Dasypus_novemcinctus Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus EIF4A2
Dasypus_novemcinctus
EIF4A2
GeneScaffold_2100
SNORA63, SNORA4
4963..5095, 5273..5406
7952
ATTTCAATAAATTAGTTCATTCTGTACAAACATTTCAAACTCAAAGGCTTTTGAAAAGA
TGACAATATAAACGGAAATCAAAACTCCAAAACGGTGTTGAGCTGTAGATGCCAGAAGCA
TCCATTTAAATTCCTGTGTTACAAAGAAATGTACTCTCCCTTAGCTTATACCCATTACAA
AAGTTTATACTGATTTTTTCAGGCATTTCTTACACCTGGTAGGTTACAATTGTCATTACT
TTTAAAGAGAGCGAGTGAAGACCAGAAGCAACATAGGGAGAATAGAGGCGGCTACTCAGG
AGGGACTAGCAAACGAATTACGCTTTTTTCCCTCGCCCTGCACAATGTACCCATAAATCT
GATTTTCTGGGACACGCTGGGATGGTGACCTTTTTCCTAGCAGGAGTTTCACACTTCGAT
AGCCTGAATGGATGCTAAACACTTGGGCTAAAGGCCAGGAGTCTCTTTATTGCCAAATTA
AATGGCGATGCGAACAGGCGAAATTACCGAGTGCCCTCCGGTGCAAACAAGGCTATCCGA
GGCTCTCCGGCACTTCAAGACCTGCAGCAAAAGCGAACCCCTCCTCGCTCGCCCAAGGGG
AAGGCGGTTCCGCCTCTCCGCCCCGCCCCGCCTCTCCCGGGCCCGCCTTTGCGGCAGGGA
CGCGGAAACCCCGTAGGAGTAGGGCGGGAGGGAAACGCAGTCTCTGACGTTCGCTTGCTG
CAATATTCTTCCGCCGCTCAGCAAAGAGTCCCTATACTTCCCCAGGATTCTGGGATTTCC
AGCGACTCAGAAATATCGAAGAATTACCAAATATGGATTTTTTCATCGACTTGCTCAGGG
TTTTATCTGCGGTAACAGCTGCAGGATCACAGTTTTGTGGCAGATCGACTAGCGACGAGA
AAATTCCTCCGCAATAAACAGGTTCCGGCCGCGAGCCTATAAAAAACGGGTGGCGAGGTA
CTGCTGTCTTTTCAGTCGTGCGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCTGCGG
ATTACAACAGGTATGGCTCTCTTGGCTGGTGGTATTTTGTGGTGAATGTCATATGGCCTC
AGAGGAGGTTGTAATAAATGGTTTGGAGGCGAGAAACTGAGAATTCATGGACGTCTTTTT
AGGGCAACAGTACCCCGTGCCCTTCGAGAACCTTCCATAATGGTTAGTGCCCCGTATTGC
AGGAGACAGGACAAGGGTACGAAAATGGAGTAGTGAAATAGTGCCCTTGCTTTTCCCTCT
CCCAAGGACGTTCTGAAATCTGGGTTCCCACCCACTCCTTTCCGTGGGTAGTAGCGGAAA
CATGTAGTTAAATTAAAGCCGTGGCGCAGCCCGCATTCGTTTCCGTATAACTGGACGCCG
AAGTTTTGTGTGTGGCCAGCGGCGCGAGTTGAGTGCCTGGGCGTTTAGTCGGGAGAGTGG
CGGCGGCGCCCACCCGGGCCTGACAGAAAGCGGGTGGGACTGGACCGGAGTCGAGGGTCC
CAGCGAACCGTTGGCAAAGCCTTTCCCAGGCCTCTGCGCCCGTCAATCACAGGCTTGCGC
AGTGTAAGGGGCGGAGCTCAACGCGTGGAGCTCTCGCGAGAAGCTCCACCGCCCAAACGA
GCGCTTTGCGCTCGGGGCTGGGAAGGGACCGGGGTCCGTGGGGCTTTTGCATGCAGGCGT
CCCCATGCTCCAGTCTTCACGCAGAGGGATGCGGTATTTTTGGTATCCTGCACCCCCAGC
TTTACGCTGATTTTTAGGAAATGTGCATGCGTAGAAGAGGGTAATCTGGGAGGCAGGATC
TTCGTGCTTGTGGGAGGACAGGAGGCGAGCTTAATGTTATGTATAAAAAGACTGTCCCCC
TGAGGTGCGATTGAATTGAAGTCGTTAAGTAAAGGGGTGTTCTCTAACAGCAGTATTCTC
GTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGA
AATATGTGTGGGTTTTTGAAACTCTGCAAAGGTGAGTTAGTTCATCCAATTTACACCTGC
CTTTATTTTTTTTCTTAACAGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGAGCTATTATTCCCTGTATTAAAGGTAAAAGAAAACTCGGGTGTTCCAA
AGTAGTGGATTCACTGTTCTTCCTGCACCTGGACCCTAAAAGGGAAGACTCTTGGGGGCT
AGCACCTATTTTGTATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTG
AAATGAAGAGAATACTCATTGCTGATCACTTAATTGTTCGGGCATAATTCATGTTCCAAA
TGGAATACATGGTGTGAACTAGCGATGGTTTGATGTGGGATCGGTAAATGTGTATCCTAC
TTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACAT
TTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTAT
TGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAAAACTGC
TTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAAACTTTAAAATAGTATAAATTG
GTCCTTTCAGAGCCCTCTTAATTGTCCATGCATGCAGCGAATTTTTCTTGAAAGTTTAAA
TAGGAAGTGGGTGTACAGGTATAGTTAGCAGGCTTGTATTGCAAAGAAACCAATGCATTC
TATTCAGGGTATACTAGATTTGTGCCCATTTTAAAAATTTGAATGCAGTTGTGCAACATG
AAAACTGCAGTGACATGTTATATGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGC
TATGTTTTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAACTTTCCTAATAAAGCAATA
GACTTTGTTAAGGTGCTTTATTAGGGTGAAGATTCAAGTCACAATATCCCTTGAGTAGAT
GTTTTTAAATAAAGTATCAGTAATATGCTGTTAGATGTAATTGCAAAGCTTGTTTCAGTA
TTTATACATCCCTACACATTGAAGAATAAGGTAGGAAATGTTTTAGTTCTTTAATTACCT
AGCTGGTAATTGTGAGGAAATAAAGATCCGAAGTTTGACAAAGCACAAGAATGAGGCAAT
ATTCTAGGAATTTTACCTTAAAACATTTGATAAGTCTGCATTTTAAGCTTGGAAGTAGTT
ATGTGCTGTGCATGCATAAAAAGCTGTTTGGAGACCAGATATTTTACATGCTTTGGAAGT
TAGATGTAGAGGCTGTGATTGGTGGGATAATAATTGAAATATTTGGCTTTTAGATACAAA
AGGTAATTCTGGCTCTTGGAGACTATATGGGAGCAACTTGTCATGCCTGCATTGGTGGAA
CCAATGTTCGAAATGAAATGCAAAAATTGCAGGCAGAAGCACCACATATTGTTGTTGGTA
CACCGGGCAGAGTGTTTGATATGTTGAACAGAAGATACCTTTGTAAGTATTGGCCCTAAT
TATACGTTATTTCTTTTTTGTTAGTATTTGCTAAGTTGGGTGGGCAAAAGCGATTGTAAC
CATAAAGACCTAGGGATGATAGTATGACTTTGTTTTAACAGCTCCAAAATGGATTAAAAT
GTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAAATATATGA
GATTTTCCAAAAATTAAATACAAGTATTCAGGTAAGAGCCTTAATGTAAATCCCTGTTGT
CTAGCTGGTGGCTTTGGTTTATTTTTGCAGAAACTGCTACTATTGTCATTCCCCTGCTTT
TAAAGCCTTACCTAGTTCAGTTCCATAGTAAGGGTCTGAAATGTATGAGTATTTCTGTGA
AAGCTTTTCTACTTACAAGTGTGTCTTCATAGGTAAAAATTTTTTTTTTTTTTTTTTTAA
GGTTGTGTTGCTATCTGCCACAATGCCAACAGATGTGTTGGAAGTGACCAAAAAGTTCAT
GAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACA
GTTCTATATTAATGTTGAAAGAGAGGTAATTTGCTAGTTAAACATGAAACTAGCCAGATT
TCCTTACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGAAACTAAGATTATTTCTTAGT
TTCTGTAATAATGCTAGCAGAGTACACACAAGAAGAAAAGTAACTGCACTAGATTGTAAA
GACTGGGGTGGACCTCTTTCTTAATGTCCAGTGTCCTTTGTCTTAAGATTTGGTGCAATA
TGTCTTTAGGCCGACTTAATAGAATGAATTTCTAAAGAATGCAGTTGGGAAACTAGTGAA
TAACTGCTGTTATTTATTTTTGAAAATTGTAGGAATGGAAGTTGGATACACTTTGTGACT
TGTACGAGACACTGACAATTACCCAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGG
ACTGGCTTACTGAGAAAATGCATGCTAGAGACTTCACAGTTTCTGCACTGGTAAGAGGTG
TTCTAATCTAGTAATGCTAATGGAAATGTCTGTACTTTGATCAAAGCAGGATTTAGACTA
CAATATAGCTGTTCAGTGCTGTGTTGTCGTTCCCCCTGCTAAAAATAAAAGTTGTTTCTT
ATCTATCCCTGTCTGCTGAACTCTTGTAGCAGCCAGGGACGCTTGGTCTCATACACATTG
ATGGAATTAAATATTGACTTGACTGGTGATTCTTGAATTAAGGTTTGTTGATTTGCAGCA
TGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGTTCAGGGTCAAG
CCGCGTTCTGATCACTACTGATTTGTTGGTAAGTCTCATTGCTTTGTTTTAATCTCCCAA
AAGTTATTCAGGGGAAGGTTTTTTAATAACCTTTACCAATTTGGGCTGTTTGGGAGAATA
AAAGGACCACACTCCACAGTGGGCTATTGCACTTAACGTAGCTCACTACTATTCCGTGGC
CTACATTACATAGGTTCCCAGTTGCTTTTTTCAGTTAGGATTTGAACATACACTGTTGTT
TTTCAGGCTCGCGGGATTGATGTGCAACAAGTGTCTCTGGTTATAAACTATGACCTACCT
ACCAATCGTGAAAACTATATTCACAGGTCAGTTGAATGGCACCTTGACATTTCTGTATTT
GAAGTAAATTCATAATGCTTTTTAAATGTGACTTGTCTAAAAGGTAAAGATAACCTCAAG
TCAGGAAATTCATGCTCTAAGAAGATCTAGTAACTTGATAAGATATAAATTAAAATTTAT
ATTTGGGAAGAACTGATGTTAAACAGTGGGAAAACTGGTAAATGCTACCCAAAATGGACT
TCATAGAGATGAGGTTTTAGATCTCTTGGTTTGTGCTTTATTTTTAGTGAGTTGCTCTTG
TCTGTCCATGTGCTTTCTTGGTGGTTGATTCCTCTATAGTTGGGATTTTTCTGGTGTCGT
CTGGTAGCAATTTGATCCCTGGTTTAGTTAAGAGTGGCTTTATCCCTAAATAAATTGAAT
TGTACTTTGTTATGTGATGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGATAGCCGC
AGTTGATGACGAGATGGCGTTCAGAAACGGCGTTGACCTAATTTAGGACGTGGAGTCATA
AACGAAACAACACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTT
GTCATGATTATTTGATATTTAAGTTGCTCCAACCAAGGCATTTTTGCATATTAGCCTGTT
AGGTGATTTGTTTTGTCTGGTTTCTGTCAGGAAGGTAGAGCTGTTTTGGAGGTAAACACG
TTTGAATAATTTTGAGTTACAACGTGTGAGACAAACTGAGCAAAAAAGCAGTGATAAGTT
TGGGTTACCATACCAAATATGTTTTCCCACTGGAAAAAAAAATCAGTAAGTTTTAGATAG
TAGTTAACCTTGTAGCATTTGTATTTACAGTTTACAGTTCCAGAAGTGCGTCGAAGTGGA
TTTACATAACTTCTTTTTGTTTCATCCCTGGTATTTACATCTGTCCCAGGCTGACACCTG
CTCTTGGCTGGCCCACTTTGGTATGGGCTTTAATTCACTACCCCAAACATCTGCTTTATA
AATAATTAATGCTCAAGATACCTGATAAAATCTCATTTTGCAGCCAGACAAGCCTTGTAT
CCTTTTGGCACTAACTGCAAAGTAAGACTTTTTTCTCTATAGATATTTGACGAGCAGCTA
GTGCTCCAATTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCAGCTGATGGTTAAC
AAGTGGATCTTCATTTTCAGTAGTTCATGCAATATTTGAGAAGTAATAAACTGATTGCTG
ATTTTTTATTTTTATTTTTTTAACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAG
GTGTGGCTATTAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGGGACATTGAGACTT
TCTACAATACTACAGTGGAGGAAATGCCAATGAATGTGGCTGACCTTATTTAATTCCTGG
GATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGACCACAACGTGCATT
GTGCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATTACGGATCAGAAATACAG
ATTTTGATAGCAAAGCGACTTTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATC
CTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTT
TCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAAATGTTCTCTATCATTT
AATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAA
ACTAGCATATTTGCCTTTATTGTGTTTGTCATTAGCCTGAATTTAGAAAGGCCTTTAACA
TTTTTTTAGACAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATT
TAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCGATCATATCCTAGGTAGGGTT
AAACCCGGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAAAATAAA
TTGTATATTCACTTTAAAAAGTGTTTTTGGTCATTTTTATTTACAAATCATGAAAACTTC
AGGATCAACAATTCTGACTTAACTGTTGCATCACAGTGGCACAAAGGCTGATCAATTGCA
GGTGTTCATCAGCACCATCTGCTAAGCATTTATCTACTTCCTAGAACAAGAAGAAAAGTA
AATGAGCAAAATGTGCTTAATGTAAATTGAATTAAACTTGACACAACATGCTAAATGTCC
CTACTTACAGCAAGCTTTTCTGTAATAATGGATTTCTGTTTATCAGAAAGGTCAGTGTTT
TCTACAACTATATCATGAAGTTGGTTTACAAGCTGAGTTGCTGCATGGCCATCATTTATC
AAGTTCTGAAACAAAATTTGAGTATAAAAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1928..1973, 2061..2063, 2214..2319, 2471..2494, 2769..2908, 3713..3881, 4001..4110, 4321..4464, 4772..4909, 5158..5247, 5466..5545, 6808..6952
1001..1029, 1928..1973, 2061..2063, 2214..2319, 2471..2494, 2769..2908, 3713..3881, 4001..4110, 4321..4464, 4772..4909, 5158..5247, 5466..5545, 6808..6949
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved