Dasypus_novemcinctus Locus ENSDNOG00000007674
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000007674
Dasypus_novemcinctus
ENSDNOG00000007674
GeneScaffold_1716
SNORA19
12028..12155
45383
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTGGGGGGGG
GGGGATGCGGGGGCGGTGGCGTGAGATCCCAGGGATCGAATCCAGGACCTCATACATGTG
ATGCCTGTGCTCAACCACTGAGCGGCACCCACGCCTCACTTTCCTCGTTTTTGATACCCT
TGAGAGTTTTGAGTAGTATTGGGCAGGTATTTTGTGGAATGTCTCTCAGTTAGGATTTGT
CTAACATTTTTCTCATGAATGTACTGGGGTAAATAAATCAGGGGAACTGCGGAATAGAGA
GCCCAGAAATAGTCCCACACAAATACTGTCAACTGTTTTTAAAGAAGCAAAGGCAATCTG
GTATCTGTTTTTGCTTCAAGTCAGCAAGAAACTTGGAAAATTTTGTCAGATGTCAGGGGG
GCTATGAAATGATACTTGAGCTTTTCTAGATTTACAGGAGGAGACTCCCCCCCCCCCACA
ATTTTACTGGAACTTTTAAATCAGTTAGATTAGATTGATACAGTGGAATTGAGTAAAAAT
TCAGTTTTACCTGTAAACCATATTTTGAGATAGTACCAATCTTTGTTTTACTTGGATAAT
TATATCATAGCTTTAGAAGTAAAAAAAAAAGTGACCTAAAAAAAGATGGTAATGAGTTCA
GAAATTAAAAACAGTTTAAAAGATGGAAGTTTAGACTGTTATACTTATAACTGTTGTGTT
AAAAGTAACTGATTTTAATGTCCCTGAATTACTTTTCAGAATTTCTTGAGGTTGGCAAAA
AACAGCCTGCTTTGGACGTTCTTTATGATGTTATGAAAAGTAAAAAACATCGAACATGGC
AAAAGATACACGAGCCAATTATGTTGAAATACTTGGAACTCTGTGTGGATCTTCGCAAGA
GCCACTTGGCTAAGGAAGGATTGTACCAGTATAAGAATATTTGCCAACAGGTAAGAACAG
GAGGATTGGGTTTTATAGTTTTAATAATTACTTTTGTTAATTTTCAGGCAAGTTTACCTT
TCAAAATAATTATATTTTCTGTCATGGGATTCGCCTATTTTTTTTTTTTTTTAAGAAGTT
TTATTTATTTACCTACCCCCTCCCCCTCTTGTTTTGCACTCGTCTGCTCTCTGTGTGTCT
TCTTGTCTGTGGCATCGGGAAGTGATCCCGGGACCTTCCAGATTGGGAGAAAGGTGCTCA
ATCTCTTGCACCACCTCAGCTCCCTGGTCTGCTGCGTCTCTTATTGTCTCTCCTTTGTGT
CTCTTTCTGTTGCATCATCTTGCTGCTCCAGCTTCTTGCATGGACCACTACTCCATGTGG
GCCAGCAGTCCTCACCAGTTGGCACTCTGCATGGGCCTGCTCACCATGCAGGCCAACTTG
CTTCTCACCAGGAGGCCCCAGGAATCAAACCCTGGACCTTGAGCCACATCTGTTTCCCAG
GATTTGCTTTCTGTGGTTGCTCGGGAAAGTTTTTTTTTTTTTTTGAGGGTCCGGGGCTGG
GGGTTGAACCTGGGACCTCATGTGGGAAGCTGGTGCTCAACCACAGAGCCACATCAGCTC
CCCTGAGTTGGGTTTTTGGTTTGTTTGCTTTTTTTGGGCGGGGTGGGCGGGGGAAGCACT
GGGAACTAAACCTGGGGCCTCCCCATACGGGAAGTAGGCACTAAACCACTTGAGTCATGT
CCACTTCTGAAAAACACACACACACACACAAATATATATATTTTAAAAGATTTATTTATT
TCTCTCCCCAAACCCCCCATTGTCTGCTCTCTGTGTTCATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTGC
ATTTTAATGTCAGGGTGTACTTAGAGGTAGTTAAGACACGTGAAATGAGCAATGACTGAT
CACTTCTAAGAGTGACGAGTTTGGCAAATCCTGTTTAAAATAACTGATATTAATGTATAA
AATAAAATCTTTGAAATATTTAAGATGGTGATGGAAAGGATCTAATATCTTTTATAATTA
TGCTTGTAGCTTTCAAATTCTGCCTCCAATACACTCGTAAGGCTGAATTCCGTAAGCTGT
GTGACAATTTGAGAATGCACTTGTCACAGATTCAACGCCACCATAACCAAAGTACAGCGA
TCAATCTTAATAATCCAGAGAGCCAGTCCATGCATTTGGAAACAAGGCTTGTTCAGTTGG
ACAGTGCCATCAGCATGGAATTGTGGCAGGTATGTTGTAAATGGCTTTTCTCTTTAGAAT
AAAATCTGCTTTATTTAAATTCTTCATCTTTTTACATCATCAGTTCTGTACAGTGTATAG
TCAATGGACTGGTGCCGGCCGGTCTGTGAACTGTTTGTAACTGTGTAGTGTGTGATGAGA
TAAATGTAGTTGGAAAAAATAAGCACTTACAAAGTTTTTTTAGTACTTTCACAATAATTT
TATGTCTATTCAATAAAAATTAAAAGAAAACTTACCCTTTAGTATAGATTGTCTGAGCAG
CTCTGCACTAGATCATCTTCTAGATAGCTCAGTGTTGTTTTTCTTAGTACATGTGGATAC
TTAATATCATATGTGGGAGAGCACAGTAATTTTGGCATTCCTGACCTCTGCCTTGCCTTT
TTTTTTTAGGATTGATTTTTATTTATTTATTTATTTATATTTATTTATTTAATTCCCTTC
TCCCCCAGATGGTTCTCTTTTCTGTCTACTCATCATTTGCTTGCCCTTTACTGGAGGCAC
TGGGAACTGAACCCAGGACATCCCACACAGGAGGCGAGTGCCCTGTGGCCTGAGCCACAT
CCGCTCCCTGGGGCCTGTGGCATCAGCTAATTTAGGCATCTGCTTGTTGTTGTGGTCTCT
AGCTCATTGTGGTGGGTGCAGCATATACTTGTATTCTTTAGGAGGCATTGGGAGTCCATC
CTGGGACTTCCTGTGTGGTAGGCAGGCACCCAACTTGTTGAGCCACATCCTCTTCCCTCT
GCCTTGCTGATTTTCTCTAAGAATCCTTCAGAGACTATTCATATGATTTCATAGCCGTGT
AGCTTGAAGCTTTTATGTATTTGACAAAGAATATCTGATAGAAATATAGAGGAAGAAGCT
AAAAATTTGTATTTCTTTGGACCAGTGGAAACATGATTGATTTGATAGTCTCCCCTCCAT
AATATTTTCCTTCTCTGTAGTAAAATACTATCTTTTGAACTAAAGGGGAAAAAAAACCTT
TTGAACACAAGTAAACATGCTCTTTATAGAAAAAAATGGGTAAGTTAAAAGAAGAAACTA
TTCATCCATTATCTCAGCACTCATAAATAACCACTATATATTCTATTGTACGTTCTTGTT
TTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTAAAGATTTATTTATTTATTTA
ATTTCCCCCCCTCTCCTGGTTGTCTGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTT
GTCCGCTTCTGTTGTCGTCAGCGGTAGGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGC
TGCTCTTTCTTTTTCACGCTGGGCGGCTTTTCCTCACGGGCGCACTCCTTGCGCGTGGGG
CTCCCCCACGCGGGGGACACCCTTGCGTGGCACGGCACTCCTTGCACGCATCAGCACTGC
GCATGGCCAGCTCCACACGGGTCAAGGAGGCCTGGGGTTTGAACCGCGGACCTCCCATAT
GGTAGACGGACGCCCTAACCACTGGGCCAAAGTCCGTTTCCCTTGTTTTTTTTTTTTAAT
GTAAATCTTGCCCCCCAGTGTATGATGATGATATGTATCGGTTTTTTTTAGTTTTATCTT
ACAGTATTTCCTAAGACTTGAAAAAAGTTTGAAGATTTCATGTTTTTGTAGTAATGGCAA
TTTCCTGAAATAAATCATAAGTTATATGTACAGGTGGATTAAAAAAACACACCTGAAGAC
ATCTTATTGGCTATTCTTTTTAACTGTTTATATGTTAGGTTTCATAAAGAGATTTGATAA
GAAATTTTTGTTCAGAATGCAATGACTGCAATTTATACTACTAATTTTAGGAAGCTTTCA
AAGCTGTGGAAGACATTCATGGACTCTTCTCCTTGTCTAAAAAACCACCTAAACCTCAGT
TGATGGCAAATTACTATAACAAAGTCTCAACTGTGTTTTGGAAATCTGGAAATGCTCTTT
TTCATGCATCTACACTCCATCGACTTTACCACTTATCTAGAGAAATGAGGAAGAATCTTA
CTCAAGAAGAGATGCAAAGGTAAGAATGTTATATTCGGGTGGTATTGAAATAACAAGTAT
ACAAAATGTCATGGTAGTATGTTCTAGGTCAGGATTTTCTCACCCTTTGTGTTTTTTTAA
CGTTTTGGGTTGGATACTCTTTGTCGTGGAGGGCTATCCTGTGTATTGTATAGGATGTTT
AGCAGCATCCTGGTCTTTACCTACAGATGCCAATAGTACCTTTCCCCCAGTTGGGAAACC
AAATTTTGCTGCTTTTGGGCAGTAGCTGTCTTGTCTGATAAAAAAAATTCCAACTATTGA
AAGCCCAATTGACAAAACTGAATTTTAGGAAAGACATTGTTAAGACATAGGTTTCAGTCT
TCGTGAGTGTTTAGAGTCTATTCGTAGACCAAATTAGACAATTAAGAAGATAAATACTTT
TATCAAGTCACTTTTTTCTGGTTATAAAACAGTATTAAATATAGAATATTTGAGATACAA
ACACACTACATTAAAGAAAGATCTATAACCTAATATCAAAGGTTTTTTTTTTTTTTTTTT
TTTTTAGTAAGAACTGTTTAGCTCTTAAGGCATTTACTTTTCAGAAAATTAAGTATTTGC
CTGAGACCACAGTCTTGGAAATGCAGAAGTTGAGATTACAACCCTGCATTTTGGGGCTTT
AGAGCCCACAATCTTTAGTTTTCTACTGTGCTCTGAATTCAACCTTTCTTGTTTTTAAGG
GAAGCTATATGTTAGTCTGTCCCCATGTGCCTGCTTCCCCCCCCCCCCATAATGGTATTT
CATATGGTCCTTCTAATTTTTCTCCCTTTATTGCCTTTCCCCCCCCACAGTTTTAAGAAA
TGACTTGAGTATTTTTGTAAGGAAGTGTGGGATATATGAGTGTGCTTTGTCACTTATTTA
AACAATCTTTTTCTATAGCAAGAAAATGTTTACAGTAATAATTGAGTGGATTAAAAATAC
CTGGGAGCTGATATAGCTCAAGAGGTTGAGCACCTGCTTCCCATATATGAGGTCCCAGGT
TTGATTCTCAGTACCTCTTAAAAACAAACTGACAAGTGGAAAAAACAACTCTCATTAAGG
AGCAGGTATGGCTCAGTGGTTGAGCACTTGCCTCCCATGTATGAGGTCCTGGGTTCAATC
TCTGGTACCCCCTAAAAAAAGAAAATTCTTACTCTTTTTAAGTATTCATTTTAGCATTCA
CTTCCTTTAAACCACCATGCTATGATGGTATATATTATTTAAAAATGCTGTTGAATGGTC
CTGTGTATCTTCTGTCATGGCATATCTTGCTGCATGATTAAAGAGTTGCTTTTCTGCTTA
TCAGATAACATTTGAACATTTAATAGTTTGACTTTTTCTCCACAGGATGTCTACTAGAGT
CCTTTTGGCCACTCTGTCCATCCCTATTACCCCTGAGCGTACTGATATTGCTCGTCTTCT
TGATATGGATGGTATTATAGTTGAAAAACAACGCCGCCTTGCAACACTGCTAGGTCTACA
GGCTCCACCAACACGAATTGGCCTTATTAATGATATGGTTGGTATCAGTTGGGGCATTTT
TATATTTTGGATAGAAAACTTTATGGTGTGGTCAGGTATAATAGTCCATAGTTAAACATT
AGGAATTCTGATTCATAGTCAAGCAGTTCTGTTACATAGACAGGTTTCAGAACCCCTGGT
GTAAGCCAATATTATGTTCAGGTGAAGTGATTTATCTGGTGGGTGAGCTGGGGTTACACT
GGTGAGGGCTTTGATGTACTAGATAAGGCTTGGACTGGTCCTGAAGAATAGTACTAACCA
TGATTACTTCTTCTCTTTAATTCAGCAGAAATTTATTGAAGGTCTGTTATTTACCAGGCA
AGTTATACTTAAATGGAGCATAGATTCTAGGGATTCTGATTTGCATAGCCTAACTTAGTG
GCTGTTGAGGCAATCACATCCAGCAAATCCCATCGGGACAAGAATGAGAGGAACAAGTGC
TAGGAGAAAAGTACTAAAAAAAACCCAGCTTGGCTGAACGTTTACAAAAATCCAGTTTTA
ATGTGTCCCCCAATTTGTGACTAGAATTTTAAGAAAGTGCTAGTGATAACAGGAAATACT
ATTCTTTTAAGTCTTGAGAACATGAACTCTTAAAACAGCACCTATAGTCACTGTGGTAAA
AGCCTGGTAAAACACACTATTGTAAGATGTTATTACTAGGGGAAAGTGGGAGAGTGGTGT
GGTATATGGGAATTCTTTATACTTTTGATATAATTTTTCTGTAACCTAAAGCCTCTTTAA
AAATAGTTCAGTGTATGGGAAGGGAAGCCAGGTAAAAGACTTTTCTGGAAGAGTCAGTTA
AGAACTATAGTAAAGTTCTCTTTATAGTGGCATTTTCCTTTTCTAATGTATGTCTCTGTT
CTAGTAGTTACTTAAATTATCTTTTAATTTTCTTTTTTTCCCTTAGGAGGTGCCGGGGAT
TGAACCCGGGATCTCATATATGTGAAGAAGGTGCTTAAGCACTGAGCTACACCCACTCTG
CCAATTTCTTTTCTGTATAAGGCCTCCCTGTTTTAGTTTGTTGCCACTGCCCACAAAGTT
AAAGTTTGCATTATATTTTTGGACAGGTTTGTATATGCGCCGATTTAGGATTAAATATAA
TAAATCTGAAGCATTGTTTGTAGAAAGAGGTTTTATTAAAAAAAATTAACATTTTTTTTA
GAGGCAGGACTACGTGCCTAACTAGACTTATAAGTCATACTTCTTGAGCCTGTGACTCTC
CATATCACACCTCACTGTTAGAGCTGGTCTGATATTGATGCAGGGATCAGTATTGGAGAG
CATTGGACCAGCAATCAGTAAATCTAGATTTGGGTTCTCCTTTTGCTTATAAGTATGTAG
AGGCTTAAAATGGGTACTGATGCAAGTCAGGTGAATGGAATTCTGGCTGCCAGGAAGCAT
TTGTAAATCTTGTTGAAATCACAATATAACCAAGGGAGGATCCCTGAGCTTTGGTCTCAG
GTAACTTTTTTTTTTTAAGATTTATTTATTTTTTTAATTTCTCTTCCCTTTCTCCTCCTC
CCCCCAGTTGTCTGCTCTCTGTGTCCATTCGCTGTGTGTTCTTCTGTGACTGCTTCCATT
CTTCTCTGCGGCACCAGGAATCTGTGTTTCTTTTTGTTGTGTCATCTTGTTGTGTCATCT
CTCCGTGTGTGTGGCGCCATACTTGGGCAGACTGCACTTCCTTTCGCGCTGGGTGACTCT
CCTTACGGGATGCACTCCTTGTGCGTGGGGCTCCCTTACGCGGGGGACACCCCTGTGTGG
CAGGGCATTCCTTGCGTGCATCCGCACTGCACATGGGCCAGCTCCACACGGGTCAAGGAG
ACCCGGGGTTTGAACCTTGGACTTCCCATGTGGTAGGCAGACACCCTGTCCATTGGGCCA
AGTCTGCTTCCCTCAAGTAACTTTTCGAACACCAAGAAAAAGTGATTCTGTATCAAAGGA
ACAGACTCTTAATTAATGAAGTTTTCAAGAGACCAGTTGTTAAATCAGAAAGGCAATTTG
TAATGAGAAATGTAACTTAGAACCTGTCTTCCCTAGTAGGGATTGCTAAGTGGAGAATGT
AAATTATTTGCTTGATAGGGTTGAAATTAGAAGGAGAGGAGTTTTATTTGAATGTTTATA
CTACACCTTATTCCAATAAAAGATTTCAGGATGCATACAAGTGGGAGCATTACAATGTTT
TTGGACATTAGTCATATGCCCAATTTGCACTGGGTAAGTTTAGATGAGAGTGCTTCAAGT
GTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTCCTCAGTCT
GTGATCCAGTCTGTATGGGTGCACTACTCTTGTCTTGCTTTGGCCCAGCCATTAATCTGT
CAAAAGGTTATTAGTTCCCAGCCTATGAAGGATGAAAGGTCACATGTACTGCATGTTCTG
GATAAAGCCTAGGTAAGATGGGATTTGGCAGATGCATAATCTACCAAAAGGGGCAAGAGA
CTCAACATACTTGAACTTTGGATTCCTTTTTAGTAAATTTAAAGAGGGTTGAGGCTGGAC
AGTCTTTCAGTTATTTTTCAGATTTCACATCCTGTAATTATTTTAATTTATACTCAATTC
AAAAATCTGTTTGAGAATTTCCTTTAGGATTATACCTTTTGTTTTGCTTACTGTAGGTCA
GGTTCAATGTACTGCAATATGTAGTCCCAGAAGTGAAAGACCTTTACAACTGGCTAGAAG
TAGAATTTAACCCACTAAAGCTGTGTGAGAGAGTCACAAAGGTAAGACCTTGTTTTGGGT
TTTGGGTGTGTTACCATGTTAAAATCTTGTCAGCTAGTCCTACTCCAGTTTTGGGTTGTA
TTTATATTTGTTGAGAGAGAGGTATTGTCCTATGTGTTTGAATTTAGTGCACATTTCATT
GTCTTTTTTTCTTTAATTCAAGAGAAAAGATATTTCTGATGTGCTAAATAAAATCTTTGG
AGGTAAATTAGCAGCATGACTGATTTAGCCATTGCTGTCAGTCACCTTCAGACAGGCACC
AGTAGCTTCATACTACATTTTTCATTTCTTTGCATTGTCTGATGCTTTTATATTTAAGAA
ATTTGGGAAATTCACAGATGTTCTAGTATTTGTTACCTAGAAAGTATAATTTTTTTCAAT
TTAATGGATTTTATAGGTTCTTAATTGGGTCAGAGAACAACCTGACAAGGAACCAGAGTT
GCAACAGTATGTCCCACAACTCCAAAACAATACCATACTTCGCCTTCTGCAGCAGGTAAA
AAATATAACATGAATATTTTATGTAAGAACTGGAATTTTACTCCTTCGTTACATGTTTTG
GTCACAAAACTCAAAAAGGAAAAAGATCTTAAAAATGCCAAGGAAACAAAAGCCTCCCCT
AATCCCTCTCCGTGCCAAAACTAGTCTTAAGTTTATCTGTTTGATTTGAAAAACAATCTT
ATTTGACATAGTATGCTGATATTACCTTTATATATCTTTGTTAGTAATGTAGGTCTGCCA
TATTCTTTTGGCATGTTTGCTGTTGTGTTTGCACATTTCATTGACCTGCTTTCTTTTGTG
TAAGCAGTGTTATTTCTTCTGTGCTATACAAATAGTGAAGGTTAATTAGCAGTATTATAA
CTAAATAATAATGCTGCCAGTCTTCTTCAAACAAAAATTGTTTATGTGAGTTAATTATAT
CTACAAATTTGTGATCATGAAAGTTTTTTGTTTTATTAAACTCTGAGATGAGAAAAATAC
TTTTGAAGACTAGTATATGTGATCCCTTAAAGGATATGATTTGGGGTTGATAGCCTTGAA
ATTTCAGCTCCAGCAATATACTGTTAAAATTCTCTGGTCTAGGTTTTTTTCCTCTGAAAA
CAATTGGCCTTATTTCTACTTCCTAGGATTGTTATGAGATTGTATATAAGAAGCGTTGAA
TAAATGGTAGCTATTTATTAACCCTCTGTTTTTTATGCAGGTTGCACAAATTTATCAGAG
CATTGAATTTTCTCGTTTGACTTCCCTGGTTCCTTTTGTTGATGCTTTCCAACTGGAACG
GGCCATTGTGGATGCAGCCAGGCACTGTGATTTGCAGGTATTTGCTTTAAGGAGACAGAG
GAGGAAGGCTGTTGAGGACTAGGAAGCCACATTCCCTTGTTTCTCAGCTTTTTGTAGAGT
GGCACTATTAGAAAAAAAAAAGAAACAACTTAGTGAATCTGATAGTGTTTGTACATATTG
TTGTATGTTGAATGTAATGCATTTATGTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGCCGTCAGACAATTGAGGAAAGGAA
GGAGCGGCTTGAAAGTCTAAATATTCAGCGTGAGAAAGAAGAATTGGAGCAGAGGGAAGC
TGAACTCCAGAAAGTACGCAAGGCTGAAGAAGAGAGACTGCGACAGGAGGCGAAGGAAAG
AGAGAAGGAGCGTATTTTACAGGAACATGAACAAATCAAAAAGAAAACTGTCCGTGAGCG
TTTGGAGCAGATCAAGAAAACAGAACTGGGTGCCAAAGCTTTCAAAGATATTGATATTGA
AGTATGTAGTAAATATTACCCATTAAATATTTAGTTTTGTCCAGGTCTTCTGAATTCTTA
AAGCCATGCTTATTTACCATTTATTGGCTTATTTTGGTTATTTGGTTACTTTATGCATAA
TATACATTTGGACATTAAATCTGAGAGTGTTTGTTTTTAAATTGCTCTTTGTAGTTTTTA
ACTATTGTATTTATTTCTTATGGAAGTAGAGTTTAGATAGATAACCATGCTTAATTTGCA
GACTTGAGAAATGAGAATTTTTTTTTTTTTTAAATGTACTGGGTCTGGGGAATTGAACCC
AGAACGTCATGTATGGGAAGCTGGCACTCAGTGATTCCCCTGAATTGGTTTCTATTTGCT
TATTTTTATTTTTAGGAGGCATCGGACACCTGGGAAGCAGGAGCTCACCTGCTTGAGCCA
CATCTTCCCAGAAATTGATTTTTAAGATAGTTTTTTCTACCCATAATTGGGGGGAAAAAA
AGCTATTGTACAATATTTTTAAATGTTGTCTAAATCTTAATACCCATTGAAAAAAGTAAT
TCAGTATTTGATTCTAAAAGGCAGTGAACTTCACTGACTTGTGTGCATTTCTTTTGTATT
CTTATTAATGACAATGCAATTATATTACTTCTCAGGACCTTGAAGAATTGGATCCAGATT
TCATCATGGCCAAACAGGTTGAACAACTGGAGAAAGAAAAGAAGGAACTTCAGGAACGCC
TAAAAAATCAAGAAAAGAAGGTAAATGAATGAATTGGCAGACTTTTAACAGGCAAAAGTA
AAAAATATATTTTAAAAAAACATTTGTTTTCATATTCAGATTGACTATTTTGAAAGAGCT
AAACGTTTGGAAGAAATCCCTTTGATAAAGAGTGCTTATGAAGAACAGAGAATTAAAGAT
ATGGATCTCTGGGAACAACAAGAAGAAGAAAGAGTAAGGTTTTCATTTAATTGAAATGTT
TTTAGATTGTAAGTTGTAATAAATCATCTGCTAGTAATAGGACCAAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTTGCAGAGTGGGAGAGAGGTGTTCATTCTCTTGTGCCA
CCTCTGCTCCCTGTTCTGCTGCGTCTCTTATTGTCTGTCCTTTGTGTCTCTTTTTGTTAT
GTCATCTTGCTGCATCAGCTCTCTGTATGGGCTGGCACTCCTGGGCAGAGCAGCACCCTG
TGTCGGCCAGCTCGCCAAAGATTACTTTTTGTGGTTCCAAGAAACTTGTGGATCTTTTGT
AAATTTAAAACTTATGGCTAGTTTCTTGCTTTTGAAAAAATGTGAATTTTTGTTGTTAAT
TATTCAATTGCAGGAGAAACTTAAACAGTTTGAAGCACGACTAGCAGAAGAAAGGCATAA
TCGCTTAGAAGAACGTAAAAGGCAACGTAAAGAAGAACGCAGAATAACTTACTATAGAGA
AAAAGAAGAGGAGGAGCAGAGGAGGGCTGAAGAGCAAATGCTGAAAGGTAACTAAAGACC
AAGATTGGAGGGTGTGGTGAGGCAAGTATGACATTAGATCAAATTGAGAGCGGTCTTTCT
TATTTAAAAAACACGGGAATCAAGACACTTGGCACGGCGACTATGAACCTAGGTTCTCTG
AACCTAGGAACCTAGCTTAGTTGTCTTTGTTATATGTGAGGATGTTACATCCTCTGTAGT
TTGTTTCCACTTTGTTAAATATTTTTTTAAAAATGAATAGTCTAATTTTTATTGTGGTTT
TCTATGTAGGTGTTACTTTTTTTTTAAGGAATGCATTATTGAGGATGTCCGTCAGATGAT
TCCATACTGGGAATCCCACATACTGAGCAGAGGGGAAGGGAAGTCTGAGTCTTCTGAAGT
CATTACAAACCTATTAATGTGGAGTGACAAAAGATTTATGTTGCATCTTTTGTGCCTTAA
ACTGTAAACAAATTTTGAAATTCTTACAAAGAATTTACATCTATACTCTGCTGCCTGTTT
AGTTCTAGAAAATTAGACCTGGCAAGCAGAGCAAAGATGAGGGCTGCTAGGCTGCAGCAC
TTTATAAGCTAATAAATTTTATAGAGCGTGAAGAGAGAGAACGTGCTGAACGAGCAAAAC
GTGAGGAAGAACTACGGGAATATCAGGAACGAGTCAAGAAATTAGAAGAAGTAGAGAGGA
AAAAACGCCAGAGGGAGTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGGG
TCTCTCGTGCGGGTGGTTTGCTGGCTCGCGTCCTGCCCTGGTGCCAGGACGCGGGAGAAA
ATGAGCCTGCGGGCTCTCTCATGGAAACCATGAGCTCAACTTGCTGAGAGACACCGGAGC
GTGAGCTAGTATTTTTATTTTTAAGATATATTTATTTATGCCCCCCATCAATGCAAAGCA
GATCCCCCAACTGGTCCATTTTTATTTTCTTCTTTCAGTGATTATAAATAATTCCCACAT
CCCAGTCTTTCTAAACTTTATATCTTCTCAGTTTTTTTTTACCCACAGGATATCTTTGTT
TTCTCAGTGGAACAATGGTTCTATCAGTTCAAAATCACCTTCTCTCAAATTTGGAGGCAT
TGCTTTACTGCTTCACTGTCTTTTTAGTATACATTGTGGAGAAAGAGAATTTTTGATGAC
TAGACTTGGTCTTGTTTCTTCTGTAGGTATTGTATTCCTTCAAAGCTTTTAGAATTTTCT
TTGTCTTTGGTGTGAAGTTAGTGATTCCTGTTCAGTTGATATCTTCATTAGAAGATTCTC
TTCTGCTTTTTCATCTTATCCATGGATTTGATATTTTGGCAAATTTTGTATCCCTTTTTC
TTTTTTTTTAATATGGCTTTTATAGCCATCTTTAAAATCTCTCTTTTTTTAAACTGTATC
CTTTCATGACTGAATTCTGTTGAATTTAGTTTGCAAGGCAAGTGTGGGGGTTAGGGAACT
TGTCTTCTGGTTGTAACAGTCCTTGTAGCTAGCATAAGTTACATTGGCTGCTGTTCGTGT
TTTCTTCCACAATGCCCACTTGAGGAAGTCTCTCAGAACAACTCCCATCTTAAGAGCTAT
CCCATAGTCAGTAGCTAAGATGGCAGGGGACTGGCCTATTACCTAGCCATACTTACTTTA
TCTCATTTCATCTGTGGAGGTTATTGGAGAGTTTGGGTGCCGAGACACTTATCTTTTTTT
GAATAGTGCTCCTGTCATTCACGTACTCATTACATTAGTAAAAGCAGTTGAGTTGTGAAA
GTTAGAAGGTATGTATGTTTAAGTTTTTGGATCAGGTTGTACCAGGTTTATGTTTTAACT
GTAAAGATTTTGAGTATCTCCCTACACCCTTTCCTTAATTTTTAACGATAGCAGGGTATT
CTGAAGTGGGAAATAAATTTAACCACCCTCTATTAGATATTTCATTTACGTCCACATTTT
TGTGCTTAGTAGTCACTGGTATTAAGTTTTGGGGCACTTGGGTTTTTTCACATAGTCTCA
GAAGCGAATTTCTAGGTCACAGGAAATTCCTCTTGGGCATTTTAATGGCTCTAGGTGAGT
GCTGCCAGTTTGCTTTCCAGTAGTGGAGGTATATCAAATTATAAAGTCACCCGTAGTACA
TGAAGTTGCCATTTTCACTGATTCTGTACGTCAGATTTAAAAAATAATGAAATTTTAAAA
TGTGCTTACTTAAGAGCCTGAGATCTCTAATATAAGTACGATTATGTTTGGCTGGTGATA
CTGGTAGTTGTAACAAAGTGTTGCCAATGTATTGCCTGCCCCTGCCCTATGGCTCCCTGG
TCTGTCTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTACACATGTGCGAGTTGAAATTACAATTGTTTTCTGGCAGATTTGGAATAAA
GCATCTTTTCTAATACTAACAAATCAGTATATTATGACAATTTTCTGACAGAAAATGTAT
CTTGTGGAAGAAATGCCTTTGTCTTCATTTGGCCAAAGGTGCCCCATGGGCAGCCCTGGC
TCTGGCCAAAGCTGTGAAATGCTAAACTCCCTGAATGCCTCAAGCTTGGCCTCAGCCCGG
TACCCGTGGACCCTCCCCGTCCTAAAGTGCCCGTGAAATTGTCTCCCAGCTGAGCTAGTC
AGGGTAGCTGACTAGGGTGGGGCCTGGGTGCAGTTCCGGCTCTATTTGTTGCAGGTGGGT
TGGCTGACATCTTTAAGATCACGCGAGCCTTTTGGGCTTCCACCTCCGTTCTCCAGCCCT
GAGTTCTCTAGAGATTTCTTGTGCCTCGAAGGTGCCTGTCCATGACAGCGAGCGGGCAGT
TTTCTGCTCTGGGGCTTCCATGGCTTAGTGACCAGAAGGCGGGTAGGGCTGGCCTAGGAA
GCGTAGTAGGTGGACACTGGGGAGCAGGAGAAGACTCGAGACTGAATACTTCGAGTAGCA
CTGAGCCAAGTCAGTGGTTCTCCCTGGGCTGTGGGATTACGGAAGATTTTTTCTCTTCTC
CTCCTAGTATAGTGGTCCAAAGCTAGGTTTGTAGGAGCAGATGAGGCTCAAGCAGTTGAG
CGACTGCTTCCCACATGGGAAGGTCCTGGGTTTACTCTCTGGTGCCTCCTGAAAATAAAC
AAGCAAACAAATGAAAAAACCAACTCAGGGAAGCTGTTGCGGCTTGGGTTGCGTGCTGGC
TTCCCACATACGAGGTCCTGGGTTCAATCTCCAGCCTTGGTACCTTAAAAACAAAAAAAC
ACCTAGGCTTGTATCCCAGTTCACCACTTACTTGCTGTACAAATTTCCCATTGCTGCTGT
AATAAAGTACCACACACTTAGTGGCTTAAATCAACACGGTTATTTTCGGCTCTGGAGGAT
CGGAAGTCTGAAATGCTTCTCGCTGGGCTAAAATCAAAGCATCAGCGGGACTGTGCCTTT
CTAGGGGCTCTAAGGGAGAATCTGTGTTTTGCTTTTTCCAGCTTCTCAAGACTGCCCACC
TTCTCGGTTCGGGGCCCCCTTCCGTCTTCTAAGTCAGCAACAACCAGCCAAGCCTTTCGC
GCGCTGCATCGCTGGCAGACGCCTGCCTGCCGCTTCCACCTGCAGGGAAGCGCATGATTA
CATTGGGCCTACCTGGATAACCAGGAGACGCTCCAGGGCAGGGGTTCTTAACCCTTTTTG
TTCCCTGGACCCCTTTGCCAGCCAGGCGAAATGAATGCTACTGTAATTTATTTATTGCAT
ACACTTATAAGTGAAGGAAATGCTAGATTTCAGTTAGAAGTCAGAGAAAATAAAGATAAG
CGGCCTTTCTCCAATTCAGGCTAGTGGACCCCCTGAAAACTTTCCCCGTGGGCCCCTGGT
TAGGAACCCCTGCTCTGTGGTGAGGTCAGCTCATTAGCAACCACAACTGCCCTGGGCCAA
GTAAGGGAAGGTTTTCACAGGTTCTGGGGCTTGAGTAGATGTGTATAAGTCTGCTGACCA
CACCAGCTGTGTGACCTTGGCCAGCTCACCCTCTTTTATTTATTTATTTATTTATTTTAT
TGACTTTGTAATAATATTACATTAAAAAATACATANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCATGCGGGAGGTGGGTGCCCAACTGCTTTGAACCACATCCGCTC
CCCTGTATTGCTGCTCTTTTTTTTTTTCATTGCTTCTTAAGGTTGCCAGTGTATTGTTTC
TTTTCTTCTTTGTTCCATATAGGACTCTCGTTGGGGAGATAGAGATTCAGAAGGCACATG
GAGAAAAGGGCCTGAAGTGGAGTCTGAGTGGAGAAGAGGCCCACCAGAAAAGTAAGTGAA
GTTATGGAACAACTAATCATAGGTCATATTAATATCTTCACTGTGGATTTTAAAATTTGG
TTTATTTTTGGGGGACCAGGAAAGAAGAGTCTGAAGAAATATATGCGTGCCTAAGTACTA
CTGAAAAGTTTTTAGCAGTTTACTTCCAAATTTCTGGAGAAATCTGAATATTTCTTTTTT
TAAAATTCCCTAATTGAACAGTATTGGATCAGAGTAAGCAAATAGTTCCAAAATATATTT
TTCTTTACTTTAAATATCCCAAGTAGATTGAACCATCCTTTAAAATAATTAATGGTAGGT
GGAATGCTGGCCAAGTGCTTGTTAAGTTTTGAAAGATTGTGATAAAAGATTGGGAACTTG
CCAAGGTACTCTAGGTAAAGTACCTTTCATTTTTAGGCAGTTGTTTGCTTATTGGTCTAT
TTGTTGATATATAATATATTGGATTTCTATTTTTCAGTAGGATAATATATTTTCCTAGGA
CCAGGATTATTGAATTTAAACTGAATTGACTTTTAAGCATAAGTGAAATAAAAAACCATC
CAAAAAAGGATCATATGTTGTTTTTTTTTTACTACTCTTAAAAATGTGTGACTTGTCATA
CTTTAGGGAGTGGAGACGTGGAGAAGGGCGTGATGAGGAGAGGCCTCTTAAAAGAGATGA
AGATCGACCGAGACGTTTGGGAGATGATGAAGAGAGAGAGTCTTCTCTGAGACCTGATGA
TGATCGGATTCCCCGGCGCGGCATGGATGACGACAGAGGCCTTAGACGTGGTCCTGATGA
AGACCGCTTCTCCCGCCGTGGGGCAGATGACGACAGGCCTCTCAGACGAGTTGGTGATGA
AGACAGGGGAAGCTGGCGTCATGCAGATGATGACAGACCTCCTAGACGGGGACTGGATGA
GGACAGAGGAAGTTGGCGAACAGCCGATGAGGACAGAGGACCAAGACGTGGGATGGAGGA
GGACCGGGGGCCTCGGCGAGGTGCTGATGATGAGCGATCATCCTGGCGCAACGCTGATGA
TGACCGGGGCCCCAGGCGCGGGTTGGATGATGACCGGGGTCCTAGGCGCGGGTTGGATGA
TGACCGGGGCCCCAGGCGCGGGTTGGATGATGACCGAGGACTTTGGAGGAATCCTGATGA
TGATAGAATTTCTAGGCGTGGTGCAGATGATGATAGAGGGCCTCGGCGAAACTTGGATGA
TGACCGACCCTTGAGGCGTGCTGATGACGATCGGTTTCCCAGACGGGGCGATGACGCAAG
ACCTGGTCTCTGGAGACCATTTGGCAAGCCAGGTAAATTTTAGGAAACTAGATTGGACAC
ATTAACAGAATCCACTTGATGTGTTAAATATAAAAAGTGAATTTTAATGGAAAAATGACA
TGCTACGATTGGGCTATTAATCATTATCACTTCTTAGTCTGACCGTTTTTTAAAAAAAAA
ACCATTCCTTGAATACCTGTGCAGTGACTTTTATGGCAAAAATGTGTCTTTGATACCCTC
TCCCCCCACTAACAGAAATTAAGTAACTTCACACTCTTTGTCTAATAGTGAATCTGTGTT
CTTTGTGCTTTGTTGACTGTTTCTTTGTAGGCTCGTCGTTCTATTCCCATCCTTTTAAGT
GTTACAGTTCTTTGGGTTCTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTAGAAA
TCAGGGACTTATTCTTTTTTCTGCTTTCTTTCATCCTGTATGTTAAATCTTAAATTTAGT
TCAGTTCTGCCTTTTGAATGTTCCTTAAATCGACCCATCTCTATTCTCCCTGCTTTTTCT
TAGATTTGAGCCATTGTCATTCTTTTTGAACTCTTGCTGGTTTCCACTTCTTCTCCCACC
TCCAGTACTATACTTTATGCAGTAACCAGAGTGATATGTTCTAAATTGCAAATTCAATGG
AGCAGCCTCCCTACCTTTACTCATACTGGTTTCTGGTACAAAACTTCTCTCTCCCCAAGT
CTTACCTTATTCCGCTCGCCTCATATAAAATGGCACTAATAGTACTTACCTTAGATCTAT
GGCGAGGATTGAATAAGTTAATAGTCACACAGGATTTAGAGTAGTGCTTTGGCACATGGT
AGTAATAGCTCTGATAATAATATTTATTGATCTTGAACTATAATGTACTTTGAAATATGT
ACTTTCTTTTGGGCCTTCATATATTGTGTTCATAGATTTGGTCATCCCACGGCTAAGTGG
ACAAAGGTGGGCAGGATCAAAGGAATTATCCTTGTTTTATGACTATAGATGGGGGATAAA
TAGTGGAGGATGGGAATATAAGAGTCTTTCTGAAGGTTTTGAAAATGTTGAAAACGTTGC
CAGGGTATTAAAAAACCCACAGTTGGGTTTACATCTATCCCCCAGAGGTTTAGATCTAAA
CTTTTCTCTTTAAGTTTTCTGTTGAGTGGTTTGTTGACTATCTGAACAGATTTTATACCT
CAGATTTTATACAACAGGAAAAATCAACTCTCAGTGATAGTTTTACTTAATGGAACGTTC
AGCCCAGACTATTTACTATAAGGTAATGAAAGGAAAAACTGTTAAGGAACTCAAAAATAG
GTACTGGGGAGTCTAAAATAAGGGACATGGCTTTGGGTGTTTTGTTTTTAATGAGGTTGG
AACATCTGAAAGTAGCTTTTAGAATGCTGATGAGTTAATGTTTATGTTAAGATTTCTGTT
CATTATTGCTGAAATAATGTTTCTCTAAAAAAAAAAAAATAGGTGGATGGAGAGATAGAG
AAAAAGCCAGAGAAGACAGTTGGGGTCCACCTCGAGATTCAAGACCTTCAGAAGACCGTG
AATGGGATAGAGAAAAAGAAAGGGATAGAGATAATCAAGATCGTGATGAGAACGACAAGG
ATCCTGAGAAGGAAAGGGACAGAGAGAGAGAGAGAGATGGGGATCGAGAGGATCGCTTCA
GACGGCCTAGGTTTGACATTTGAATGAAAACTGCCTAATTATTTGAAGAGCTACAGTTAG
AATTCCCTTAAATTCTTTCCAGTGTATTCCAAACTCTTTGAGAAATGGTGCTCCTTTTTT
TCTCTTCCATTTGTCTGTTAGATAATAGTGCAGATTTTTAAAAAAAAACCAAAAAAAACC
AAAAAGCATCTTTAGAATTTTAGAGGTCATCTAATTGGACCTTCCCACACTTAAGCTGTG
ACTAAATGTTAATTGGATTGGTCATACCACTGTTTGGTAATGGAACCATTAGATTTCTTT
TTACCAGTTGATTACTTTTTCCCTGTGGTTTAAGTCAGTCAGTTCTCTTGGCCTTAAACT
ATCCAAACCCTTCTACTTTTTTTCTTTAGAAGGTATGGGGGATTGAACCCAGGACCTCAT
ACATGGGAAGCAGGTGCTCAACCATTGAGCTACATCTGCCACCCCCCTTTACTATTATTA
GTGGTAAAAGTTCTAGCTTGATCTCTCTGTGGCCAAAGTGGCTGTGTTTTGATAAATCTA
GAGTGGTGCTAGTCAATGCAGTTCTTCTGTGAGGATGAAAATGTTCTGACCTCTTCTGCT
AAAATGGTAGCCAGTATAATCGCATTTGGTTATTGGGCACTTGGAATGTGGTTAGTGCTA
TTGAGAAAATGTCTTCATTTTGTTTTAGTTTATTTAAATGTAACTGGGTTCCTGTGGGTA
TGGCTGGTATGCTGGTCAGAACAGGTTCAGATGTCCTCATTTGATCATCTCCTCTGCCAG
AGTTATGGGTGTAAACTCGATCCTTGTTACATTTATGGCCTCTTGGAGTGCCAACTTGGA
TATAATATAGTCACTTATAATTACCTGTGCAGGCAGCAAGACAGAAAGTAACTTCTCATT
TTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCTTGTCTTAAGGTTTATAACAATTAGGACATTTCCTAGGCCAGTGATT
TCTTCTTGTTTACAAGTTTTTGGTATCTGTAAGTCTTTGTTGTTTTAAAGGTTTTTTAGA
AATAGTATCCAAATGATTAAAATGTTTTTTGCTTTTATTAGTTTTTATTTCTATGATTCT
GTGTTAATCTTTGCCACATGATTTGAGTTATTTGAAGTACTCCTTTTGCCTGTATTGTTT
AGTTTGAGCCAGTAGAACAATAATAAGGAAAAACTTAATATTGTTATTGTAACTTTTTAG
TAAGTTCTTGGAGACGCGCTGATGACAGAAAAGATGACCGGGCAGAAGAGCGTGATGCTC
CTCGTCGTGCTCCTCCCCCAGCTCTTTCAAGAGACCGAGAAAGAGACCGAGAAAAAGAAG
GCGAAAAAGAGAAAGCTTCATGGAGAGCTGAGAAAGATAGGGAAACTCTTCGTCGTACTA
AAAATGAGACTGATGAAGATGGATGGACCACGGTACGACGTTAAGCCTCAAGATAATGGC
TTCAGACTTATGTCTTACATAGGTTTGATCACATTCAAGGATTATTATACTTGTGCTTCA
ACCAATCTAAATTGGATTCTTTAACTAATGTTTCACCATAACACACAAGCATGAACTTGT
ATTAATCCTATATAATAGATTGATCATGCACCATATCCACAGAAGGTTGGAAAACCATGC
CATTTTCTGAAATTTAAGGTGTTGCATTATTTCACCAATCATTTGTTTACAAAAAAGAAA
AACTAAAAAATAAATTTAAAATGTGAATCCTTCAGGTATTGAGTAACACCTATATCTCTT
AAAGAATTGATCTTTTTCTTTTGATTTTGAAATATCTGACATTAATTTGGATTGAGGTAA
GGTTCTGTATAGAAAATGTATTTGAAGACTCTAAAGCAGTGGAACTGAAACAATTTTCAC
ACCATTAGCTGTTGAAAGAATACCTCTAGGTATTTTGAGGTATTAACTATTAACTATATC
TGGACAGTTTTAAGTGCAGTAAATGTTACAAACATTGGATACAGTGGGGTTTTCTGTAGA
TTTTACTTGAGTGAAGGTGAGTATAAAGCAATTTGCAGTCATTATTATAATGACAAGAAC
ACTGCTAAAATGTGCGTCCAAAACATGACAACTTTTAAATTTTAAAGCATTTGATAAAAC
TATTGCTGAGGTTTCTTTTTTGTTGTTGTTGCCAATAGCAAACTGCTTTTCCATTAATGG
AGAATTCATGCCTTTCAAGCATTTTAAATATGACAATATTTATAAATGTGTGGTTTGGAG
GAAATGTTCAAATTCTTTTTTCCTAATTTTCTTTCTCTTCAGGGTAGATTCTTTCAAGTA
CTTTGTAGTAATGACTGTGTTGACTTCAATTTTGGAGTGCAGTAGCTATGTTAAAGATTA
ACTATATGGTCTTATTGAAGCCAACACAGAACTTGCTGCTGTTTTTTTCCCAGTGGTAAA
TAAAATACTTACAGAATGTTTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1189, 3056..3192, 3293..3456, 4689..4888, 6710..6918, 8265..8436, 11156..11260, 11656..11754, 12460..12573, 13280..13465, 13993..14340, 14975..15079, 15159..15272, 16262..16384, 17593..17746, 18324..18440, 18442..18509, 38542..38630, 39246..39931, 41802..42009, 43292..43482, 44160..44383
1001..1189, 3056..3192, 3293..3456, 4689..4888, 6710..6918, 8265..8436, 11156..11260, 11656..11754, 12460..12573, 13280..13465, 13993..14340, 14975..15079, 15159..15272, 16262..16384, 17593..17746, 18324..18440, 18442..18509, 38542..38630, 39246..39931, 41802..42009, 43292..43482, 44160..44380
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved