGGCTACAGACATCTCCAAACT
TTTGATCCCCTTAGCCTTCAGAGCTTCCAGACATGTCCTTAGATGACCTGTGCCCACATT
GTTTCTGTACACCTAAGTTGCTTCTGGCTACACGTAGCTTGTCCACGTCCCCCTGTGTGC
CATAGAAATGTTAACATTATGTATTATGATATAAAAGAGGTTGAAAAGTACTGCATGAAA
TTATATTCTGCAACGTTTTTTTTCCTAAAGAACTCAATTCTTTCACCTTCAATAATCTTT
AAAACATACACAAAATGGTATAATGAAACAACTGTCACCCAGCTTTTGCAATAATCAACA
CGACCAATTGTTTCATCTTTTCTTCCCCTTATTGATGGGTTATTTTAAAGCATTTTCTGT
CATTTCTTTTGTATGCATCCTGAAAAGGTAAAGATGCCTTTTAAATTCAGGGTCCAAGCA
AGGTAAAAAAATCACATTTGGTTTCTATGTCTCTTAAGTCTTTTTTAACTCTAACAGATC
CCCTCTCCCCCCCTTTAAAATTTTTTTCTATAGAATGTCCTATGTTCAATATTTGGATAT
TGCAGCCCCTTGAAGTCATTTAAGAAGTCTCTATTTCCAGACCATTGGTAGTTACATCTA
GAGGGCTTAAGCATATTGAGGTTTGAAGAAATTTGCTGTTTAATTTGAGGAAATAGAGCA
GCAAAATATTATCAGAACTGGGTTTTGTTTTTAAAAAGATAACTGCAGTACTATCCTGAA
AATGCCCCGTATTACACCTGTTTTCTCTCTCTGACCTTAGAACCTCCAGTGGCTACTGCC
TCCACATCAATGATATAATTTCTTCCATTGCTAGAATCACAATAAGTCTATAGTAGAATA
CCAGTTAGTACACGCTTATCAATAGTTTATTCCCCAATCCTGAGGATTCTGGGATGGTGA
TGCCCACTCCACCTCTAATTGAAAGGAGGCTTCAGTCCCATACGGCTGATGGATGGGACT
CTCTTGCTTGCAGTTGTAGACTCTTGGTTCCTGGTGTGGTGGTTGTCCAGCCTCACCTCC
TTGTTAGTTGTCCTGGGTGAGTCCAGTGAACTGGAGAGTAGGTGTTGTAACTCTGTTAAG
GCTCAGGGCCCAGCTGGGACATGAACAGATCAAGATTAAGTCTCTTGAATGTACATATAC
TGACTCAGTACCACCTAAGCCAGCACCATCTTGCTGGAACCCTTACTTAAAAAAAAAAAA
AAAGGGATATGATGCTTTTAGGATTTGTGAGATAACAGTGATAGCCATTAGTAGTGTTCT
GCAAAATTTTCATTCATCTTAGAAAAATATTTGTTGATATCTTCCTTGTGCCTTGTTTGT
TAGCTAAGGATTAATTGATGATCCTCAACATTACGATTTTTTTCTAAGCTATACTGTTTT
TTTATTTATGGTATAGTCATATATATCATTTTCTGATCTCATTCTTAAAGATACTTATTC
TTCCTGTTTGTAATTTAGGGCCTTCAATTTTGAAATAATGCTTATATACTTATATAGCAT
AGTGTTCTTTTTTTTTTTAACTTCAGAAATAACTTTATTTCATGTGCAAAAATGAACTGA
TGCTCTACCCCGAAACTATTTTCCAAAACCAACAGAGACTTTTGTAAAGAGACTAGCAAT
ACATTTTAAAAGGCACTAGGATTCCACTGCTAAATAGTGCCAAGCTGGAAATATAAAGCT
TGTTCTACCAGGAATCTGAAGTTGATAGAAATTAATAAAGTTCAGTGCCATTTCAGAAAA
AGATTATTCAACTCTTACCACATCAAAAACTAGCTATCAGAACCATACACTTAAACCAGG
TCAAAACAGTCTAACATAATTAGGTTTCAATCTAGAGTAGCCTAGTGTTTCTTTGGTATT
GGCAGAATGGGCTTTGATCCCTATTTCTTAAAATCAAGCATTTTGTAGATTCCCAGATTA
CATCCTATTGAATTTTATAGTAATATGGTATTGGAATTCTCAGGTATGTTTTGTTTGTTT
TTGAGGCAGCTCTAAATCTTTACCAACTGGTATATTTAATTATTGATTACTGAGTAAAAT
ATTGTTCATTTGCCTAATACATTCTATTTAGTCCATATCAATCAAAATATTTCAAACTTC
CTTTTTGAAATTGCTGTCCTGTAGAATCATTTAAAATGAGGAAACTGGGGAAAGAGAGGT
TAAATCCTGAGATCAAGGCCACACAGCTCACTGTAAAGTCTCCAACCCTTAAAACAGTGG
GAATGGGGATGTATAGAGACTTTGAAAATAATTTGTGATTTTTTTTTTTTTAAAGGAGGT
ACCAGAAACTGAACTGGGGCCTCCCATGTGAGAAACAGGAGCTCAATCAGTTGAGCCACA
TCCACTTACTCCCTGTGATTTTTTTTAAGTGACCTGTTGACTTGAGAATTTTTACATTTC
TTAACTGAAAATACTTTGAAAGTCTGTTGATTTTTACTTAAAGTGGAAGCATATTGCACT
ATGGTTAGGGGCAAGGGATCTGGTATCAAACTACATGGATTCATATTTCAACTTTTTTTT
TTAGTTTGAACTTGGGCATGTTACTTCAAATCTTTTAAAATGGGGGCCTCCAAAAAAAGG
ATAATTTTAAAGTAAGCTGCCTAACTTAAGAGGGTTGTTATGAGATTCAAGTGAGACTTA
TGTATAGAGTAAATTAGCATGCTGCCTGGAATGATATATGTGCTCAGTAAATTTTATCTA
TTATTACTTTTCTTTCTTCTTGGTGCATGCATTTTCCAGGTCTTCTCTTTTAAAATAATA
AAGGGGTATAAGGGACATGAGGTTTTTCCTTTTGGAGCAATGAAAATGTTCTAAAATTGA
TTGTCGTGTTGAATGTACAGCTCTGATTATACTGAGAGCCATAATTGTCCACTTTGGATA
ATTGTATAGTGTGTGAATATATCTTGGTAATACCACTGTAAAAAGTGAAATGTCAAATTT
AAAAGCTGATTTATGGCTCCTGTATGACAAATTCAGATTGTAAAAAAAAAAAAAAAGGAA
TATTGTTTTTTACTTGTTTTATGTAAATAACTGAAATGTATCTTATAATTGTGGGCCACT
AATGAATTTTTTTTTTCAGATGTGTTTTAAAGGAGTTGGAAACTCTGGGAAAGGACTTAT
ATGGGGCAAAATTGATTGCACAAAAATCCCAGGTTCGAAATTGTCCCCATTTCAAGAATT
CAGTGAGTGGATCAGAATGTCTGCTCTCCATGGTTGAAGAGGGAAATCCTCATCATTATT
TTGTGGCAACACAGGTAATACTACTTTTAAGATTACAAAGTAGGCCTCCTGGTGCTTACC
ACAGACTGTGTTCTTGCACTGACTGTATAGAAAAAGGAGGCAGAGTGAGCCTACCCCATA
CACACCTCAGCCCAGGCCTTGTGCCTGGTCTGAATTGTGAATGGGGGACATGGAAGAATT
CAGCAGTTCCCTACTGAAGACCAGAGCACTCAGCCTGCCGCTGAAGACTGGCTTGCAGCT
CCCAGTGCTCAGGCCACTGTGTGAGTGGTCCTGAGCTATTTATCCACAGTTCCAACAGGA
AGTAGAAATGAGGGTACTGGAAAATAAACATCAGTTTTTATAATTTAAAAAAAAGGATTA
CAAAGTAACTTCATTTCTATAATCAGAAAGAAATTAAAATTAGAAATTACAGACTAACGT
GTGATGAAAATGATTTAGGGTTCTTGAAGGAAAGTTGAGTAGAGCAAAGATTTTGCATTC
TATGTCATGAGTGTTTTTTCATGTTCATATATTTCATACTGTCTCAAAAAGGCATGGTTC
ATATGTTTAAGACCTCACCACTGACATAGAACTGTTCAGGCTTTTAAAGACTAAGCAGGA
GAAGAGACATTCTTTCAGATTTGATATTAAATAAGTTTGCATAACTAGAAGTTTATATAT
GCCCATCGTATCTACATTGTCCAGTTTTTTGGTGTACAGTTGTTCATAATATCCTCTTAA
GATCTCTTCTATTTCTTTGGGGTCAGTGGTGATTGTGCTCCCTCTCATTTTGATTTTATT
TATTTACTTCTTTTTTCCTTTGTCAGTCTAGCTAAGGGTTTGTTGATTTTGTTTATCTTC
TCAAAGAATCAACTTTTGGTTTTGTTTCTCTATTGTTTTTTTGTTCTCAATTTCATTTCT
GTTCTGATCTTTTTTTGTGTGTGTTTGGCTTCCATTTTATTTTATTTGTTTTGTTTTGTT
TTTATTCATTTTTTAAAAAATATTACATTCGAAAAAATATGAAGTCCCATTCAACCCCAC
CGCCCCCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACAACGATAATCTTTTA
ACTTATTCATATCATATTTACTGAAACTGATGTACAGACTTCGAAACAATAGCTTTCAAA
CAAGGTGACATCTGTGCTTACATTGTGGTCCTCTGTTCTGATCTTTAGTTTTCTTTCTTT
CAGCTTGGTTTGGGTTTGATTTACTATTCTTTTTCTCGTTCTTCCAGGTGTGCAGTGCAG
TTAGATCTTCAATTTTAGCTCTTCTTTTTTAATGTAAACATTGAGGGCTACAAATTTCCC
TCTCAGCACTGCCTGTACAATGTTCCATAGATGTGGGGGGTTTTTTTTAATCTTTTTTTT
TTTAATTTAAAGATACATAGATCACACAAAATGTTACATTAAAGTATGTAAGAGGTTCCC
CATACCCCTCTCCCCACACCCCCTACTCCTCCCACATTGACAACTTCTTTCATTAGTGTG
GTACATTCATTGCATTTGACAAGTACATTTTGGAGCACTGCTACACAGCATAGATTTTAG
TTTACATTGTAGTTACATTCTCTCCCCATCAATTCAGTGGGTTATGGCAGGAAATGTAAT
GTCTTGCATCTGTCCCTGCAGTATCATTCAGGACAACTCCAAGTCCCGAAAATGCCCCCG
TATCACACCTCCTTTTCCCTCTCCCTGCCTTCCGCAACTCCAGAGGTCACTGTCTACGTC
AATGATATAATTTCTTCCATTGCTAGAGTCACAATAATTCTATAGTAGAATACCAGTAAG
TCCACTTTAATCCATATTTTATTCCTCCATCCTGAGGACCCTGGGATGGCGATGCCCACT
TCACCTCTGAATTGAGAGGGGACTTAGATCCCACATGGCTGATGGATGGGATTTTCCTGA
TTGCAGTTGTAGACTCTTAGTTCCTTCCATAGGTTTTTATATGTTGTGTTCTCATATTAA
TTCATCTCAAGATATTTTCTGAATTCTCTTGCCATTTCTTCTTTGACCCACTGATTATTT
AAGAGCGTGTTGTTTAATCTCCATTTATCTGAGTTTTCCTTTTCCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAAAATGAAA
ACAAACAATCAAACAAACATAAAAGCCAACTTGGGGGCTGATGTGGCTCAGTGGTTGAAC
ACCAGTTTCCCACATACGGGGTCCTAGGTTCAAGCCCTGGTAAAAGTACTTTCTGAGAAG
CAGGAGGCAGAAGTATAATGAATTCTTTGGATATTTTTAAAGACTTTAAAATGTGAAAAA
TGTATTTAAAATTGTGGAAGTACTTATGTTAAAAGACTGAATTTATTTTTGTAAATGAAT
ATGGACCCATAAGCCTCTGCCTAAAATTATTTGTAAAATAAAGAGTGGATGTGTTTAGGT
GTGGGAATATTTACTTTTTTTACTTAGTGGTTTTGGGAGGTGGTTTTTCAATGTGAACTT
AGTGTGTCCTTTATTTTCCTCTGATAAAACAGTATATGCTAAAGCAGTCCCTCTTTCACA
TTCACAGAAGAAAACCTTTTTCCACTCTTCTAGTTGTAGAATTTACCTTTATATTTCCAT
ATAATATGAATACAGTGCTACTTATTGATCCATCCATTATCACTTGACTTCTTATTAAAA
AGAAAGGAAATGCTTGTACTCCTCCCTCCAATCTCCATATATATTAATATTTCAGTTTTT
ATACATCAGAAATTGAGTATTTTCATTACTGTGATTATAAATATTGTTCACTGCTGATCA
AGTTGCATGCCATGACTACATTTATTTTATATATATATATAAATTGTTCTTGAAGTTAAT
AATGGCCTAGTTTTCTTTAAGCATCTCACTGAATTTTGCCACATTCTCAAATAACTCTGG
GATGGACCTCAATTTAATTTCCCATATGGTCATACCTATCAGATAATATCAGGTCATTTT
TTTCCACTTGGAAGATGTTACTCCTGGAGCCCTCTGACATTCTCCAATATAGACAGATTT
TCTGTCCAGCAAGACACATAGCTGGAATAAGACATACTACCTCTTATTCTTATCCAGGGG
ATTTATTTTCGTCACTTGTATTTTCTAGATCCTCTGTTTTACTCTTTTTTTCTTTCTTTC
TTTTTTCCCCCTCTTTGTTATGGTAGAGCACAGCTAGTATTTTTGAGAAAGGCTATGCAG
GATGTACACTTCTTAAACCTCAATGTTTCTCTATCCTCGTATTTGTTGCACTGATCGTCT
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1188, 5419..5593, 11382..11414, 11418..11420
1001..1188, 5419..5593, 11382..11414
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved