Dasypus_novemcinctus Locus ENSDNOG00000003380
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000003380
Dasypus_novemcinctus
ENSDNOG00000003380
GeneScaffold_4129
SNORD73
4535..4602
6039
GGTGGATGTCATGCAAGATAGGGGTTCAGGGTTAGAAGGTCTGGAAGGGATCTTAGGAT
ATAAAAAGTTTGCCGGAGGCAGTGGGAGTGGGAGTTCTCGCTTCTTGGTGTTTGGGGTGC
AATGTTTTGCCAGAGGGGAAGTTAGACAAGGAACTCATACATCACTGGCTAAGTACCAAG
CTGTGTAGAACAGAAGCTCTCCAGGGGCTACACACATGGGCGAGCTTGGCACATTTAGCC
AGGATGTGGTTTGTTAAAACCCTATAGCTAAAAAAAAAATTTCTTTTCAATAAGTTGCAA
AAATTGAAAAATTTTGAGGTTTCACAAAAAATGTGCATCTCCGGCTTTTCTTGGAAATTC
AAAATATCTGGGAACACTGGATCCATGGTGCCTCAGAGCAAAAATCAGCATAGTTTGCTT
CACTAAAAGCAAAAGCAAAACAACAAAAAAACTTAAACTTTCTCTCTACATAGTAAGTGT
ATAAACTGGATGAAAGTGAAGCTACTTATCTAACCAGCACCCGTAACAACAAACAGAACA
TCACAGTATCCCAGGCCTTACACTCATTTAATCCTAACATCTTCATGAAGTAGCTAATAT
GATCCCCAAAAGACAGGTTAAAAGTTAAAGCGTAGGCTGTTCAAAACCTGCAATGTGAAT
CTACATCTGCTCTGTTTAATTCCAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCCCGAGCGCAAGGCCCGGTGCTGCGCGACCTCCTCACACAAGACGGCGCTG
TCTCAGCTACCGTCAAACGTGTGCGTGTCTTTGTTGTCGCGATATTCTTGAGGCCGGAAG
CGCGCAAGATCGAAGGTCACGTAGACAGCGCGGCCCGCCCCCGTAAGCCTAAGTTCTCGC
GCGAGTTGTACTTCCACCCTTTTGGCTCTCTGAGCAGCACCATGGCGGTTGGCAAGAACA
AGCGCCTTACGAAAGGTGGCAAAAAGGGAGCAAAGAAGAAAGTGTGAGTGGCGATCGTCG
TGGATCCCCGCTCTTTGGGGTCCAGCTAGAATCGGCGGGCGGGTTCTAGGTCGCGGCGTG
GGCCGGATGGCGCTGATGCCAGTCGGATTGCGCCGCCCGGGTCGCGTTGGTGCACTGATG
ACCGCGGCGGAGCCGATCTGGGAGCTGCGTCGCGGCCGCCCGGCAGCCGTCGCTTGACTT
CCTGAGCCTGGCGTGCTCCGCGTTTGAGCCGATTGCCGCCACGACTCAGGGCCAGCGTGT
TCTCTATTGTGGGTTCTAACTTAGTAGACTGCTCCGGCATTTGGTACCTCTCCAGTATCA
GGAGTTTTGTAAAGCACTGTCTATTCCTGTCTCTCCAGAACCCTGCACCCCCCCCCCCCA
TCCCTTTGGGCCCCTGGGAACCTGGGGGCTCCTCCTAGGGTACCTTTTAAGGTAATGGGA
GGGCCTTTTGGGTCCCTGCCATCCAGTATTGATAAAGTTCACGACGTGTGTATGTTACTT
GCTGGCAGTACTACCTGTGTAGGGGAAGGAACGAGGGGGGTGGTGTGAGTATCTGGTCTG
TAGTGACATAGTGCCAACAGCTTGATTTCCATTTGTGACCCTCCACTGAGGGAAAGTTTA
TTCTAATGTCTAAATTCCAGTTCGTCGTTTAAGCTTTTAGAAATATTTAGAAAATATTAA
CGGTCTTATTTGAATGAAAATTAGGTGATCTGTAATGAAACTTAAGCAAACTTTTTGTGT
TTGTTTTTTTTTTAAATCCAGGGTCGATCCATTTTCTAAAAAAGATTGGTATGATGTGAA
AGCACCAGCGATGTTCAATATAAGAAATATTGGGAAAACACTAGTTACAAGGACTCAAGG
AACCAGTGAGTATCACAAGTTGGTCCTGTGGTGGGAGACTTCAGGGAAATGTCAGTCCTT
AGTTGTAGCTTTTGTCTGGTGTTGTGGAAGAAAAGGTGGTGCTTTCAGAACTCAGAAAAT
GTGCATAGGTCGTTGCTTTTTCTTTCTTTTTTTTTTTAACTAGGCATTTTTAAGAGTTTT
AAAAATTCCCCCGCAGAAATCTCCATCATCTGTCTGCTTGTTTGCAGTCGTTGCCGGCTC
ATCTTAATTTAGTAGGCACCAGTAACTGAATCTGGTACCTCCCATGTGGCAGGTTGGCAC
CCAACTGCTTGAACCACTTCCATTCCCATAGGTCATTTTTATGAGCACTCTGAATAAGTC
ATTGATGTCCATGTGGGTTGAATAACAAAAGTTAAGGTCTTCATAATTTACCTAAGCTTA
ACTTGTATACATGGAAATGATCTCTGTAGGCTTGATTTTGTTATTGTGATTCCTAATGTT
AATGAGAATTGATTCTTGTTTTGTAGAAATTGCATCTGATGGCCTTAAGGGTCGTGTTTT
TGAAGTAAGCCTTGCTGATCTACAGAATGATGAAGTTGCATTTAGAAAATTCAAGCTAAT
TAAAGAGGATGTGCAGGGCAAAAACTGCCTAACCAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGAGTCAGGATAGTGAATC
CTGGCCTGTATTTAAACCCTGTCACCGAATACTTCTAGTTATAATCCCTTTAAGTGGAAA
TGTTAAGTGTATAGTAAATTTGGTATGGTTTCTTTATTTTGGTGAAGATATCCCATCCCT
TGGCAGTTAGTGAGACTGAAGAACAGGAAATGCTTTTGCCTTAATTAGAAAATAAACCGG
TTAGACAAAGCCCTCCACAATCTGTAATGTATGGGAATACATGATGAGAAAATGTTTCGG
TCCCAGCTGATGTACACTGATAACTTAACATTTTTCTGATGTTCCCATGCAATCTGGATT
TGGCTAGGTAGTAAGGGAAAAGGCATAAGACTTGGAAAGTTGGAAGGCTCAAATAACTAA
CATTACGACTAACTAGCTATGTATGAGACATCATTTAACATTTATCTATAAAGGGGCAAT
AATGAGGATTTATGTGAATTAAAGGAGGTAGATATTATAAGTATGAGCTTATTCTAAGGC
TTTTTTTAGAAGAAACTACTTTTATGTGCGGTCTGAGACTTTTTTTTTTTTAACTGTTTT
TACTGTTGATTTCCAGGATTCCAGATAGCATTGGTAAAGACATAGAAAAGGCCTGCCAAT
CTATCTATCCTCTCCATGATGTGTTCGTTAGAAAAGTAAAAATGCTGAAGAAGCCCAAGT
TTGAATGTGAGTGAAAATCAAAATCATGTGATTCCTGAAAGAAAAAATGTAGGAAATATA
TTGGGTTGTTTTTTTTTTTGAGACCAAATGATGGCCTCCAAATACTATACACCTAATGTT
TTCTTTTCCCTTTTAGTGGGAAAACTCATGGAGCTTCACGGTGAAGGTAGTAGTTCTGGA
AAAGCAACTGGAGATGAGACAGGTGCTAAAGTTGAACGAGCTGATGGATATGAGCCACCA
GTCCAAGAATCTGTTTAAAATTCACCCTTTTAAAAGTGGCAAATAAAATGTCTTATTTGT
GATGGTTTGCTTTAAATAGTCTTAACAGTTTGGTATATCAAGTGTTCTGATAGTGAAAGC
TCGATCTGGTGTATGAATTTTTTCTATGGCCCTTTGGTAAGTAATTGAGAAAGGGATATC
ATTTGCCATTCTAAGTTCTTGTAATTTAGAATGGAAGTATTATGTAGATGGTTAATGAAA
GGAAGCCCTTTCTTCACATGGCTTACATTTAAGTGTTACTGTGCACTTGTACTGAGAAGC
TGAATTTGGCTAGAGAAGCACAATGGTTACTGGTCTCCTGTTAACTAAATTCAGTGCTGC
CAACTACCCAGTATTTCCTTATCTAATTACTTGCCCATTCTGTTTACTACCTCCTCAAAC
CTCCAGCTTTTCCATGTTGTTGCTGAGCTGAGTGACCCTGCTTACTGTAATATCTAAGTA
GATGAGAAAAGGACCTTACCAATTCTACCTTGTAATCTATGCATGTGTTTCTATTTTCTT
CCCTCTTCACTGGATGAATTGTGCTAAGACTTACCTTTACACTTTTAGATCTCAGGCCTT
CTTGCCTGATCAACCTTATGGCTTCAGCAGTTCTCAAATGCATCACTTTTCCTTCTAGGA
CTCCCATAATACAAATTGAAATACTCTGCCCTTGCAGGTTTCCACCTTATTTTAACCCTC
TTACAATAGCCAATTATCTTCTAATCCATTGCAGTTAGACTTTCCCTCATACCACTCACA
GGGAAGCTGCTGCTCTCAAGAGTGTTAGTAGTCCATTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1821..1924, 2426..2613, 3352..3560, 4876..4985, 5116..5237
1001..1062, 1821..1924, 2426..2613, 3352..3560, 4876..4985, 5116..5234
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved