Dasypus_novemcinctus Locus ENSDNOG00000016079
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000016079
Dasypus_novemcinctus
ENSDNOG00000016079
GeneScaffold_5972
SNORA32
6630..6743
107016
AGAGGGTATTTCCTTTTCCTTGAGATTTCCCTTTTCTTTCCGATTTCCTTTCGAGAGTC
CCCCAGCCGACTCTCAGGATGAAGCAACCTCTTAAAGAGAAAGCCATGTCCCACTCTTCA
TTCAAATTCTCTTCTTTTTTATGGCAAACCGCTCGAAATAGTTGTGCTGGGAATCATTTT
TCCCTCCAGACCCAAACAAAAGCAAACACTACGTTTTAGAAAGGTAGCACTTTGTTTAAA
GATACTACACGAAATGCTTATAACAGCTCCCTCCTCCCCCCTCAAAGAAAAAAAAAAAAG
CTAAGTGCATCTCCCTGAGCGCTGGGGAATTCGGCGGCGGGACAGCGGCGGCGAGCAGCA
AACCCGTGGTCCAGAGGCAGTTTTTCCAGGCAGCGTCCAGAGAAACTTGAATTTGCACCC
GTCGGCAAGGAGCGGTCGCCTGAGCCTGCGCGCCGATTGGTCGCCCGAACACCTCGGGCC
CCGCCGCGCCTGCGCCGTCCTCGGCTGCCTCGCCCTCCCCTGCTCTCCCCCGCCCTGTCG
CCCGGTCGCCGCGCCTGCGCCCTGGAGACGGACTGATCGGGCGGTAGCCCGCAAGCCGGC
GAGCGCTGAGCCGGGCGGGCAGACGGGTCAGCCCGGCCTGCTCTTTCCCGAGGAGGGAGG
TGGGGACGGCTTTCTGGGTCTCCAGAATCCCCCCCAGGCCGCGCAACCTGTCCCCGGCGG
GCGAGGAAGAAGTTGAGGAGCCGCGGGACGCTCTGCCCGGCGCCGCCGCCATGGCTGCCA
TGATGGATCGGAAGTGAGCCTGAGGGCGACGGCTGCAGGCGCCGGCGCTTGGGGTCTCGG
CTCCCCGGCCGCTCCGCCGGGGGACGCGCGGCGCGGAGTCTGCTGAATCTCACCGTCCCC
GCGGCCCCGATCGCTAGCGCTCCCCCGAGCCCAGGCCCCCGGCTGCTACTCTCTTCGCCC
CGAGACTGAGCAGCGGGGAGTGGCTCCCGGCAGCGCGGAAGATGGCGGACCCGGCCGAGT
GCAACATCAAAGTGATGTGTCGCTTCAGACCTCTCAACGAGTCTGAGGTGAACCGCGGCG
ATAAGTACGTCGCCAAGTTTCAGGGAGAAGACACCGTCATGATGGCGGTGAGTGATTCCC
ATCCTTCCCCGCGCGCCCGCCCCACCTCGTTGGATCTGGAGTTGTTGGGGCGCAGAGTTT
GAGAGGGAGCAGTCGTGTCCCCAACCTTGGCGGCGGGTTTGCCGGTTCAGTTAACCTTTG
GTAGGGTGACTGCGCAGCTGCCTGGGTTTTCCTGGATCGCCCCAGCCCGGGACTTCGGCG
CCGGGAGATGGGAGGTGCCTGGTCTCAGCCTGGGACACTCCCCCACCTGGGGCGCTGGAG
GAGCCGTCCCGGGAGCACGTCGTGCGCTTATTTGCGTGTGTTTAGGTGTGTGTGCAGTTA
CTGCTGGTGATGCTGTTGGGTTTTGGATAACCCCCAAACTTAGCATTCATAAAATACATT
AAAATTAATATAGCAGTTCAGCGAGCAATATTGAGTTGTGAGACCAGTCCTGCTGCACCT
TAAATAGTGGGGATGCTAAATTTTATAGACGCGGATAACCACATGGTCAACCGTATTGTC
TCAGGAGAAGACAAACCACCAAACTAACTACAAAGATATCTGTGCCTCAGATGTTCACCC
ACCCCCCTTTTGAGTGATGAGGGAATTTTCTTAACAACAACAAAAGGCGAGCCGAGGGCT
AAAAAGAATAGTGAGTTTTCCTTTGAGATCGGTGTTACACATTCCCCCCCCCCCCCCCCC
CCCCCCCAGTCTTCTGTCCGATCTAGCAGTTTCAGATCGGGTCAAGTAAGTGCTCAGCAA
GATCCAGAATCTCACCCTTACTGAGTTTAAGTCCAGGGAAAAGCATTTCTTTTTTGTGTG
TATTAGAGAGAGAATTATAAGAAGCAAACTTGAAAAAGATCAAAGTTGACCAGTGAACTA
GCTTTCTCATTCTTGGTATTAGATTCACACTTAACAGTTAAGATCTAACTTGAAGAAAAT
TCATTTAGATAATCCTAAGGATAGTAAGCCATTGTTCCTTTGTAGGATAAAAGTGTACTT
TGGGTGGTCATTGTCAAGGAGAGCAGAATGTGAGGGGTTTTGTTTTTTGATATCTGATTT
TTATGCCTCTGGTATGAAAAGGTCTCTGAAAAGAAAATAGCATTCCCAGTTGAAGGAGGT
TAAAATATAGTAAGATACTGCATGCAGATTACTGAACTATGGCTAAAAATTAAATTCACC
TTTCTTGGTAATGCCATGTGACAACTTTTTCTACATTGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAGACTTTGGCAAACAAG
TCATTAGGTCACTAACAACTGCCAAACTGAAGATTGTCAGTCTGGTTCTTTGTTAACAAG
TCCACAAGAAAAACTCTTGTTATAAATGACATCATAGGGAAGCCAAGAAGTTCAGTACAA
AAGGAGCCAGTCATCTTTTCCTTTAGGATAGTCTCTTACATGGATTCAAAGGAAGTTTGC
AAGGCCTGGGTTGTTAGTTGGCAAACCTGAGGTGTCTAGTTTCTCCGAGTTTTTGTGATT
ACTCAGCTTCAACAGTGGTTGACACATCAAACCTATTTTCCTTTATGAATGTCTCTTATT
TCTCCAGATTTTTGGTATATACGTTATCTATAAGTAGTGCTAAGTGTCTTTTGTTAGAAT
GCTAAATTTAGTATTCTTAAAATAATATTAAGATAGGTTGGTAGTGAACCTTCTACTGCA
GCCCAAATATGGCATATAATATGAGGAGAGAGCTAAAAGAAAACAATTACCGCAGGAAGG
ATATATCTGTTCTAGGTTGTTTCCTTTGGAAAAAGTTGTAAGTTCTTTAGTAATGTTAGT
AAATTTAAATGATAGTATTGTAAATAATGGATAGGTGATTGAGTTGTGAATTAGTAATGA
ATAGTTGGTCTTTAGGTAAACTGAGCATTTTCGTCTGGTGAAAAAAATAAGAACAACATA
GTATAAGCAAAAATATTACTGAGTGACTATCCTTAAAAAATGTAAGGCAACATGTATGGT
TTATTATTTTCAGCATCTAATTTCTTGCATATAGTAAGTGCATTAATTTGGAGTCTTATT
TTTGTTCACTTTATTAAATGAGCTTTTTTTTTTTTTTTCTTCAAAAAAGAAGGTTGTTTG
GGAGTTCATAATGGCTGCTGAGAAGAGTGGAAGTAAAAAAAATCTCTAGATAAAATCATC
TTTTGTTTGTTTTGTTGATTTCACTGAGTCCTGATCCTATTCAAAATAAATAGTTTAGGA
AGGGAGTTGGTGCAGTGCAGCATTTAAAACTAAATTGTTTTAAACATGGTTTTAAAACAT
TTTCTAGACAGTGTTTCAGTTAAATCAAAATGTAAAGAATAAGTATATTTTCGTTTATGA
TGTTACTGAATTAAAAGCATAATCAGTACTGATGTAGAAAATAATTTTTAAGAATTTTTA
TTTTCTTCAAGGTTTATTTTCCAGTGTCTTGTCATTGAAAAACATCTGTGTCAGTGACTT
TAATATCCCATGGCAGACAAGTCTTTATTATAGTGTTTCTCTTTGTGCTCTGTAACCTTT
TATACAAATTTATTTGTAATCAGGTGCTTGGTGAAGTGCTGTAAACATCACATATTGAAT
GAAATAAATGAAATAATTTTATTTTAAAAAACTTTAAATGATACAGATAGATTCTGTTTG
CTTTAAAAGAAACTTTGACATCTGGCTGGTTTTAGGAAAATTGTATAGGTAACAAATGAC
AATTTTCCTTCCTCTTTTTTTTTAAGCAAAGGTTTTTTAAAATAAGAGAACTTGTTATCC
ACAAAAAAGGAAGGACAAGGGAGGCTGCTGCAAACACCAGAAAAAAAAAAATCCATAGAA
AATTTACTCCTTGTATCCATGTACCATAAAGATGGAGTCTAACTCATTTATATCATTAAG
TATCCTTCCTGTTAATCAGAATTCCTTTTATGGTATACTTTAGAGGCTGCCAGAACGCAA
AACAGGCTACTGTATGTAGCTCATTGAAATTATAGGAGAATAAATCTAATTACATCATCT
TGCCCAGTTCCTTTCCTAAAGAAAAACGCTATTCCCTTTTAAAGTGAATGATGGTTTGGT
GTCTGAACCTTCTTATTACCTTACAAGTGAAAACTGAAAGAGCAGAAGGAGCCACCATCA
AGTACAGTTAGTGTCTGACTAACAAGGAAAATCTAATATGGTATATAATCCCATGTGAGG
TAAAAAGATCACATTGAGATTTCTAGAGGAAGGCATATCCCTGCCAGAAAGGTGTCCTTC
ATAACCGGATTTGGTGTTCAGCCTGGTTTGTGCCCTCAAACAGGATCATTTTCTTCAAGA
AATCTAAGGTGTGGTCTCAGTTTAGGTAATTAAATTATTCTTTTTGGTCCTGTTCCATTG
GTACCCAAGTGCATCTTGTGACATGGAGTTTGTAAAATGGAAATCTGCAACTTGGAGTAT
CTTTGAAACTAAATAGATTTAAAGGCTACAGAATGTACAAGTCAGCCAAGAACCTGGCTT
CTTTAATATAGCTGTCCAGATACTGAGTTTTCCTTTGTTTAAAGTAGTTGAAAGATGATT
AGTTGAGAATGCCTTAATTATAGAGCCATTAGAAGTAATTTTATGTTTAACAAGTCTTGT
TTTTCATCCCAGGAAGCCAGGTTCATTTAGTAACTTTATGGCTAGACTCTAATTAAAACA
TTTGCTTTATTTAATAAAATTATAATTTAGTTTTGGAATTAAATCTAAGACTATTTTATC
AAAGTAATGCTAAGCACCTAACTAATTTTTTTATTTAACAATGGTATAACTTTCTACAAA
AATCACTTAGTCCCAGCTCCTTGATTATTTTTGTTTATATATCACATTTCAATAGTTGCC
CATAAGTATTCTTATTTTAATAAGGTTGTAGTAGTAGTTTGTATATTTGCTATGAAGTAA
TGCTAGTGTAAATAGCTGCTTAAAGTATTTTCGATGCAGACCTTACTATTACCAATGATA
ACTCTTTCTAAATGGTTTAGAAGCACTTATTTTTTATTGATGTAAAAAATTGAGATAGGT
CATAATTCAATAGTAATATTTGTTCTTTCTATTTTTAAAATATTTATTTTAGTAAATTTT
GTATGATTTATTTTAGAAGAATGTAGCTATCATCATACTTGTAATTAGCTTGTTTCTTAC
AAGTAAAATTAGAAGTAATCATTATTTAATTTTTGCTTTTGTGCTCTTTTTATATACTTC
TTATTAAATCTGTGTTTTGACCTGCAGCAATCTCTTTTTGTTTCCTTTACCACATTATGA
GTTCTTTAACGGCTAGAGACTCTCCATTTCAATTCAGTTAACGTTACTTGATCACCTATG
TTTAAATCCTAGTATACAGCTTCTTAATTTAGTATTGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCAAATAAATGCATGATAGTAAATGAAAAGAGAACAATTATT
TTCTATTTGCATAGAAGAAAGAATGGAAGGAAATATAATGAAATATTATTTTGATTGGCT
TTTTTTTTTCTTTTTTTTTTTCCTCTCCCCTTCCCATCCCAGACCCCAGTTGTCTGTTCT
CTGCATCTATTTGCTGTGTGTTCTTCTTTGTCCGCTTCTGTTGTCAGTGGCATGGAAATC
TGTGTTTCTTTTTGTTGTGTCAGCTCTCCGTGTGTGCGGCGCCATTCTTAGGCAGGCTGC
ACTTTTCTTTCGCACTGGATGGCTCTCCTTACTGGTCGCACTCCTTGCGCATGGGGCTCC
CCTATGTGGGGGACACTCCTGCGTGGCAGGGCACTTCTTGCACGCATCAACACTGCGCAT
GGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGCAGACCTCCCGCGTGGT
AGACAGATGCCCTAACCACTGGGCCAGGTCAGCTTACCTTGATTGGCTTTTGACTGTTAA
GAATTAGCTTACCATGAGTAATATCTTGTATTAAAAAAAAAACAACAATTAAAAACAGTA
AATTGTCCTTTTTTAACCACATTGGGTGTTTTAAGGTATCAGTAGCATCCTAGCAGAAGG
TCATTTTTATATGTTTGTCATAGTTGAAGAATAATCAAGCACACCTATTTTTAAATGACA
CCAAAGTGAGGACTGTTTCTAGCCGCAGAGGGAAACAAACAACTAATAGTGACTTAAATA
AATAAGGGATTATTTTTCTTACATAACAAAAAGTTTGGGTATAGGCCATTAGTGCCTACT
ATTTAAGAACTCTGACCATAAAAAAAACTCCCCACTGGGCTTTCTTTTGCTACCTTGCTA
GCATTCAGCCTGTTGGGAACATTCTATTTCCTTGTTTTATTTTCAAAACATTGCTTATAT
CAGCACTGATCGAAGAAATAATGGAAATTACATGCTATTTAAGGCTATTAGTATAAGACA
AGGCTACATACAAACGTGCTCTACATGGATAATCCAAATAATCTAGGTTATTAACCAGTG
TTATGTAGTAGAGCTCAGAGAAGGAAGCTGGCTCCAGAACCCATTCCTGGATATAACCTT
TATACTCTTGTTATTGTGTAGGGCTGATTGGAAACAGCTTTGGATTCTTTCAAGAGGCTA
TCTTGAAGATCTTGTTTCAAGCTTCAGAGGAATTAAGTTGGTTTTGATAATTAAGCAGTG
GAATGACCACATATTGAATTCTGTAAATAAAAGATTTATTAACTTAATTTGCTACACATA
ATAAAAATACTTTTTACACTGTAAAAAAAAAAAAAAGAACCCTGAAACTCTTGTACTGTT
ATTATTAATTGTTGACTTTTTAGCAGCAGCATCTTGTTCACAAGATGGATGCTACAGCTC
TAGACATTCCTTCCATGAAGAAGAAGGGATATTCAGTTGAGATGGTCCCTTTTATTAGGA
AAACAAAACCCTTCCCAGAGACTTCCAGCAGACTATCACTTACTCCTACTATTGAGAACT
GAGTCGCATAGCCACTAGTTGCAAGGAGACTAGGCAAACAGGCATTTGGCTTTCCAGCCT
ATCTAGTGGGAGTGGCAAGGGAGTTAGGAGTGACTTTGGATAGCACTTTAGCAGTGTCTG
CTTTGTGGTTACTGTTATTCCAGATTTGGGGAGGGAGGTTGCAGGGTATAGTTTCTAAGA
AATAAGACCTTTTCCAACTGAGATCTTGAAAGGATTCTTTAAAGGTTTTTTCCTGGGGTC
TCATGTTTATATTTTAAAGCCTAACTTCATTGCCTTTCTTTCTTTCTTTCTTTCTTTTTT
TTTTTTGAGTGAGGAGATTCCTTTATTTTTTATTATTAAAAAACTGAAGAAATACAGAAT
AGCAAAATGAAGAACATAAACGTATAACCTGGGTATCAGGAGGAAACCATGATAGCTCAC
TGTATTAGTTAGTTGTTGCTACATAACAAATTACCACAAATTTAGTGGCTTAAAACAGCA
CACATTTTTATTCTATTACCATATATACAACCCAACATTTTAGAAAATTTTTTAAAAATC
CATGGGACTTAGTACTACACAGTGAACCCTAAGTTAAACCATGGACTAAGTTAATAGTAC
AGTGATAAAAATGTGCTTTAATCAGTTATAACAAATGTACCACACTAATGCAAGATGTTA
ATAATGGGGTGGTATATGGGAATCCTTTATTTTACTCATGATTGTTCTGTAAACCTACAG
CTTCTCTAATAAAAAAAGAAGCAGCCAAAAAGGTGTGGTAAAAAAAGCATTAGCGAGATT
TGCCAGGCAGTTATAACTTCATTCCTTTTTAACGAATAAACTAGGGAACAAGCAGACATT
TGTTGTGTATACCAGAACCCCTGGTGCCTCTGATCCATTAATACCTACATAGCTGAGCAT
CTTAGGAGAAAATCATAAGGGATCTCAAAACTGCCTTAGTCTTACCGCATTTTTCTTATC
GGTCTTTCTCATTCTCAGAAATGCCCCTTGTCATATTTTTTCTACTGTCTTCAAGCCTTT
GAACCACTCTTTTTCTAACCTTTTTACTCCATTGAAGACTTCATAATGGAATTCCCACTT
CCAAATCAAGAAACATATTTGCATTAGTACCATTTTCTTCTTGTTAGAACGGAAGGAGTA
TTCTTTCTGGTATCAAAGGCATTCCTACCTTTTGTACTCTGTACTGCATTGGCCTCTCCC
TCATCTTCAAACTCTCTTGCACTATTAGATTACTAGATTTTCCTGCTAGCATTTTACTCG
GGTCTTGCCTATCTTTAAAAAGTCTTTCTTAGATCCACAGCCAAATTCTCTGATCACCTT
CCATTCTTTTTCCAACCCCTAACAATCTGACCTTTGCCATTGGATGCTTTTTCAGTTTTG
TCTTGACTTTATAACACTATTTAACATAGTCACTCCTTCCTTGAATATTCTTCCCCTTGT
TTGTGTGGACACTATACTCTCCTCTGACTCCTTTTTTCTCATATCAGTGGTTCTCAGAAT
ATGGAGTCCCTCAGATATTTTCGGGAGGTCCACAAGGTCAGAACTGCTCAAAAAAAAAAA
ATACCTAGATATTATTTGGCCTTTTTTACTGCATTANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCAGACATTTTCTC
AAAAATAAATGAGCTAACTATTTTAAGGAAAATAACATTTTTAGTTGTTGCTAGTGATAA
AATTCCAGCTTTAAAGAGAAATCTAGGACTTTAGAGAGCCTGTGTCTGCTACTGTGAACT
CGACAGCGTCCCAATACTTAAAAGCCAATGAGATCTGTGCAGATTTTTAAAGAATGTGAA
TATTTGTATATACATAGAAACATATACACAATGAAATGTTTGACGGCATTTGGAGGATCT
GTATAGCTCATTGAATCAGTAGTTTCCAAATAACTTACATATGATCCATTCAGCGCGTAA
GGTATACCATTGGATTTTAATGTAGCAAAATACAAAACGGTTCACTGGTAATTGTTTTGA
ATTCTGTGTTGTGACTATTCTTTAAGAAACTGCCTTTTGTCACGTTTAGGTGTAGTATCA
AAGAAGAAGGTTAACCATTCTCTGAAAAGGCTGTTAAAATATTTCCTTTCCCATGTATTT
GCCTATGTGGCCATACTTTCTTCGTATACTTCATTCAGAACAGCATTACAACAGATTGAA
CACAGATGCAAATATAAGAATCCAGCTGCTTCTATTAAGAACTTAAAAGAGATTTGTAAA
AAGTAAAATAATATTACCCTTCTCACTGATTTTTTTTGGAAAACAATTATTTTCATAAAA
ATGTTATTTTTATTAAGATGTAATGAGTTTATTATGTTATTTTTAATTTAAGTATTTTGA
AAACATCTCAGTTTTAATATCTAATACAGTAAATATAGATACGTTTAATTCTCATAAACT
AAAGCTCTCTGGGTTACTGGATACTTTTAAAATATAACGGGGTACTGAATCCAAAAACTG
AGAACTGCTGGTCTACACTGCTGAGTCGTCATCTACTTGTCCTCTAAATATTGGCGATTT
CAGGATTCAGTCTTTACCCTTCTTCTTACTTCATTTTCCTTCCCTAGGCCATCTCATTTG
CCCTCTGTATGACTGTATAAGTCACCGCCCGTGTACATATTTCTCTTAACTTTGTCACAT
ATATCCAAGAGTTAACTAATTTGTATATCTTGCAGGTACCTCAAATTCAGCATATCTTTA
AAAACAAAACAAAATGAGGAGGAGGGTGAGAGAAACTCAGAGATGAGAGAAAAGGGGTGG
CTGATTGCTACCTCCCTTTCCCCACATGCGCTCTAGCTCCGGCTGCCTGCCTGCCACGTT
TACCCTGGCATCGCCCTGTGATCAGATCAAGGAGCTGAGAGAGGCCTTGCCTGGTGGTCA
TGTGGTAGTGACAGGAACTCGGGCTTCCTCACTCTCTCCGCCCCTGCCCACTCCCCAGTT
CTTATCAGCCCTGCGTAGTTGGCCTGCAGTCCAAACTCACTTCCCTTCAGCACCCCCAGT
ACTGGTGCTGCCTGGAGGTGGCTGCTTTGGGGAGGATGGCCCAAGCAGCCATGTCTGCCC
TGCCTGAGAGCAGAATGGTGGTGACATTCTTCATGTCTGCTCTTGAATCAGTGTGTAAGG
AACTGGCCAAGGCCAAGGCAGAAGTAGCCTGCATTGCAGTATATGAAAGAGACTTATTGT
TGGAACCAAGAGAAGACTTGCTTTTGTCAATACCAGGAAGGATTTTCAGAAAGATTTTGT
AGAATACTGCGTTGGAGAAGTAAAGGCTGCAGAGATGCATAAAATGACAGCTACAATCCA
GCAAATCAAATGACTGTAGATGCTGTGGAAATTGGAACACTTGAGAAAAACAGTTTGAGG
ACTATTTCTGCTTTTGCTATGGAAAAGCTTTAGGCAAATCAACAGTGGTATCTGTTCCAT
ATGAGAAGATATTAAGAGACCAGTCAGCCTTGGTAGTCCAGGGGTTTCTTGAAGGAGTTG
CTTTTAAATACCCTGAGGGGAGTGGGTGTAGCTCACTGGTTGAGCACATGCTTCTCATGT
ATGAGGTCCTAGATTCAATCCCCAGTACTTCCAAAATGGGTGGGGGGTGTTGGGAGAAAT
ACCCTGAGAATTAAGATCTTGCAACCCGGAAATGGATATTGGAGAATAAAGCAGGGATTT
CATTTATCATTAAGAGACCTTTTCTAGAGCCAAAGAAGCATCTACGTGGTTGCATGGTAG
TAACAGGTGGTGAAAGGTCAGTTCTGTCTCCATGCAGAAGTTGTGGCCCCATCAAAGTGA
AACCTGAACCCATGGAAGACTCTGGCATTTCCCTAGAAATGGCAGCTGTAAAGGAAGAAC
CAGAAGATCCTGGTTACTCTCAGTACAACATTCAAGGATGCCATCATTCTTCAAAAGGCA
ATGAAGGAATAGAAATGGAAACACCAGCTGAAGATTTTAGTCAGCATGTCCCTTCAGAAA
CAAGTGAGGACCCTGAAATTGGGGTGACTATTGAAGATGATGATTATTCTTCACCTACCA
AGAGACCAAAAACCAATGAGCCATCACAGCCCCGTTACTGAACCTGCCAATACTGAAAAA
TGGAAAGTGAGGTAGTTCAACTTTGAGAAATGAAATGCTTGAATTATTGATCTATGTAAG
CAAAGGAATGGATTTGTTTTATGATTAAGAAGCATGAACTTCTGAATTTAATGTGATTTA
CAACTTGATAAACCGGCTTCAGGAGTAACGGAAGATTAGTAACGGCTTCAGATTCACTAA
GAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAAGTGTGAAG
CCAAGGCTGTACCTTACCAGAAATTTGGGGCACGTCCTAATGATGTCTTTGTAGAAGATC
TACCAGAATACATTCCTTTTAGAAGTCCCTCATGGTATAGAATTCCAAGGCTGGAAAAAA
AATTATTCAAGTGGGCAGATGAATTATATTTGTTGTTAAAACACCAGAACTTCTGACTCT
CAGTACCCCTAAAATTGCTCAGCCAAGAACAAATATGCCAGGCAAAGAAGTTTCAAATGT
AAGGATTACCAGGCTATGCAAGCAAGTGGAAGAAAATTTTTATTTAGAATTTGCTCAAGC
TCTAGGACTCACAGAGGCAGGAAAGTACCACACCCTGTGTTTGAAACAAATCCTGAGTTC
CTGTATGAAGAAGGCTTGCCAGAAGGAATTCCCTTTCCAAGCCCTAGCTAGTTTGGAATT
CCATCACTTGAAAGGATTGGGGATGGATGTGGCTCTAGTGGTTAAGGGCCTGCTTCCCAC
ATGGGAGGTCCGAGGTTTGGTTCCTGGTGCCTCCTAAAAAAAAAACCAAAAAGACAAACA
CAAGCAAACAAACAAAAAAACCAACTTGGAGCAGATGTGGCTCAGTGGTTGAGCGCTGAC
TTCGCACATATGAGGTCCCAGGTTCATTCTCTGGTCCTGGTACCTGGAAAAAAAAAAAAA
AGATTGTGCGTGGGAGTAATAAAATCAAGTTTGTTGTTTATAAACCTGAACTAGTTATTT
CCTATTTGCCTCCTGGAATAGCTAGTAAAATAAACACTAAAACATTACAGTTCCTGAAAA
AGACCATGAAATCCTGGGACAATTCAAAGGTTCCTGAAGCTTAATCTGAAGCTTAAGATT
GTTTACAAGTATTTGGGTAAGCTAAATAACACTACAGCCTCACTATCATGTAACTTATTA
TGGCATGGAATTCTTTGGAACACTGCCTCTCAGATTAGGCTCAAGGAGGTTCCATTGACT
TCATTATTTTATAATTCTACTTGTAACATTGAGGCTCCAGTCTGGGAAGTAAGGGGTCAA
CAAGCTAATTATGTACCTCCAGTATCTTCACCTGTTGTGTCAAGATTTCACAAACAAGAG
TTGTAAAATACCAGCTATATGAAAAGCTAGAGTATTGTGATAGCATAGTTTTATTAGCTT
ATCGTAATATTCACAGTGGAGAATTATATTACACAGTAGTAGAAATAGATATTTTTATGT
GTTGCTTATATTTTACCTCAAATTAAATGGTCACTTCTCTTAATCTTCAAACCACCTTTA
TCTCTACTATTGTGGATTATTAGTTAGTATCCCTCTTTGTTCATTTTCTACATTGTACAT
CAGCAATCTTATAAAATGTAAGTCCCAGTCACTCCATTGCTTATGGCTTCTTAACCAAAG
GGCATGAAACGTTCATTATCTCATCTTTGCCTGTTTCTGTAACCAGTCTTGACCCATTCT
CTGACTTGCTCCTTATACTTCAGACTTAGCTTCCTTCAGTTTTTTGAATGCTGCATGCTC
CTTTCTGCCTTATTGAAGCATCCCATCCCAAAGCCTACAACGATTTCCCATACTCAGCCC
TCTACCTGACTAATATTGGAGGGAGTGACAGTGAACTAGGTGCTACTTTTTCTTTGATTC
TTCCATTCTCAACTTAAACTTCCCTTCCCATAGAGTATTCCTTGATATCTTTCAGCAAGC
CCCTTAATTCAAGATCTCCAATTATATGCCATCATAGCATTCTCATGGTGCTCTGTTGCA
AGGATCAGAATTTTAGTCACTTAAATATTTGTCTGTTACTCCACTAAAGCAGAGAGTAGG
TTTTTCTTGGTCACTGTTATAGCATGGTGTCTGGTACACAGTAAGCATTCAGTAAATACA
TGAATGAATGATTGAAAAGCTGTTGCAGTGTACTGAAAAACCAAATGGAGTAGTGGAAGG
AGTTCTGGACTAGGAGGTAGGAGATCTGGGTTGAATTTTACTTTTGTCGTTAGCTCTTGT
GCCTTCAAGGGTTTTAGTTTTCTAACTTCACAGTAATATTGGTATTGAAAATATAATCTC
AATACCTGTTAGACTACACACTTCTTAAACAGGAATTCACTCAGCAACATTTGCATGCCT
ACCATCGTGCTAAAAACATAGGCCCTGGAAATACCATAAAGACCAAAACAGACATTCTTG
TTTCCATGGAATTTATATTCTATTGGATTTGTAGTTGGTTGCGCTTAAGGTCCCTTCCAC
TCAAAGATCCAATGACATGAAACGATGTATAGTATGTATCCTATTTTGCAGGTTAAATAT
GAATTGATATCTTTAAAGTCTAGAAATGTGCACCTTTATTTTGTATCGTTGAAGTACTTT
TGTTTTTGTTTTTTAGTCCAAACCATATGCATTTGATCGGGTGTTCCAGTCAAACACATC
TCAAGAGCAAGTATATAATGACTGTGCAAAGAAGATTGTTAAAGGTAAACATATTTAACC
TGCTAAGTTGTTCTAGTAATAAGTAAAATTTTGTTTGTGATCTTTTCCCATTTACCCAAC
TTTCTTGTTTTTATTTTCACACCTCTTCTAAGTTAATCACAGAAGAAAGTTGTTACAGTA
ACAATTTTTTTAGAAGGTTGAGTAAAATTAGTATACATATGGTTGCTCAAATTCCATGAT
ATAATCACATACATACCTAGTAAAAGGGTGTTATAATTATAAGAATGATAACGTTACACA
CTTAATTCTTGGGGAATGCATTTCTATTAAATATTCCCAGAAGAGTTTCCAAAGTAGCAT
AGTAGAAATAGAACAAGCAGCATGAGAATGAAAGCAATATGGTTAGAAAAGTTTCTAAAA
AGTAGTAGAAAATGGCATTCTTTATCATTCTTGAATTCTATTTTTACTCCTTCCTCAAAG
ACTTATCTTGTAGTTAAAAAATTTCTGAGAATTTAACAGGGATTGCCAAGGATGAGAAAA
GTATATGCATTACAGTTAGTCCTATTAAACTATACTAAGAAAGTTTTCAATTTCATATTT
TTGAAAACCATAGAACTTTAGAGCTGAGAGGGTACTAAGTGATTATCTGGACTTACTTCC
AATTACAACAGAAATCCCTTTTATCCACGGGATCTTAAAGTCAAATAATCACAGCTTTGT
ATTATGATTTATTCCAAAAGTGCTGTTAGATTGAAGCAAAATCTGTCTTGCTGTGGCATT
CACCAGGGGAGAGGGGTTGGAATTCAGTATAAAAGTAGAGGCGGGGAAGCAGATGTGGCT
TAAGCAGTTGAGTGCCTGCCTCCCACATGGGAGTTCCCGAGTTTGGTTCCCAATGCTTCC
TGAAGAAAAAAACAACAGGCAAAACAGATGGGGGCAGGAGGGGTGGCTCAGAGAAGCTGG
TGTGGCTTGGTGTTTGAGCCCCGGCTTCCCACATACAAGGTCCTGGGGCTCAATCCCCAA
CCCCCAGTACCCCCTCTCACCCCCCCAAAAAAAAGAAAGAAAGGGGGAAAAAAGTGGAGG
GGCACAGTTACAGTAATGGGAGAGAAAGCAGAGTTTATAGATAGAAGTAGGTTTATAGCT
GTGCAAAAGGGTAAAGGTGGACATTCTCTTCATATTCCATTTTATCTATGATAAAGGGAG
CAAAGTCCTCGCACAGAATGAGATTGGGTAGGAGGTCTGAGAAAAAGATACAAAAATCAT
GCAGGCATATGGAAGTGATTGGATTAGAGATGTGTGGCATCATTGCCAGGCAGCACTGAG
GAACCACTTGAGGTGACCTACTAGAAGAGTTGAATTTAACCAGGTTGAGGTTTTGCCAGG
AAAAGAGAAAAGAGCCGCAAAGAGAATTGAGCATGTAGTTAAGGGAACAATAATGGTGGG
CCATGGAACCTAAGGTGGTGAGGAGAAAGAGAATATGAGGGGAGTGGGAAACAGTGAGAA
AAGGTGGTAGGGTTAGTCATTTATAGGTGTCAGTGGGGTCAAAAGATTGTTGGACTCAGG
GAACTAGAAGGAGTAATAGGGGGTTGATACTATGAAAAGATCTAGGGTATGACCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGATTATCATTGTC
TTTTGCTTTTGACATACTTTTGTTTTTCAGGACAGCCTAAGATTATATTAGCTTTTAAAA
TAATATAAAATTATTGATTCATGAACTCATGGGCAATTTAAATTTATAGATTTTTTACAT
CAGCTGTAGCTAGCTTTAAACCACATTCCATACTTGGGCATTTGAGTTTTTTAATGAGTA
CAAGTCTTTAAGTGTAAATTTCATTTTGTTTGTTTTATCTTGATCAGATTTTGAGTTTTT
TTCTTATACTTATCTTACGAAATTGACTCCTAAATTGACTGTCAGCATATTTGATAAGTA
CTATGATATCAGGGACATTGAAGTTTGAAAAATATTGTTCTAAATCATTTATAATATGCT
TGATGAGTCATGGTCCTTAGCCCAGTCTTGTAAAAACTACACAAGGTTGTTGCCAATTAA
TTTGTTTCCTCTATTTTCTGAGAGGAAATTATTCTCTTTGTTTAATCAGCATAGTTGTCC
TTGGGGGCATCCTAAGCTTTTACACACTACAAAGATTAAAATATTCTACTTTTAGAAGAA
TTAGACTTTTAGCAGTTGTTAGAATAGAAAGTTTCTTTCCCTGTTTCTTGCTTCTATGCT
AGCTTTGTAATTTATATAAAAGATCACCTGGATATTACTTTGTCCTTTTACCTTCTCACC
CAAATGTTTTTCACTATGTTGAAGGAACTGGGATATAGTAGCTAGTGGGACTTGTCATGA
GGGTAAAAGAGTCTAATCAAGAATGTGGATGTGATGATGGGATTATCAATTGATACTATA
TAGATTTAAGGGGAGAGAAAAGCGGTGAGGTAGGTTTTGGGTGCTTATTGAGATGTAGGG
ACAGGAAACAAATTAAATTCATATCAGGTTAGAGTTGGAACAGACAAAGCAGATGAGGAA
GCCAGGAGAAGGAGATTTGCATGAGCAAGCTGCCAGGAAAGACCTGAAAGCAGCAGGTAG
TTCTCTTTGGGCCCCTGACAGTCCACTGTGATTGCATTTTTAATCAGTTCATACAAGTAT
ATAATTTTATTATATGTATAGCTGTTACCTTTCCCTTTTTGTAAATTCATTAGATTTGAA
CAAGGTTTACCTACTTGTATTCTCTTTTAATTCTAAATCTGAGTGATTTCCTTAAGTTTG
TTTCCCCTGTAATAAATAGGTACCGTTTTTTGAATACCAGGCATCACACCAGGCCTTCAT
AGATGCCCTGGTTTCCTTGCGTGATTTCCTGACCTGAACGATCTATACTGTACCCATCCA
TGATTTTTCCAGATGTAGCTTGCCATGTGTTTAATACATATTCTCCTTTAGAATATACAG
TACAGTGGTTATGAGTATGTCTCTCAACCATACCTCATTACAAAAATTAGCTCAAAATGA
ATCAAAGACCTAAATACAAGAACTAAAACTACAAAACTCCTAGAAGAAAACATAGGGAGA
TATCTTCAGGACCTTTTATTAGCCAGTGAGTTGTTACACTTTATACCAAAGCATAAGCAG
CAGAAGAAAAAACAGATAAGTTGTCCTTCAGAATGAAAAACTGTTGTGCAACAAAGGACA
TTATCAAGAAAGTGAAAAGACAGCCTCTACAGAATGGGAGAAAATATTTGGAAATCATAT
ATCCGATAAGGGTATAATATCCAGAATATATAAAGAACTCCTACAAGTCAATAACAAAAA
GACAAACAGCCCTCCCCCCCCAAAATGGGCAAAAGATTTGAATAGACATTTCTCCAAAGA
AGATATGCAAATGGACAAAAGGCACATGAAAAGATGTATTAGAGAAATGCAACTCAAAAC
TGCAAGGCCAGTAGAATGGCTATTATAAATAACCGTTGGGAAGGATGTGGAGAAATAGGA
ACATTCATACATATTGGGAGAGTAAAATGCTGGCAGTTGTTCAAAAAGTGAAGTAAAGAA
TTACTATATGAGGGGAACAAATGCGGCTCAGTGGCTGAGTGCCTGCTTCCCATGTATGAG
ATCCTGGGTTCAATCCTTGGTACCTCCTGGGAAAAAAAAGAACTACTATATGACCTTGCA
ATCCCACTTGTAGGTATATATCCCAAATAATTGAAAGTGGGGAATCAAATACTTGTACAC
TGGTATTCATAGTAGCAATATTCACAGTAGCCAAAAGGTAGAAGCAACCTGTGTCCTTCA
ACAGATGAATGGATAAACAAAATAGTACATACATAGAACAGAATATTATTCAGCTGTAAA
AAAGTTTGAAGTTCTGATACATGCACCAACATGGATAAATCTTGATGAAACCATGTTGTG
TGAAATAAGCCAGATCAAAAAGAAGACAGGGCAAATATCATAGATATCACTTATGAAATA
ATTAGAATGTGCAAATTCATAGCATCAGAAATTAGAATACAGGCTAAAAGGGGTAGGGGT
GGGAAATAGAGAATTAAGGCTTAACTGGGGGAAGTGGACTTGGCCCAGTGGTTAGGGCAT
CCGTCTACCACATTGGAGGTCCGCGGTTCAAACCCGGGCCTCCTTGACCCGTGTGGAACT
GGCCCACGTGCAGTGCTGATGTGCACAAGGAGTGCCCTGCCACGCAGGGGTGTCCCCCGC
ATAGGGGAGCCCCACGCGCAAGGAGTGCGCCCCGTAAGGAGAGCCGCCCAGCCCGAAAGA
AAGTTCAGCCTGCCCAAGAATAGCGCCATACACATGGAGAGCTGACGCAGCAAGATGATG
CAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATAAGCTCATGTAGCTTTGTTTAACTTGGTGTTTCCCTTTATGCAGCCTACTGTACTG
AGACATAAGTTTGGGAATTTCTGTAGGAGAGACGATAGCTATAAACCTGGATTAGACTTA
AGAATGGAAGATTTTTTTTCTTTATTGCATTGATCTCAAATTATTTGTGAAGATGAGCCT
TAGCTTCTCTGTCACCACTGTGATTTCCATCTGCAAGGTCTTTCAGAACATTTCATAGAA
CTGGATGCCTTCCTCTCAGGGAGTGGTGTATTTGCTTAGGCTAGACTTTGGCATGTTTCT
ATATCCTATTAATCTACATGGATCTGTCCACAGAAAAGAGAATTATAATACTTTGCTTGT
TGGAAAAAAAAAAAAAGAGAAGCATTTCACAATGCTCTTTTGTGTCTTAAAAAGTGAACA
GATTTATGTCTGCTTCTTGGATTTTTAAGTCCATCTGTGTATTGAACCTAGGCCAAATAT
GAACAGAGGGCATTAGAGGATCAGAGAGGAACTTGCTTATGTTTAGAAGCAGTGGTTCTT
CCCAGATGTTTTTAATACCTGCAAGTATCTCCAATTATTTAGGTCTTCAGGTGTGTCTTT
CAACAAAATTAAATTGTTTTCCATAAAGATATTGCCCATCTTTTGTTAGCTGAATTTCTA
GCTATCTCTTTTGTTTGTTTTTGTAAATGTTTTCTTTAAAAATTACACTTTCTAAATTTT
TTTACTGATGTATAGGAATTCATATTTGCATATTGATATTATATCCAATGAGGTTACTAA
ACTGTCTTCTAGTAAATTGTCAGTAGTAATTTTTAGATACATCATGAAGATAATTATATC
ATCTGAGATGATGACAATTTTGTTTCCTTCTTTGTAAAACCTGTACAGCGGGTTCCAGAC
CATTGCAATAAAGCAAGTATCTCAGTAAAGTGAGTCACACAAATTTTTAGTTTCCCAGTG
CATATAAAAGTTATGTTTATACTATACTGTAGTCTATTACATGTACAATAACCTTATATC
TAAAAGAACAATGTACATACTTTAATTTAAAGATACTTTATTACTAAAAAATGCTAACCA
TCATCTGAACCTTTAGCAAGTCATAATCTTTTGCTGGTGGAGGGTCTTGCCTTGGTGTTG
ATGGCTGCTGACCGGTCAGAGTGGTGGTTGCTGAAGGTTGGGGTGGCCACAGCAATTTCT
TAAAATAAGACAACAGTGAAGGTTGCCATGTCAATTGACTCTTCCTTTCATGAGAGATTT
CTCTGTCACACGCAATGCTGCTTGATAGCATTTAATCCTCAGTGAAACTTTTCAAAACTG
GAGTCAATCCTCTCAAACTGCTTTGTCAATTAAGTTTACTTAATATTCTAAATCCTTTAT
TTTTCATTTATATTTTCTTTATATTTTCATTTCAACAATGTTCACAGCCCTTCACCAGAA
CCATCTCAAGAAACCACTTTCTCTGCTCATCCATGAGAAGCAATTCCTCATCCGCTAAAG
TTTTACCATGAGATTGCAGCACTTTCGTGATATTTTCAGGCTCCACTTCTAATTCTAGTT
CTCTTGCTATTTCTGCCACATCTGCAGTTACTTCTGATACTCAGAACCCCTCAGAGTCAC
CCATGATGGCTAGAATCAACTTCTTCCAAACTCCTGCAAATGTGGATATTTTGACCTCCT
CCTGTGAATTACTAATGCTTTTAATGGTATCTAGAAGATGAATCCCTTCCAGAAGATTTT
CAACTTACTTTGCCCAGATCCATCAGAGGGATCATTATCTATGGCAGCTGTAGTCTTATG
AAATATATTTCTTAAACAATAAGACTTGAAAGTCAAGATGACTCCTTGATCCATGAGCCT
GCAGAATGGATGTTATATCAGCAGGCATGAAAACAACATTTATCTCATTGTATATCTCCA
TCAGAGCTCTTGTGTAACCAGGTGCATTGTCAATGAGAAGTCATATTTTGAAAGGTAACT
TTTTTTCTGAGTAGTAGGTCTCAAGAGTGGGCTTAAACTATTCAGTAAACTACGTTGTAA
ACAGAGGTGCTGTCATCCAGGCTTTGTTGTTCCATTTACAGAGCACAGGCAGAGTAGATA
TAGCATGATTTTTAAGAGCCCTAGGATTTTTGGAATGGTAAATGAGCATTGGCTTCAAGT
TAAAGTCACCAGCTACATTAGCCCCTAACAAGAGAATCAGCCTGTCCTTTGAAGCTTTGA
AGCCAGGCATTGAGTCCTGTCTAGTTTGAAAGTCCTAGATGGCATCTTCTTCCAATAGAA
GGCTGTTTTGTCTACAGTGAAAATCTGTTGTTTAGTGCAGACACCTTCATCACTTATCTT
AACTAAATCTTCTGGATAACTTGCTGCTTCACCTTGTAACTTTATGTTATCGAGATGACT
TCTTTTCTTAAACCCCATGAACCAACCTCTGCTACCTTCGAATTTTTCTACTGCAGCTTT
CTTTACCTCTCTCAGCCTGCCTTCATCATAGGTTTCTCTCTATTGTAAGGAAGCAGTATA
ATGGAGGTTATTGTAAAAAGGGGGGTGGCAGGGGGAGACCCAAAGGTCAGATTTGGATAA
TGTGCTAGATTTGGGACATTTTCTTACCAAATTGCCTGAGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGGAACCTGAGACCTTCCATTATGGTAAGCGGAATATCTAACAAGTGAGAGCAACATCC
TTTTGCTCCACCTACACTTTTATGATTTGGATACGGCTTCTACCCTTAAACCTCTTGGAT
CAACCTCTTCTAGCTTCAAACATCTCTTCTGCAGCTACCTCACTCACTCTCTCAGCCTTC
ACAGAACTGCAGAGAGCAAAGGGCCTTGTTCTGGATTAGGCTTTGGCTTCAGGGAGTGTT
GTGGCTGGTTTGATCTTCTGTCCAGACCACTAAAACTTTCTCCACATCAGCAATAAGGCT
GTTTTGCTTTCTCATTATTCATATGTTGACTGGAATAGTGCTTTTAATTTCCCTCAAGAT
CTTTTCCATTGCATGCACAACTTGGCTAACAGTTTGGCACAAGAGCCCTAGCTTTCAGCT
TTTCTTGACTTTTGACATGCTTTCTTCACTAAGCTTAATCATTTCTAGCTTTTGATTGAA
AATGAGAAACATGTGACTTTTGCTTTCATGTGATCACTTAGAGGCCATTGTAGGGTTATT
AATTGGCCTAATTTCAATATTGCTATGTCTCAGGGAATGGGGAGACCTGAGGAGAAGGAA
AGAGATGGGGGAATGGTGAGTCGGTGGAGCAGTCAGAATACACACACCGTTTATTGATTC
AGTTCAACGTGTTATATGGGTATGGCTTGTGGTGCTCCCAAACGGTTACAATAGTAACAT
CAAAGAGCACCAATCACAGATCATTATATCAGATATAATAATAATGAAAAAACTTGGGAT
ATTGTAAGAATTATCAAAATGTGACACAGAGAGAAGTGAGCATATGCTGTTGGAAAAATG
GTGCTGCTAGGCTTGCTTGACACAGCATCACCACGAACCTTCAGTTTGTACTAATAAAAG
ATGCATTATCTGTGAAGTACAGTAAAGCAAGGCATAATGAAATGAGGCATGCCTGTACTT
TTATTTCTTTTTTCTTGTCTAACTACACTGGGTAGGGCCTCCAGGACAATCCAGAATACA
AACAATGATAGCAGCGGCCTTTGTCTTGTTCTCGGTTTTAAAGTGATGGTTGCTGTAGGT
TTTTGGTAGAGATCCATTATCAGGGTAATGGATCTTGATTGCTCCTTGCCTGGATTGAAA
TACTCTTGGAAAATAATTCCCTGTTTAACTCCCTTTAGTCTCTCCTGAACACTGTAGCTA
TAATCTTTGTCAAGTACCACCCAACGATGCCAATCTTCTCTGCTCCAAAACATGTAGGGA
CTCTCTTTTCTTTACTAAAATGAGTTTGAACCCCCCGGCTTGGTCTCTCTGGTTCAGAAA
CATCTTCCACCATATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGTGGTGGTATGG
GTGCATTGTGGGGAGAGAATGGTCGTCAGGGGATGAAAGAACTCGTTGTCTCCTATACTT
TCAGGAGGGAAATCACATACACACCTGGCAGGGAGAGGCTCCAAGGATAAACAGCTGATG
GTTATTCTCACAAATACTCCTCCGTGTCCAAAGATAATTCCACAGAGCAAGAATAAATCT
CCCTGTGGACACTTTTTTTTTTTTTTTGAGGTACCACCAGGGATTGAATCCAGGAATTCA
TATGTGGGAAGCCAGCACTCAACCACTAAGCTATGCCTGCTCCCTGGAAAACTTTTTTTT
TTCCTGTTTCTTTCTCAGTAAAGATAGAAGAAAAATGATATTCAGATCATTGGCAACCTT
CTGCCACTCCTCTTGGTTGGTCATAGAGATTATTAGATTACTTCTTGGTTATCTCTTAAG
GATAAATAATTTCAGTTTCCTTGACATCTCTCCTGGTGCCCATCTTCTCAATTTTTAAGT
GGGTCTTCTACTTTCCTCTGTCTCCTTGAGTAATATTCCTCTTAAGCTGGGGAACAGCAG
TTGGGTCAAATGTATTAATAGGCAGGCCATATAGGTTCACAGAAACTTTGCTCTCAAGTT
GATAGGAATTCTTGTGATTCTATTTCTTTCATAACTCTAGAAGCCTAAGAACCATCTTCT
GTTATTTTTTTGTACCTGGTCCTGGTAAGTCATTAATTTTGGTTACAGTGATCCAATGCA
ATTAGTACTGCTCTGCATGGAGGCTTCCTGGTAAAGCTGGGTGGACTTCATTTTCAATAG
GAGCGAATGTTGAGTGTGTGTGTCCAGTCCAAATTCCCTCCGTAAATTGCGGCAGCATTA
CCTACATGCAGGTAGGTCTTAGAGTTTAGTTGTCTTCTACTTAGCTGGTTAAATGCTTTA
ATTAGTGCTTCATTTGATAGGTCACATAATAATGTCCACGGAGCAAACTTGTTGAAGCTC
TTGAAGGAGAAGTTTGAGTTGTGATCTGTAGGATGATAAGTAGGAAACCAAGTGAAGATC
TGTGGTGAGAGAATTCTAAACAGAAGGAAGAATTAAGAGCAAAGGTTCTGAACAGAAGAA
TAAACATGGCTTGTTCACAGTACAGAAGGAAGTCCAGTGAGCTACAAGGTAGTGAGAGGG
AGGAGAATGCAGGGAGGTGAATTTGGAGAGGGTCTAGTCTAAGTACAATAGGAACCACTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTACAGGATGTAACAAGCCTTGTCCTTGGC
ACCCTCATAAGGAGTTATCTTTTTGAGGAGTCTGCCTGTCCTTGGGTGGATCCTGGTGTC
CAGAGCCACTTGTAGGAGGTGCAGGAGGTGGGGGGATGTAGGAAGCTCTGAGCTTTCCTT
GTTTTTTCCTTCATTTCTCTTATCCTCCCCACTGTCATTTGGGTAAAATGAAGATGAAGG
GCTGCCTGGGTGGATGGGGCTGTGGGAAAGGGCAGGGCGAGGGCCACCCCTTGCCTGAAT
GGCATTGGTGGGGACTTTGGGTGGGTTCTCAGGGAAAGTGGCTGTGTTTGTCTTGTCCAC
TGTCTTCTCCCAGTGTTCAGTGCCATGACTGGCACATAAATGCTCACTCACTCATTGTTG
AACCTTGAGTGATAGGAGGTCAGGACTCCTATGGGGCCGTGGCAGAGCTTCTCTTCCTTT
CTACCAGCTGCCTCCTCAAATCAAGCCACATCCAAGACCCCACATCCACCCTGGCTTACT
GTGCAGAAGGACCCCTTTGTCTCAAGGCTCAACCCAGTTAAGATAAGGCATCACTGAAGC
ACATGAAAGAAAACACTGTAATTCTTTAACACATGCTTGCCTCCTCTACCAAGTCATAAT
ATCTTTCTTTCATAACATATTTCACTGACAAGAGCATGAATCAGCTCTTGATGTCCTTCT
TAGCCTCATCTTGTATGACTCACCCTGCCGGTCCTTGGACACCCACCCCTCTCCTGTCTG
CTGGGCTTTGCCTGCAGTGCCCCTCCACAGCTCTTCACGTGCCTTGATCTTTCTGATCCT
TTAAGGATCAGCTTAAATGTTATTCTTCAGTGGGGCCTTCCTTGACCCTTGTCCCATTAT
TTTATGCCTAAGCATTTTGCATTTCCTTATGTGTCATCTTCCTTTTATTAGCTGTCTGCC
CCACTTGATTGTATGCTTCACGAGGGCAGAATTTTCTTCTGATTTGTTCAGCATGAAGAC
CCAGTGCCTGACTCAGTAAGCGCTCAATAAATTTTGTTCAAACAAATGCATAAAGCCCTT
CTTTCATCAGAAAAAAAGCCTTTTAAATTAAAAAGAAACCTTTTTTTTTAGCTCTTAAAT
TCTCAACATACACTGGAACACAACATGTTTGATTCATGCTGTAAAAATTCCCTAGTCTTC
AAAAGCAACTGCCTTAAAGGAATAAGGTTGGTGATTTAGTGCCAATGGTCTAACTACTAA
CATTAGAGCTTTTATTCCGAACCTTCTAATGTGTTTTTTTCTGCCCTTTTCTGTCTTTTG
TCTGTCTTTGTTAGCAAGGGAAGCCATATGTCTTCGACAGAGTGCTACCTCCCAACACAA
CCCAAGAGCAGGTTTACAATGCGTGTGCGAAGCAATTGTCAAAGGTAAGTGCTATTTCTT
TATTTCCTCCTGGGCCTTTCAGAGTAATTGAAAAACATTAAGTGATATTTGCAGCCCAGG
AATCAATGTGCCTTGGCTGTAAGCAGAAGCCTGCTAATTAGAAACACTGAATTATAGCCT
TAGCTTTGGCCCTGATGTCAGGCAAGTTATTTAACCTTTCTATACCTCCTTTCCAGGGAG
AGTTCTTTCTTTTGCCACCTTTTTTTTTTTTTTCTTTTAAGAATTATTCATTCTGTCACC
CACAAGCTTAAAGGAAAGGTAAGCTATGGCCACACTCCTTCTGAATGGTTTTAAAATGTT
GCTGTTGTTTCAAAGGACCTCCTTGTTCCTTTGAAAGAGAAGAGTACATATTCCAGATAT
ATTCCATACACTTTTATTTTATGATTTATTTTATGTAGCTGTCTCCTTTTTATTAGGGGC
TCTCAGAAAATATCCTTACATTTGGAGAATTCTTGTGCATCAAGGACTTTTCTACAGCAT
CATAAGATCACATTACCTTGTTGATGGCTGAGCTGTTCTTACTGCTTAGCATTCCTTAAT
TATATTTCATCTAACCTACTTTCAGCCATTCTACCACATCCTGACATTTGTTCCTCTAAG
TAGGTAGCCTCAAGCCTACATTTGTGTCGTAGAGATTAGCCGTTTTCCCTGGGACTGGCT
TTGGCCCTGGAGGATTTGTGTCAAAATAACAGCAGGGAGATGAAGCAATTTACACATTGT
TCTACCTGCCCTTTCAAATCAGGGGCAGGTTGGAACTTGCATTGGAGGAGCTGCCATCTG
GTAAGAGCTGGGGGGCTTTGTCTGCTACTTTGCTTTTCATCATCTAATCCTCCCCTTCAA
ATTTGCATGCTATGGCAATTGTGCTTTCAAATGTCTTGATGCCACCACCTTAATAGGTAG
CTCTAGATTTAAAAAGCAAAAGTAAAAATAAAACCAAAATATCTACCTTGTCATGTTAGA
TCTGCTTGTACTTAGAGGCTGTTAGCTAACTTGACTATTTGAAATTCATGAAAATCAGAC
GTGGGTACATCTATTTGATTAATTTTGACCCTGGGCACCTGTGTGGGAGATGCGCATCAG
TAAGTAATGTTCCTTGCTGAGGTGTATGATTATTCACTTTCTTGTTGCAGACATCAATTA
ATTTCGAAAATCTCCATAGTGAGATTATTATAGAAAACTGAAGAGAAAAATGTGCCTACG
TTTGAGATCTTACTGAATTAATAGCATGGGTCTATATTGGGTAGTAATTTTTGTTTTCCT
TCTATTTTACTCTTTTGCTTCTCTTTCTATCTAAATGTTTTCTGTCTCTTTTTGGAGTAT
CTATTGCTCCTACTCAATCCCTGTCCCCACTGTTACCAGACTCTGACATATTTTTATTAA
AGTAAGAATAATCACATATGAGCCAGAGTTTTTCTTCTTTTTCTCTCCCCCTTCAGGATC
AGAACCAAGAACAATTACCACATGGTGTGCTAAGCCTGAGGGCCATTTAAATACATCCTC
ATCCTCTAGGCTGAGGTTGTAATTAGAGATGGATGCACTCCATTAAAAAAAAATCCTGTG
ATTAACAAACAATAGTATCTACAAATCTTTGGGCCCTTTCAGTGTTAGATTTTTGTACAG
AATGAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGTATGTG
ACTTTACTACTGTGATCTAAAACTTCTTTGAAGGCACAGTACAACAGACATTACAGTGAA
GAAAGACAAAAGTCAAAATATTTTAAAAATATTTTCCATTATTTTTTAACATCCCAATTT
TTAAATTTTATCTTAGTTTTAGTTTTTCTAAATTATTATGTATTTTATTTCCTATATTTA
AACTGATATAGCCTGTGCATTAAATCAAAATTATCCCAAGAGTACCTAGTCTCCAAGATG
GCCAAATAAGTAATATAGGCCCTACAGTCTTTGAATGTTCAGAAGGGATGTGAGACTGAG
TGTGTATTCAGGGCTGCCTCCAGACGATGTGGAAGATATGCTAATCCAAACTGGCTTGGA
TGTGGAGAATATGTAACTCACCGGGAGGAAATAACCTATCTGATACTAAGATCTGAAGAA
CCTAACCAAAGGTCTGTTTACCATCACTGTTAGTCTTCCTAATCCTATATCCTCTGTATA
AAAGGGTCTGGAAAAGGCTGTTCGGGGCTCGGTTTTTATTAGGACAAGAGTCCGCCAAGC
CCGGCCGGTCGAAATAAACCAACTTCCTTCTCGGTATTCTCGTGTCCTGGCCTTCGAAAC
CGCGCATACCCGAATTTCTCCACTACACCTTGATATGGTAAACAGACATTTTAGGATGCT
ATAATGTAATAAGCTCATACTCATTTGTTAGTGATAAAGAGTACCTTATTATCTCAAAGG
GAAATTATTAAGGAGATCGTGAAGGTCCAATTTAACTTTTTAAATATACGCTGAGGCTGG
CCTGAAGGGAAGTGGCTACGTATTTCTGCCTCAGGAAGGTATAACATAGATCTATAAACA
AGAACTCCTTAGAATAGATGACTAAGGCTGAGGTATCTCTCACCTTGAGGAGCCTTGCTA
AGATCAGGGATGGCACACTGAAGGCCTTTTTTTCCTGTAGGCTACAAATGGAATCAGATG
ACTTCTGAAGGTCACTGCACCCCCATGATTCATGGCAGTGTGGAGAACTGCTGAGCTTTC
CTTTCGAGTCTGCCTAGACCATGAATGCTTTTGAGGGTCAGGAAGTCTGCTTTTAACTGG
ACAGCTTTATTCTCTCTTTGTTTCTTCATTCCCTACAATTCCGCTGGGTTTTCTTTAATA
TTTCTGAAGTTCAATTGTAGAGCTCTGGCATCGCCCACCCTCCCATCTTTGTCTGGTGTA
TGTTTTTCAGAATTTTGTCTGTAAAGAGCCTGTGGAATTTTCCTTCATTTCTTCTAGAAG
AGGTTGTAGGGTTTGTGACCAGCAGCATGGTAAATAGGAAGGCATCTGTGGGTGCCTAGG
AATTAAACACTATCGTTACGGGATACTATTGTGCAAGTTCTGGGTAACCATGGCCCAGCT
TACAGAAGCTGCTTTGGATATTTGCCCTCCAAATTAACTAAATGTGCTATATTCCAATGC
TTGGGAAGGTGGTTTCTTATTTTCCAGTTCTAATTCCTTTTAACTTCATTCAGTGGCTTT
TCTTTCATTCATTCATGTACTGAAGAGTACTAAGTACTCACCATATGGTAAGCACTGCTA
GGGGCTAGAGTCTCCAATACGTAAGACGGTTTGTAGGTTGCAGTCCAGTACAGGGAAGGT
GACAGGCGCATACATAATTTTGGTACATATAGGCATTCTGTTCTTTAAGAGCTGGTGTGC
AAGCTATGGGAGCACATGCCCAATTAATACTGATTTCAGTGGACCAGGAAAGCTAGTGAA
GAATTAAGGAAGATGTAGCAGTTTGATATAATTGATGAATTCCAAAAAGAAATATTGGAT
TATGCTTGTAATCTGATCTGTACCTGGGCATGATTGAGTTATGATTAGGGTATAAAAGGC
ATGGTGAAGAACAGAGTTGAGGGTTTCTTATGTTGGAGTTTTAATGTTGTAGTTTGATGC
TGAAGGCTTAAGCTGGATCCCTGGGAAGTAAGCTCACAGAGGAAAGAGAAGCCAGCCCCA
GGAATGTAGGAACCCAGGAAGCCTGAATCCTCGCAGTCATTAGCAGCCATCTTCCTCCAA
ACAGACTTTGGTGAGGGAAGTAAATTATGCTTTGTGGCCTGGTATCTGTAAGCTCCTACC
CCAAATAAACACCCTTAATAAAAACCAACCAATTTCTGGTATTTTGCATCAGCACCCCTT
TGGCTGACTTATACAGAATTCTTCTTGGAAGAGTGGGTGCTGAGGACTGTAGAACATAGC
AGGACAGTGTGAGCAGAAGGAATAGCAAAAGCATAACGGCTTTATGTGATGTGCTTGGCA
ACTAAGAGCCGTACAGGGTACAGAGAGTCATGATGGTAAGTGAGGCTTAGAAAGTTAGAC
TGGATCAGAGTTTGATGGAAATTGGTGAACTTTATCCTGTAGTCAATGTAGACACATTGA
AAAGTTTTCAGCTTAGGATGATCTCATTTGACCTATTTTATTATCATGTCATATACATCT
ACCAAGTATATTATTTTTTTAGCTGTTATTCTTTGCCAGATACTATCCACGCACTTTACG
TATGATATTGAATTTTAAATATTAGAAGTTTATGAAGTGTGAGCATTTTTATCCCCATCA
TACCAAGGAGGAATTTGAGGCTCAGAAAGGTGAAGTAAATCAACCAGACCAGCTTGGGGG
TAGTAAGGTGGGGATGGAGCCTAGGTTTTTCTGAATTATTGGTGGTCCTCTCTACTCCCC
TATCCTCGCTTCTCTGCTGGACCCACAATGAACATTTAACAACAAATATTTTTTGAGTTG
TTTTTTTTTTAATCTGGCCGAACTGACTATTAACCACATATTGCAAAAAGACAGGGATAG
GAATAGGTGGGGGGAGAGGAGTGGGAATAGAGACAGTGGTTCCAGAACCCCGTAGTGGCC
CTGACTGCCACCAATAAAGAGACTCCTTGTCATCCAGAGGAGGCAGCCTGCCCTCGCCTG
GGCACGGTGGCAGCCCTGCAGTCCGGCTGGGCCCAGCCTTCTGGTTGGCCCTGGTGTTGG
GAGGGCCAGCATACACCTTCCTGGATCATGGTCACCGTGGGAAGTTTTGTTGACTGGCGA
AAGTGTTAGGATTCCAAGCTGGGCTGATTTGTCAGCCACTATTGCCAGAGACCTTGGTGC
CATTGATGGGCCACATTTTATCGTGAGAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGCAATGCCTGGACTCAGAATTGAGCAGAGCTAGTACCAAAACTTGGCT
TCTGAGAGCTGCAGCAAGGAGTAAAGAGTATTTCCAAGTACCCCGCCCTCTCTTCCTTCC
TCTCTTGGGAGTGAAGAAGGCTCTTCCCACCTGGAGTAGACTCTCCCTGGGCTTTGCTCA
GCTGCTCGGCTGCTCGGGAAGTGTGGATTTGTGGTGTGCCGGCAGTGTGGTGCGAGGTGA
GATCACATCACCCCAGGCCCCGTCACAAAGAAAGGTTCTGTCCAGCTGAGCTTGTTCCCC
GACACCATGGTTGGAGTAAAGAAACAGTCATTCTCTTAGGGCAGAAACTCTGAAACAAAT
GCTTTCCTTGGGCCCAGGAACGGCCATTGGACGTGATGAAAGTGCCTTTCTGTGGGCTGT
TTGTGTTAGAGTCGAGCGGGGGTGGGGGTGGTGACCCAGCGTGGGGCTGAGCTGGCGGTA
GTTCTTTCTCTCACCCTAGCCTTCAGTCCAGCCACTCTGCGGCCCCTCATCTCTTGTCAT
TTCAGTGCGCCAACGCCCCAAAAGCTTGGTTTGAGCTCTACCTCCGCTCCCTGCCTTCCT
GTCCATTAGGAATAAAACATTGAGGTTTTTTTTTTTAAAAGGGAGTTTGGAAGAAAATGA
AAAACACTGGGTTTCAAAGAGCCTTTTCTTTTCTTTTAAAATTACCCTCTCCTTCAGGAT
TGAGTAGATCAAGGTCGCCATCAGCTCCGTTCAACGCTAGAGAGAGGTTCTCCAACAGTG
ACTTAATTGTAACATGATTGCAAATACTTTTAAAGGCCAAGCGGCATTTGTCGTGGTGTG
GTTTTATGTATCCTCTCTTCTTAAAAAAAGAGAAGTGCTTGGGGTGGAAACAGCAGCTAG
AAACGGGGATCCTCCAAGTCCAGCCCTGTGTGTTTCTCGGCTCCTCAGTCCAAAACAAGT
GATGCCAAGGATGAGCTCTCGATTTTATACATGCGACCCCATCCTGGACCTGCAGGTGCT
TGGTGAGAAGTGACTAGCTGGGAGCTGGAAGCATCGTGCGCTCTGCTTAGTGAGAACGTA
GGCAGAGGGCTGGGCTCAGCCTGCCTGTCTGGTGCGGCCTGAGGATTCTTCAGATGCGGG
GCCTCGGGGACCCTGGCCCCACTGCTTCCTGGGCTTTTCCTGGAAGGCCACAGCCTTCTC
TCCCGTCACCTTTAAGGAGTGGCAGGTTGCCCCCCTCCACCCTCCCTGGCCCTCCTGCCC
TTGCAGGTGGCGGTGGCCGGGGTCAAGGAGCAGAGGGAGCTCGACCCCAGGCCCTGGCCT
TACCTTAATGGAACCGGACTAATGGGTCCCAGAGCGCTTCAGAGGGTCTCTATTTTCTCT
TCATACGCAGGGGCTTAAGATAAGGAAATCCCATTCAGTTTGGGGGAAGAGGATTATTTT
CAATAAGTTGCAGTACTTGTGAATATGGCCAGCATTCCAATTGTCTGGAGTTATTTATGC
TATGAATAAACACAGGGTTTTAAACAACACTGTGAATATAGGATTTAAAAAATGTAAGCG
AGGGGCGGGTCCTAAATTTCCTTGGGTCTTTCTAAGTGCTTATTCATGCTAGTCCTTACA
CTCGCTTTCAGCCAGTTTTCAGACCTCAGGAATCTTCTCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGATGGAACACAACCCGCCGTGTGGG
GGCGGATTGCACAGTGTGCTCGTTGTGTAATTAAAAGAAATTCCCCCTGCCGGTGGGCCT
CGGCCATTTTGCCAGCACAGGCCCTGAAACAACAGGGGCATTAAATCAAGGCCGCGCTAG
TGCCCGTGCTGGTTCAGTCGTCGCTGGCCGGCTCACCGTGCAGAGCAGGGCCCCTTGTTC
CCCACCCCAGCCCGGAACAGCTTGTGGCCTCCACGAGAGTACTCCCCAAGGAGCTTGTCC
AGGCCAACAGTTTAAACTGACCCAAATCGGGTCTTGAGGAAAGAAATTCTCTTCTATACC
TCCCTCGAGACACTCAGAGCACCAGGAATAGTCTCCCCCCCCCTCCCAGTCTCAAGAGAT
TACAGAAGAAAACCCAAGCATCTGTCTACTGAAAAGGAAGTGTTCTGCTCCATGTCTCTT
TCTTAATTTTGATGTGACAGGGAGAATACGTGTCTGCCTCCTTCTTCATTAATACATTCT
CTGGGACTATGAGTCCATTTCCTTCTATTTGTGGAAGCTCTCATTTCAGCTTTTATCTTA
CAGTTCTACTTAAAATGCAAATGGAGTTGAAATAGATCATATGTGTGAAAAATGAAAGAT
GGGCCATTTGGAAAATGTAATTTAAAAATATGCAACCACTACCAGCATATGATCAAAGTA
ATGAATAGGTTTTAATATATTTCCCTTGCTTGCAGATGTCCTCGAAGGTTACAATGGGAC
AATTTTTGCATATGGACAGACCTCATCAGGAAAGACCCACACTATGGAGGTAAGATTGCC
CTGTGCTGTGACGTCAGCCTCTGACATGCGTGAACAGAACTAATGCTTCCAGCAGAACTT
GAGGCACACATTATTTTTTTACTGGGCAGTGGAGATGGTTAAGGTAGTGGCTATGTCTAA
CCAATTTGTTAGGTCTTGGAGGAGTTTTTAAACTAGCTGGGAGTATTAAGGTTCAGGAGC
TCAGTATTTTAAAAAAAATCCTTTGTCCATAGCTCTGTCAAAATAAACAACCATAAGGTC
TATTTAGAGCTAATCATCAGCAAGCTAAGCAGTGGTCCAATATCCTTGTGGACATTAGGC
CTAATCTGACTGAGTAAGGCTGTTCTCAAATTCATTATACTGGAAAGGGCTTGGGGGGGA
TCTCTTTGGAAATAGATCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAAATAAGAGTTCTTATCCTCTATTGCCTGTAAACTGTAGATTGAAAGTTTGCTTTTT
AATTTGTACTTTATAATTTAAGAAATCTGGTTTGTCTTCTCTTTAGGGTAAACTTCATGA
TCCAGATGGCATGGGAATTATTCCAAGAATAGTGCAAGATATTTTTAATTATATTTACTC
CATGGATGAAAATTTAGAATTTCATATTAAGGTAAATTCCTTGGGGGAAGGTTATGTTTT
AATTCATACCTTTAAAAAATTCTATTCCAAAAAAATAACAAATGCTTATTTCTTCCTTAA
TTTTTTTTTTAAGATTTATTTTATTTTATTTTATTTTATTTATCCTCCACGCCACCTGTT
GTTTGCGCTTGGGTTCTGTTTATTGTGTGCTCTCTGTGTCTGCTCGTCTTTTTTTTCTAG
GAAACACAAGGAACTGAACCTAGGACCTCCCATGTGGAAGGGAGGTGCCCAATTGCTTGA
GGCATATCCGCTCCCTGCTTGTTGTGTTTCTCATTGTGTCTCCTTCTTGTGTCATCTTGT
TGCATCAGCTCACCATGCCAGCCCCTCGTGTCGGCTTACTGTCTTGCTCATCTTCTTTAG
CAGGCACTGGGAACCAAACCCATGACCTCCCGTGTGTTAGACAGGCACCCAACTGCTTGA
ACCATATCCGCTTCCCTCTTTCTTAATTTTTAAAAATTGTTTTTTTGAACTATATAGTGG
AAAGATTGTTAGGGTTAGTAAACTTGGATTCTTATTTTATCTATCTCTAGATTACCTTAA
ACAAGTTACCTAAGTCTCTCTTGTCCTTAGTCTCCTTGTCTATAAGGTAAGAGAGTTTGC
CTTACTATAGAACTCAGGTTCCTACCATTCTAAATAGTCTGACTCATTTTAGTTAAAAGT
ATGTAAAGGAAATTGCTTTTTATTTTACTATATTGGCTTTTTTTTTTTTTTAAGAGGCAC
CAGGGATTGAACGTGGGACTTCATTGATGCAAAGCAGGTTCTCGACCACTGAACTATACC
CACTCCTGCTTTTTATTTTAGTTATTTAAACAGTTTAACTCATTTATTTCTTCCCATTAG
AATGTAAGCCATGTCTGATTTGTTATTTACTCTGTCCCCGTAGTCTAGACAATGCCTATC
ACTCAGACCTCAGTCAATATTTAATGAGTAAGTAAATAAATCATCTCATAGTTTTAATTG
CTTTTTTTTTTCTTTTTTCATTTCTTTGCCCTTTAGGTTTCATATTTTGAGATATATTTG
GATAAAATAAGGGACCTATTAGATGGTAAGTTAATTCCTACTTGTTGATGAATTTTTAAG
TAGCACTTGTTACGTTTTTTTAGTTGTAAATGTGAGTGATTTCTAGATCTGTGAAATGAC
TCATTGTAGTAAACTGATGCTTAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTTCATTACAGATATGAATGACATAGCTCTAGAAGTCA
CAGTATTATTCCTTATTAATGTAAAACAAGAAAACACACAAACCGGAACAAAAATTGAGT
GGAAAACTGTACCTGGTTGATTTAGCTGGTAGTGAAAAGGTAAAGTATATATATTCTGGT
AGATATCTAAGCATGTTCATAAACTTCAGTGTCATTTTGCATTTATGCAGTATTTGTTGC
ATCGTGAAAAATTTTATCAAATTATATTTGGGAATAATTTTTTATGCCAATGCTTTATTA
TTAGATAACAATGTGAATGTTATTTCCAGATTTTTATATCATTTGGGCCATAGTCCAGGT
CAACCAATAGTGTTACCTTTGTCTTAAGATGAGTGTTTTTTTAATTGAGAAATTGTTCAG
TATATATCCAGTTGGGAATTTTAATTAGTTGTTTCTTCCTCATTTTTGGTATCTGAACTG
TCTCTGTTTCTGACAGTTATGGCATCCATATTATGCTTTAACAAATTTTAGAAGGTTCCT
CTCTTCTAATATTAACAAAATGAACCTAATAAATCAGTGAATGAAAAGAGTTGTACTCAA
GAAATAGTGATACCTTAAAGTAAATGCTTCTTGGCAAATAACATCATGAAGCAATTCACT
TTTTTTTTTTCCTGATTATTGCTGACCTCTGAACTTTTTGAAAATTTAAAGAAAATTATT
TTAAACTTTTAATTTTCTTTACATTCTTTCGAATTCTTATGTATAGGTTAGTAAAACTGG
AGCTGAAGGTGCTGTGCTAGATGAAGCTAAGAACATCAACAAGTCACTTTCTGCTCTTGG
AAATGTTATTTCTGCTTTGGCTGAGGGTAGTGTGAGTATACATGTCTTCTGCTTACCTGT
TTTTATTTTTAGAGGAATTATTTAAATATAGAGTATTTGTGTGTGTGGATGAACATGTGT
GAGAGAACGATGTATTGTGGGTAATTTTCTTCTTTTTCTTTTCTTGATATATAGACATAT
GTACCATACCGAGATAGTAAAATGACACGAATCCTTCAAGATTCATTAGGTGGCAACTGT
AGAACCACTATTGTAATTTGCTGCTCTCCATCATCATACAATGAGTCTGAAACAAAATCT
ACCCTCCTATTTGGTCAAAGGTCTGTTGTTAAAAAATACAAAGCCTAAATGAAAACAAGC
CTTACGTTTATTTTATTAAATCTGAGAAAATGTCGAATAGATATTATTCAAATCAGTGCA
TATACTCCTTTTTAATTGAGAGACAGATATTACAATACAAGCAAGACCTCATTTTTAGGC
TGCTTAGGGTTTGTTTGTTTTTTAATGTTTAAATTTTTTTAGGTTGCTTAGGTTTGAATT
CATTTTAATACAATTTAAGTTAAATTTTACATTAGTCAAATTTATGTGAAAAGTTTTAGC
ACTAAAGAAAATAGCGTTGAATCAGATAATGAAATTTTTAAAATGCTGACAAATAATCCT
GTGTTAAACCTATTGACATAATGTGATAGGTTCAATCTATGTGAGATAGTTAGTCTAGAA
AAATTAATAATAATGATTCGATTTTTTGATCTTCAGTAATTTCTTAATTCAGTCTTGCAA
ATATATTGGAAAAATAAAGGCTTTTGGTTTGATATTCTTTTAAGCATTCAATGAAATTTT
TAAAATGCTGACAAATAATCCTGTGTTAAACCTATTGACATAATGTGATAGGTTCAATCT
ATGTGAGATAGTTAGTCTAGAAAAATTAATAATAATGATTCGATTTTTTGATCTTCAGTA
ATTTCTTAATTCAGTCTTGCAAATATATTGGAAAAATAAAGGCTTTTGGTTTGATATTCT
TTTAAGCATTCACAGATATTGGGGCTAACTCAAATTTAGTTGGATTATGAATAAGCATTA
TATTGATTATAGTTTTCAGGATTTAGTCTAAAAGATAACTGGACAAAAATAATTAAATTA
CTTAACTCTATATATATATGTTACATAGAAGTATAGATACCATTCAAAAGTAATTAATTT
GTCACATCCTTTTTTCCTCCAATTATTTCTGTTAGGGCCAAAACAATTAAGAACACCGTT
TGTGTCAATGTAGAGTTAACTGCAGAACAGTGGAAAAAGAAGTATGAAAGAGAAAAAGAA
AAAAATAAGACCCTACGGAACACCATTCAGTGGCTTGAAAATGAACTCAACCGGTGGCGA
AATGGTAAGAACTTAAGAATTTGTTTTCAAGCGTTTGGGGATCATCAAATAAAATATAAT
ATGGTATTTATATTTTATTCTGATGTGACCTGTGATAATATGTTTTGGAGGCACAGAGGG
CAATTAAGGAAGCTATGGAAGTCGTGAGATGGCAAGGTGCCTAGATTATGTTGTACACAA
TAAAAATAACAGGATTTGGTGACTAGATTTAGAAAGTGGGGGAGAGTTGATAATTCCAAA
GTTTTCAAATCTCAGGAACTAAGCAGATAGAAAGGTGGTAAGACAAAATTAGCTTTAGGC
ATGGATTTTTATTAACCATTATCTTATTTTAGGTGAGACAGTGCCTATTGATGAACAGTT
TGACAAAGAGAAAGCCAACTTGGAAGCTTTCATAGTAGATAAGGATATCACTATCACCAA
TGATAAACCAGCAGCCACAATTGGAGTTACTGGAAACTTTACTGATGCTGAAAGAAGAAA
GTGTGAAGAAGAAATTGCTAAATTGTACAAACAACTTGATGACAAGGTAGGTATTTAGGT
ATTATTCATGTCCTATTTTGTTTTAGAATAATATTGACATAGATATTTTCTAATTTCAAT
ATTGTGGGTCCTTGTGATCTATATACATCATCATTAATTTCTGTTAAAAATAATTAAACT
AGCAAAAAATAAAGCATCGTAATTTCATCAGGTTTACTTTTGTCCAGAAACTGGGCATTT
CTTTCCCTCAACATATTCTCCCCACCCCCATCCCTGTTCTATTATAAGCTAAAAGAACTT
TCTAGAGGACATTTGGCTTTGGGTCATTGGCGAGCCTGAATCGAGTCTGAGAATCCTAGT
AAAAGATGATGCAAGAAATTCAATGTGGGGAACAGAATAGGGTAGAAATAATGTCTTCCT
GCTTTACTTATATCACTAATGTCAGTAGCATGAAAAATAACGAATTACAAACTGAATTAA
AAAGTAAGCAAGGACAAGAGCTATAAAGAAGAAAATAATTCTAGTTTTTTTGTTTTAGGT
AGAGGTGGCAGATGTGAAGTGACTGCGCAGCCATTATTTTCAGTAATAGTATTGTGCATG
TTGATTCTTTTTTAGCATTTAAATTATTTCATGAGTGGCTTTCATAAACATAGATCTTTC
ATCTTGTTGCATAAAAAATGTAAGCTCCAGGGGAGCAACTCTGACTCAAGCAGTTGAGTG
CCTGCTTCTCACATGGGACATCCTGTGTTCATTCCCTGGTGCCTCCTAAAAAACAAAAAA
ACAACAAGCAAACAATTGGGGGAGAAAAAACCCAACTCAGGGGAGCCCATTTGGCTCAGT
GGTTGAGTGCTGGCTTCCTGCATGTGAAATTCTGGGTTCAATCCCTGACTCTGATACCTT
TTTTAAAAAAATTTATATATATACATATATGCTCCGTTTATTGATAAGTGGAAGGAATTC
CTTCTGTTTTTTCAACATTTTCTTAAGAAAAGATTAAAAGAGCTTTGTTGAATTTGGAGA
AATGGTTTTAATTTTGGGGATGTTAATCTTTTAGAAAAATATTCACTGAAACAAGACTTG
GTTCTATTTTATTTTTTTAACTGGATACTTTTAAATTTCTAGGATGAAGAAATTAATCAA
CAGAGCCAGTTGGTAGAGAAATTGAAGACACAAATGTTGGATCAGGAAGAGGCAAGTTGA
ATACCTTTCATATTGCTTCCAGAAAAGTTTTATAGTTTGTCATTAACATTTAAGTATATA
AGAGATGAAGTAGTCTGGCCAGAAGTAGCTGTTCCTTTTGCCTGAGGCCATGGTAACTTT
TGATTGCATTCCTGTTTAGAATATCTGGAATCCTTGCTATAACATCTGTTTCCACTTACA
GCTAGAATGAAGTCTTGGAGTCTGTTGTACATTTAAGAATAAACTTTTGTAGGGAAAATA
AAAGCTGAAGGAATTTACAGAGCTCAAAATACACTAGAGTATATTTTAAATATTCTTGAA
TATGTGTGTGCTTCATTCTGTATATCTTGTATATAGAATCAATAGATTATATGGATTTAA
GCCAAGATTGACTTAAAAATTTTTTTTTTTTAGTTTTTTTGTTTGTTTGAATTTCATCTA
ATTGGAGGGGAGAAGAAAGCTTTTTTAGCATTCATTGTTTAACATGTATCTTTCTAACAC
TATCTTCTGCCTTTCTTGTTTCGATGAACAATACTAAGCACCTTATTCTACCCAAAATAT
TTCTAATTGGTCCTGTGGAGAAGGCTTATAAAGGAAGAAAATATTGGTTTCTGAGTCCCA
TTGACTGTCTTTATTAATTGTATAATCTGGGTATGATTTGTAATAGTGATGCCACGTGAA
TAAAACCATATTTTACTTCTACACCATTTCTGTCTATCCAGTCACTTTTTATTTCTGCCA
TCTTTACTTTCATTGTTCTTCCATGTTTCTCTTCCTCTCACCTAGTGTGGCCCTTTATTT
TATCTCACCTGGCATAGCTAGGCATGATTGAAAATGATTCTTCATTTAAGGTTTCTGTTG
TTGTTGGTTTTGTTTTTTGTTTGACAGTAACAGTAAGAACATACTTATCTACCATGCCCC
CCAGGGTGTCCAAATTAATCCTGTTCAAATCATCTTTGTACTTATGTCATCTAGTACATT
ATTTCTCAAAGAGGCACTAGCACCATTTTGGGTTGGATAATCTGTCATAAATGTTGTACA
CTTAGCATTTTCCCATTATTGATACTCCCATGCATTTCCAGGACCTCCACTTAAAAGCCA
CTGACCTGGACAGTTGAGTTTATTGTCCTAACTAGTCTCTTGGCTTCCTTCCAGTCTAAA
TTTTATATGCTGATACTATGTCTTCCTGAGACACAGCTCAGATGACACCCCCTTGCTGCC
CAAAGAAATCTCAACTTACTAAGCAACTCTTCAAAGTATCTACTACTTTCTTTCTTATTT
CTGTGTATACAACTATAGATTTGGAATGCCTTTTTATATTACATTAATTAACACATGACT
AAAATCTACCCATCCTGACCGCTTTTTCCATGAATTTCCTCACTCCAGATATGACCCTTT
CCTGTGCTACCAAACACTTTACCTACCGAGTCCTGTCCTCTTTTGGCTCTTATATTTCTA
TCTTCTACTACAGATATTTACATACCTATCCTCTTTTGTACTAGGCTTCTAAAAGGCAAA
GTCTTTGTTTTCCTTCCTGTCTCCTAGTGTCTAGCACAGTGCCTGCACAAAGTAAATGTG
TGGGAAATCTGTTGAATTAATGAATGTTGCCAAACTTTCTAGCATCCACGTTTCATTCCC
TTGTGCTTAGCAAATGGTGAAGCAAATAGATTTCTTTTAAAAGCCTATATGCTTATTTTG
GTGAGCATAGATATTTTACTCTTTTGTGTAGCTTCTAGCATCTACCAGAAGGGATCAAGA
TAATATGCAAGCTGAGTTAAATCGCCTTCAAGCAGAAAATGATGCCTCTAAAGAAGAAGT
AAAGGAAGTTTTACAGGCCTTAGAGGAACTTGCTGTCAATTATGATCAGAAGTCTCAGGA
AGTTGAAGACAAAACCAAGGAATATGAATTGCTTAGTGATGAACTGAATCAGAAATCGGT
ATGATATAGTTTTGTTTTCTTTCTTAATACTACAGTGTAAGTATTCTTAATTGGACAGTT
GTTTAGATTGCTTATTTCGGTATAAGCCCAACACTGATAACATCAAGTCTCAACTTCTTT
TCCTTCTATATAGTAAGTCTTAAGGTAGAGGAAGAGGGTTATCTTTTTCTTTCCTGAAGA
TCTATGTAAAATGAAAAGTTAGCTCCTAATAGCTTGGTAAAGCCTATTAGATGAATGTTC
AAACTACATGTTAAGAAACTTGCATATAAAAATAAAATCATTTAGTCAACTAAGTAAATT
ATTTGAAGTAGTTATAAGGATATGCACCTTCATAGAGCTTATGTTTTATTTACAGTTTTA
TTTCTAACACTTGGCCATCCCTACCTAGCATGACGTAGGAGGATCTTCTTTGTGGTTCCT
CATTGGTGGGGACTTTTACTTGTTATTTATTATAACTTTAGGGCAGGGATTTCCAACCCA
CAACAGCAATGCCAAAAATGATTTATAGCTATGATTGCTCCTCCTGTCCTTAGAGCATCA
CCAGGATGAACTGTCATTTTTCTTATGATTTTGTTGTTATGGCTAGCTCCTTGTTTGGAA
GGCAGCAACTTTAGCTGGACTCATAATCATTGTCTACCACTTATTTCCCTACCCATATTC
ACCTGTGTTAAGAAGTCAGCACTCTTGAAATAACATTTTTAAAAGGTTTTCTGCCCCTGG
TGAGTTCATTTTCCCTTGTTAATCTCCAAAGTTACTGTTATAGATTAATACTCTGAAGAT
CAAGATACCTTTATAACCCCTGCTTATATGCATTATTAGCAAATGTAATTACTGTTTAGA
ATTTTCTTATAGCTCTATAAGCAGTATTCCATGGTCCTTGGTGAACAATTTTAGTCTTCA
AGACAGTTGTATTAGTGTGGTAGTTGAGAAGCTGAAATCTGTAGGCACTAAACTGGGAAT
AGAATTTGTAAACCCCTAGTGTTCAGCATATTTTATATGCTTACAATATTGCTGTTCAGT
TGTTACAGAAAATGTGTGGTTAATTTAAACATTTATGGTAAATACATGTTGTGTTACTAG
ACTCACCAGGTAACCAGTATTATATTGCCGATTAAACTGGGTAACCATAAATAAAACACC
TGTCCACCTTGAGAACTGTCACTTCCATTCTAGCATTTATTTACTCAGACTCACTTTCCA
AAGATAAGCTATAATATAGTAATAAATGAAAATTGAATCTAATTAATTTTGAAGTTTCTA
TTTCTAGGCAGAAAACATTGCTCAGTTTCAAAAATTTAGTGAAATAACACGAACTACCTG
CTCTTAATGGAATATAATATGACTATTTTACAGTATATTAAGTTTATAAGTTTAAGCTAG
GAACTATCCCAGAATCTAGTATCTAGTTAAACAAAATAAAAGCAGAAAATGTGTGGTTTT
GTGTGTGCTGGGTGGACAGCTTGAAATGCCTTTGAATAATCATGTGAATTTTCATTTAGT
AGATTTAACTGTACATTTTTGTTTGTTTGTTTCTGTTAGGTAACTTTAGCAAGTATAGAT
GCTGAGCTGCAGAAACTTAAGGAAATGACCAACCACCAGAAAAAACGAGCAGCAGAGATG
ATGGCATCTTTACTAAAAGATCTGGCAGAAATAGGAATTGCTGTAGGGAATAATGATGTA
AAGGTAAATATAATAATGTAATATTTAAGTATAATATTCTTTATGCAATTCATGCTTTTA
TTTACTATTATTTATTTTTCACAGAAGTCTTTTCATATCCGTTATCCTCACAACAGCCGT
TCATGATAGGTAGTATTAACTGCATTTTAAATAGGTGGAGAAACAGGGAGCGAGTTAGGG
GGGCACACAGAAACATACTCAGTAAGTAGCATATATTGGGCTTCATTTCTGGTGCCTTCC
TCTACTCCTCACACATTTTGCACTTAGAAATTATGTTAATAAATTGTCATACATGAAAGT
GTATGACAGTTTATTAGAACAACAGTGAAGGTAGCTTAAGGGGTAAAATGATTCAAAAAT
AAATTGGCCTATGGTCACTTTATTTTTTGTTTTCTTTTGTTTTTCTTTTTATATTTATGG
TCACTTTAAATGTAAGGGAAAAGTGTTGCTAAATACTGGGTGACTTCACAATATGACTGA
ACTGCAGGAAAGGTGTTAAAAATTTTCTTTGTAGATTTGCAGCTTGTTTTTAGAAGAATC
TTTTCATTTCATGTTCAAATCATAATTTAACTGAAAAGGTGGTAAAGACATAAAGAGTGG
AAATGGCTTATTTTAGTGGCAGAGCCAGAAATAGCATAAAAGAATCTGTGGATCCTTAGT
ATTTTCATCATTACTACATAATTCTTTTCCTGTTAACAACATTGGTAAGCACTGATTGAG
TACCACTTAATGTTTTTTGTGTGCGTGTTTTGTTTTTTTTTTTTTTTTGTATTTTGCATT
GGGTTTCAGGCTTTTCATTGTATAGTTCTTCGAATTTTGACAAAAGCATAATGTCATGTA
TCCACCATTACAGTATCATATAGAGTAGTTTTTCTACCCTAAGAAATACTCAGTGATTCA
CCTATTCCATCCCTCCCTGCCACCACCCCTCAAACTCCTGGCAACCACTGTTCTCTTATT
TTTCAGAATGTCATATACTTGGAGGTATCTAACCTTTTCTGACTGGCTTCTTTAACTTAG
CAATATGCATCTAAGAGTTCTTCCATGTCTTTTCATGACTTCATAGCTCATTTCTTTTTA
TCACTGAGTAATACCCTATTTTATGCATATCCCACAGTGTCTTTATTCATTGACCTGTTG
AGGGACATGTTTTTATTTATTTCTCCCTATCCCCCTTCGCTGTTTGTGCTTGTCATGTCT
GTTCATTGTGTGCTCATCTTCATTTTGGAGGCATCAGAACCGAACCTGGGACCTCCCATA
TGGGAGGGAGGTGCCTGATCATTTGAGCCACCTCTCCTCCCTGCTTTGTTGTGTCTCTCT
TTGTGTTTTCCTCCTTTGTTTCTCTTTGTTTCATCGTCTTGTTGCATCAGCTCACCACAC
CAGCCCATCATGTCAGCTCAGTCTTGTTCGTTGTCTTTAGGGAAGGCACTGAGAAGAGAA
CTTGGGACCTTCCATGTGGTAGGTGGGAGATCAATCACTTGAGCTATATCCACTTCCCTG
CTTCCAGTTTTGGGCAATTATGAATAAAGCTGCTGTAAACAAAAACTGAGTACAAGTTTT
TGTGTAGACTAAGTTTCAACTTATTTGGGTAAAATACCTAGGAGTGCAATTGTTGGATCA
TATGGTAAGCCTATTTTTAGCTTTGTAAGAAACTGCCCACTTATTTTTTTCTTTTCAAAG
TAGCCATACCATTTTGCATTCCCTCCAGAAATTAATGAGAGCCCGTTACCACATATCTCT
GTCAGCATTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACAATGGTAAAACGCTGCAAACAGTTAG
AAAGCACACAAACTGAGAGCAACAAAAAAATGGAAGAAAATGAAAAGGAGTTAGCAGCAT
GCCAACTTCGTATCTCTCAAGTATGTGTTACCATACAAAATGTCTTCATTTATTGAACAG
GCACATATATATTTTATTTATTGTAAAAATTTTCAGAAAAATAAGTTATTTTGTGTAACA
AAATGCAAAGGTTCATTTAGTCAGTTGTATTTCCTAGTCTAACTGCAGTATTACAACATG
AATGATTTAACTGGGTTATATTTGTTAGCATGGGTTGTTATATACACATATTCACTTTTT
TAAAAATGTGATATAACTGATGAAGAATCTAGACAAATTCTAGGGTGAAAAAAATTGTAA
GGAATCAGTTTTTTGGTTTTGGTAACTGAATGGATGGGACCATTCACCAAAATAGGGACT
GTGAAGGAGAGAAGGGGTAGCATTAGATAAAGATAACTATAAGAATATTATCTGGGGAAA
CGGACTTTGGCCCAGTGGTTAGGGCATCCGTCTACCACATGGGAGGTCCGTGGTTCAAGC
CCTGGGCCTCCTTGACCCGTGTGGAGCTGGCCCATGCGCAGTGCTGATTCGCGCAAGGAG
TGCCGCGCCACTGCAGGGGTGTCCCCCGCGTAGGGGAGCCCCACGCGCAAGGAGTGCGCC
CTGTAAGGAGAGCCGCCCAGCGCGAAAGAAAGTGCAGCCTGCTGAGGAATGGCGCCGCCC
ACACTTCCGGCGCCGCCCACACTTCCCGTGCCGCTGACGACAACAGAAGCGGACCAAGAA
ACAAGACGCAGCAAAAAGACACAGAAAACAGCCAGGGGAGGGGAGGGGAATTAAATAAAT
AAAAAATAAATCTTTTTAAAAAAAAGAAAAAGGAAAAGAATATATCTGTTTTCAGCTTCG
GGCCTTAGCTGCAACTGTTAGAAGCTATCCAGGTGACCTTTTTTATTGACTAAGTCCTTT
AGCATTGTAAATGGCTCATGAAAATTTTGGGCTTAAATTTCTTCTTTAAATCATGTATTT
AGAATACTGATAAAATTTACTTATTTTCAAATATTCTTAACAAAATATATTTGTGGGACT
TTTTTTCTACCTTTTATTGGTATATTTTTCCCCAAAGCATGAAGCCAAAATCAAGTCACT
GACTGAATACCTCCAAAATGTGGAGCAAAAGAAAAGACAGCTGGAGGAATCTGTTGATTC
TCTCAGTGAAGAACTAGTCCAGCTTCGAGCGCAAGGTGTGTATTCCTGGTTGCTAATGAG
TTACATGTGTATTAATTCTTACTTTAGTATCTGTTCATATGTACACTGATAGTGGATAGT
AGGAATGTGGATAACTTGGAACAGTAAAAAGTTCATACATTTTAATGTAGCAATGAAACA
TTTTTGAAATCATGTTTGAATATGGAAATGGCCAACCTAAGAACTTAAAGTTATGAATTG
TTTATATATAAACCTTGTCATAGGGAACTCAGAAAGCTATCAGATTTCTCTACCATACCC
TTAACCCATTCTATTCTGGGTTTATGCAAAGTAAGTAGAAGAATCTATAATATCAACATA
AAAGTGAGCCAGTCAATGCATCATTGAACTTGAAGGGTAAGATTTACTATGTGGCATTTG
GATAATTTAAAGTCAACTCCTGGTAAGGAATTAGAGCCCTTATAAAACTCATTCACTCCT
TGGTTTATATGTGGACTCTTGAGGCTTATTTCCTTTTTTCTGTTTGCTCTTCCTACCCAA
ATAGAGAAAGTTCATGAAATGGAAAAGGAGCACTTAAATAAGGTTCAGACTGCAAATGAA
GTTAAGGCAAGTTTGATGTTACATTGCATTCTAAAGACTTTAGTACAATGTTATTTTGAT
TAGTCTGATTTTAACATCTTTTTTCCCCAATAATTTCAGCAAGCTGTTGAACAGCAGATC
CAGAGCCACAGAGAAACTCACCAAAAACAAATTAGTAGTCTGAGAGATGAGGTCGAGGCA
AAAGAAAAACTTATTACTGATCTTCAAGAGTAAGTATTATATTTTTGTTTCCTCTTGCTC
TTAAACTGAGGTATTAAGAAACAAGTTCAAGGGATGTGTATTTGGCTCAACTGATACAGT
TAGTCCGCCTACTTCATGGGAGGTCCAGGTTCAAACGCAGGGCCTCCTGACCCATGTGGT
GAGCTGGCCTGTGCGCAGTGCTGCTGCATGCAAGGAGTGTCATGCCACACAGGGGTGTCC
TCCGTGTAGGAGTGCAAGGAGTGCACCCTGTAAGGAAAGCTGCCCCACACAAAAAAAGTA
TAGCCTGCCCAGGAGTGGTGCCACACACACACGGAGAGCTGACGCAGCAAGATGATGCAA
CAAAAAAGAGACGCAGAGTCCCGCTGCCGCTGACAAGAATACAAGTGGACAAAGAACAAC
ACACAGTGAATGGACACAGAGAGCAGACAACTGGGGGTAGGGGGAAGGGGAGAGAAATAA
ATAAAAAATCTTTAAGAAAAAAAAAAAGAAACAAGTTCAGAAAAATTAACTATTTAGACA
GAAGGGAATAATAGGTATATCCTTATTAGAAACCTATATGTTTCATCCAGAATTTTTTCA
TTTATGAATATAACTTCTGTCTTAGTTTGCCATAGGGCTGATGCAAAATACCAGAATTGT
GCTGGCTTTTACAAAGGGGATATATTTGGGGTAAAAGCTAACAGTTCTGAGGCCATCAAG
AGATGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAATCCCAAAGCTTAGCGGTGGGCACCAGACATAGGCTTTTC
TCTTTCCTGGCCACCTCTCTCAGTCTCTCAGGTCTTCTCTGCCTTTCTATAACATAGGCG
AATTGGGAGTTCTCTCTCATATGGCAGGGTCAAAAATGGTAACTTCATATTTCTTTGTGT
GTCTCTGTCTCTTTGTTTATATCAGGCCCAGCCGGCTGCCTCCTACCTCACTGATACAGT
CCAATCAAAATCAGTCTAATCAAGTGAGCTAATAATGCAGTCACAGGGTACTGTATACCT
GCAGGAATAGATGAGTTTAAGAACATAATCTTTTTTAGGGGATTCACCAAATTCAAACTG
TCACAGCTTTAGCTCTTGATCTCCAGTAGGAAGGGAAAAAAGCAAAACAACTTTAACCCA
TTATTGCAAGTAGTCCCTGTAGTCTTCTCCAAATCATTTCCTCAACTTTAAAAAAAAAAA
AACACAGGAAAAAAACTTTTGGAAATTATGCATTTAAAAAGTTTTTTTTAAAAAAACTGA
AGTTAGTTTATCTAAAAGATATTTTCCCTAATCTCATAACCATATGTATATACCATAGGA
TTTTAGAAATCAGAAGTCACAATTTGAGTCAGAACCAGAGAAGAGTAACAAAACAAAACA
AAATGATGACAAGTTTGGGGCATAGTTCTTATTATTAATACCTAATGGAATTAGGTATTA
ATACCTAAAGGATTCAGGGAGGTGAAAGGTATAGAAGAATAAAGTCATGGTTTCAAGGTA
AAATATGAGAAAATATGGTAGCCACATACCCTCCCCTTCTCCCTCATGGGGACAGGATAA
CAGGAGGCTTTGGGTATTTAAAAGGTGAGATTATGGGTGTTAAGAATTTGAAGAAGTTTA
ATGACAGCATTCAGAAAAGTGTGATGTGATGCTTTATGTTTTTTATTTTGTCAGCCAAAA
CCAGAAAATGATGTTAGAGCAGGAACGTCTGAGAGTAGAACATGAAAAGTTGAAATCTAC
AGATCAGGAAAAGAGCAAAAAACTACATGAACTTACGTGAGTAAATGGATCAATTAATGT
TGAAAAATAAAAACTAAAGAAGAGGATTGCAAACATCAATTTTAGATATATCCAGTGAAT
ACATTTTTTACTTTGTGTGCACTAAAGATGTTTTTCTTAAACCTTCTGAGTAGGTTTGAT
TTTATATCTAAAAACTTGCATTATATTCTTGTACTTTCATGAAGAAAGTCCTGTATTTCA
ATCATGGTCAAGATTCATACTCCTCTTGCTGATTCTTTGTTATTTCAGAATCAATCTTTA
AAATGAACCTAAAATATGGCATTAAGTAATTTAGGAGATTTCAGGATCTTTCGCAGTAAC
TGAATTTTTGTAAAATCTAATCTTGTCTAAACAACTTGGTTGTTTTTAGTCTTGCCCTTT
TTTTAAGGAGGTTCTGGGGATTGAATCCAGGTCTTCAAACATGGGAAGCAGGTGATCAAC
CACTTGAGCTATATCCTCTCCTCTAGCCTTGCCTTTTGAACTGAGGATTTTACGTTCACT
TTTTCTAATTTACTAAGTGTAATTAATACTCAGTTCACTAGAATCTGACCAGGTAGAAAA
TTCACAATTATAATTTTTTCATGTATCTTGAGTTTGTGAGACATTTGGCAAGGAAATGGG
TTGTTATTAGGCATGATCACATCATAGGAAGTCTAGGGTCAGAGTTGATTTTATAAAGAT
TGTCCTGAATCATCAGCTATAATTTTGCTTAGAATAATTCTTACTGTAAAATATGTAAGA
TGTTTTTCTTTTTAAAAATTTCTTTAATCTCTGTAAGTCTCTATTCAAACCATTTTAGAT
AAATAGCAGTGTGCTGTGATATATTCTAAAATATAAATAATAATTCCTTACTCATTGAAT
TCTGCCACTTGATCTTTTTATCTCTTTCATTGCTGAGAGGTGTTGTTGCTGTTGTTCAAA
TGTATTTTTATTTATTTTTTTTAAAGATAGATTACATAAAATGTCACATAAAAAATATAA
GGGATTCCCATATGCCCCACTCCCCACACCTCCCACTTTCCCCCACATTAACAATTTACT
TGATTAGTGTGGTACATTCGTTGCAATTGATGAACACATTCGGAGCATTGCCAGTAAGCA
TGGATTATAGTTTACGTTGTAGTTTACATTCTCTCCCACTCAATTCTGTAGGTTATGGCA
GGATATATAAGGCCTGTATCTGTCATTGCAGTGTCATTCAGGACAATTCCAAGTTCTGAA
AATGCCCCCATATTATACCTCTTTTTCCCTCTCCCTAACTTCAGCACCTCCAGTGGCCAT
GTCTTCACATCAATGATATAATTTCTTCCATCGCTAGAATCACAATAAGTCTATAGTAGA
ATACCAGTGAGTCCACTCTAGTCTATTGTTTTTAAAATAAGAATTGATCCTTTCAGATTC
AAAGTAATTGATTCACCTCTTGTGGTAAACAAAACTAGAATTTTATGGAATCAAATTTGA
AGTTATAATATTTATATTTTTCTCTGGTTTAGGGTTATGCAAGATAGACGAGAACAAGCA
AGACAAGACTTGAAGGGTTTGGAGGAGACTGTGGTAAGATAAACTTGAAAATAAACAGGA
TTGGGGAGCATTTTATGTTTTGTTTTTTCCTCCTTCTGATTATTCTGAATTTGAAGTCTG
AATTCCACAAATATAACTGTTCTTAATTCAAGGCAAAAGAACTTCAAACTTTACACAACC
TTCGGAAGCTTTTTGTTCAGGACCTGGCCACCAGAGTTAAAAAGGTAATATAGCAATACT
GATGATAGCTATTGCTATTTGTATAAATGGTACTTACTCTGTAATTCTCTGAATTCAGAA
AAGAAGTAATTTTACAGTCATAAAAAGGTTGATGTAGTTAAGCTTAGAATTTTTTGATCT
TTAAATTTTTTTCATAGAATTCATCAAGTTCTCTTTCTCAGAGTGCCGAGANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTATTAGAA
GCACCGGGAATCTGTTTCTTTTGTGTGTTTCTTTTTGTGTGTGCATCAGCTCTCTGTGTG
TGCAGCACCATTCTTGGGCAGGCTGTACTTTCCTTCACACTGGGTGACTCTCCTCACGGG
GTGCACTCCTTGCACATGAGGCTCCCCTACATGGGGGACACCCCTGCGTGGCCGGGCACT
CCTTGCACGCATCAGCGCTGCTCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGAT
TTGAACCATAGACCTCCCATATGGTAGGTGGATGCCCTATCCTTTGGTCCAAGTCTGCTT
CCCTGTAGTTGAATCTTATAAGAAAGTGGAATGGGTAAAACATGGCTCAACTATCAGCTC
TAGTATAAAAAGTCATAATTTTAGTTGAAAATGTTAATATAAATTTAGGACATATAAAAA
GAAAGAAGAGGCCAGGAACAAGAAAATCTATTTTTCAGTGTTATACACACCATATCTGGA
ATATTATACTCCACTCCTAGACACAATGAAAGAAATGTAGAGAAAATAAAAATATCAAAT
GTATGGTGGTCAGATTAGTAAAAGTTTTATAAACGTGGTCTAAGAGAAAGGAACAGCAAG
AGGACTTCAAAGATTTGAGGAGCATTTAGATGGGGTTATTCTGTGTGGCTGAAGAGGCAG
AACTATGATGAATGAGTAGAAGTCATAGAAATGGAATAATGTGTGGTGAGTGGCAGTGGG
TTTCACAGCAGAACTTATGTGCAAGCTGTGGAGGAGAGCCATTTGTTCTGTTGCATGGTG
GAGAAGAGTCTTTTCAGTTTGCAGCCCAATTCAAAAATAATGATAGTAATAATAGGACAC
ATTTTTGAAAACCCAAAATAGCTTCCTCAAAACTCATTGGGGGGAAAGTGGCTGTGGCTC
AATCAATTGGGCTCCTGTCTACCTAATGGGAGGCCCTGGGTTTGTGTCCTGGGGCCTCCT
TGTGAAGGCAGGCTCGCCCGCACCTTGCAGAGAGCCACTGGGCTGCAAGCCCCATGGAGA
GCTGACTCAGCAAGGGATGCAACAACAACAACAAAAAAAGGGAGACAAGTAAAAACAGAA
GAAGTGTGCAGTGAATGGACACAGAGAGCAGACAACAAGCAAGCTGTGGGGGGGGGGTGG
AGAAATAAATACATAAATAAGTAAATAAACTCATTGGGGGAGAATTTTTACAGTTTAGAT
TACATTCTTTAGCAAACGGGAGTGTTGAGAGATTTGGGCACTACTTTGTAGTCATTAAAA
TGTTAACATTGGGGAGAGGATGTAGCTCAAGTGGTTGACCACCTGCTTTCCATGTACAAG
GTCCCCAATTCAATTCAATCCCCAGTAACTCCTAAAAAAAAACAAACAAAAAAAAAAACC
AACTTTCCCTGGGGAGTGGATATAGCTCAGCAATTGAGCACCTGTTTTCCCACGTACAAG
GTCCTAGGTTCAATCCCCAGTACCTCCTAAAAATAATCAAACAAGAAGCTAATGAAAACA
CAAATTCTTATTTCTTTGGAAGACTTCAGGTCTGCTAGTTTTCTAAATTTATTCATGGTA
ATATAATTTATTAAATTTATTTATGGTGGACGGGTCTTTATAATGAGAAAATTAGAATTT
TTTAAAATTTGTTTACATTCAGTGCTTCAGATTGTGAAATAAATAAAATGTATTTTACAT
TTTTTTAAAAAGCCATGATTATTATTAATTTTGCTTGTTTTTTGTTACAGCTTGATATGT
GATTAATAAAAGTTTTTCTTAAAGTTTCTTAGCACTCAGTTCATCTATATCTGTTACTCT
AAACCTGATGTGTGTGCTAGAAATTTTAACCTTTATCTTCTTTGACACTTAATAAGGAGC
TTTCTAAGTTTATATTTGCTTATGGTCTTATGTCTCTAAAAGAATGTTCATTTCTACCTT
ATTAATACCTTACCAAAGAGGACTGGCACTTGTGTTGGAGTTTACTCTCCTTGCATAGTA
AGGGAAAAGAACAATCTCCCTCCCCCAGTTAATATGTTGCAACATAAATTAAATTAAATG
GAAAAGCCTTACTATAAAGTAGTCTTCTCTTTTAAAGAGAAACTGAAATGCTTATACTTT
CTGTATCATCTTGTTAAAACCAGAATCATTTTCTTTATGTACCCTTAGTTGGTACGTGAT
AATGCAGATCTTCGCTGTGAACTACCTAAACTGGAAAAGCGACTTAGAGCTACAGCTGAG
AGAGTGAAAGCACTGGAGTCAGCACTGAAAGAGGCCAAAGAAAATGCATCTCGTGATCGT
AAACGCTATCAGCAAGAAGTAGATCGTATAAAGGAAGCCGTCAGATCAAAGAATATGGCC
AGAAGAGGACATTCAGCACAAATTGGTTAGTACAACACATTGAAACCTTGAGAAATGTTT
CTTTTAGTTGAAATCACAGTCTGATTCATTCATAATATGTTGACTTTAACTTATCAAAGA
ATAGCATTGTTGGGAAGGAAAAGAAAAATTGAGGAATAACAACATTTTTAGCATGAGTAG
ATAAATAAGAACTAGAAAAGCAAGCAAGAATGGTCAGAGATGAGAGAAACTGTATAGATC
AATGTTATTAAAGCCAAGGGAGAATTGTAAGAAAATAAGTCATCAAAACTGTATTTCATG
CTTCAGAATAATCATTGGTGCAAGAACAAGATTGCATAATCCTGGAGAAAAGAATGTAAC
CAATAAAGAGAGAAAGAGGTGTGGGGAAAATACACCAAATATAGGCTATAGACTACAGGC
AGCAGTAATATTGTGGCAGTGTTCTTTCATCGTTTGACAAATATGTTACAACAGTGTAAG
GTGTTGGTGGTGGGGTGATATATGGTATGCATGATTATTTTTTAAAATTTTGAAATTAAA
AAGGGGGTGTTAAAAAAGAGAGGAATTTGCTGAGAAATAAAAAGGCAAAGAAAAACAAAA
ACATGGAAATTTAGTGTGAACAAAGAGAAGAGACCTAAAAAAAAAAAGTCATTTCAGTTG
TGTATCACGGTTATTCTAAAGTAAATTTTTGTTTTTTGTTTTTTATTAGCTAAGCCTATT
CGTCCTGGGCAACATCCAGCAGCTTCTCCAACTCATCCAAGTGCAATTCGTGGAGGAGGT
ACATTTGTTCAGAACAACCAGCCCATGGCAGTACGTGGTGGAGGAGGCAAAGTGTAAGCA
TTTACACAAACCCACAGGTTCGTAGTTTACATCTGGCTTTTGAATCATAGCTATTGGTTG
TTTAGCAATATTTTGAGTTCTTAAATTTGTGTCACAGTTTTTTTTTTTTTATGTGTGTGA
TTGATTGTAAAAGTAACTTGGCATGATTTCATCATTCAGATCTAACTTTATTCAGTTTTG
TGTCCTTATTTTTAACCTAACATACTGGATCATTTTTAAATAGCTTTTAGAATTTTATCA
TATGGAAATACCATCGTTTATAACTGTTCATTTTCACTGGACATAAAATTGTAAATTAAT
TTTTCCCATATTATCTAAAATTGAAATTTCCATATGTGAAATTTGGAGTATGGAGCATCT
TTTTTATACTTTCCCACCCTTTAGATGATTTCCACAGGATTCCCAGATGTGGAATTATAA
AATGCTATGAACATTTTTTAAATTCTTGATATATAATGCTAGGATGCTTTCCAGAAATAT
TTCACTGAATTGCGTATTAGTCAAGGATACTGTCCATTTTGTTTCATCCTTGCCAGTTTT
GTGTATTAGTAGTTTTTAAGCATTCCCATTTAATAGGCCAAAAATGGCTTCTGATTGATT
TATTAATAAAGGATGTATTTTCAAGTACTTATTGGCCTATTTATATTTCCCTTTTTTAGA
GAGAATTTTCTGTGCCCCTTTTCCATGTAGCTATTGTGGTTAGTTTATCTAAACAGATTC
ATTAGGTCTTATTTCATTCACTTATTTTTAATTATACACATAAATATCTGTTCATTGTAG
GAGTGTAAAGAATACCACAAAGTAGAAAAATAGATACACATAATATATGGTGTGGTATTT
TTTCTAGAGCTTTTTCTTGTTCTTAAAGATTTAATTTTTTAATTTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1126, 14296..14383, 75215..75288, 75886..75990, 77016..77064, 77692..77747, 77848..77935, 78453..78460, 78463..78485, 78487..78522, 78524..78578, 79186..79290, 79434..79579, 80495..80643, 80972..81165, 82242..82310, 84031..84237, 85779..85922, 96611..96799, 97837..97954, 98464..98525, 98619..98728, 100494..100595, 102092..102152, 102272..102343, 102521..102528, 102631..102727, 104988..105204, 105889..106016
1001..1126, 14296..14383, 75215..75288, 75886..75990, 77016..77064, 77692..77747, 77848..77935, 78453..78460, 78463..78485, 78487..78522, 78524..78578, 79186..79290, 79434..79579, 80495..80643, 80972..81165, 82242..82310, 84031..84237, 85779..85922, 96611..96799, 97837..97954, 98464..98525, 98619..98728, 100494..100595, 102092..102152, 102272..102343, 102521..102528, 102631..102727, 104988..105204, 105889..106013
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved