Dasypus_novemcinctus Locus EP400
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus EP400
Dasypus_novemcinctus
EP400
GeneScaffold_6751
SNORA49
50744..50877
85006
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCCCAGAGTGAGAAATGCTAAGGTGCGTACTGCAGGAAGTTAGG
TACCCAGGAAGAGACCTTTGGCCCTAGGAGAGAAATGGGTTGGCTATAAGCATTAGGTCT
GATTGCCAAAGTGCAAATTTTTGTTCTACTTACTAGCTGCTTGGCTTTGAGCAACTTAAG
AGCAACTTATTATTGCTTATTTGAGCAACTTATTATTCCTCTGAGGGAAATAGTTCCCCC
ACGGGTTGATGTGAGCAGACAGTGTGACATCCCAGGCCAAGGGCGTGGCAGAGAGGCTGT
CCCTGCTGGTGATGTTAGTGGCATGCGGCAGTGCCTGTGGGGCCACTCACCTGTCCTGGG
CAGAGGCTCAGAAGGCATCTCAGTGCCCTGGATGTGAATTGATAGCACTGTGGTTTTGAA
CCTTACACCGGTGGAAATAGGCTTTCCGAGTATCTTTTCAGTGCTGTTGGATAGTAATCT
TAGTAAATGGTAATCAGACAATTATATTTGCCTTTAAATAACTTGACTTTAATTTTGATT
TTTTAGGATAACATTAAGTTGGATAAAAAAGGGGGGCGATAATGCACCATGGCAGCAGCT
CTCAGAATGTCCAGCATCAGCTGCAGCGGTCCAGGTCCTTCACCGGCAGCGAAGGCGAGG
AGCCGCCGCAGTCCCATTCCAATCTGCCCCAGTCCCCTGCCACGCCCTTCGCTCCGTCCG
CGAGCCCGTCGGCACCCCAGTCCCCCGGGTACCAGCTACAGCAGCTGATGAGCAGGAGCC
CCGCGGCGGGGCCCAACGTGAACCTCACCCTTCAGAACGTTGGTCCGGTGGTCGGAGGAA
ACCAGCAGATCACGCTGGCCCCTTTGCCGCTGCCCAGCCCCACCTCGCCGGGCTTTCCGT
TCGGCGCTCAGCAGCGGCGCTTTGAGCATGGCTCGCCGTCATACATTCAAGTCACTTCAC
CGCTGTCCCAGCAGGTTCAGACTCAGAGCCCCACGCAGCCCAGCCCCGGGCCGGGGCAGG
CCCTGCAGAGCGTGCGGGCGGGCGCCTCCGGCCCTGGACTGGGCATCTGCAGCACGAGCC
CCCCTGGGGGGTTCGTAGATGCCAGCGTGCTCGTGCGGCAGATCAGCCTGAGCCCATCGA
GTGGCGGGCACTTTGTGTTTCAGGAAGGATCAGGAATTGCCCAGATTGCTCCAGGGACGC
AGGTGCAGCTCCAGCATGCAGGCGCTCCCATTCCGGCCAGAGAACGGCGGCTCTCCCAGC
CTCCCGCGCCGTCGGGAGGCACCATCCATCACCTGGGACCCCAGAGCCCTGCGGCGGGTG
GTGCGAGCGTCCAGCCTCTGGCCAGCCCCGGCCACATCACCACGGCCAGCTTGCCCCCAC
AGATCAGTAGCATCATCCAGGGACAGTTGATCCAGCAGCAGCAGGTGCTGCAGGGCCAGC
CGCTGAGCAGGCCTCTGGGGTTTGAGAGAGCCCCGGGTGTGCTCCTTCCCGGGGTGGGCG
GGTCGGCCGCCTTCGGCCTGACCACCCCACCCCCGCCCACAAGCCCTTCCAGAACCACCA
TGCCCCCCGGCCTCTCCAGTCTCCCTCTGGCTTCCACAGCGAGTCCAGGAGTGAAAAGGG
CACCCAAGAAGTTAGAGGAGATTCCACCGGCCACCCAAGAAATGGCTCAAATGAGGAAGC
AGTGCTTAGAGTATCACTACAAAGAAATGGAAGCCCTGAAGGAAATCTTTAAAGAATATT
TGATTGAACTGTTTTTCTTGCAACATTTTCAAGGGAATATGATGGATTTCTTAGCTTTCA
AGAAGAAGCATTATGCCCCGTTACAAGCATATCTTAGGCAGAATGATTTGGATCTGGAGG
AAGAGGAGGAAGAGGAGGAAGAGGAGGAAGGAAAATCTGAGGTTATCAATGATGAGGTAA
GAAGTCAGTAGTTCAGTAATCTACAGGGCTTGTGTTAAGCATACGCAAGTCTATGCAACA
GTAAATGAGAACGTAACATATATTCTGGCTAATATGGTTCATAATGATTTGATGCATTAG
TAGACTGTGGAGTGCATTTTGCTTATTTCCTTCATGGAAAGGAAGAGTTGTTTTTAGTGC
AGCAGTGTGTTGGAAGGAAGATAAATAACAGGGCTGTCCTTGATGGTCATTAAAAACTCA
GACATTTTCATTTGGAAACAAGGATTCATCTGGGTTCAGGCAGCTAATCTGGTGTGATCC
AGTTCTTGCCCCTTGAGTCTAGGTGTTTGGTTGTTGACTGAAATGGTTTGACAGCTGTTG
TAAGCCCTACTGCCTTTGGCCTGTGTCGGGGGCACGGGCAGGGATTTTCTCTAGCTTTAA
TGCCCTCTGGTTGGTTTTCCCCGTTTCACATTGCACTTCTGGAGGTCCACCCATAAGAAT
ATGGTTAAGGGATTTAAATCACTAATGTTTTAGAGTATAGCGGCCACAATTACAAATGTA
TAGATACATTAATATATTATCTTAATGATTATATAACTTAAATGTGCCAAAAAATTATGT
TTGAGAGTTTTTTCAATTTTTAGATATGGCCTTAGGTCTTAGATCTCGTTTTAAGCCTAT
ACTTTTGCAAATACCTACGGAGTGCTATTTAAGATTCTTTTTGGGTGCCTGAGATAGGTG
CTTAATAAATCCCCTAATTGAGACTTTTTAATACTGTAGTGGGTCCTAAGAGCCTCGTAT
CTGTACTTCCTGAAAAACCCCAGTTTCTCGTAGCAGGTAGGGGGTGGGTTGCACTGTGAT
GAGCCTTGGGTCCTTGCTGGTGCTGTGCTGGGAAGCCGGGGGCTTTGTAGTTCAGTGAGA
TAGCTAAAAGGGCTTGCATCCCTGCCAGCCCTTATCCTGCAAAGAAATCAGCCTTTGGGA
AACAAAAGCTTGTCTCTTTGCTTAAGGTGTCCCCATTGATATTTATGGGTGTGTCTGTGT
GGCTTGGCCATTTTGTGTTCTCCTTAACACCCTTTTCAGGAGGGGCCATCTTATTTTCCA
AAAGTTTACATGATTATTTTGAGGATTTCATTTAAGAAAGCATGAAATTCGAGTCTCTTC
ATGTTGTACACCTTTGTTGTGTGTAAACTCAATCCCCTTTACCTGTGCCTATAATGAAAA
GGGAAGTCCCTTTTTATGACTTCCTGCTGACCCCACCCTGTGCCCTGCTGGCCCTGCAGA
GAGCAGATGGAGAGGGGCTCCTATGCAAATCCCCCATGAGCCCGTAGGACCTGTGTTCCT
GGAAGTTGACACACAGTCCACAAGAGCTGCCATCTGGTTTTTAAAATGTGAAGTTACAGA
ATCGGAGGACCTTTTTCTTGTGACTTGAATTGGCGCTGCTGCAAGGTCTGCTGTTGAATT
CGGTTGTCATGACTGTCAGTTCTGTGTCCTTTTACAGGATTTGATGCAAAAGCCTTTTGA
GTCATAAACACCGGACATCAGTGAGCTGTCAGCAGTAAAATTCTAACAAAATTTTGAGCA
GTCTTAAAAATTATGTTACCTTTTTTTCTCAAAATATTTCCTCCCAGGTAAAGGTTGTGA
CAGGAAAGGATGGGCAGACTGGTACTCCTGTTGCTATAGCAACCCAGCTTCCTCCAAACG
TTTCTGCTGCTTTTTCATCCCAGCAGCAGCCACTTCAGGTACTTTTCGATGGTTCTAAAA
ATGTAGTCTCATCCCAAACTTTTCCTTCATCCAGATATTTTAACCTTCAATTTACTATTT
GCTCTTCAGCATTTTTTTTTCCAGAGCCCATTCCTTACTTTTAAAAAATAAAAAAAAAAC
TTCCTTCATATAAATAATCAAATTAATTTGCATGAGTAAACAACAACACAGACCCTAATG
CATTATTTTTTCCTTGATGACCTATATATTGCAGTAGTAACTTCTAGCATGCATGTCATC
TAATACTTTAAGTCCCGTTCAGTGTTTGCTCGGGATCCCTTGTGTGCTGTGTTTTAAATG
TTGTTTCTTTCTTGTGTCTTTTATCTGTATTTTCTAGAACAGTGCTAAACAGAACAAGAA
AAAAGACTTAAATGGATGACAACTTGGTGTTTTTTGTAGATAGAAGAAATACTGAAGTGA
AACCCCCTAAAAGTCTCAGTACCATAGGCTTCTAAGTGATGTTAATTGAAAACAAATTGA
TGCTTTTTAATTTTTGGAAGACAATCAAATATTACATAGTAATGTCAAGAACCTAAGAGT
GAAGGTCAAATTCTAATAATTTTGGCATAGATAGTGCTAGGTTTAGGTTCTAAAAGCAGC
TTGATCTTTGTGGTGACATGTTTTATACAATTTTTAATTTTGATATAATAATTTCACTCG
TCCACAAAAGTTGCAAGACTAGTAGTAACACAAAGAACTCCCCTTATTCCCTTTACCCAA
GTTTGCCAGTTGTTGCCTTTTTATCCCCTTTGTGTTACTCACCTTCTCCCACCCCCTTGC
CCACTCATAGTCATGTTCTCGTCTAGTGCCCCTGGCCCCAGCCATTTGCAAGGAGGTCTG
CACTAGGTAAGGACCCTCTTGTCCCTAAGCACAGTACAGTGATCCACATGAGAACTCACA
GTAACGCAAGACTTGTCCACGCGCAGTTCACATCCAGACTCCGTTCGCTGCCCCGTGGTG
CTCCTCATAGCTCTGCTCCCCATCCAGGGCCTCGCATTGTGTTGATCTGTCTCGCCTCTT
TGGCCTTTCGTCAGTCTTCGTGACATTTTTGAAGAGTAGAGAGCAGTTATTTTGTAGCAC
CTCCTTAAGTATGGGTTTTCTCATGTTTCTTTGTGTTAGATTCGGGTCATGCATTTTTGA
GGAGAATACTTCAGAAACGATGAGGTGTCCGTCGCAGTGGAGGCCATTATGTCCATTTGT
CCCCTGCCTCTTGTTATTAAATGTGACCACTTGGCTAAGGTGGTGTGCATTAGGCCTTCT
CACTGCGAAGTTGTTAGTTTTCCTTTTGCAAAAGATAAATAATTGTGGGGAGACATTTTG
AGACTGTGTATCTATCCTATACCTTATTAAACTTTCTCTCACTCCTTTGGCATCTATTCA
GTCTTTCCAGAGTCAGTTGTTACTTTGAAGGTTGCAAAATGGATTTCCTAACCCCATCAT
TCCTTCTACCTTTAATAATTGGCATCTACTCTAATGAAGAACTGTCCCTTTGCCTCCATT
TATGTCTTCATTCATATATGAATTATTTAAATCCATGGGTTATATGGCATACCACTCCCG
GTATTTATTTTTGTTTCTTTAAATTTATTTCATTTACATTCAGTACATTCGCTCTTTTTG
GTCTATATTTGCTCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CTTATACTACTGTAGAGACCTGTGTCTACCCAAACTGCAGAACTAGAAGACCCAAATATG
TCCTGGGCCTTCTCCTCCATACCCATTCTCATGTAATTTGCTCGACCTAGCAGGCCATCT
CACTCTTCGGTCCAAATTATACTCATCTTTTAAGGCCCAGTTCAATAGTCACCTACTCTC
TAAATTAACTCTCCCTGCCACAATACCCTGTTCTCCCGAGTTAGCACATTCAGCAGTGAT
GTAAATGAAAGAGTCCAGACAGAGAAACAGTTCAGTACTGCTCTACAGCTGTATGACTCC
TGGGCAAGATATTTAATCTCTCAACCCTGGTTTCCTCATCTAGACAGTGAAAAGGCTGAC
CAAATCACTACTAAATTCTTACCCAGCTCTTAAACTCTATTAGATTTATAGCATCTGTAT
CCACTTTTCCCCAGTCCCAAAGCGACGATCAAGTTGAGGCCCCCATCATGTCTTACCCAG
ATTACTAACATACCTGCTCATTGTTTTAGTTTCCTAGGCTACTGAAAGCAGAGACCATGA
AAATGGGTTGGCTTAAACAATGGGAATTTATTCACTTAAGACTTTGAGGCTGAGAAAACG
TCCAAATCAAGCATCATCAAAGCAATGCTTTCTTCCCCTAAACGAGCTGCTAGTGATCCT
TGATTCCTCTGCCACATGGCAAAGCACATAGTGGTGGTAGTCTACTGGTCTCTCCTTTTT
CTTCTGGGTTTTGTAGAATTCAGCTTCTTGCTTCTGTGGCTTTTTGTCAGAATTTCATTT
TCTTATAAAGGACTCCAGTAACAGGATTAAGTCCCATCCTGAATGAGGTTGGTCACACCT
AAATGAAGTAGCCTCATCAAAAGGTCCAACTTAAAATGGGTTCCCATCCACAGGAATGGA
TTACTTGTAAGAACATAATTTCTGTGGCACATACTACTTCAAACCACCACATGGTTGTTC
CAGTTTTTGTCAATTATGAATAAAGCTGCTATAAATGTTGACATACAGTTTTGTGTTTTT
TTAAAGATTTATTTTATGTATCCACCCCCCCTTGCTGCTCGCTTGCTGTCTGCTCTCCAT
TCGTTGTGTGTTCTGTGTCTGCTTGTCTCCCTTTGTTGGGTCATCTTGCTGCGCCAGCTG
TCCGCCAGTGCGAGCCATCAGCTCTCCACGGGCGTGGGCTGTCAGCCCTCTGCGGGTGTG
GCCAGCTTGCCTTCACCAGGAGGCCCTGGGAAGCGAACCAGGGCCTCCCCTGTGGTAGAC
GGGAGCCCAATCGGTTCAGTCACATCTTCTTCCTGACATAGTCTTTTGCATGAACATAGG
TATTTACTTCATTTGGGGCCAGATTACTGGGTTGTATTTTATGTTTTACTTTGTAAGAAA
CTGCCCAATTTTTCCAAACTGGCTGTATTTTAGAATTCCAGTTGCTCTGCATACACCCTG
GCATCTGGTATTGTCATTTTGTAAAGCTTGTATTAGTAGGTATGTAGTGGTTTTAATTTG
TGTATGTCTAAAGACTAATGATGTTCAGTATTTTTTTATGCACTTATTTTCCATTTGAAC
ATCTTCTTGGGTGAAGTATCTGCTCATGTCTTTTGCCCACTTTTGCCCTGGGTTGTTTGT
TTCCTTATCATTACATTTTGAGAGTTATTTACATGATCTGGATATGTCTTTTGTCTGATG
TGATTTGCAAATATTTTCTCCTAGTATGTGGCTTGTCTTTTTATTTTCTTAACACTTTTT
TAGAGCAAAAGTTTTAAATATTGATGAAGTCCACCTTATCAATTTTTTTCTTTTATGGAT
TGTGCTTTTGATTTCATATCTTAACTCTTTAACTTTAGGTCATAAAGATTTTCTGTGTTT
TCTTCCATAAGTTTTATAGTTTCATGTTTATATTTAGAGCTGTGATCCATTTTAAGTAAA
TTTTTATGTAATGGGGGAGAAATAGGTAGAGAGGTTCCCCCGCCCCCCACCACCATACAG
GTATCCAGTTGTTTCAGCTCTCTTTCTTAAAAAGACTCTCTTTTCTCTGTTGAATTGACA
TTGCATCTCTGCCAAAAATCATTTCATCATATTATGTGTGGGTCTACTTCTGGGCTGTCT
CTTCTCTTCTATTTAACTGTCTTGATTACAGTAGCTTAATAATAAGTCTGGAAATCAGGT
TGTATGAGGTCTCCAACTTTTTCAGAATTGTTTTGGTCATTCTAGTTCCTTTCCCTTTTC
ATATAAATTTTAGAATCAATTTGTTGATATCTTCAAAACATCCTGCTGGGAATTTGATTG
GGATTATATTGAATATATTGACCGGTTAGGGAGAATTAACAATGTGACAATATTGAGCCT
TTCAGTCCATGAATTTAGTACATCTCTCCATTTATTTAAGTCATCTTTGATTTATTTCAT
CAGTGGTAGTTTTCAGCATAACAATCCTGTAAATATTTTGTTAAATTTGTAATTAAGTAC
TCTGCTTTTTGTGTAATATTGTAAATGGTATTTTAAATTTTATTTTACTTCCATTTGTTC
ACTGCAAGTACATAGAAATACAATTGATTATTTGAACTTGTGTTCTGCAACTTTGCTAAA
CTCATTCATTAGTTTTAGGAGGTTTTTTTTAGTTCTGTTAGTTTTTCTACATAGACATCA
TGTTGTCTGCAAACAGAACAGGATTTTTTTTCCCTTGATTTATATGCCTTTTATTTCCTT
TTCTTGCCTTTTTGCACTTGCAAGGACTTCTGCTATGATGCTGAATAGAAGTGGTAAGAG
CAGATATCCTTGCCTTGTTCCTGGTCTTGGTGGGAAGGCATTCAGTCTTTTACTCCTAAG
TATGATGTTAACTGTAAGTTTTATACATATCTTTTATCAGGTTGAGGAAGTTCCCTTCTA
TTCGTAGATTTTTGAGAGGATTTATCATGCATGGATGTTGAATTTTGTCAAATGCTATTT
CTGTATTTTTTTTAGATGATCATGTGATTTTTCTTCTTTAGTTTGTTAATTGGTGAATTA
CATTAAATTGAGATGTAATTTACATACAGGGAGATACACCGATCTTAAGTGTTACAGTTC
ACTGAGTTTTAACAAATACACCTGTGTAACCCCCATTGCCTTTCTTTCTTTCTTTTTTTT
TTTTAAGATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGTTGTCTGTTCTTGGTGT
CTATTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTATTCCTCTCCCCACCCCCCACCCCCGTTCTCC
CCATTCCCCCTGTTGTCTGCTCTCTGTGTCTGTTTGCTTGTATTCCTCTGTGTCTGCTTG
TATTCTCATTAGACGGCACCAGGAACCGATCCTGGGACCTTCCAGAGTGGGAGAGAAGTG
ATCACTTTCTTGCGCCACCTCATCTCCCTGTTCTGCTACGTCTTCTTATTTTCTCTCCTC
TGTGTTTCCTGTTGTGTCATTTTGCTGCGCCAGCTTTCTGCATCTGCTGGCACTCCTGCA
CAGGGCTGCATTCATATGTGGGCCAGTACTCCGTGTGGGCCAGCTTGCATGTGGGCCAGC
TCACCTTCACCAGGAGGTCCTGGGCATCGAACCCTGGACCTCCTATATGGTAAGCGGGAG
TCCTATTGGTTGAGCCACATCCATTTCCCTAAAAACCACTCTTAAAACCTGGAATGTGTC
AACCATTGATAAGGTACTTGGAGGCGGTTCCATGTACTCCACAGAGCAGATGGGGCTGGA
TCGGGAGATGTAATTATAATTATGACCTGTGTGTTTTGAGTCCTCTGTAAAACAACACAA
GGGTAGCCACAGTCAGGAAGTCAGTCAAAAGAGTTTGGCCTTCTTTGTCAGTGACCTTTG
ATGAGCAGAAGTTTATTTTAATGAAGTCCAATTTATCAATTTCTTTTCATATGCATGTCT
ACTTTTCCAGAGCCATTTGTTGAAAAGGCTTGCCATTCCCCATTGGAGCCTTTGTTGAAA
ATCAAATGATTGTATAAGTGTGGGTGTCTTTCCAGGCTCTCTGTTTGACTCCCTTGAGCT
ACTCCTTGGATTCTTAAGTTGACATCACACTACCTGAGGACTGTTGCTTTAGAGTGTGCC
TTGAAGTCAAGTTCACTAACTGTGTTCTTTTTCAAGAATGTGTATTCAAATTAAGGCTAT
CCAAAGAATTTTTTGTTTCAGAAATTGTGTTTTTCAGTTTTAGAATCTCTGCTTGGTTCT
TTCTCTTATGATGTCTATTTTTCTGTTGCTATTTCCTCTTTTCCTTTGTAACAGACATAT
TTTTCTTTGAGCATAACTATTACAGCTGCTTTAAAGTCTTTGCTAAATCCATTATATCTG
GGTCGTCCCAGGTTGGTGTCCACTGATGTCTTTTGGGTCATGGTTTCTTTTTCTTTGTCA
TTTTAAATTGGATTTTGTGTATTATTAATAATACATTGTAGAGACTCTGGATTCTGTTAC
AGTCTTCTGAGGAGTATTGATTGTTTTGCTTTAGCAGTAGGTTAACGTGACTGATCTCAA
ATTGCAAACTCTGTCTCCCCTGTGGTAGCTGGCTACTGCAATTTCAGTTTAGAGTCTGTC
CCATGTATGTGTAGTTTAGGAGTTAGCCAGAGATTTTTCTCTTTTTAGAGAGAATACGGG
AGCATTCTCTCTCTCTCTAGCTGTCCTCTTTTGGCGATTTCCCCTTTACTCTCCAGTTGC
TGCAGTCACCTGCCTTCTGTCCTACAGTTCTTCAGCCTTTGAGACTGTGTTTTTCTGAGT
TTTGTTTGTTCCATACAGCACAGATGGAGCCTGCCCTTATGCCCAATGCCATAGAGAATG
GGAGCCTCACCTGTTTCCATTCCCTTCCTGCAAGTATCAGTTCCCTTCCTAGATCTGCCT
GTCTTTTAATATTGTTAATATTTCATCTAGAGTTTATGGTTATCAGTGATATGTTTGATC
TGACAGGAAGTTCTTAGCCATTACTGAAAACAGATCCCTTTATCATTTTTTTAATTAAAT
AAAACCCTTTTAATTACATAAGTGATGCATGTTCATTATAGAACATTTGGAAATTCAGAA
TAACACACATTCACAAAAATAGAATTTTAAGTTCCCTGTAATCCTGCCCCCAGAGAGAAC
CACTACTCACACATGGGTGTCGCTCTTTCAGTCATTCTTTTCTTTCCTTCTTCCCATTTT
TTTTGTTCGTCCCTCTCTCCCTTTCTTCCTTCTTTTCTCCCTTCATCAAATGTAAATGAG
GGTGTTGTCATGCTAAATTTACTAGATATAGCTTATTTTTACTTTTAGTACCTTGTAAGC
CTTTCCCTGTGTAAATAAATAAAACTGTAGCATGATTTGTAATTGCTGCACAGTATTCTC
TCATGTGTTTGGGCATCTGCAACTTTTGCATTTATTAATAAAGTGCCTCACTAAGGTAGT
GGATGTGACTGAATCATTAAGAAATAATTTAGCAGCTAGCAATGGTTAAGAAACATAATT
CTTAGCATTAACTGACATTGCAAGATGGTTCGTAGGTGTAAAAGACTAAGTCTGCAGACA
TGGGTTGAGTCTGTGCTGACTGAAGGTTATTTTCTTTCTTTTAAAAATAATGTTCCAATA
GCTTTTTACTTAAACATTTTAAATAATAAGTACACACATGCACACATACACACACACTTG
ACATGTACTTCAACTAGAACATTAACTGCAAAAGAAACATCATTTTGAAGATCCCCTTTA
AATTGTTATTAGTTAGGGTTTTAGTGTCATTTTCCATGGAAACATAATTCAGCCTTTCTT
TTTACTTAGTTTTGTTTTTGTTTGTTTTTGGTGTAAAGATATGCCACGATATGTGGCTAT
TTGGTGACTGAGCTATAGTCACAGCACAAATGCTGATGTTTCCTGGTGTCAGCCCTTTGC
CTTCATTTCACAAAGCCATTGGTTCCTGAAGGATTCAGTGGATTTGCCTTGATTTGAAAT
TGCATTGAAGACAAAAATAGGATATCCTTTATCAATTCTTTTCCCCTCTCTAGAGGTGGT
AAGTTAGAACCTTCAACTATTTACTGTGTATAGGTGAACACTGCATATGTATGTTAAGCT
CCATGATACAGATAACATTTCTCTTATTAAATGGGACTGAGGTTAGTGTTTGGGATACTT
AGGATGCTCTGAGCTTATCTTCATTCTTGAAATGCACCTGAGTGACCACAGTCTCATTTT
TTCACTGTTTTTCAGCACCAAGCCCTGGCAGGGAAGCTGGTCTCAGCGGCTGGAAGCCCT
GCAGAAGGGGACCCTCTTAAGAGGCAGCAGCCATTACCCCCAGCAGGTAGGTCCCGAGCC
CAGGCCCGAGGGTGCCTCGGGGGTGGCCCTGCCCTTAAGACAGCTGACACCCATTTCCAA
ACAGTAAATGTGAAGGACCCTGTTCTTGGGTAGCGTCTTTCTGCTTTGAAAGTTGTTTTC
TTTTGATGCTTATCAACTAAATAAAATCTTTATGTGACTGTTTACGTGCATTGACGTTCA
TCAGTTGAGTGCATTCTGTTTTGAATTTTCTATGTGCATTTCCGGCCGCCTTAGTAATTA
TGATAGGATTATGTAAAGTCACTGACTTTTTAAAGTTGTCATTTTTATTTTCAAATTGAA
TTTTTCTCCAAATCATAAGCCTAATACATTCTTATATAAAAGACTCAGGCAGTTTAGAAG
TGTATAAATGAAGTCTGTTCTGGGCCACCATCAACATTTTTCTATGCTTACTCAAACATT
GTTATACATATGTTCTTTTTAAAGCATTCAGATGTGATTAGAACTATAGCACAAAGTGTG
CTTGTTTTTTAGACTCAGTCGACTGTCGTGGACGTCTTTCCACGTCAGTGCACCTCCTGC
TTTTTGAGGCTGCTGTGCAGTCGCCCGTTGTGAGTGCCTCATCACCTCCGTAGCCAGGCA
GGCCCTTGATGACCCTGCTTGGGTTACTTGTCTTTTCTCGGCTTCAGTCAATGCTGGCTT
GAACATCCAGTCTCGTCTCTTTTTCTACACACTGGTGTGTATATCTAAGGAGAAATTTGT
AAAAAAAAGAAGTGGCTAGGTCCAAGCATATGCACAGTTAAGATTTGATACTGGAAGCAA
ATGTGACTCAAGCAGTCGAGCACCCACCTCCCACATGGGAGGTCCCAGTGCCTCCTGAAA
ACAAACAAGCAAGCAAAATGAGTGAGAAGCCAACTTAGGGAAGCTGATGTGGCTCAGTGT
TTGAGAGCTGGCTTCCCATATACAAGGTCCCAGTTTCAAGCCCTGGTATCTTAAAAAAAA
AAAGAAAGAATTGATACTGTTGGGGAAGCAGGTGTAGCTCAGCTCAGAGGTTGAGTGCCT
GCGGTCCTGGGTTCAATCCCTGGTACCTCCTAAAAAGAAAAAGAAAAGAAAATTAATCTG
CTAAATTGTCCTCCAATAGGGTAGGGTCAGTTTTCACTCCCATCAGCAATTTCTGGTCCT
CTCACATTTTTGCCATTTTTTTAGGTACAGTCAATCTTCTAATTTTTGTCGCTCTTATGG
ATTTGATAGTTTTAATTTGGGTTTCTTTAATTTTGAATAAGGTTGCACAGTATTTTTTCA
TGTTTATTAACCAATTGTGAACCTGTTCCTCTAAACTCACTGTTCCGGTTCTTTGCCCAT
TTTTCCTACCTGGCCATTGGTACTTTTCATATTAATTTGTAAGAGCTTTCTGATTGCGTC
TGGTAGCTGAGCCTTTTGTTTGTTGCATGTGTTGCCAGTGCTGTGTCTTTGTTTGTTGCT
TGTCCTGTGCCTTTTCATGATGCTTCAAAAAATATTTGCACATTTTTAATTAAAAGAAAT
TATATTTATCAGTCTTACCTTTGTGGCTTCTGGATTTTGGCTCATGCATGGAAAAGCCTC
CCTGTTCAAAATTATAAAAATAAACACTTTCACATGTTTTTTTTCTACTACTTTTGTGGT
TTTATTTTTACATCACACTGCACCTTTTTTGAAAATTATTCTAGAGCAGTCTAAGAGACC
TCGACTTGAAGTGGGTCATCCAGGGGTAGTTTTCCAGCACCCAGGGGTGAATACGGGAGT
CCCTCTTCAGCAGTTAATGCCGACAGCACAAGGTAAGACCTAGTATTAGAACCAGCTCTT
TCAGCTGATTAAAAGGGAGGTCATAGATATCTTAAACTAAGACTTTTATGGTCGAGGTAG
TATATTTAAAGTAGAATTTCTGAAATTGGGATGTTTCTCCAAGTCCCAATTAATGCAGGA
TGAAGAAGCCCCTGGAGACACATTGTCATGTGCATCTCCTTGTCCCCATGCCTTGCACAG
GCTTGCTCCTGTGTTTCCTTGGTTGCTCTGCTGTGGGGGACACCCTTGGGTTAGTTGATA
CTTGTCTTGCTTGGTGCTAACTTGCAAACTTCAGGTGCCTTTCTTTCCTTTTTTGTGTGC
TCACTTATAACATTAGATCTAATAGAATACTAATTTCACACCAATTCTATTTCCTGTTTT
GAATGTATGAATTGGTTCTCAAGTGATTTAAGTCCATGACAAAGCATTGGGATAAAAGTA
CCTTCTTACTTGGTAGAGTGCCTCCAAACCCCAAAATCAGAGTCGTTGGTGTTTTTCTTA
TTTTGCAGGAGGAATGCCTCCCACTCCTCAGGCCATGCAGCTCACTGGGCAGAAGCAGAG
CCAGCACCAGTACGATTCTTCCACGGGGCCTCCTGTGCAGAATGCTGCAAGCTTGCACAC
GCCTCCCCCGCAGCTCCCTGGGAGGCTGCCTCCCGCCAGCGTCCCCACTGCACCCCTCCC
ATCTGCACTGCAATTTTCACAGCAGCCACAGATGGTGGAGACTCAGACACAGCTCCAAAT
TCCAGTGAAGACGCAGCAACCAAATGTGCCTGTCCCTGCCCCCCCATGCAGCCAGCTCCC
TGCTCCTCTTCCACAGCCTCCACAGCCAGCACTCCATGCTCCGATGCCTGGGAAGGCCCA
GGTGCAGGTCTGTCAGCTTTCATCCCAGCCACAGGTACTCTACAGACATGCGTCTGTTTT
GCTAGTTTGGGAATGAAAAAAAGAACACATGTTGTTTGAGGTGGATTGTCATCTGTGTAT
TGAAAGGATGGTATGCCATACTATACTTCGTAAATTTTCTCTTAACATTCTCCCACTTCA
GAAAAATCAGTTAATTAAGTAGGTGCAGCATTTCATTTTATTTGGCTCTGTAATGATGAT
AATCACCATTATTTAAAATATTTCGGTCCTCAGTGTAGGAAGTGTCTCCTCCTTGGACCG
CAGAGCTTGCAGAGGTCACTGTGCACATTAGCTTGTCTAGTTGGCCCACTGCCTCCGAGG
AAGATGGCAGCAACCCATTTTACTCTCTTGTGGGCTCAGGCTTAGAAAGCATGCTTTTTA
CTCTCTTCCTTCCAAATGACAACTTTTTTGGGAGGGACACAGTAGACTCTATAAGCATAA
GTTCTTGTTCATCAGGATAGATACACTGTTTTAAGTATTTAATATTAACCCCTCCCCCCA
ATTGATTTTACTCAATACACAGTTCAAATATTTAAAATGGCCCCTCATTTGATTTTACAC
CAAATGTGTTTTTGGCATTATGATGATAAACTGTTTTCAGTCCCTAAAAGGGAGAGAAAT
GCTACAGCATGAGAGTGAACTGATTAGGGGAACACTGAGGGGGTGGTAGGTAGGGTTTTC
AAGTACTTCTATGACCCATCTTAGCTCTTTGTTGGTTTTTTTTTAAGAGGGTACCTGGGA
TTGAACCTGGGACCTCATACATGGGAAGCGCAGTGAGAGTTGGCTTGTTTGTTTTGTTTT
TAGGAAGTACCAGGGATCAAACCCGAGACCTTGTACATGGGAAACAGGTGCTCAACCACT
TGAGCTACATCTACTTCTCCCATCTTAGTTCTTAATAATTTGATTTATTTCTACGTATTG
TAAATAAAGCAGGAAATCACTACTTTCTTTTGCCTTCTCCCTCATTAAGGGCATTTTCCA
GGTGAGCTGTGAGTTCAATTTCTTTGTGATTATTTGGGATTTATGACAAAGTTTGGTGAA
GTGTATAAAAATGGAATAATAATAATCCATAATAGCTGCCATTCATCACTTGCAAGGTCC
TAGGCTCTGTGCTGAGAACCTGGGGAGCATTGTTTGATCTTCCCAGCAGTCCTGTGAGGT
AGAATTAGTACCCCCATTTTACAGATGAGGAACCCTGAGGTAAGGCAGGTCAGCAGCCTG
ACAGGGCCACGTGGCTGGTCCGGGAGGCTGTGTGTGGAACCTGGTGGTACCTGGGTTCAC
GCTTAGGCCTTGCAGTTGCCCATGTGGAGGATGAGAGCATTTTGAGGGCAGTCTTTCTTT
AGAGGTTTGTGGAAAGGAGGACTGTTTTGAACCCTTTCTCTCATTGAGCCATGTACTGAT
TTAAAGCAGCACTATGATATTTGTTATTAGTTTATTTGCCTGTATTACTCAAAGGAGAAG
CTGTTGAAAATGATTTTAAGATGTCCTTACATCCATAAAAACCTGTTTCTTTTAGGTAGG
CAGGGCAGGGGTTGGCCAGATATTACTTACATATTTTAGGCTTTGCAGGCCATTCAGATT
CTGTAGCAGCTACTCAGCTCTGCTGTTGTAGCATGAAAGCAGCCGGGGACAACATGTAAG
TGGCTGGATATGGCTGGGTTTTGATACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTATGATATTATTCATTTTTAATACCCTAATTTATTTTTTCTAAATTAGTAT
ACATTCTATTTCTAATTTTTAAGCCTATCTTTACTATTCTATTTTTCTACTTATTGAATT
TGGCAATATATTAGGCTTCATTTCTGAAGAAGTTTTGGACCACAGAGGGTTTTAAATATG
GCAGGGGAGGAACACTAATGTGGGGTGCTATTGATAGGGGACACATGGTTGGGAGGGAGT
TCTCCAGGGCATGCATATAGGGTATATAAAAATGTTTGGATATTCATTGGGTATTTCATT
ATAGTTAATAGTTACAAATGACAACTGAGAGAGTGCTGAGTTCCTAGACAAGGAAGCTCT
TTCACTTTCCACAATGGAACAGCAACAATTCCCCAAGTACAAGGCCAAAGACCATTGAAG
AAGGATGGTCCAATGATAAGCCCATGATACTGATGACTATGCTTATGAGCTTTGTGTGCC
TGAAATTTAACCTGTGCTTAGAGCTACAGGGTACCTAAGAGTTACCTCCTAAGAGCCTCC
ATGTTGCTCAAATATGGCTACTCTTTAAGCTACACTCAGCATATAAGTGCATTACCTTCC
CCCCAGCATGGGACATGACTCTGGGGGATGAACCTCCTTAGCACTGGGGAATTACTACCA
ACCATCAGCTCATGATGTAATTAGAAAAGACCGTGAATAAAAAGGGAAAATGGAAAAACA
AATGAGTTTATATGGGCTAAGAGTCTTCAAAAAGAGTCAGGAGATCATCAGATGGGTCAT
GCCTACACAAGTCTCAGTAGGATCAGAGATAGCCAAAGTAGATACAACCCCAAGGTACTG
GTTCTCCTGAGAGATACAAAGACACACAGATTCAACAATTATGACAGTTGGTTCTGGAGC
TCAGTGCCTTGTCAGTGGGCCCTACTTTGGAATTTGTGTTCCTGAGTGTAATGGATTTGG
ACTCAGATGAGACCTTTCTACCCATGCCTTTTCTGTCACTTTTACTGAGTCTGTGGTTGG
TGCTGGGGTTGGTGTATACACAGGAGACTTTAATCTCTGGACTGGCCATATGCCAACTGG
ACCCTGATCCTCAGCAGAGTTGCAGTTCCTACTTTCTTGTTCATTGGACTTCCCCAGGTC
AGCTAACAGGGAGGTGAAGGTGGTCAACCACCACCCCAGGGAACCGGGAATGCCTATAAC
TGCAAGGAGGAGAATTGCATCCATCAATCATGTGGGATCTAAGCTATCTCTCAATATGGA
GATGGAGTGGTCTTCACCATCCCAGGGTCCACAGGATGGAGGAATAAAACATGGATTAGA
ATGGACCTGCTGGTGTTCTACTATAGAACTATTGTGACTAGCAATGGAATAAATTGTAGT
CTTGATGTGGTGAAAGTGACCACAGTAGTTGCTGAGGGTTGGGAAAGGGAAGAAGATATG
TGATGTGGGGGAATTTTGGGGACTTGGAGTTGTCCTAAATGATATTGCAGGGAAAGATGG
TGGACATTATATATCCTGCCATAACCCACTGAATATACTGTGGGAGAGTGTAAACTACAG
TGTAACTACAATCCATGCAGGGCAGAAGTATTTCAAAATGTATTCACCAAATGCAATGAA
TGTGCCACAATGATGAAAGAAGTTGTTGATGTGGAAGGAGTGGGGTGGGGAGATGTGGGG
TATTGGGAACCTCTTATATTTTTTAATGTAACATTTTTTTGTGATCTACGTATCTTAAAA
AACAGGCAATTAAATTTAAAAAATAGAAAAGAAGAAAAATATAAAGTAACCTCATACCAT
AAATGTTGATAACTTGAATGGAGAACGTATTTTAGCTCCTGTCTTTTCCCTCCATTCTGG
AATATAAATGTGCTGTGGTTTCTTTGACCTGCACTCACAGCTTAGTTCAGCAGTACTTGA
CCTTCTCTGTTCTTTCCTCCCTGCCTTTGCTCCTCAACTGAATGTCTGTAAGAATTTAAT
TTAGTCTTCATCTTGGTTGTAGGAGTCTTCTTTAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAACAAACCATTCTCAGCATTAAACAACTCACTGTCTCCACTCATTTCCAATT
CCCTGGGGCAACTGTTCAGCCACACCAAGCCAGAGTCCAGCCCTGATTGCCAGCTCATCC
CAAGACAGTTTTCAGGATACAATGACAGAACAAATAACCCTGGTAAGCATGCTTAAACAT
ATTTTTAGGTGCTTAAGAAAATTGTAAAATGTACTCTTAATTTGTGAGCATATATGATTT
TACTTTTTAAGGATGTGGTGGTTTAAAACTAGACACCTGATATTAAGGTAACTTGGGTGT
GGTTTTTGATCAGTAAAAAGCAAGATTAAAGCCAAGTCTTTTTTGTGTTTTCTGGTTGAA
GTAGATTGTGAGGGAAAAGCATTATTTCTTGTGATAAAATTGACGATTGAGAATTGCTGT
TACAATGGATGGGGAAAGGCAAGAGGGCTTAGTGGTCAGGCTGGTACTTTCAAAATCAGG
CAGGAGGGCACAAAAGGTGAGTGATGGGGCAGGAGTACTCCAGGCACCCCAGTGGTTCCT
GGGCCACACACTACTAGCCATCCCAAAGGCCTCTAGCCAAGCCACTTAGTCACTCTCAGC
CTCCTCTCCCCACTGTTGAGAGCTAGCTCTTAAAGTTTATTAGTGGCTTAGAGAATTTTT
TGCTTACTTAACTTTGTTATGGTCATAAAATACATTTATCAAGATACAAAGATTATTCTA
AAAAGCCCAGTGTTTCCTGTCATCCCGAGTTCTACCTTTTCCCAGCAAAGGGCCATCTTA
CTTCATTTATTCCCTTCTTCCCAGTGACCTGGAAATGGATTGCAGGCATTGTGTCATTTC
CCTTGCAAATACTTTGTTATAAACAATGGATCTTTCAGTATTTATTTTATTTTATTTTTT
TGAGAAGTAGGCAGGACAATTATTTTTGTGAACTTTCTTCATTTTAAAATTACTTTGTGG
CATTTCAGAGGGTTTCAACTGACCAATTTTCATTGGATAATTTAAAAATATTTTAAAGCC
TATGTGATAGGCATTGTCATGCACTCAAGTGGAAAAAAAACATTGCTTCTAATCTGTATA
TAATTAAAACCTGCTTGGGTTTGCATTTTACACATTTTAAACATATTTATTTAAATACTA
GTTAACAAGTCACCATTCCTTGAGTCCTTACAATATGCCAGCCATGATTCTGAATCCTCT
ACTTGTGCTAGCTCAGTTAGTCCTCACCCCACCTTGTGATGCTCTTCCTCATCTCCATAG
ACAGCAAAGGCATGTGCAGAGCAGAGTTTCAGGCACAGACCTTGCTGCCCAGCTGGGGCT
TGGCCCTCTCTGTTGTAAACTGTACTTTAACTTTCCTCTGGGACCTGAGTGAAAGCAAAG
AAGAGTACATGGACATTCAGAAAGGGTTTGGATTTGCTGTGAATATCAGGGATTGTACCT
TCCCCTGAGTATGAAAGTGTTACCATGAAGGTATTCTCAGAAGGTGGGTCTTGCTGTTGT
CCTTAGATATAGAACTGATGAAGCCAGAGATTTGAGTATGAGGCAAGACCCAGGCTAGGG
AAGGAGCAGTGAGTAAAGCATTGGCAGCTCCAGAGCAGCTGGGAGGAGAGTATCCCTAGG
GATTAGTAGCTCTGGCTGTGATGATGGAAAGGGAGAAGCCATGGGTGACCTTGTGCTTTT
GATCCTGGGAAATAAGGGAGGAGCTGGCGTGGCAGGCATTAGCATGGAGATTGGTTAGGG
TTCTGGTTTCCAGAGTTAGCCAGTGTGGATAACATCTGGTTGTACTGGCCAGTTTCTTGT
GACTTTCCAGTGTTATACTTATTCACAAAAATTCACCAAGCACTCTAATTCTTGGGGTCT
GGGTGAACGTCTGGAGCTACGAAGAAGAGGAGAAAAGTCCCTAGGGCTGGGTCATGTCAG
GGGAGCACTGTGTGGGAGGTGTGAACTCCATGCTGAAAGATGCTGTTTTCCTTCAAGTTG
CTACAACCCCACCACTTCCTGTAATACCCACCTCCCTTCACTTGGTCCCCAAATACTTTC
CATTCTTAAAGACTCACTTCTCTGAGGATTCTTCTAAGAATAGATTTTTAAGTGAAATTT
TTAAAAATGCAAAGTATAAACTTGTATACACTTTGAATTAGTTTAAAAATAAGAAGGTTG
TATGGGCAGAGACTGGAAGGAAATGGGAAGAAATGAAATGAAGATGGATGTTTTTGTTAT
GGTCATGGTAATCTAGTGTTATTTTTACCCTTCAGTTGCTGGCTTTGTTGTTCCTATGTT
TGTGCATTTAAAAACACAACACTGATACCCCCTTTTAGTGACCCCCTTTTGGGACACTCC
CTTTAGTCACCTCCCCTTTAGAGACCCTACTTTAGGGATTAGCCTTTTGCAAATCACCTA
TAGAAGCTGCCCTTTAGCGACTGTTCTTTAGAGAACCTCTCCCTTAGTGACTCTGTCTTG
AAGACAGTGAAGCCCCAACTCATTAATGACCCCTGTCCCCTGCCCCTGCCATTTTCTGAG
GCATGGGTTCATGCTTTTGCCCATTCTGGGCTTTGTGTCTCTGTTCATTTAGACTCATTC
TTTTGACTTCCCTTGGAAAAACCATGCCTGGCACTTANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCTTGCTTCTCTCTGAGTTGAAGGTTCCTTTCTTATGGCGGTAAACGGGGCCTTCCT
CTGTGTGCTTACTTCCCAGGGGTCCTATGCATGGAGGGCTTCAGCATTAAACTCCAACAT
CAAAAACCCTCAGCTCTGTCCTTTGCCATGTCTTTTATCTGTGAGTCCCCACCCCTTGGT
GGGTGGGAACTCAATGCCCTAATGACGTGGCCCAGTGAAAGCATAATCACGATTTAATCA
TGCCCAGGTACAGACCAGATTACAAATATAATCCAATATCTGTTTTTGGAATTCATAAGC
ATATCAAACTGCTGCACTATTCAATGTGGTTAATCACATTCACATTGCGATACGCCCTCA
CTACCTTCCTTACTAAAACTTTCCCATATCCCCAAAGAGAAACCGTATATCCATTATGCC
TTGACTCCCTATCCTTCTTCCCCTGTCCCTGGCAGCCTATATTCTAACATCTGTCTCTGT
GTGTTTACATATTCTCTCATATTTTCTTTGTAGTTACCATGGGGTTTAAATTTACCATCC
TAAGTCTAGAACAATCTTTTTTGCTTTTCACTTCAGTACTGGTCACAAACTATGTTCTTA
TACCTTTCCGACCCCACCTTTGTACAGTTCTTGTCACAAATTACATGTTTAAACATTGAG
TCTAAAAGCATCAATGTATCATAATATTTTATGCATTTTCCTTTTAGTTCCTCTAGGAAA
TAAAAAGTCCTGTTACAAATGAAAAATACATCAGTACTGGCATTTATATTTACTTACTGC
TGTCTCCCGTCACTGGGGATCCTTATTTCTTTCTGAGTTTCAGTTTATTATCTCTTGTCC
TTTCCTTTCAACCTGTAGAAATCTCTTTCGCATCTCCTGTTCAGCCGGTCTAGTGATAAG
CTTACTCAGCTCTTGTTTATCTGGGAATGTCTTCATCTCTCCCTCATTTTTGAAAGTCAG
TTTTGCCAGATATAGAATTCTTGCTTGGCATTTTTTTGTTTTCAACACTTTTAAGTTTGT
CTTCACATTACCTTCTTTCCTCCATGGTCTCTGATGAGAAACTGACATTTAATCTTATTG
TGCTTCTCTTGTATGTGGCACATTGCTTCTCTCTTGCAGCTTTCAAAATTCTCTTTTTCT
TTGGCATTCGACAGTTTGATTATAATATGCTGTGGTGTGGTTCTGTTTGGGTTTATCCTG
TTTGGAATTTGTTGAGTGTATTGAATATGTATATTTATATCTTCATTCAGTTTAGGAAGT
GTTCAGTCACTATGTCCTTGAGTGTTTTCTCTGCCCCTTTCTCTTCTCCTTTGGGACTCC
CACCACGAGTGTATCAGTACACTTGATAGTGTCTCACGGGTTCCTCAGGCTCTGTTCACC
TTTCTTCATTCTTTCTGCCTCTCAGACAGAAGGATTTCAATACTTTTATCTTCAGGTTCG
CTGACCCTTTCTTCTCTCAGCTCCAGTATGCTGTTGAACCCCTCTAGGGAAGTTTTCATT
CTGTTACTGTGGTCTTTAGCTCTGTCAGGTTACTTTTCATAATTTCCATCTCTTTGATGA
TAATCAGTTTGTGTTCATTTATCATTTTCCTGCTTTCCTTTGGTTCTTTGTCCATGTTTT
CCTTCAGCTCTTTGAGCGTATTTAGTACCACTTTTTTTTTTAAGATTTATTTTATTTATT
TCTCTCCCCTTCCCTCCCCCACCCCAGTTGTCTGTTCTCTGTGTCCATTTGCTGTGTGTT
CTGCGTTTGCTTCTATTCTTGTCAGTGGCATTGGGAATCTGTGTCTTTTTTGTTTTGTCA
TCTTGCTGTGTCAGCTCTCCATGTATGGGGAGCCACTCCTGGGCAGGCTGAGCTTTTTTC
ACACAGGGCGGCTCGCCTTACGGGGCACACTCCTTGTGCATGGGGCTCCCTTACCTGGGG
GACACCCGCATGGCACGGCACTCCTTGCGCACATCAGCACTACGTGTGGGCCAGCTCACC
ACACGGGTCAGGAGGCCCTGGGTTTGAATCCTGGACCCCCTATGTGGTAGGCGGACGCTC
TGTCTGTTGAGCCAAGTATGCTTCCCTAGTACTACTTTTTAAAAGTGTTTTTTGGGAGTA
TTGCAAGTATGGTTCTCTTCACTGATGGTTTCTAATGCTTTAATCTTCTTCTCTGCCATC
ACTTCTGGTTTCTTTGTGTGTTTTGTAATCTTTTGCTGAAATCTGTACATTTTGGTACTT
TTAACAAGTTATTGCTGGAATTAGACTCTGAGGTGTCTGTTGCTTAAGCTTTTATCCAGG
TACTGGTAATGACATTGGTTTCCTTGAATGACAAGAGCATCAGCAACAACCACCACAAAC
AGAAGGAAAACTAGAAAACACCTTTCCCAGCATTTGCAGATTGCTGGCTGTGAGTGCTCT
CCTTCAGGGCTTGTCCATACAATGAGTTCAGAGAATAGCTCCAGGCCCAAGGGTCGGGGC
GTCCCTGGTCCTTGTCTGCTGGTGCCTCTTGTCTTGGGCATGTGCTGGTGGCCCTGGGAA
GCCCCTTGTTTATACAGTTCTGGATGCCCTCCCCTTCTCTAGGAAATAGTCCCTTGCCCG
GGGAGCTGCCTGCCTTCCACACACAGGGCAAGTTCTCAGAGGGCTAGTCCTTTAGGCTAC
CAACAGACAGGTTGGGCCAGACATGCATGCACCCAGTGTTTGTATGAGTGTTGCTCTGCT
CCCTCCAGAACCAGGGCCAGGCATCTGCACTAGGAGCCCAGGCCGGCTCTCTGCCAAGCC
TTGAGGCCTGGGGGAGGGGCCAGCCGGGGTGCTGTGGGATCCTACTGCTGTCTTTTGTTT
TTTTTTAAGGATATACCAGGGGTTGGACCCAGGACCTCGTACATGGGAAACAGGCGCCCA
ACCACTTGAGCTGCGTCCACATCCCTCCTACAGTTTTTAAGTGGCCTTTTCTTGGTCTGG
TGCTCGTTCTGTTACTGCAGTCCTTTATATGTGTTCTGAAGCTTTGAGAAAGATGTTTCT
GCCAGTTCTTGCTGGTTACTCAAAGCTTCTGTAGGGTAATGGAGCCCTGAAGCATGTTAC
CCTGCCATCCTGAATGCAGAGGGGCTGGTATTTCATTTTTGAGAAAAATATGTGTACTTA
TTTTACATTAAGTCTAATGATGGTCTCCACACAAGCTAAGCCAAGTGCTGATGGTGTTTC
TGCTGGTAAACACAGCAGCACTTCTCCTGGTGCTTCCCAGAGCATGCGGGACAAAACTTA
GTAAACTAGGCGCATGCACAAACTAAGCAGGGTTTTAAAAACTTTACAGAGTACAGCATA
ACATTCTTGAACTTTTATTTTATTAGCTTGTCAGAACTGTAGCACGCCATCATGAAGAAA
AGAAGCTTCGTGAGGAAAGGGGAAAGAAAGAAGAACAAAACCGACTGAGACGTATTGCTG
CCTCAACTGCTAGAGAAATAGAATATTTTTGGTCAAATATTGAGCAGGTAAAATTTTGAA
ATTTTAATGGGACCATAAAAATCATAGACTATCTTCATACTGGCAAAAATGACTTTTGAA
CATTATCCTGGGTAAGTTTTCTTTTTGACAGAGCACATGGATGCTGTTTTCTTTAGAGAG
GTGAATGGACCTGAGAAATTAAGCCTCTTTTGTCCCTCTTCTGGGCTGCGGGCTCATGGG
AAGATGTAGGAAAAGCTTACTCTTGCCTCCCATGCTTCTCTTTGTACTTGGGAATGCGTG
GGCAGGCTGTGACTCCAGTGCCTTGCTGAACAGTGTTGGGGAACTGATCTCAAGGGGCAC
TTCCAAGAGCTCTTCTTTCTGTCGCTGCGAGTCAGTAGGGGCAGATTATTCCCAGAATGG
GTGCTCTTTCTTGCTTTCCTTTTTTTTCAAAAAAATTCTCATATCACCTCCTAATAGAAT
TTAGACAGGATACAGTTAGTTATGCAATAAATGAAAAAACATTAAGCTTTAAATTTCTCT
TTGAAGTAGTTTGAAGTGAGGCTGTGGCAACTGTGTTTTTAGACCATGTCTATGACTTTT
GATGCTGTTGTTATGTTGAGAATGTGCATAACTTACATCCTCAATAACATGCTCATTTAA
CTCTTTGTATTTAGGTTGTGGAAATAAAACTACAAGTAGAATTAGAAGAAAAAAGAAAAA
AAGCCTTAAATTTACAGAAAGTTTCCAGGAGAGGTATGATATTTTGAAAAAGTGTATGTA
TTTAAAAAGTCCTAATATTTTTCAGGCTTTACAAAGAATGTATGCATTATAAAGAAAAAA
TTCTGAAAACACTCACTAGTATTCAAAAAAGGAAAATTACCCATAATATAAATTATTTGA
AAGAACTGGTATTAACATTTTGATGTCTATATTCTTCCACAAGTTTTTCAAGGTTGCACT
ATTTAAAAAACAAAACTACCATAGGATTCCTTGTTTTTCAGTCTTGTGTGTTTTGCATAA
TGTGTCATCTGCATTGTTCCACATCCCCCACTATCCATCTTTAGCGGCTGCATTATAGGT
TTTAAGATTGGCATCTCTATCGTCAGATTGGCTCACTTTGAATTCTGGCTCTTTTGTACC
CTAAAGTGATGACCATGGACAAGGACTTGACCTTTCTTTGCTTTGGTGTCCCCATTATCA
CATGGGGGGTGCGGTAAGAGTGATTGTCCCAAAGGATTGCAGAAAGAGTAAGGAAATGAG
GTATGGAGAGAAGGCGAGGAGAACAGACCTGGTGTTGGCGCGGGCTGGTGCTCAGTGCCA
TCACTGTTGTGAAGAGCCGTAATTTAACCAGCCCCTAGTGCTGTACATTTAGGGTATTTT
ATGGTGCCTGTAAACAGTTCTTTTCTGTATATTGCAAACAGATGTGGTTTTAAGTTGGCT
AAAGCTTACCGGAAGTATACCAGAAATGGGCTGGCTTTCACAGTGGGGACTTAATAGCTT
AAAAGCTGACAGTTCCGAGGCCATGGAAACATCCAAATCAGGGCACCAGGTGATGCTCTC
TCCCAGAAGACTGGCTCCCAGTGGTACTAGACTCCTCTGTCAAATGAGGAGGCACTTGAT
GTCGTTTCCCTCCTCCTGGGTCTTGTGGCTTTCAGCTGTCTGGTTTCATGGCTTCTTCTC
TCAGCTTCTGTGGGTTTTTGTCTGAGCTCCAGTGTACCATTGATTTCAGCCCTTGGCTTC
CAGGGGTTTTCTCTCTCAGACTTTAAGGATTTTTTTCTTTCTCTCTTTTTATATTCATCC
TGTTTATAAAGGGCTGAGGAGGACTGAGACCCATCCTGGGTCATGCCTTACTGAAGTAAC
CTAATCAAAAGGTCCCACCCACAATAGGTTCACACTCACAGGAATGGATTAGCCCTAAGG
AAATGATTTTCCAGGGTCCATCCAGTATCACACTGGCACATATGTCGATCGTGTTGTGAA
AACTTCTGAAGGCAGGTGTTCTATAAGCCCTGCAGCACAGCTAGGAGGAAGGATGCCTAA
AGAATCTCACCAGACAGAGGAGAATTCAATCCTTTATATTGTTAGTAATTTATATTAATT
CTTTCTGTGTTGGACTTTAAATGAGATTAAGCAACTTGTGAAACGGGTTACAAATTAATA
AATACTTGCAGGAATAAAAAGCACACCCTTGAAAGTATTTATCCTTTGGGCTTTTGTCTC
TTCCGGAGGGTCTTCTCTGTCTCTCCTTTTTCCCTGCGGGTGGAGGGGTTTCAGTGTAGT
GCTCTTGTAGAGTCCTGTTGACCAGCATTGTTTCCATTCTGACCAGTCGTTCTTTCTTTT
CTCAATGCAGAGTAGTTTTAGTTTTTTTCCTTCTCCTCCCCATACTGCGGTTTTAAGAAC
TGCTTTCCATGAGGTTTATAATTTATTGCTTATCTTGAAACTATTTTAATAAACTGTAGA
CAATGAGTCTTGTTCTCTCAGAATTCCAAGAATTGAAAAAGGAAGGGAATAGCACTGTTT
TCTGAGGATTAAACTGAAATTAAATCAGAAGTCGATGGAGTGATCATTTTCAAGTTATAT
TACAGGGAAAGAGACTGAGATAGAACCTAAAGTGAGATGAACGTACTCAGGGACTCAGTG
CCCATCGGGAGGACAGAGGCCGGCTGTGGGCGCAAGTCCCAAGGGGGGCACAGCTGGGGA
GAGGCCTCCCAGCAGGCAGAGAGGAGTGTTGGATCTGCAGGACAGGGAATGCATGCACCT
TGGGCTGGGCGTGGGGCCTGAGGAGCCCACCGTCCTAGCTCCCCAGGCATCTCTACCTGC
CTTTGTTCAGGCCCTCTGCCCACCGCGCAGCCTGACCACGGGGGACTGTTGGCCTAGAAC
TTGGTGAGCCTCTGTCCTGTGAGCTTGTGAACAGGTACAGCCTCATCCTAGGTTATAGTT
CAGTTCTTTTGAGGTTGGCTTGGATGAGTTGCATGCCAAGTTGAACAATCCTGTGGCACT
CAGATTTGGGGTCCTGAGCCCCATCTTTGGACACAAGACAAGCTCACCACAAGCTGCTGG
CCTCGGTGTGTTCTTTGGGTAACTGGCTGGCTCTGGTTCCTTGCTTGGCTCTTTCTTTCC
TTTAGGCAGTCTTGCAGGAGTTGGTGCTGTGTATTGTGCACTGATGGGGTGGCATTCATC
TCCTCTGATCCTCAGAGCAGCCTCAGGAGGGCGGGTAAACGATTCTCCCTTCACTGATGA
GGGATCATGCTGCAGGGCAGCTGCTGCTGAAAGCCATAGGGCTGTAAGGGAACAAGCACC
AGGAAGAAGAGACCTTTGCCATTCGGCTGAGTGCCGAGCTGAAAGCGTAGCGTTGCCACT
ATACCTGACCTTGCACCATCCTCCTTCCTTGGGTTACTCAGAGGAAAGGAGGCAAAATTG
TGCCTCCTTGCTTTCTCTGGACACATAGATGTCAGCAGGGCATGGCTGAAACAGGAGGAG
AGGCTCTGGCTGTTGTGAATCACTTTTATCTCCTTCCCAGCCTCAGCTGGAAACTGACCA
TGCTTTTATCTCTTTAGGGAAAGAGTTAAGACCTAAGGGGCTGGATGCTTTACCAGAAAA
CTTTTGGGTAAGTTCAGGTGTGTCTGCCACTGCACTATGTAGGAATGCAGGGAGCAATGT
GGCTAAGATACAGTGCTCTATTAAAATGGGGCTGTTCTGTTTAACTGGGAGAAGAATGTA
GGTCATGAATATCCTTCCTTTTCATCACAGAATTGGTCTACTTTGAAAAGAAAAACCGGG
GCTTTATTGCTTTATTGCTTTTGGCTTACACAGGATGTTGATGGAAATTTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTAGGATGCTTCATGTCTATGCAGTGCTGCCCATG
AAACCGAGCGGGGCTTACTTGGTATTTGGGTATTTTAAACCACTTGGGAAGTTTAACCCT
TCCGTTTTTGTAGAGGACATTTTTTGGTGTCTCTAGATGACTTGGGGTGTTTTTTGAGCT
TCCTGGGGTTATCTGCTCTTGCGAGGTTTGAGAGCTCCAGTGTGCCTTGGGGAACGTCAG
GGCTGGATGCTTCAATGCTTCAAGCCAGGAGGGCCCTCCCTGTGGGAGAGGTGGCCCTGC
ACCTCGGGGCTCAGCTACGCCAGGCTGGGGAGCACAGGCAGCCTCTGCCCACTGCAGCAG
GGCTGTGGCTGGGTGCCGGGCATCCATGTCTGCAGGAGGCACTCCTGGGAATTTTATGCC
CGCATCTCACCCAGGTGATTCCTGTCCAGATGCAGAGGAAGGCCTGCCCTGTCCCTGTGG
GCCCTTCAGTTGGTTTATTGGTTTGGTTTCATGAAATTTATAAAGTTTTCCAAAGTTTGA
AAGATTGATGTTTTGGCATCGTATGACTCTTTTTTTATTTGTTTATTTTAGGAGGTACTG
GGGATTGAACCCAGGACTTTGTACATGGGAAACAAGTGTTCAACCACTGAGCTACATCTG
CTCCCCAACAAGAGTTGGTTTTTTATCATTTATGCTACTTAAAATTTATTATTTATTTAT
TTTTTAGAGCAAATTGTAGGCTTATAGAAAAATCATGCAGAAAGTCCAGAGTTCCCATAT
ACCTCTTCCCACAGTTTTCCCAGTTATTAACATTTTGCATTAGCGTGGGACCTTTGTTAC
AATTGACAAACCAATGTTATTATTTGTGTTATTAATGCAGTCCATAATTTACATTAGGGT
TCACCCTGTGTGGTACAGTTCTGTTTTGTTTTTGTTTTATATAACCTAAAATTTCCCCTT
TTGAACCACATTCGAATATATAATTTAGTGCTATTAATTACATTCACAATGTCGTGCTGC
TATCACCACCATCCATTACCAAAACTTTTCCATTACTCCAAACAGAAGCGCTTTAGCAAT
TAAGCATTAATTCCCCTTTCCCTATCTCTACCCTGGCCCCTGGCAATCTGTAATCTACTA
CTATGGAATTTGCATGTTCTAGATAATTCATATAAGTGAGCTCATGTGATATTTGTTCTT
TTGTGGCTGATGTATTTCACGCAACATGTCTTTAAGGTTCATCCGCATTTTGCATGTATC
AAAGCTTCATTCCTTTTTACAGCTGTGTGAACATATCTCATTTTGTTCAGCCATTCATCT
ATGGGTGGACACTTGGGTTGTTCTACCTCTTGAATATTGTGAATAATGTTGCTGTGAATA
TAGGTCTGCAAATACCTGTTTTAGCCTGTGCTTTCTATCCTTTTGGGTGTGTATCGGGAA
GTGGAATATCTAGGTCAGGATTTTGTTTATCTGACTAAATTTTATTTCTATTTTTATGTA
TTTTTTAAGATTAATTTTATTTATCCCCCCCCCCCCCCCCATTGTTTGTGCTCAGTGTCT
GCTCTGTTTGTTGTGTGCTTCTCCTCTTTTTCAGGAGGCTTTGGGAACCGAACCTGGGGC
CTCCTGTGTGGGAGGGAGGCACCCAACGGCTTGAGCCACTGCTGCTCCCACTTGTTGTGT
TTCTCATTGTATTTTCTTGTTGCGTCATTTTGTTGCATCAGCTCACTGCACCAGCCCATC
ACATTAGCTCACTGTCTTGTTCGTCCTCTTTAGGAGGCACTGGGAACGAAACTTGGGACC
TCCAATGCAGTAGGTGGGCACCCAACTGCTTGAGCCACATCTGCTTCCTGTAATTTGAGT
AAATTTTATTTTAAGACCTAATGATGTCTTAGTGCAAGTCAGAGAAAACCACATTAACCT
CCTGTCCCCTCTTCACTTGTCTTTCTCCCAAGCTGTCCACCAACTTTCCCCAGTGTGGGG
TCTCTCCATATTAATGTATAAACATACCTCTATCTATACGTGTATAGATAAAGTGTTCAG
AAACACATACAAGGAAAGAATTGTAGGCAGGGTTGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTATT
TGTCCTTGTGTGTCTGGCTTGCTTCCCTCAACATAATGTCTTCCAGTTTCATCCACGTTT
TTACTTAGTTTTATTTATAAACCTGGTTCAGTAATCAAAGCACTTGATCAAGTTGTGAAA
AACGTAGAAATATCTTTCTCCAAATTCATAAAAGTTATTATTACTATGGACCTAGATTTT
TATCATATTTGTTCATGCTGTGCTATGCACATTTTGAGTTTATTTTATTTTCTGTTGTCC
ATTCCAAACGGATACATGGAATACACAAAAACACCTTGAGAAAAACAAACTAATGCCCAG
CTTTCATTGTTCTCATTCAAAATGTTCTGACCATTACAAATATATGCTGGGGGGTGGGTG
ACTGGGTGGGTAGGGGAGGAAGAAAGGCCAGAGACAAGTGAGTGAGTCTCCCAAGTGAGG
CCAGGTGTTTTCCAGATCCCAAACTGATGACAGGGCCTCAAGTTAGGCATGGTGTCCCCT
TCTCCTTTTCCTCTGTGGGGCACTTGTCTGTGTTCCCCTTTCTTGGTGGTGGTGGTATTT
GATCATCTGCTCGTGACTCTAGTTAGCTCCAAATTTCAGTTTCTAATTTCTAGGTTCTTT
GGGGCCAAATTACACTTTGAGGGCTTTCCAGAATGGTCCTGAATTCTCGTAAGAATTTCT
GTACATTTGTCCAAATAGCATTATAAGTATTAGAGAAAAACAGATTAAAATGAAACAAAC
AAAATATTACCGCTTCATTGTGTATTTGAAGTATTCAGATTCTGTAAGTTTTTCTTTCTT
CTTTTTTTAAATAAATCATCTCATAAAACGATCACAGCAGTCCCAAATTCCATTTGTTTC
ATTGTTTTTCATAGAGACAGAAGACTGTCCAAGTGACAGGGATAGTCGGAAGGATATGGT
TCTCATAGATTCTGTTTTCATCATGGATCAGTTCAAAGCTGCAGAGAGAATGAATATGGG
AAAACCAAACATGAAAGACATCGCAGAAGTGACTGCTGTAGCTGAAGCCATCCTGCCTAA
GGGCAGTGCTCGGATCACCACTGCGGTGAGGCACTGGCTGCTTTCTTTAAAAATTGAAGT
GATACTTAACATTCCTCAGACAAACCACTCTAAAGTGGCATTTAGCATTTAGCACCATCA
CAGCACCTCCCAAGCATTTCCATCACCCCAGAGGAGCCCTGCTGTGAAGCAACTGCTCCC
CACTGCCCGCTCCCAGCCCTGGCACCCACCATCTGCCTTCTGTCTCTGAGGACTTACTTT
CCTGGACTTTTCATGGAAATGTCAGCCTACAGCATATGACCTTTTGTGGCAGGCTCCTTT
CCCTCAGCGCCGTTGTCCAGGGCTCACCCATGTAGTAGCGTTGCCAGAGCTTGTCCTTGT
CGTGGCTGGATGGGTTCCATTCTGTGGCCAGATCACATTCCGCTCAGCATTTGTCCTTGG
ACAGACACTTGGGTAATTTCCACCTTGTGGCTATTGCGAGTAGTGCTGCACGCATTAGTT
TGAGTCCCTGTTTTCCGTTTTTTTTTTTGGATATATATCCAGGAATGGAATTGCTAGGTC
ATTTTGCTAATTCCATGTTTAACGTTCTGAGGAGCTGTCAGACTGTTTTCCACAGCAGCA
TTTTGCATCCTCACCAGCATTTTACAAGGGTGCTGATTTCTATACATCCTTGCCAACACT
TAGTTCTGTTTGTTTATTATTATTATTATTACTATTATTGTAGACATCCTAGTAGATGTG
AAGTGGAATCTTACTGTGATTTTTAGGCAGTGGGTCTTCAAAGAGAGAAATGGATATATT
TGTAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCC
TTTTTTGCCCATCTAGCATGTAATGAAGGTAAGAATTAGTTGTGTTTTTCTTTTTTTAAG
AATACATATTTGCTAACATTAACAGTTTCTCACACGGGGCAGGGACTTTGATTTTCTCAC
TTCTTTGTCTTACCCTCTAATCCAGGGCTTGAGCAGGGCAGGGCTCAATGAACACTCGTT
GGATGATGAGATAAAGCACTCGTTCACAGTTAAAATCTAAGTAAATGTACAGACCCAGCA
GCGACTGCACCTTGGCGGTTTCAGGGGTGGCCCTGTCATGTATGCAGCTAGCAGAGCAGG
CTCTCACCCCCATGGCTGCCGTGAGCTGGTTGCTGAGCATCTCTAGTGGCAGTGCAAGGC
TGTCGAGCTTCTGGCTTGCAGCTTTCTTCCTAGTGTATAACTCTGAGTGCCCTGCTGTTG
TCCCCGTAGGATTTTGCCTTCTCCAGGGCAGTATTTCTGATCTGCTTGGGTTGCCTTAGG
GTATGAAAACACGGGGGCATGTGCGTGTGGGCTCAGAAGCTGAGCCGCAGCTCAGGTGAC
TGCTGCCCATTCCTGTTCGGACCAGTTTCTGGCAGCCTCTTCGCTCTCCTCTGTGTCACC
TCACCTTGCATGTCATCTGCACTGGCCCTCTGACTGTCAGGCTGGGATCTTTGGGGTTCA
GCTCCCCCCACTCACTTCCATTATCCCTTGGCCTTTGGGTCAGGCCCCACCTGCAACTGC
GAGGATTATGTGGCACAAAGGACAGCTGGTAAAAGGGCTTTGGCCGGTATTTCTAGACTA
GGACAAGGATCATATGCCTCTTCAGATCCCAGGCATCTGTGATGCTGAGTCACCCCTATT
TGCTCTCCCTTAATATCTGTGTCAGTCGTCCATCCACTGGACAAAGGCTTACTCAGCTTC
TGTGGCCAACCACAGCGCTAGGTGCCTGCCCTTGAGAAGGAGTTTGAGCTGAGCTGGAGA
GGTCTCTGTCAGTTCCTTTGCAGGTAATTGGGGCCCCCATCTTGTTGTTGTGAGGAGCTG
GAACATACTCAGGTGGGAACTGGAATTGAAGCGTTGGTGCCCTGGCCTAAAAACCCTGTT
ATATGTTGGCAACTCTAGAGAACTCAAAGCAAAGAGACAGGTATTTTTTTTAATATAAAA
TAAAAAAAAAGAAAACTATCTTAATTTTTATAGAAGACAAATTTCAAAATGATAAGACAT
GACTATTATAATTGTTATAAAGTACTTGTTTGTGAGATTCCAAACCTTCAAGCTGTCCCT
AAACCTTAAGCCCCTTGGAGCTTAGATGACCTCTCAAAAACACGTCACTGTAGATACAAT
ATAAATATTATAATTTCCTACTTTCTGTATACATTTTTTCCTTTGCTCTTATTAGGTAAT
ATAGAAGCTAGTCCCACTTCAGGATCCTCTGTGATAACCACTTTATTTTCCAAATAATGA
CTGTTAATGCTTCCAAAGTCTCTTAATTTGTTAACAAAAGTATTTTAATACTTAGCAAAA
ATGTAAACTCAACCATTTTCTGAATAAGCAAGTTCGGAAAAATGAGTGAAATTTCTCTAG
GTGGAAACAGATAAGTGGTGAAAATCCTCAGAAATATTCTCAAGATTATTTATTCCAAGT
GCAGGAATGAGACGCTACTGGCGCTTTTTCCATGTGCTGCAGGGATGGACTGAGCCCAGC
AGCTTCAACGTGTGTGTCACGTCCTACAAGCAGTTCTTCAGGGGCTACCGCTCCTTCACC
AGCGTGCGGTGGAAGTGCCTGGTGGTCGACGAGATGCAGCGCGTAAAGCGCATGACCGAG
AAGCACTGGGAAGCCGTTTTCAACCTGCAGAGGTCTGACACGCCACAGGAGTAGTACCTG
GTTCAGAATCTCCCTGTGCTGTCCATTGTAATAAGTGCTCTTTAGTGCTGTTGTTGATGT
AAAGGAATCTGTTGAAGAAATTTGGGTAACTGCATGTACAAAAAACCCTTGCATTTCAGC
TACAAAGAATTACCCTGCACCGTTATCACAGCACACGGGGCGAAGGGGACTGTTCTATCG
AGTCTCATGCACGTTTACCTTAGCTCATAATGTTGTCTTCTCCTTTCTTAAATTTCTTCA
GAAAAAGAGATTCTGCCCCCACTGTATGTATTTTGAAATTTGAAACATTGTTTCTCTCCT
TTCATTTATAGTCAGCAGCGTTTGCTTCTCATCGATGCGCCTTTGCATAATACCTTTCTG
GAACTGTGGACCATGGTGCACTTCCTCGTCCCTGGAATTTCCCGGCCTTACCTGAACATT
CCCCTGAAGGCCCCTAGTGATGAAAACCAGGACTACTACCACAAGGTGGTCATTCGATTG
CACAGGGTACGTTCAGTTCTACGATTGCAGGAATTAAAAATGCGTGAGGCATGCTCTTCA
CATTGACACGTGAAAGTGGAAGAAAACAGCTGATGCTTTTTTTTTTAGGTGGCACAACCT
TTTATTTTGAGGAGAACAAAAAGAGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTACCAGCGCCCAGGC
GGGGCCGAGCACAGGTGCACCTGTGCACTGTGGAGGGCGACGGGAGGAAGGAAGTAGCAG
TGTGGGGTGGGAGTGCAGGCCCGGGCACGATCAAGCCCACCCCTTAGATACACAGGCTCC
GCGTGCGACAAGTGTGGTTCAGGTGAAGGGCACCACTCCGGCGGCTCAGAAAGCCTGGGA
AATGCTCCCTGCCACCTTGCAGCTGGTGCCGGGTTTGCCTACCCTGTTTGCAAGAGAAAC
CTCCTCTTAAAAATCTTGGGGAAAGCATGGCACCTGGAAGCTGTTCCTCTCTGCCAGGTG
TGGCATTAGCTCCAGCCTTCGGAGTGTGTGGAGATGAAGCAGGAGTGCCCAGAGAGGGGC
TTTGGTAACTACTCAAGTTGCTGCTGGTGGCTCTTTGCATCGGTTTCGTTTAGCAGGAAG
TTGTTTGCTAAGCAAATTATTTCTATAGCTAAGACTTCAGGGTACTTGTTTGGCTGTTCC
TTAAAACAGTTTTTCTGTGGAAATAGTGACTAAGTTCTGTATTAGAAGACCATGTCAGTA
GAGTATTTAAGGTGCTGGTTCTACAAAGTGGTGGTCCCTTCTTGTTGCCAGTTCTCCATG
CTCAGCAAGAGATGTCGTGATTTCCTTCGGCTCTGCGCAAGCGTCCTCACCATCATCAGC
ACCCGCAGCGTCCTGCCCTCTCCAGGAGCCCACGCAGCCAGCAGCGGCCCCTGTCGGGCT
GGTGGCACTCAGTTCAGTGGCTCCACCACTTGATCGCTGGCTTGTCCTTCGTTTAATGGC
TCCTTGCTGGTGCTGGTTGTCTCTGCCTATTGCGTTATATACAGAGGTTTTGACTTGTTT
TAAAAATACAGCATTCTGGCTATTTACAGTTTTCCAATTAAAGGAAATATAAAGAGAACG
CATTCCACTTAGATAAACCTCAAGGAAGGCGGGGAGGGGTGAGCCCTGTGGGGCAGGCTC
CCCAGCGTGTCTGAAATTGTTTCTCCGTGCTCCCTACACTACCTGTAAGGTGAATCCCAC
GGTGCTCTTAGTCTAAACAAAAGCACCTCAGACTGCATGTGACAGCTGTGTGCTTCTCCT
GATCCATGTTGATAGAAACTGAAAAATTAAAATAATGCTCACCCCTGTAGAGCCCCCATG
CCAGGAGTAGACGTGCCCCCGTCAGGTGCCTCGCCTTGTCTGGACTCCCCGGGCTCCTGG
GGCGCGGCTTCCAGCAGTGTTGGGAGCTCCATTTCCCCTGCTCCTCTTGGAGCACGGGAC
TCGCGGCAGGGCTGCCCTGCATCCCCGTGCTCCCCAAGGCTCGGCCGAGCAGCTGTGCTC
GCCGCGTCTCAGGGGCACTCTGTGTGTCTCTTGCCTGGACAACGGCATCTAGGCTGTTCC
AGCCCGTGCAGTACGGCCAGAAGCCTGAGGGTCGCACCATGGCCTTCCCCAGCGCCCACC
TGCCCCGGACGGCCACCCCCGCCGCAGCCACCGTCACTCCACAAGGACAGGTTCGAGGAC
GGCCCGCGATTGCCACATTCTCTGCCAATCCCGATGCAAAAGGTAGGCTGGCCTGCTGGC
GTAACCGCAGCTCTCCAGGCGGTGTCTGTCCCTGCCCCCGAGTCGCCGTCCCCTCTGGCT
CTGGAAGGGACCATGGGCGTTTCTCGCAGCAGCTTTAGACATTTTAAATTTCTTTAAACT
TGGCTGTTGTTTTTTTGATCCAGAAATGTTCACTCTTGGCTGAATAATTTTCTGGTGATG
AGGACATACTTTGGCAGAAATGTTTTCTTTTGTGGAGGCGAATGGACATTCATGTTGTTT
AGAAACCTTCTGAAAAAGTATGTCCTTGTTACATATTGTATCATCATTTTAAGTTGATTC
TACTCGGAAGAGAGATAAGATTAAATGACAGAAAAGGTAATAAAAATAGTATGTTAACTT
CTAAACAAAGGAGGTCTTCAGTATTATTTCTGTTATGTTTACCTAAGATTAAAAGATAGA
AGTGAATGTCCAGAATTGCCCTGCTGCAAATGTTCTTAGTAAGATAGGATGACAACCTGT
TTCTGGTTTTCTGCATTTAGGGAAGTTAAGTAGTTTTTGATTGATTTTAATGTCTGATTG
GGCTGACTTCTGGTTTTCTGTTTACTCTGAGAAATATATTGTTCAGCGTACTGATTGGTC
AAAGTAAAAATAACTAACAAAGGATATAAAATTATTTTCCTCTCACCCCATAAACTATAT
TGGACCTTTTTTTTTAAGAGAGGATTTCTCACTTGAGAAATAGTGTGAAATAATGTTCTT
CTTGTCTCTGTAAGAGTCGGGTTTAAAGTATTGCCTTTTGTTAAGCAGCTCTAACCGCTT
TGCACAAACCCACCTTATCGATTGCAGCGGCAGCAGCCCAGCCTCAGACACCTCAGGCTT
CCTCCAGTGCTCCGAGACACCCGCCGGCCTCGGCCCTCACCGCCGCAGCTAGCCCAGCCC
AGCCTGCGAAGCCGCGGGCCCCGGCCCCGGCCCCGGCCCCCGGCCCGCCCCCGCCCCTGC
CCCCGGCCCCCCCGCACTCCGCCCAGCAGAGTGTGCTGCCCCAGAGGCTGGTGCTCACCT
CCCAGGCCCAGGCCCGGCTGCCCAGTAAGTGGCCTCGCCGTCCGCTCGCTCCAGGGCGGC
CGTGCTGCCCGCACTGGAATGTCTCAGAGCCTTTGCTGTCCACTCCTGCGCTCCCCTGGC
TGTGCCCTGGGTTCCGCCTCTAGCCAGTGCTCTCAGGGCCAGCCGTCAGATAGAAAGGGG
GGAGGATGGGCCGCCCCAGGGCAGCGCCTCGGGCCCTTCTTTCCTCTTCTTCTGCTGTTC
TTTCTCTGGCTTCCCAAAGGTCAGCTCTGTTTGCCCGTGCTGCCCACCGCACTGTGCTGG
CGTGCTCTTCACACGGCACCTGTGGCGTCGGCCAGGGCGTGGGACTCCAGTGGGAAGCCC
CTGCTTTTGGGAAGGCAGCTTCCCAGTCAACCTCTTGTGCGCTGCCTTAGGTTTTCAAAA
ACCATCCTGGTTTTTAGCTCTCGCTTATTACCACTTGTGAACCTGGGATGAGAAACTTCG
AGATAGTTTAATGACTAAAGCATATTCAGTCTTACTAGTTTTTTCTAAGAGTAGAATTTT
TTATTGTGGCCAGTGCAGTGTGTTTCCAAATCGCATATATACCCTTAATTACTCTGTTGT
GGAAAATTTTCATACTTAAAATATGGATTATACCGTTTCTCAAATACCACCTCAAATACT
TTATTCCTTGGAATACCCAAGTGTTGAGGCTTCTGGGGAAGACAGAAAAGAGAGTAGTGA
TGTGGGGAGACCCCTCTTTCAAACTCATTTTCTCTCATTACAATTTCTTTCTTCCCCTGC
CGCCAAATAAAGAGTAATTGTCCAAAGTCACGGCCCGAAGGAAGAAAAGCACTCGCACAT
TTGGCATGTCCTGCTTGGGGTGAGAGTGCTCTGCAATTGTGCCACAAGCTGTTGTCTGAT
TCGGAGATCCTGGAAAGGGAGCACAATAACCCTCCCTCACCCTGTCTCCACTTTCTCTGA
ACTGCGGAGGTGACGGGAGGCTCACGTTTCTCTGCACGAATCTCTGGCTCCCTTTTCGTT
TCCTTCCCTTGTTCATGCTCACTCTGCAGCCCAGGCTTCTTCAGACCTCCCTCTTCTAGC
CTTTCACTGACAAGTCTGGGCAGTGCTTCTCGGTGCTGGTGTGGGTTTCTTGGGAGAGAC
ATTGAGACTCAGATCGCAACCACTGGGTTAAAACCCTTGTAAAGCTGTCGTTCATGATAG
CCTATAGGTATTGCCTTTCTGAGCCTAGTGCATATGACTACATCTGAGTTGCATTTTCAA
AAAACATATTTTAAGGAATAAGTTTCATGTTTTTTTCACAGTAAACTTTATAAACCAAAT
CCTAATATAAGTCAGTGTGAGAGTTTATATTTTAAAACTGTATTTATGTGATTTATTTGT
ATATTTAAATACATTCCCAAATTTTGAGAAGGTTTTGCATGTAATTGAAGGTAGTTAACT
CATTCCTTCTATATTTCAAGTGATATAATCTTTGTTTTTCTTGTGAGATAAGTTGGACAT
GCCCCTTTTTCACACTTGGAAGTTCTTTGCTGTTCAGGGGTCAATATGTGAGCCTCGCGA
GTGTTACAGGGAGATTGCTGCTGCTTCTGATGCCAGTTAGAGTGAAATTCACCGTAAAAT
AGGAATTTTTATTGGTGTTCTCTTGTCTTTGAAAGTTTTTTCTAAGTGATAGAAAGCAAT
GCTAATGAATGTTTCTAGAATAATTCAGTTTAATATAGATGGTCATTCTATACAACAGAT
GTCATCAGTATAGCAATCTCAAACTTCCCTCAAAGCACTTGTAACTCCCCCTCTTCTGCG
TTTTGACAGGTGGAGAGGTAGTAAAAATCGCCCAGTTGGCGTCCATAGCAGGGACGCAGA
GCCGCGTTGCTCAGCCAGAGACACCGGTGACACTACAGTTTCAAGGGAACAAGTTCACCT
TGTCCCATAATCAGCTGCGACAGCTCACTGCTGGCCAGCCTCTGCAGCTCCAAGGTAAGC
GCGCAGACCTGGGGCCCAGCAGCTGCCTGTAGGGCCTGGGGCAGCCCATCCTGGTGGGAG
CCCCAGAGTCAGCACCTACAGGTGACTCACAGGAGGGCCCGGGCAAGTCAGGGCCCGTCC
ACCCTCCCACTTCTTCATCTGTAAATGGCATGGAGACTTTTTATCCTTTACAGACTTTGA
GAAGACAAACGAGACAGCACATGTAAATCACACAGTTGTCTGGGCTTCATGTGTTCAGCT
CTGCCCTTTGCAAAGAGTTTCCTATTGTTTAAATCATAATAGGCCTGTTTGGTACTTTCT
TTTTTTTTAAAAAAAAAAGATTTATTTTTATTTATTTAATTCCCCTCCCCTCCCCCGGTT
GTCTGTTTTTTGTGTCTTTTTGCTGTGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAG
TGGCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCTCCCTCCTTCGCGCTGGG
CGGCTCTCTTTATGGGTGCACTCCTTGCGCATGGGGCTCCCCTACGCGGGGGACACCCCT
GCGTGGCACGGCACTCCTTGCGCGCATCAGCACTGCACATGGGCCAGCTCCACACGGGTC
AAGGAGGCCCAGGGTTTGAACCGCGGGCCTCCCATGTGGTAGATGGACGCCCTAACCACT
GGGCCAAAGTCCGTTTCCCGGTACTTTCTAATTTTAGTGTGAGGCTCCTTATCCTGATAG
TGCCAAAGGATTAACAATTTATGTAGGAGAAATCATTTTCTTTTTCATACAGCCTTTTAC
ATTTTACCTCCCAGACCTTGAACTAAGAGCAGTGTGCTTATCTAGTAGTTGGGTGATTTG
TTTTTTTGTTTTGTTTTGTTTTGTTTTTGAAGAAAATGAGGGAATGAAATTCAAGTGGCC
CATCAAAAATAATCTCAAATGGCTATCTGGCAACAATTTAGTCATTTCAATCTCTCTCTA
GTTAGAGATAATCATTAGCTTCTTATGTGTTAGGTTAGGATCCCAAAGTAATGTCCCCAG
TAGCGCAGGCCAAACTGTCTTCATGAGAAGCCCCCCCAGTGGTGGTGTTAGCAGCTCTAG
TGCAGGGTCACGGGTTCTGGTGTCGGCTGTGTCTGGGGAGGAGCCAAGCAGAGGCCTCAG
AGCCCCTGCAGTGGCCAGACCCACAGATTTTTGTTCAGTTCTTATTTCTCAAAATTTCAC
CCACAGGATTCTTTTTGCAGGGACCATCTGTATATATTGTTGAGTGGACGCTAAGTTTTG
TAGAGCACAGACTTAGAAGCATTCTTCCAGAGTAAAAGAGGTTGGCAGGACTCACTCAGA
AGATGGAAAGAGGGACGCTGTTTAAGCAGGGGTGGTACCGCTGAAGGCAGCTGAGCGAGC
TCCCTCTTGCCTCCACTCCTCCTTCATGGGGTCTGGAAGCTGCGGGTGGTGTGCCCCTCT
CCTGGGACTGGCATGCCCCTGCACCGACAGCACAGGGCCAGCCCAGAGCGGGGCCGCGTA
TGGAATAGATGAGCTTGCTCTTCATGGTCAGTAATGCAGGCATGTTCCCCTCGAGTTTTC
ATTCTTCGTGAATGAGAAGTTTTCATTTTTCCCCAAGCAACTAAACTTAACTTTTATTTG
TTTCTGCTACTCTGAGTATATTTTGTTTTACCTTTTTCTGTTTATTGTCTTGTTTGCTTT
TGTACCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTTTACTTTATTTGTGTCGCTGTTTCCTGTAGAATAA
AGAACTATGTACCTTTAGGTTGACTCTCTGCAGAAGGTCACCATGCATGAGGGACCCCAG
ATTGTTTTGTGGAGACAGTAATTTGGCATGTTGTTTTCAACACCCTTTTTCTCATCACTG
TCTTGGATAAAGGAGGAGAAAAACAGACTCTTGCGGGAGCGGTTGGATCAGCTCTGTGCT
GTCAACGAGCGGCGCTGTGCCCGTGTCCCCATCTATGGCAGAGATTTATTAGAGATTTTG
TCCCTCGGTGGTGGAGAAAACACACCTCGGCCCAGGCCTTCTCCTAGCAGTGACAGGAAG
GGGGCCGGGCCGGCGGACGGTGGTGCATCAGCCTGCAGCCGCACGCGGGGCCTGCTGCTG
GCGCTGTCGCAGTGCAGGGAGGCCCTCCAGGGCGTCACCGGCAGGTGAGTAGCCTGTCTC
TCGGAGGCCTGTCTCTCGGAGCTGTATACCTTTTACCTGGTTTTGCGCTCTCACTGTATT
GTACCCCACTGATTTTCATGCTTGTTTTGTGGACATTCGTCTTACTGCCGTAAGTGTCTC
CGCGAGCTGCCATTGGTAAATTTGTTTGAGCAGTCCTTGCCAGGCCGTTTGCCTTGGGCT
CAGGTGTGTCTTGTTACCTGGGACCTGCCGGCAGGCCCCGCCGGGTCGCGCAGGTCACCC
CTGGAGGTGGGAACTTGGCTCCTGCCAGCCTGCCCGCGAGGGCGGCTGCCTCCCCGTGGC
CCCGGGCAGAGATGACAGATAACTGCATTTTGCTCTTTTTTTTTTTTTTTTTAAAGATTT
TTATTTTTTTATTTATTTAATTCCCCTCCCCTCCCCCGGTTGTCTGTTCTTGGTGTCTAT
TTGCTGCGTCTTGTTTCTTTTGTCAGCTTCTGTTGTCGTCAGCGGCACGGGAAGTGTGGG
CGGCGCCATTCCTCGGCAGGCTGTGCCCTCCTTCGCGCTGGGCGGCTCTCCTTATGGGTG
CACTCCTTGCGCATGGGGCTCCCCTACGCGGGGGACACCCCTGTGTGGCACGGCACTCCT
TGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGTCTAGGGCTTG
AACCGCGGACCTCCCATGTGGTAGACGGACACCCTAACCACTGGGCCAAAGTCCGTTTCC
CGCATTTTGCTCTTTAAAAAAATATTTTATTAAAATAACCACATGAATTTTTTTTTATTT
TGCATGATGAGAAATGTGTGATTCAGAGTTAAACTAAGGAACAAGGACTTGTTTTCTTTT
GTTTTAATTGGCTTGTTTTCTAGTTCCTTAGGGTTTAAAAAGCTAGATTATTGATTTGAT
ATTTCTTTTTTAAAGTCAGTTTTGATACATATTAATAAAGCATAAATCCATCCGAAGTAT
ACAATCAGTGGTATTTGGTGTGATCACCGAGTTGTGCGTTCATCACTTCAGTCAATATGA
GAGTATTTTTATTATTCCCATAATAATAGTATTAATAAACAGGCAAACAAAAAAACTCTA
CCTACCTACCCCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTA
GTATAGTTCCTTTTTTTTTCCTTTTTTACCTGTTAATGGAAGATTATTAGTATATTATTA
TACACTCCTGTCCCATAGTTTGCTTTGGTTGTATTTTTCCTGTTAACATCGTTTATCGTT
AACATACGTTTTTTCAGTTTCAAAGCAAAACGATGTTGTATATGCAATATATTACCCAAA
GCAATATTGGTTTTGCTATGTTCTGCAGTTCCATGTTCTATCTTCTAGCTTTCCTTCTAG
TAATATACAGAACTTTAGACTGTCCCTTTCAACCACTGTCATACCCATATAATAACAGCA
CTGCTAGTTACAAACACTCTGTTGTGCTTTTGCCATTCTATTCATTTCCAAATATTACAA
CCTTTTTTCCAATTCTGCACCAATTAACTCTCAGCTCCCCATTCTCTACCCTTCTTCTAT
TTTCTGGGGACCTGTATTCTAGTTATTAACTCCGCAAGTTTACACAGTATATTTAGTTCA
TAATAGCACAATCATACAGTATTTGTCCCTTTGTGTCTGGCTTGCTTCAATCAACATAAT
GTCCTCCAGGTTCATCTGTGTTGTCATATGCATCGTGACTTCAATCTTCAATTCTTACAG
CTGCAATGGTGTGAATATACCACGATTTGTTTATGTTTGTTGGTTGATGGGCACCTGTGT
TGTTTCCATCTTTTGGCAATCATGAATAATGCCACTGTGGACATCGGTGTGCAGGTGTCT
GTTCATGTCACTGCTCTCAGTTCTTCTGGGTATATACCTAGCAATGGTATTGCTGGGTCA
CATGGTAGATCTATAATTCAACTTCCTTGAAAACTAAGGAATGAGTTTTAAAAGAGAAAT
GAAATTCCAGGCCCCGTTGGTGCATGGCAGCCACTGTCCTTTCTTGCTGTGCTGAGGTGG
AGGATTTGTCTTCTGCTTCTGCTGTTTAGAAAGCACCAGGCTTCTTGGCAGCTTCATCCC
CTGCTGTCGCCACGTGCAGTGCTAGCTCTTCACTCTCCTGCCTATCTTGTTGGCTGGCCA
CCCTCGCACTTGACCCATATTTGCAGAGGGAAACCCTGCCATGCTGCCTAATTCTTGACT
CACCTATCAGAGGTTATCTGCTTAGAAGGCTCTTAGATCAAGGCAGAAACAATCAAGGAA
ATAAAACTGGGAATATTTTTCCAAGTCTGAGCAATCCAGCCTCTAACTCTCAACCCTTAT
ATATTTTCCTCTTTATGTTGTTAGGTTAGTAACTTTTTTTACTCGTGTACTCATCTTTTA
AACTCTAATTTGTCTTTTTCCCTTTTTCTTCTGCTAATAGTATAGGTGCCTCTTCATTTA
AAGATATAGTTGATAGGAAATAGTTAGGAAAGCTTATGTCACCTGACTTGCGTAGTAAGA
GATTGACTGGCACAGGTGACTCACGTCTAGAGGTGGGGCAGGTAGGTCCAGGTTGGCTGG
GGGCAATGGCTCCACAGCATCATCATGTCCTGTTCACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCAGCAAAGACATG
AGCTTCAGACAGAACAGGCCCCCTCTGAGCCTGTTCCTGTAGTCAGCACAGGGCCCACAC
TGGTTTAGCCCAGAGCTGCCTCTTACCTGTTGGTCATTGCTGTAGAGTAAGATGGGGTCA
CTCTTATTGGCTGTGTCCAGGCAGGCCCCACCCTTGTGAGCCTCTCCCACCTGTGGGAGG
ATGAGCTGGTAAGGGCAATGAGGGCTGAAAGTAGATGGCCACCTACCCTACCTGCTTCTG
CTGCATTTCCCACTGTGATACAGATTTCAGAAGGGTTGCTTCTTCCTTCCTGAGCCTGCA
CCCCTTACCTAAACAGGACAGTGCTATAGCCCAGTGAAGCCCCAGGCAGTGCCCCGTGGT
GACAGAGCATGTGTTTTGTTTCTCAGGGTGACCTGTGTGATTCCAGCTGTGGTGGTAGCA
CCTCCATCCTTGTGGGTGGCCAGACCACCCCCCTTATACAGCCACAGGATGACGATGTTT
AGGCACAGCCTTAGAGAGCATGCTGCTCCCTATTTCCAGCAGCTGCAGCAGATGACAGCG
CTGCGCTCCTTGCAGTTTCCCGAGCTGAGATTGGTACAGTTTGACTCAGGTATGGGAGTA
ATCTTGTTTGTGCATGTTGTTATATGAAATTTATTTCTTTGGGTTATGAGATGCTTGAAA
AAAAATGTTAGCCTATTTCCTAGAGCAGTAGTAGGTTTGCAGAAAAATTATTCAGAAAGT
ATAGAATTCCCATATACCACCCCCTCTACCCACACAGAGTGGTTAACTTTATTCTTGTTA
AAAAATTAGTATCAGTGCAGTACTTTTTGTTACATTATTATTGGTGATACATTATTATTA
TAATTGTGTTATTAGAGTTCATAGCTTACATGAGGTTTCACTCTGTATAGTACACAGATT
TTTCAAAAAAATTTATTGTGTTAATACATATACATCATAAAGTTTCTTATTTTTAACCAC
TTTCGAGCCTACAATTTGGTCATATTAATTACATTCACAGCCTTGTGCTACCATAACCAT
CATCTGTTACCAACATTTTTCCATCACCTAAAGAGAAACTCTGAACCTTTTCATGAGATA
CTTTTAATGTTACTTATTTCACAGGAAAGCTAGAAGCTTTAGCTATCTTACTCCAGAAGT
TGAAATCTGAAGGCCGTCGGGTACTGATTTTATCACAGATGGTTCTTATGTTAGACATTT
TAGAAATGTTCTTGAACTTCCATTATCTCACCTACATAAGAATTGATGAAAATGCCAACA
GTGAACAACGGCAGGTAAGAAAAAAATGTTTACCTCTTTATCTTGTATAATTAGATTTCA
TTAATATTAGTCACCAGTTTTTAAAGAACTTAATTCTAATGGCTATTTAAATTCGGTTAT
ATCATGACCCTTATAAACAAAAAGAGGAAGACTTGTTAATCTGTTTGGAATTTTTAATAG
GTCTTTAGCTCCATCCTTTGTATTTTTTATAAGTCAGGTACACTTTATTGAGTCATGTTA
TTAGGTAAATGTACAGTCATCTAGACATCCCAGTAAAAATCAGTTATCTGCAATCGTTGT
AAGACTGTATTGCTGTTCTTCAGAACATAGCCACGGAGTAAAAACATGAAACTCTTGATA
CTCGTTTATAATTAAGGGAAGGCAGATTAAAGTGATATGCCTGGTTCTTACTTATCCAGC
GAGCTGAGGGTGTTTTGATGCCTTGCAGTACAGTGAAACAATGAAGCAGCTCTCTCACAT
ACTGCTGGCCCGGGCGTCGATGAGCCCAAGCCTTCTGGACACAGTATTTTTGACAGCATG
GACTGTGGATCTTAGAAAGGGCTTACACTTTGCCCCGGTGATTCTGTGTTGAGGACTCTT
CCCAGTCAAGGACTTCTACAAGTTCCCTGTAGACGTGCTTGTCGTGACCCCGGTGAGGGC
GGTGTGGGTGCCATCGTAGAAAAGCGTGCTGCACGCTCTGTGATGTGGCCGCGTCTGAAG
CGAGACGCTGCTCCCAGGATTCCAGTGGTGGGCCGGGGGGTCACTAGCAATGATGCATCA
GAGGATGTTTTTACAACAAGGAAAATATTCCCAATACAAGGGTAACTACAGAAATCACAG
TGTGCCACTCTGTTTTGACCACTTTGTGTCATACAGGTTATGCAGTATTTTTCATACAGA
TGCATATACACGCTATGGAAAGACCTGAAAAAATATGCCAAATTGTTAATCAACAAGTTT
TCTTGTTAGTAGTATAACAAATGGATTATAGGCTTTCTTGAAGGAAGAGCAGTATGGTCT
TTTGGGCACTGGATTAATTATGAGCAAGTGCCCCGTCTGAGTCAGCTCAGCTCTTGGGCC
TCAGGTGGATAGAGGGGCTTCTCTTGTGGTTTTGGAGTTCCGCACTTCCTCAGCCTTACT
CCAGGGGCTTTTGTGCCTGTAGAGTGCCCTGGCATTGCCTGAGGACAGAGGAGAAAGCAC
ATGTCCCTCCCCAGTAAGAACCTGCTTTCTTTTGGGGTCTACACATTGAGCTGACAGGAA
ATAGGAGGCACGGACCCTTGCGTCCTCATTTTTGTGATCCTGCCTCATGCGTTATTTGAG
CCGTGTGTGCCAGTGCTTGTGAGGGGTGCACGCGGGTCCGTGTGGGTGCAGAGAAAGCCA
GAGACTCCAGTGTGCTGCCGACGGCGGACGTGTCAAGTGAGGCGCAAAGCACACCGTTCT
GTTACGGAAGAGCTTTCAGTCGGGAGTGAAAGCTTTGCTAACTCGAGTGCTGTCTCTGGC
CGTAGGAGCTGATGAGGAGTTTCAACAGGGACCGCCGCGTTTTCTGTGCCCTCCTTTCCA
CCCACAGCCGCTCGGCAGGGGTGAGTCTCGTGGAGGCCGACGCGGTTGTGTTCTACGACA
ACGACCTGGACCCGGCGAGGGACGCCAAGGCTCAGGAGTGGTGTGACAGGATCGGGAGGT
GCAAGGACATCCACGTGTACAGGTGACGCCAGCAGGGGGGCGGGCGGGCGCCGTGGCGGG
GGGCGCCTGAAGCCAGAGGGACGCTCTGTGGCTTCCATTTAGAGGCTTCTGTGGGATTTT
GTTGATTTTTCCTTCAGACAAAGTATATTGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTACTGAAGAT
GGTAAACCTGTTACGTTATGTTCAACTGCAAAAATTGTAACTGGCCAAAGAGATCTTAAC
TGGGGAGAATGGAGAAAGGTCTGTGTTATTTCTAGACTTGTAGAAGTGTTTACATTCCTC
AGTATGACAGTGGATTGGATTCTTGCTGCTCGTTTATTGTGGGCCTGGCTGTGTGTGCTG
AGCGCTGGGCTGGCTCCTTCTCGTGCAGTTGTGAGAGCCCGTGTCTGTGAGCCCTAAGCC
CGGCTGCCAGTGCCCAGACAGGGGCCCGAGGCCAGAGTGGCGTGGCCCCTGACCGACGGC
GTGCAGGTCCAGGCCGCCCTGAAGCCGAAGCCGCTCTGTGCCCTGCGCCGGGTTTGCAGC
AGGCCCGTTGGAGGTACAGCGATCCAGACGCCGAGCCAGGACCATTTCCACCACTTAGCT
TTATTTTTTTTTTCTGATTGTGATGTATTATGCATTCATTGAAAAAAAAACCATATAGAG
GAAAATAAGGATCCTGCAGAGGTACAATAATTAACATTGTGTGTGTACATTTCCAGGCAT
TTTTCTGATTTTTGAGTTGGATCATATTATCAGTCTTAGTTTGTAATCCCTTTTTCTTTT
AACAGTATGCTGTGCATGTATTTCCATGCCAGTCAATATAGGTTTAGTATGTCATTTACA
TTGAATGAAGAATATTTCATTGTGTAACCCCTTTTATTAGGGGTGATCCTTTAGCATTTA
CTAGCTAGACATGGGGAAATCTTTTTTGCTCAGCAGCCCTGAAACCTGTGAAATAGGAGT
AACCTTGGCTGTGAAGGTGCAGGGTGCCTGTGTGCAACGTGCAGTATAGCGTAAAGCATA
GTGTAAAGCATTGCAGGACGTTGTTCTAGATGTGACGGGCAGGAGGACACAGTGGTTCTT
TGACGGGAAGGCTCACTTCATAAAAATGTGGCATCTCTCCAAAATAGCATTAAAATTTAA
CATAATTTTAATGAAAACCCGAATTATGAGTGTGTTTGTGTGTGCATGCATGCACATATA
CAATTAGGTAAAATGATTTTTAAAGTTTATTTGTGGTGAAAATATCTGATAATGGCCAAA
TAACATGACAAGAAAGGATGGGGAGGGAGCACTGGTCGGTGTGCCGTGGGCAGGATCCTG
AGGGGCTGAGAGCCTGTGGTGTGGGGTTAAACAGTACACAGATGTGGTGTCATGTGAATT
GCAGGGGAGTCCCAGTGCCTTAATTCTTGTGGGTATATTTTGCTTTCTAAGTGCAGTTCT
CTACTTTATAATAAGATACAGATAGGTTAAAGACTTAAATGTAAAAAGTGAAACAAAATT
CTTAGGCACTGTTTAAGAGGCAATACATATAGCCTAGCGTGGGATGGGTTTGTTGTGTGT
TTTTTTAAAGATTTATTTATTTATTTATTTCTCTCCCCTTCCCCCCCACCCCGGTTGTCT
GTTCTCTGTGTCTATTTGCTGCGTCTTCTTTGTCCACTTCTGTTGTTGTCACCAGCACGG
GAATTTGTGTTTATTGCTTGTTGTGTCAGCTCTCCGTGCGTGCAGCGCCATTCTCATGGG
CAGGCTGCACTCTTTCATGCCTGGGCGGCTCTCCCCACAGGGCGCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCACAGAAGCAGAGAGCAGTGATGGGCGAGCGCACGCCATGGGAGCGCGGCTGCCGATG
CACCAGTAGGGTCTGGTGGGTGTGAGCGGGAGGACATTCTTAGTTTCTTGTTGCTATAAG
CACTCCTTCAGTAAACATTCTTTGCATCTATTTGTGCAGTGGTGCAACTGTATGATCCTC
TGAGCAGTGGCAGCATTCGCCAAAAGATTTGTACAGTTAAAATGGCTTTGAGTAAAATCC
TGTTAGAACTTAATATATACACCTCATACAGACTCAGCTAGGTAGTCTTCACCCAGTTAA
AGCACCCCTGAAACAAGCACCCAGCTCAGGAAATAGAAGATTGCCAGCGTCAGGAAGAAC
CCCACTCCCTCTCGGGCCCCCTCCCTTTCCTCAAAGATAACCACTTTTCTGACTTCTCAC
AACGTAGTTGCGTGTTTTAAACCTAATATAAATGGAATCTTGCTGTTTTGCCCTCATACT
CTCTTGTTACTTGTAGCAATAAGTTGTCATTCCCGGTGCTGTGGAGCGTTCTGGGGCGTG
CGTGTGCCATGACTTACTTAACTACTCTGTTGGTGGACTTGACGACTTGTGCTACTGTGA
ATGTTCTTACACGTGTCTTTGGTAAACACGTGCATGCATTTCTATTAACTGTCTACTGGG
GTGGCCTGCTGGGTTGTTGGGTCTCAAATGTTGGGCTTTGATAGATGCTGCAGAGTCTTC
CCGAGCGGCTCAGTCAGGTGACCCTCACTGCAGGAGTGCTGGCGCAGCTGTCGCCACGGC
CTGGGCGTGTCCACCATTTCCCTGTCAGCTCTTGGTTGGTGTGCTCTTGGATCGCAGTGT
GGTTTTGAGTTTTTCTGTTGGCTGATGAATTTTTGAGTCCCTCGTCCTTTGATTGGCAGT
TTGGAGACTTTTTTTTTTCAATGATTCTCTACAGCCCCCTTTCCAGAGATGGCTCCCTTC
TCCGTTTGCTCATGGTTTTGCTCGTTGTCTGCTTTTTTTTTTTCCTTGTTGTCTGCTGAT
TGTTTTTTCTTGAGGAGGCATCAGGAACTGAACTTGGGATCTCTTCTATGTGGGAGGTGA
GTACTCAACTCTTTGAGTCACATCTGTTCCTCTGGAGACTTGTACTTGCTCAAGTCTTGT
CTCTCCTTTTTATTTTTTAATTGGGTTGTCTCTTCTTTTTCTCGGCTTGTTGGAGTTCTT
TATATAATCTGGGTAAAAATTCTTTTGTTGGATACATGTAAAATATCTTCTCTCATCCTA
TGGTTTATCTTTTGTCCTCTCTGAATGATCTTTTGATAAGTAGACATTCTTACTCACACC
TATGTTCCACATGTTCAGTTCTTTCTCTTTATAGTTAGTACTTTTTCTGTTCTGCAGAGG
GATTTTTCTTAAACACTGGTCTGAGGCTCTCATGATATCTCCGTGATCCTCAAATGGTCA
TCATTACATTTGTATTTAGATGTACAATCTGATAACTTCTTGTCAGTGGTAATGTAGTGG
GGAATGGGTTCTAGTTAGACTTCGGCAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACGTACACCCAGGACGATGCCTACCGC
ATGGTACTGACACGGGCCTCTCGAGAGGACGCTGGCCCCTCTAGTGAGGCCGCGCTCACG
AGAGGAGATCTGGTGGAAAACTTTCATCACTCTTCGTATCAAAACTATCTAATTTGTGTT
CTGAAAGCACAATTTTTATATAAGTAGCACTTTGTTAGTTTTTTTATTAGATCATTAGCT
TTTCCATGAATTGTATTGCTAGTTGTTATTGAAAATAGTAATCTTAGTGATGTTGATCAT
ACTTATTTTAAAGACTTAATACGTATGATGATTAATTATTTGTGGCTTACAGCAGAACAC
TAAGACTTTGTCAAAGTTTAAAACTTGCCTGTATTCCCTATAGGAATATGTCTATGAAGA
TGCAGATGGACAGACAGAAATTATGCCCGTAAGTAACTCCGTTTTGCTCTACGTCTGAAC
CAGCTAGCTTTCTATGTGTCCACATCTCTCAGCATCTTCTTTCTCTCTATAGCTGTGGAC
ACCACCCACGCCCCCTCAGGATGACAACGACATCTACATCGACTCAGTCATGTGTCTCCT
GTACGAGACCACTCCCATTCCCGAGTCTAAACTGCCTCCGGTGTACGTGAGGAAGGAGCG
GAAGCGACACAAGACAGACCCGTCAGGTACCTGAGCGTGTGGGCGCCCTGGGGCCCGAGG
CGGTTCTTCCACCTTGGAGGAGAGTGCCCGCTCTGTCTGCTTCGGAGAGCCAGGGAGCAC
TTGGATATCGACTCTGGCCATGAGCACGTTGACATTGTTCTGTCTTTGTTTCCTTTTGTT
TTGTTTTTCTGAATCTGGTGACATATGGGGATTAAGAGACTCTTTATGTTTACCTTCCTA
ACGGGTGGTACTGAAGGCAGTTACGGGCTCCTTTGTCTGTTCTCTGCATTTGCCCTTCAT
GTGGAAGCAAAGCTGCTTGCTCCCTGTCCCCTGAAGTTGGCCTCTCTGTTTAGCTGCAGG
CAGGAAAAAGAAGCAGCGCCACGGGGAGGCGGTCATTCCTCCTCGATCACTGTTTGACCG
CGCAGCTCCAGGCGTGTTGAAAATCCGGAGAGAAGGGAAGGAGCAAAAGAAGAACATTCT
GTTGAAGCAGCAGACACAGTTTGCCAAACCTTTGCCGACTTTTGCCAAACCAGCGGCCGA
GTCTGGTCAGGACAACCCTGAGTGGCTCATCAGTGAAGACTGGGCGCTCTTGCAGGTGAG
CAAAGGCGTCTCTCCTCCAGGTTTGAATGTCGAGGCAAGGCTGGTTGTCCCTTCTCCACG
CCTGCCAGGTTTATACACTGCTTTATAGGATTTCTTTAACAAGAGGGAAAGCTCTCTAGT
CTACCTCTTACTGACCCATTTTATCTAAAACCTTTTTCCCTAGGCTGTAAAACAGTTACT
GGAGCTTCCTCTGAACCTCACAATTGTGTCACCTGCTCACACACCTAACTGGGACCTTGT
CAGTGATGTTGTTAACTCCTGCAGCCGGATTTACCGCTCTTCTAAACAGTGCCGGAATCG
CTATGAGAATGTCATCATTCCCAGAGAAGAGGGAAAGGTGAGCTGCGCTCCTGAACCCCC
GCTGTCAGCTGCCTGTGGGCAGGCTCTGCGTCTTTGGGGGGCGTTTCATGGGGCTGTTCT
GAGGACTAAGGTTAGTTAGTTGTAGTGAGCCTGGCACATAACATAAGAAATGAGAAAGAC
GTTCATATTGTCGTTATTATCTTTAGGATTAGCTGTAGTCCTAATACCAGATATTTTCTC
CAGTTCCAAACTTCTGTGTTGCTGTTGTCGTTTGGAAAATATTGTGTAACGTTTGATGAC
TCCAGGGCTCCTCCCAAGTATTTGGTCATAGCTTCTTTTTAAAAAAATTTAAGTATTGGA
TGAATAAAAGAGAAGGTAAAGTTTGCTTTGTCCTATGAGCATTTTAAAGAAAGTTATAAA
AGCTTACCACTAGCTGCTTTGCTGCTGTGCCTACACTGAATTACTAGGCTCGAGGCCGTG
GTTTGACAGATGTTGTTTACTATCTGAAGGGTCACTGTGAGTATTGGAAATGCTTATTTA
CTTATAGGACAGCTGAATAATTGGGGCCTTTGATTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGGGTGCG
CTCTTGGGAGGAAGGGCAGGAGAAGATGGCCTCGGGTCCACCCAGTACAGCCGTCACTCT
TCTCTGAGACCGGCGTCATGAGGGCATTGTGTCCCACTGTTGCTCTTGCTCCCACCCTGG
AGCACAGCCACGCCAAGGCTGCTCCTGCCTTGGGAGGTGTACAGAGCGCGGCACCCGTCG
TCTGGCAGCTTGGGGAATGAGGGCTTTTAGACTGTAGAATCTTGGCCCGTTTTGGAGCTT
GCATGTTTCCTTTTCATGTTTGTGCTTCTGTTTTTCAGTGGAATCAACTACGACAAGCCC
CTGCCTCCTATTCAGGTTGCGTCTCTTCGTGCAGAACGAATTGCAAAAGAGAAAAAGGTG
GGGAGTCTTGGGTATCTTGGACCTTCTGGTTACTGGGGCAGAAACTTTTAATTGTCACTT
GGTTGCGACTCCTCAGCAAGTGAGACTGGATTACGGTGACTGTGAGGGGGGAGGGCTCTC
AGCCCTCACCGCCATTTCTCTTTTCTTCCCTGGCGGCTTCAGGCTCTGGCTGACCAGCAG
AAGGCCCAGCAGCCCGCCGTGGCACAGCCTCCCCAGCCGCAGCCGCAGCCGCAGCCGCAG
CAGCAGCCTCAGCAGCAGCCGCCACCACCGCCACCGCCACTGCCACAGCCTCAGCCGGCA
GCCAGCCAGCAGCCAGTAGGGCAGCCAGCGGCACCGCCACAGGCCCAGGCCCAGGCCGCA
CCCCAGCCCCAGCCCCAGGTCCCGCCCCAGGCCCAGCCCGTGCAGCCCCAGCCGAAGGGG
CAGCCTGCGGTAACCACAGTGGGCGGTGCAGCAGTGCTGGTGAGGAGGAGGCCCGTCCCA
GCGTGCTCGCCAGGGTTGAACCGCCACATGCTGGCACAGGGTTGAAATGCGTTCCGTTAG
GATGAATACTGGCTGAAATTTCTATCCTACTTCCAGCCTCCACGTTTTCCTCTCTGAGGA
AACAGATACAAGGCCAGGTTTTCCCCTAGCAAAACATGTCTTCACCCACACTCTGCCACT
CTGTCTTGCGGGGCCTTTGTGGCCTTACATATTTTTGTGAATAATTTGGGAGGATGAGGC
AGCTCTTCTTAGTGGAAGTGACTGGAAAGTTTCAAATTAACAAGATTTTGTGAAGCATAA
CTCTGAAGAAGTCGCCTTCTTTTCCTCCTTCAAACTCACAGAGCAAATACTTTGTGATGG
TGCAGCAGGTGCCGAAATAAGCAGTCTTCTGCTGAGCCTGCCCTCCTTTTCCATCAAATA
AGTATGTGTGCGCTCACACACATGCACATCTTAAACCTCATTTACGTCCAGTGTAGAAGG
TTGTACAGTAAATGAAAAGTATGAGGAAAGGAAAGGCAGAAATTATGATCTTGAAGACCC
CAAGGTCACCGTGAGCCCCGTTTGGTGTCCTCTTTTGCTGGGTGCGTTGTGTGGATGTTC
CTTTCTGTTAGACACAAATTGAATCCTACACGCAGCATTACACTCCCAGAGACTTTCTTA
GGGCTCATTGGACTAGTTGGACTATCAGCCAGGCGAGAAAAAAACTATGCAGAACCATTT
CCTCAGTTGTTTTTTAAAAAGTGTAATTGCTGTAGTGGGATCTTCTTAATTCAAAAAACA
AACAAATGTCTTCATTACACACTGACTTGGCACAGGGGCTCTGGGGTGAGAAAGACAGGT
AGGGTCCCTGCTCTCCTGGAGTTGGCACTCCTGTGCTAGATGGGAGGCGAGCAAAGCCTG
GCCATTGTAAATGTCGACAGCAGAAACAAAGCATGTAGCAGGCTTTTCATAGGCGTTTAG
CTCAGCCTGACAGGAGTTAGGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGCCCGGCCATCGTGAGGTTC
GAAAGGTCGGCCTGGCTGAGGCCACAGGACGAGTGGTGCAGAATGAGGCTGGGGAAGGAG
GAGGCCAGAGACAGGCTTGGGGGTGGCCTTGTAACCACGGTCAAGGGTTTGAGTGTGATT
ATGAATGAAGTGGGAAGCCTTTCAAGGGTATGAGCAGAGAGAACTTGACAGATGCCATTC
ACATAATCTTCTTTCTGAAGCAGGCAGGAACCATTAAAACATCAGTTCCTGGGACAAGCA
TTCCAACCGGTAAGAAGAATACAGAATGCTGAAGTAAGAACTTAGTTGTATTTGTGGCTC
TCTTGCCTGACAGCACTCTTCTCTCTGCCAACACAGTGAGTGGCAATGTCATCATGAGCA
GCATAGCAGGTGTCCCTGCGGCCACCTTCCAGTCTGTTAACAAGCGTCTCGCTGCACCAG
TGGCACCTGGAGCTTTAACTGTGAGTTGCTCACACACAGAGAATGGTTTTGTTTCCATAA
ATTAATGGTCATGGGGAAATTATTTTTATTTTTAATACTTGATTGATGAAAAGAATAACT
CCTAATCTAGTTTGAACTTCATAAAATAAGTAGGTGATCAGTGTGATAGTTTCAGAAACA
TTCAGGCATTTGGAGAATGCTTTTATTTTGTACTTTTTGGTGAAGTGAAAAAAATGAGTT
TCTTGAAAAAATTTCCCTCCAGGAACAACTTCCAGAGAAGAGGTAGGTGAGAGGTGAGGA
TGCACCACTGATTCAGGTGTCGGGGTGCCCACCGAGCGCCAGGCCCTGCCTGCATTTGGG
GCCAGAGAGGGCAGCGAGGGCTGCTCTTGTGCGTATCGGGCCGGAAAGGGGCTCGGCATC
CTGTGTGTTGGGTGACATGCTTTCCTGTGCATTGCCAGGGTGCATGCGGGGATTGGGGGC
ACAGAGAGGGAGCGGCCAGGTTCTTAGCAGAGATCTAGACCCTACATGTGGGAAGAGATC
AGGGGGCTCCACTGGGCAGAGGAAAGAAGCAAGTCTCTGAGCACGTGATCAAATGGAAAT
AAGGAAGCTAATCAAACTACACATTCTAGTGTTGTGCCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTACTAGTA
CCACAAACTACAATGAGATGCACTTCACACCAAGTAGGAAGGCTATGATAATAAAAAAGG
GACATAACAAACACTGGCAAGGATGTGGAGAACTTTCATGCATTGCTGGTGGGAAAGTAA
AATGGGACAGCTGCTGTGGAAAATGATTTCTCGGTTCCTCAAAAAGTTAAACTTAGAAGT
ACCATGTGACCTTGCGACTCCACTGTCAGGTATCTGCCCCAGAGAACTGAACACAGGTAC
TCAGAGAGAACCACGGACACACGTGTTCATAACAGCACAATCCACAGGAGCCGAAAGGCT
GATGCAGCCCCCATGTCCACGGGAGATGACCTCCCCTCCCTTTAAGGCCGGGGCTCTTAA
CCAGGGTCCACAGACGCCCAAGGGGTCTTCAGAAAGATTTCAGGGGTCCACGAGCCCTGA
ATTGAAAAAAATAAACTTAGGATCTTTATTTTCTCTCACTTCTAACTGAAACCTATCATT
TTCTTCACTATGAATGTATGCAATAAATTACAGTAGCATTCATTTCACATCATGTTATAG
GTGTTGCATATCTCGAAAAATCACTTCCGGCTCATCCATACTTAGAGATTACTGTAGTTA
GACCTGACACTAGATGAGTGTTATAAAATTGTTTGTTTTTATAAAACTCTGCCGTTTTTT
ATAGTTTTTATGAAACTTCTGAGACGGGGTCCCTGGTTTTCACCTGCCTGGCAAAGAGGT
CCATGGAACAGAAAAGGTTAAGAACCCCTGGGTTAGGGAATTTTTACTGAGTGGCTCCAG
TGTGCACGGCGCTGCAACGCTGGGGCTAGGCTCTGGTGAAGTGTTGACTATCAAGCATTA
CTCATCAGGCAGTGGGGTGCCCTTGACCGTCTCTGGGCAGAGGTGTGTTCTTGGAGAGTT
AATTTGACTAGAGCAGAAAACGCTAGGGAGAAAACAATTTCTGTGTTTCAGGAAAGTCCT
TCTGTTTCTGGTAAAGTAAACTAGTTTATTTACACCACCCTCTTAATGAACTAAAACTAT
GGGATAAACATTTAAAAGATCTTAAAAGCCTCAAGGAGCTGACAAAAGAATAAATAATTA
TCAGGCCAAAATATAAGGAAAAAAAGAAACCCAAGGAGATGAACAGGGTGCACGGAAGCT
GCTTGTGCCTTGATTTTTTTTTTTTTAATTGATTTGGTAAAAATGTTACATTAAAAAAAC
ATATATATATATGAGGTCCGCATTCACCCCCACCACCCCCATCCACCATTCTCCCCCCCC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTTCACATTTAAAGTC
TATTTTGTCTGATATTAATATAGTTACTCCTGCCTTTTTTTGTTACTGTTTGCTTGTATG
ATTGTTTTCCAGCCATTCACTTTCAATCTCCATGCGTCTCTGGGTCTAAGATGTGTCTCT
TGTAGACAGCATACGGATGGGTCATATTTTCTTATCCAGTGACCCAGTCTGAATCTTTTG
ATAGGTGAGTTTAATCCATTGACATTCAGTGTTATTACTTTCAAGGAATTATTTGTGTTA
GCCATATTTTGATTGGATTTGTGTTTGTCATATTTTGTTTGTATTTTTTTTCCTTCTATT
TTTGTCTTTTTTTGTTGCTCTTATACTCTCCTCCAACTCTGCCTGTCCTGTTTTTTTCTT
TCTTCCTGCAGAACTCCCTTTAGAATTTCTTGAAGGGGAGGTTTCTTGTTGGTATACTCT
TTCAGTTTCTGTTTATCTGTGAATATTTTGAACTCTCCATCATGTTCGAATGCTAGTTTA
GTTGGATAGAGTATTCTTGGTTGGAAATTTTTTTCCTTTAGTACTTTGATGATATATCAT
ACCACTGCCTTCTTGCCTCCATGGTTTCAGATGAGAAATCAGCAGTAAATCTTATGGAGC
TTTCCTTGTATGTGATGGTTTTCTTTTCTCTTGCTGCTTTTAGGATTTTCTCTTTGTCTT
GAGCATTGGATAATTTGACAAGTGTGTGTCTTGGCGTGGGCCTGTTGGGGTTTACGACTA
GTGGAGTGCGCTGTGCTTCTTGGATATGTACATCTGTCTCTTTCAGTAGATTTGGAAAGT
TTTCAGCCATTATTTCCTGCAACACTCCTTCTGACCCCTTTCCCTTCTCTTCTCCTTCTG
GAATGCCTATAATACGTATGTTTGAGCGTTTTGCATTGTCATTCAGGTCCCTAAGTCCTA
GCAGGATTTTTTCTATCTTTTTATCGACCCCTTCTACTATCTGTTTGATTTCTGATGTAC
TGTCTTCCACATCACTAATTCTCTGCTCTGCCTCTTCTAGTCTGCTGATATTTGCTGCAA
GTGTATTTTTGATTTCTTGAACTGTGGTGTTCATTCCCATCATATCTGTTATCTTTTTGC
GTATGTCTGCAATTTCCCCTCCAAGTGTTGTCTTCATGTTGTTAACCTCTTTCATTACTT
CATCAAATTTGTCGGTGATAAATGTTCTGAAATCTTTCATTGCTTGAGCGAAGTTCTGCT
CCCCTTCCTGATTTTTAGTTTGTTGATTGGATTCAGCCATGTTTTCCTGATTACTGGTTT
GGTTTGTAGATTTTTGTTGCTGTCTGGTCATCTTTTTTCCTTGACGGGTTTAATCAGTTC
CTTAGCTTCTTTGTCTACTCTTGGAGATTAATTAGCTGTTGTTTTTGCGTAAATGTTGTA
TCTTCTCTTTGTCACTTTGTTCTTCTTATTCTAATTTCTTGTTGCTGGTTAAGTTCACTT
TAAAGGAAAGTATTAGTGCCGGGGAAAGGTAATTGTGTAAGCAAGAAAAAAGTGTAAGGT
AGTATTGGTGATATATGTTAACAAAGCAAGAATATGAGATCTGGGAGGATGGAGGTTAGA
TTCATGTAAAATTGTGTAGAGTTGTAGCAGTAGGTAGATTACCTATTATGAGGTAGCTGA
CTGAATATGGGAGGAATATGGTATGAGCTAAAAAGCTATTGTTTTCGTGAGAGAGGGAAA
GAGAAAAGAATGATAATAGTTTCAAGAGTGGATAACAGACAGAAAACAAAACAAGGGTAT
TATGAATTAAGAGTTAGATACTTTGTTGATCAAAGAAAGGGAGATGGGAGGTGGAATGTT
GGAGAGACAGTAGATGATGGCCGGATATCAAGATGTAGGCAAAAAGGGGATAGTGTAGGG
TAGCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAAGAAGAGAAGAAGGA
AAGAAGAAAAAGGGGGGTGGGCAAAGGGTGGGGAACAGGTAGGGGAAAGAAAAAAACAGA
TATACGCAAACCACTGTTGCAACACCAACTACAACAACAACAACAACAACAAAAACCTAA
ATAACTGAATAAAAAAAAAAGACTTTGGGGAATATGCTGGGAGAAAAGACTAGGGGATAA
TGCAATATTAGCACTCAGGACATTAAAAAAAGTAAAAAAATAAGATAAAATGAAAATAGA
AACAAAACAAAATGAAACGGTTAAGGAAAAATGCAAACGTTGAAGGCTAGGGCATTCAAG
GACCTCAGATGGACCTCAGGGCGTGATGGATTCAGGGGTGGAAAGTCTGAGATATTGAAG
ACTCAAGAGGTGTGTGTCTGGGGTGTGGGCCACCAGAGTTTAGGGGACTCAGACCTGGCC
ACCTCAAATCTGGTCAACAGGAAGCCTAGGAGCCCCGCAGTGTAGCACAGCCCTCAGGGA
GCCCCGCAGCTGGGCGCCAGCCCTATGGGGGCAGTCAGATCCGCAGACTCTATATTATGT
CTGAACCCTGCAATTCACTTACTCACTAGGGTTTATTTATGTGGATATTTCATCAATTCA
GCTATCTAATTCCGTTGCAGATCGGCAGCCGGGCCTGTGGGGGCGGGGCTCCAGGCGGAA
GCGCTATTATTTGTGTCCGCAATCAAAAATTTCCCCGCTTCACAACAAAACACCGTCTGT
CTCCCCAAATCGATCCGCAAAGGCATCCTGTCCCATCAACCCCCCAACAGCCCGCTCAGG
ACTCTCGAATTCCCCTGCACCGCAGAGCTACCAAAAAGCGCGGCCGAAGTGCGGGTTCTG
CGGCTCAGCCCACCCCCAAGGAGGGAGCAGCCCGTGTGCAGGTCTCACCTCCGGGCAATA
GAACCCAAATTATATCTTATAGACCAATCCTCTCCGTTACCTTCCCACCAAATCGATGTC
CAGACGCTTCCTGCCCTGCAAAAATCCCGAAAAAGCCTGGTCCCGGAGAACCTCCAGCGG
CGCCCAGCTGCCTCTTCCCAGGAGAGACGGCAAGGCAAGCTCACTCAGCCACCATCTTGC
CGGAAGTCCTCCTGCTTGTGCCTTGAGAGTCAGTTTTGGCTTATGGGAAAAGGGGGCACA
TGTCCAGGCTCTGGCCTGCAGTGGAGCATCTAAAAGGAGGCTGTTGATCCACTGGGCTCT
AACGGCTAAACCCTTAAGGCAAGAGTGAGCAAGAAGTGAAACCCACCTGTGCTGCCATCC
CATCCCTACTTGAGGTGTTAAAAGGATACTTGCCTTTGTGCTGAGAAGAGGTGAGGGGAC
AACTGTCCCTAATGAAGTTGTAATCTCAAATTGGCTCTTCTGTCAGGTTATAGCTTGAGT
TGATATTACCTTAAAGGGTAAAAAACGAAGTCAAGTGAAGTAGACCTGGACTGGTAGTGT
TTGTGAGTAGCTGACAGATTTTCTCTGGGGGAATATGTCTTTATAGTGGACTTCTTAGAC
TCTCTACAAATAATTTTCAAGAACAAAGAGCAGCATATAGTCAAAAATAACCACTGACAC
CAGGAAACAAGACACCATGAGTGAGAACCAGCAGAAACAGCAGACAGGACAGTTCCATAA
AGACGTGAGATGTTGGAATTATCAAGCATGGATTATAAAATAATTATACCTTCTATTTTA
AAGAAACAGAGGAGAAACTTGAGCTTATCTGTATAAAATCAGGAAAATATATTTGAAAAG
CCTATAAAAAATTTTTCTAAAGGAAAAATAAGATTGCCAAAATTGAAAAAACCTGATAGG
TGGGCTTAATATATTACACACAGAGATTTAGTGAATTGGGACATGTTAGAAGAAGTTAAC
TAGAAAGCAGCATGGGAGACAAGATGGAAATATGACAAATAACTTAAGAACCATGGAATA
GAGGGTGAGAAGTGCTAATAACCCATGGTTTATCAGAGTTCCAAAAAGGACAGTGAGAAA
ATGGGGCAGAGAAAATATAGGAAAAATTCATAAGCTCATATATGAGAGCGTTCCAGAACC
GGTCGCTGAGTCCATAGTTTATCCCAATCAGGATAATAAGAGCAGCCAGAGGAAAAAGAT
TGCTCTCAGAGGTTCAGCAGCTTACTTTTCAGTGGCAATGACCGAAGCAAGGGACCTGTG
GAAGGATTACCTTTACTATAATAAAAGAAAGAAAGAAACCGCCAACCTTCCTGCTCAATG
TCCTTTGAAAATATCCTGAACAGCAAGGTCAAAATAAAGACATTTTCAAACAAAAACTGA
GAGAATTAATCATAGCAGACCTTCACCCAATGATGTACTTCAATGATGTACGCAGAAGGA
AGGGGTTCCCAGATGGAAGGTCTGAGAAGCTGGAAGGAAAGTAGAGCAGAGAAGATGAGC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTAGTTTTAGGCG
GGATTAAGCTGAGCCGCCACAAGGCCTCAAGCAGACTGGTGAGGGCCTTGCCTTGCACCA
GGCTGGGGTGGTGGAGACGCGGGGCTCGGTTTGTTGGGGAGAGGCGCCAGTTTCTAAAGG
GCAGTCAGTGTGTGATGTTCCTGGGACCTTTCTCAGGAAGAGAGTGGGCATACTGCGTCT
GAAACTGACCTCTGTCTCCTCTGCTCTGTAGCTCAAGACACATGCTGCTGAGCTGCGCTT
TTGAATTTACATGGAAACAAAAATTCTCTTAGTGTTTTTAAGTTTGTCAAAAGACCTCAG
TTTAGAATGTATTAAACTTCCTGGGATTTTAGAGCTTGCTATACTTTTCTTTCCTACTAG
GGTGTAAAATGCCTTGGAGTAGGGTGTGACGTAATTTGTGGTTTCCTCCACTGGCCTTTT
CTAGACGCCTGGAGGTTCTGCTCCTGCTCAGGTGGTTCATACACAGCCTCGAACAGGTGG
CTCCCCAGCCACCGCCACGCCTGACCTGGTGTCCATGGCAACGACACAGGGTGTTCGGGC
GGCCACTTCTGTGACGGCCTCAGCAGTGGTCACCACCAATCTGACACCAGTGCAGGCCCC
AACACGATCTTTGGTGACCCAGGTGTCTCAAGGTGAGGACAGATTTTATTCTTCCTTTTG
TAACCCATCCTACTGGTAAAGAAAGCTTTGTTATCTGAGCACAAACTGGAGCCACTGAAG
GAGGACAAGGGGCAATGGCAATATCCAGACCTAATGAAATAAACTTCTTTATAGCCACAG
GGGTCCAGCTTCCCGGGAAAACCATCACACCTGCACATTTCCAGCTCCTCCGGCAGCAGC
AGCAGCAGCAGCAACAGCAGCAGCAGCAGAGCTCTCAGGTGCAGGGCGCACAGATCCAGA
GCCAGGCCCAGCCGCCAGCCCAGATCAAGGCTGTCGGGAAGCTTACCCCGGTGAGCACTT
TTCAGAAGACTAAACATGTATCCAAGACGCGGTCAGCCAGTGTTTATAACTGGATGCCCT
GTTGAGCGGTGCCGCTCAGTGTCTATTTTGCAAGAATTTAGCCTTCTCTTTATGTAGGAA
ATGTCGTCTTACAGGTACTATTTTCATGATTGTACTTTTATAAAAACAGTTTACAGCTTC
TACACATCACTTTGGAGACCTTAATCCCCGGTTTCTAAATTTATCTCCTTAACTTTCTTG
TGCTATGTGCACAGCAGTTTAGTCTCCAGCAAAGATTAAAAGAGGCCACTTTGTACCAAA
GAAAATGCTGGGAAGAAGACTCTGAAACAATTTCAGAAGGCCTGGTGGCAGGCACTTGGT
CTCCTGAGAATCGCTCATTTGCAGGATTATTTCCTTGGGGTCCTAACTGGCCAGTCCGTG
AGCCCCTTTGCTCTTATTCAGTCTCCTGGTGCCCTGTCCTGCCCCCCAGGGACCTGTGCT
TGGGCTCTGCTCTCTCTTGTAGTAGAGCATAGTGGAGCAGGTGTGGCTCAGTGGCTGAGC
GCCTGCTTCCCATGTACGAGGTCCCGAGTTTGATTCCCAGAACCTTCTAAAAAAGCAGCA
TAGTCTATGCTAGAGGCTGCTGTGCCCCCGTCACACTGGAGAGAGGCAGGGCGTGAAAGC
CCACCCTCCTCCTCTCCACGCTCAGCTTGCAGTTACCCCGTGCCTCGGTCTCCTTTCTCG
AGGCCAGAGCGAGGAAGCGCTGTGCTCCCTCTGACGGCGGAACAGAGCCGCGCCAACGCA
GGTGCTACTGGCTAGGTGGCTGTTCAGTTCAGCGTAAAGCAGCTAAAGCAAAGCACAGTA
ATTCACTTTGTCAATGGCATCTGCTGCATTTCAAGGGCTCAGTAGTCACGTGTGGCTGTG
ACTACTGTATTGGGCAGTGCAGATCTAGAACATTCCATCATCGCAGAAATGTTTGTTGGA
CAGGGCTAAATTAGAGAATGTGTGTCAAGGATCTGGTCCTAGCAGAGGCGGTCTTGTTAC
GAGACAGGACGTCTGACCCCCTGCCCACCCACACTCAGGCACGCTCCCGGCTCGCCCTCC
CGGCTCACCTTCCCGTCCTCTTTGTAGGCCACGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACTTTTTTCTTAAAAGCAGCACCTTTTAAATGTACTGAGCGAGACTGCTTGCTCAGGA
CTGTGCCGGGCATGACACTGACTCACCAGCGAGGTCTCGGCCTGTCTTTCCACTAAGAGC
TTGAGGTCCTGAAGAGAATAGAAGGCAGCCCACGTGTGTCCCTGTAAACACTAACACACC
CTCGCTTTAGCCGCTGTCACAAAGCTCATCACAGCGTGAGCCGTAGAGGGGTTCTTGGAG
GTGGAGAGTGAGCGAGACCACGGAGGGCAGTGAGACCCACCTCGAGGTGCCTGAGCTGGA
CAGTGCAGCGCCCAGGAGCGCCGTGGGGTTGCGAGGTCACAGCCGCGTCTGGGGAGGAGC
CAGAGGTGGGTGCGTGAACAGGGTGCCAGAGTCCTGGAAAGGCAGGCTCAGAGACGCCTG
AGCTCAGCGTGCGGGAGAACGGAGGAGCAGTGATGAGGGAGGTGGGCTCAGGGAGGATGG
ATTGTGTTCAGCCAGCCGAGGGGTGGTCTGTGCGCCTGGCACCGGAACAGCGAGCCGCTG
GTCTGCTGCGGAGGAGACCACTGGCTTCCCCGAGGGCTCCACCTTCTCCCCGGCTCAGGT
GCAGGCGAGGATCCCGGGGACTGCAGGTGCAGGGGCCCTGCCCGAGTCCTTCTGCCCTGA
ACCACAGAAGGGCTGGCCCTGGGGAGCAGGGCTCAGGCACCACAGCACAGGTGCCCCGGC
CAGGGCTGGCCTGCCCTAGAAGAGACAGGTAGATGAAAACTTACTTAACCCAAAGGGCTG
TGATTTCGCCAGCATGCCCCAAAGTGCCAGCTGACGTTGGAGGAGTGGGACACCTCGGAA
GGGCCAGGGCGTGGGTGTGCATCTCCTCCATGCGGGCTTTGTGGAGTTGTTGGTTACCTT
TTATGGAGGGAATTTGAGTAATTAAGCTATAAAAACAAATCCAGCAATCCTGTTTCTAGT
ATATCCTAAAGAAATAATGAAATAATTACAATGTGATGAGTGTAGAAGCTTTTGTTGAAA
GAATGTGAATTTTAGCCAAAACATAAATGCCGTGTTTAAGACATTTACCCAGTGAATTAT
AGACCAACCCAACAGTAGAGCATGACACCACTTTGAGAAAGGATGTATTTATTGACAGGT
ACTTGTGAAGGGAAGAAAAACATTACAAAACATCTGTAATTTCATCCCGTCTTTACATAG
CAACCTACACAGATACAGAACAAGATCTAGAAGGATAAACATCAATTTTAACATTTGTAT
GTGGGCAGTTTTAAGATGATAGGTGATTTTTACTTCTTTATATTTTTTTGGGTTATCTGT
TTTTTTTTATACCTTTAAAAATAGAGCTACTCCCATTTTGCCTTTTTTAAAATGTAAATT
AAGGAATTAGGTCAGAGGGGGGCCAGGGGGACCACCACTGGTAGCTGATGAAGAGGAAAT
GAGAGATGCGGCTATAAAAGATGATGTATGTGCTTTGGTTATTAGCAGGTACAGTGATGG
GCAGTGGCAAGGGTGGAAGAGGGGCCGAGGCTGGACTGTGTGGCTGTCTGAAAACCCAGA
CCGCGGTAGTGGGGCTGGTGGGCTCCGCCTTGGTGCGCGGGGCCCCAGGCCTTTGTAGAA
AGCAGTTGAAGAGAAGGGTCAGGCTGGAGGCGGAGGCCGTAATCCCTGTGCTTTCGTATC
ATTTAGACACCACGTGCCAACCTTGGTCATCATGGTAAATGACCTCTGCAGCCTGGCCTC
CTGCCAGGGCGTGTTTGAAGAGCCGCAGGCTGTCCTGTCTCTGGGCTCACACCCTTCTGT
TGCCCTCCAGACCCGGGTCCCCACCTCCCAGCTGCAAGCGCCAGGTCAGATGCAAGCCCA
GACGCCCCCAGCGGCCCAGGTGGCCCTGGCAAAGCCGCCTGTGGTGTCTGTCCCTGCGGC
TGTGGTCTCCTCGCCTGGGGTCACGACCCTGCCCATGAACGTTGCCGGCATCAGCGTGGC
CATCGGGCAGCCGCAGAAGGCCGCAGGTACGTGCTCAGTGCCTGCTCCTGGCCTGGAGCT
CGTGCTGCTGCTTCGGCGGGTTCAGTGATGTGAGTCCACCCTTGGCGACAGCAGTGGTTA
GCTCTGCTGCGCGCTTTGCTTGAAAGGCACTGCGTCGTGCTGCGTTACATTTTAGCATAA
ATGTCTCTCAGAGATTTTAAAGTCCCCAAGTTTTGGTCCATCAGTTTTAACTGCTGGATA
TTCTGAATTTCCCATATCTTTATTTAAGTGTTCTTTATGAACCTGCGGACATTTTAAGTG
TTTAAAGGGGATGGCTTCGTTTGTCTCAGCATTGTTCTACCATCTACTCTTTGCATCTGT
ACAGAAGTCAGTCAGCATGAACACCGCAGTGGGCTCGTTAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCAG
CATGCTTACCAGAGAGGAGAGAGTGTGTGGCTAGAAGTGAGGATAAGGGGGAGTATCCTG
CCCCTGCCTCCAGGTGAAGAAACAGGACTGAGCACTGGCTCTCCTGGAGACCCATCTTTG
CCCCCCATTGCCTCTGCCAGACTCAGCAAGGAGCCTGAGCATTTGTGATCCACTTCTCTT
ACAGCATCGCCATCTGTGTGTCCCTGAGCAGGGCACTGTTTGACTTTGTGGGCGTGACGT
CTCAGAGTCACATGGCGTGCAGTATTCGGCGCCTTGCCTTGCCATGTAACGTGGTGTGAC
CTTATGCCAGGTGTCTGCATATGGCATTCCACCTGTGCCCACCCCAAGGACAAGAAGCTG
AGGCAGTGGTTCTCCTGCTGGCCTTGGGAGGCAGGTGGCACATTGTTTGCAGTTTTTGAT
CCCGTGTTGACAGTGATACCCTTCAGTCCTTCCATTTCAGTGGATGCCCTTGGAGAGCAG
GCAGCCTCCCTGCCTCTGCTCGCGCCTTAGGGCTCCACTTCTGCTCAGGATCTGCAGCGG
AGAATTCCTGACTTTTGGAAAGTTTCCTGATGGCTTAATGATGTTCATCTAGTATCTTTG
CCAAGACGATTTAGTACTTTCAGCGGCATGCCAGCCTGACTCCTCACTGTGTGCTGAGTG
GAGGGGCTTGGCTGTCGTGGCCCCTGGCTCCTCAGTTCTGCAGAGGGTATGATAAATGGC
ACGCTTTATTTTACTGAAGCATGTTTACATATTTTTATTCTAAATTACAATAAACCAGTA
AACACCTTCAGGTTAATTTTTATTTTTATAACTAGTGCTAGCATTTATTTGGAGCTTTGT
CTTTTTACAAACCTATCATATAGTTTTCCCCAGAATCAGCCAGCCCATAGGTGAGAGAAT
TGAGCGGGGAGCAGAGGTCTACAGGGCTTTGGGATCCGGTCCCACCAGCTGCCTGCTCAT
GAGCCCATTCTGCTTCTGTAGGCCAGCACCGAGTAGAAACAAAGGAGCAGTGAGTGCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGACGCAGCAAGTGCAGACCCAGATACA
AGTGAGTATGACCTGTTTGCGAAGTTTTTATTGTACAATCCAGCATGCTTACCAGAGAGA
GAGAGTGTGTGGCTAAGAAGTGAGGATAAGGGGAGTATCCTGCCCCTGCCTTCCAGGTGA
AGAAACAGGACTGAGCACTGGCTCTCCTGGGGACCCATCTTTGCCCCCCATTGCCTCTGC
CAGACTCAGCAAGGAGCCTGGCATTTGTGATCCACTTCTCTTACAGCATCGCCATCTGTG
TGTCCCTGAGCAGGGCACTGTTTGACTTTGTGGGCGTGACGTCTCAGAGTCACATGGCGT
GCAGTATTCGGCGCCTTGCCTTGCCATGTAACGTGGTGTGACCTTATGCCAGGTGTCTGC
ATATGGCATTCCACCTGTGCCCACCCCAAGGACAAGAAGCTGAGGCAGTGGTTCTCCTGC
TGGCCTTGGGAGGCAGGTGGCACATTGTTTGCAGTTTTTGATCCCGTGTTGACAGTGATA
CCCTTCAGTCCTTCCATTTCAGTGGATGCCCTTGGAGAGCAGGCAGCCTCCCTGCCTCTG
CTCGCGCCTTAGGGCTCCACTTCTGCTCAGGATCTGCAGCGGAGAATTCCTGACTTTTGG
AAAGTTTCCTGATGGCTTAATGATGTTCATCTAGTATCTTTGCCAAGACGATTTAGTACT
TTCAGCGGCATGCCAGCCTGACTCCTCACTGTGTGCTGAGTGGAGGGGCTTGGCTGTCGT
GGCCCCTGGCTCCTCAGTTCTGCAGAGGGTATGATAAATGGCACGCTTTATTTTACTGAA
GCATGTTTACATATTTTTATTCTAAATTACAATAAACCAGTAAACACCTTCAGGTTAATT
TTTATTTTTATAACTAGTGCTAGCATTTATTTGGAGCTTTGTCTTTTTACAAACCTATCA
TATAGTTTTCCCCAGAATCAGCCAGCCCATAGGTGAGAGAATTGAGCGGGGAGCAGAGGT
CTACAGGGCTTTGGGATCCGGTCCCACCAGCTGCCTGCTCATGAGCCCATTCTGCTTCTG
TAGGCCAGCACCGAGTAGAAACAAAGGAGCAGTGAGTGCATTTTATTACATCAAGACAGC
AAGACATGTATTAGTAAACACAGGGCCAAAGTTTTCTAAGATCTCAATCATGATTTTAAG
AAAAGTGTAGAAAAATGATTTAAAAAGCTGCCATTAACACTTTGGAACGTCCTGGATGCA
GGCTGAGCTTCCGTGTCCACATCCCCACACCCAGTGTTGGGTGTTGCGGCTTCGCCTTGC
ATCCGCGCTGTTCCTCGCAGCTGTAACTTCACCGGGGGCCATGCGAGCGTGCCGAGGGGG
CCTCCCCCAGAGGCCAGGGGTACCCTTTCAGGAACTCATAATATACTCATACATTTCATC
CTGTCCTTGATTTAATTCTCTCATAAATTTTGGGACAGTTTTTACTAAAGGAAAGCATTT
GACTACCCGTAATAGGAGGCCAAGACCATAAAACTAAACTTCCATTATGCATCATTACAG
ATGGGGGGGTTATTATTTGGTGTTAAAGGTGAGATACTCCCATCAGAGAGCAGGTGTGAC
TCGTGGTTGGGTGCTTGCTTCCCATGTACGAGGTTCTGGGTTCAATCCCTGGTACCTCCT
ATAAAACCAGAAAAAGGTGAGATGCTCTGTCACCGTTCCCTGGGAGCAGCTTGGAGGTTC
TTGTATCATTTGGTCACTGTTTTTCTGCATAAAGAATGGAGAAGAAAAGAAAGGGAGAAA
AAGCTCTTTGTACACATTCTTTTGGATTCCACCTTTTGTTTTTTTGTCAAAGGTTGCGAA
GCTCCCTCAAGTTGTCCAACAGCAGGCAGCAGTGGCTGGTGTCCAGCAAGTGGTTTCTGC
CTCTCAGCAGGTGGGTAATCCAGAAAGGGTCTGTTCCTAGTCACACATAAAAGGGACCTT
TTATGCACATCCCACCTTTCCCATTTTTAAGAGGATTCTTGGTTTTTATCCTTAGGAAGT
GGAATTTTAATTAGAGAACCACTTTTGATTTTCATAATACAGAAAAAAAAAAATAACTTT
CAGGGAAAGATGTGATAATCTCAGAATAGTAGGGGGAAAACCATAAGCATATGTGGGTTC
ACACTGATTGTCAGCTCTGCGGAAGGAGTCTTTCCTGTGTTTCTTGGGCCATTCAGCCAG
TGACCTCAGGTGTACCCCCTGGCCTATGGTGCCGTGCTGCTGCCCCCAGGGGAGCACAGG
TGTTGCCGGTGGACCCTGCATCCGGGGAGCAGGGGGTGGGCAATGATGAGCTGACCCCCG
TAAGAAAGGAGCATTTCAGGCTTCCTGCATTGGTTTCACCTGGTACTGCAAGTGCTGTTG
GTGCTACAAAATGAGGCTGTATAAACGGTGTGCTTTAAGCATTTTTAATTTTGTTCAGAG
TCACACTGGTATACAGATTTTGGGAAACAACAACAAAATCAGTCTTCTGACCCTACCCTT
ATTCTTTGCCAAGGCATCCACTTTTTGTCTGAATGACCATCTTTTAATTTTGTGTTTTCG
TTTGGTTACTCCAGAGGACATATTTTGGCAGGCCAGATGGTTTTTACATTTTGTAAAAGC
AAACTACTAAGGACATTTTGAAAGGACCAATCCCCCCCCCAAGAATGTATTACTGGTTAT
GTCCCTGATGTGCCTGTCTTCTCTTCTGGCTCAGGCTTCCCCCCAGACAGTGACGCTCAC
CCAGGCCACCCCAGCAGGCCAGCAGGTGCAGGTGATCCCTGCCGTCACAGCCACTGCTCA
GGTGGTTCAGCAGAAGCTCATCCAGCAGCAGGTGGTGACCACGGCATCCGCCCAGCTCCA
GGCACCCGGCATCCCTAACCCAGCCCAGGTGCCGTCCAGCGCTGACAGCCCGAATCAGCA
GCCAAAATTACAAATGCGAGTACCTGCTGTCAGGTTAAAGACACCCACCAAGCCTCCGTG
CCAGTAGTTGGCTCCTTCGCCTTTCACGGTCTTAAGGCAAAAATCTAACTTCTGCACAAA
AAAAGGTTTATTTATTTTTGCACATTGGGACAATGTCATATAAGATAGTCAGCATTGGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTACCTTTTGTTCAATTGAAGGAAGCATTTGGGCCGGATGCCCA
CCTAAGCACATCTTGAGATATTCCCAGCCTTTTTGGATAACACTCTTATTTGGACTCTAA
ATCAACGCCAGGGCACCTTTGTGGACTGGTTTAGACCAATAATGCTGTGTACGTATGATG
TTCCAAGTGTTACTCTGCTAAATAAAAGGAAAAAATGAGGTGGTTTTAGTGAGAGAATAG
GGGTTGTCATAGACCCAGATTTGGTTTGGAGATTGAGAAACCTTTTTGTAAGGCTTGTAA
GGTGGTATATTTGTGACTCTAGAATTAGTAACCACAGAAATGGGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2335, 3947..4057, 12138..12234, 13904..14011, 14528..14913, 19192..19326, 19328..19387, 19390..19394, 19399..19411, 19413..19481, 22037..22222, 25646..25788, 25790..25791, 26157..26158, 26414..26492, 29297..29346, 29859..29916, 32356..32445, 32546..32653, 33614..33804, 34770..34947, 35903..36039, 36582..36751, 37091..37265, 37368..37405, 37509..37607, 37708..37894, 37995..38161, 39652..39821, 40647..40883, 42669..42833, 44629..44787, 44888..44982, 45252..45523, 48746..48948, 49464..49633, 51125..51321, 53306..53417, 53518..53661, 56178..56336, 56437..56520, 57408..57542, 57883..57927, 58012..58165, 58493..58734, 58903..59076, 59715..59851, 59952..60008, 60398..60476, 60642..60938, 62903..62948, 63030..63139, 71824..72031, 72174..72349, 74068..74286, 76690..76885, 80558..80682, 80783..80929, 82852..82929, 83734..84006
1001..2335, 3947..4057, 12138..12234, 13904..14011, 14528..14913, 19192..19326, 19328..19387, 19390..19394, 19399..19411, 19413..19481, 22037..22222, 25646..25788, 25790..25791, 26157..26158, 26414..26492, 29297..29346, 29859..29916, 32356..32445, 32546..32653, 33614..33804, 34770..34947, 35903..36039, 36582..36751, 37091..37265, 37368..37405, 37509..37607, 37708..37894, 37995..38161, 39652..39821, 40647..40883, 42669..42833, 44629..44787, 44888..44982, 45252..45523, 48746..48948, 49464..49633, 51125..51321, 53306..53417, 53518..53661, 56178..56336, 56437..56520, 57408..57542, 57883..57927, 58012..58165, 58493..58734, 58903..59076, 59715..59851, 59952..60008, 60398..60476, 60642..60938, 62903..62948, 63030..63139, 71824..72031, 72174..72349, 74068..74286, 76690..76885, 80558..80682, 80783..80929, 82852..82929, 83734..84003
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved