Dasypus_novemcinctus Locus ENSDNOG00000002285
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000002285
Dasypus_novemcinctus
ENSDNOG00000002285
GeneScaffold_385
SNORD70
3132..3221
30993
TAAAACAAATTAAACATCTGTCAGGAAGAGCACAAATGGTAGTACACCCATATAATGCA
GCACCAAGCCGTCTTACACCAGCAATACCAAGAAACTATGCTGTGAATGCTAAAAGTATG
ATTCCTAAAAGTATGCATGTATTTTAAACGTCTTAGAGAATGTATATCCAAATGTTATTA
TATTTCATAGGGTAAAAAGTGCCTCTTTTTTTTCTTTACATTTTAAAATTTCTTACATCT
AGATGTCTTAGTTGATGGTGTTCTTGTTTTAGTAAAATCCATAATGTGAGGATGATCATA
GCAGTAGCAGGATGTTTTTTATTGAAAATGAGCAAATAGTCTTTTGAGAATGTTCTGTGA
ATATGTTGTGTATTACTGATGATTGTGAAAGGACTAGGAGCACTTTAAAGATAGGTTATC
AAAAAAATCATAGCTAGAGCTGAATTCCTTTTGAGTTAATTGTCATGTTGAATCACTGTT
TTGACCAAAACTTTATGCTGGATAAAAAAGAAAATACTTTATTTCAGGGAGAGAAGTATC
TTCCATTACCCTCATTTTGTTTTTGTTTTTTTTTTTTAAATTTCTTTGTCTTTATTTTTT
TTAATGTTACATTAAAAAATATGAGCTCCCCATATGCCCCCTTATCCCCCTCACCCCACT
CTTCCCATAACAACCTCCTCCATCATCATGGGACATTCATTGTACTTGGTGAATACATCT
CTGAGCACTGCTGCACCATGTGGTCAGTGGTTCACATTATAGTTTACATTCTCCCCTAGT
CCACCCAGTGGGCCATGGGAGGACATACAATGTCCAGTAACTCCCTGCAGTACCACCCAG
GACAACTCCCAAGTCCTGAAAATGCCCCCACATCACATCTCTTCCTCCTACTCCCCACCC
TCCATCACCCTCATTTTGCATCTACATTTGTACCTGAAGAGTGTAGTTACATATACCTAT
TCTGGGACATTTAAATAAATTTATTCAAATATTTATTCCAGGTTCTAAATGAGAAGAAAC
TTCAAGAGGTCGATAGTCTGTGGAAAGAATTTGAAACTCCAGAGAAAGCAAATAAAATGT
AAGTAATCTTGAAACAAGTTTTAGCAGTAAATACTTAGGTTGGTTTGTTTATTTTTTTAG
GATTTATTTTTATTTATCTCTCTCCCCTCCCCCCGCCTCAGTTGTCTGTTCTCTATGTCT
AGTCGCTGTCTGTTCTTCTGTGTCTGCTTGTATTCTTGTCAGTAGCACCTGGAAACTGTG
TCTCTTTTTGTTGCGTCACCTCCTGGGCAGGCTGAACTTTCTTTCGTGCTGGGCGGCTCT
CCTTATGGGGTGCACTCCTTGTGTGTGAGGCTCCCCTATGTGGGGGATACCCCTACGTGG
CAGGGCAGTCCTTGTGCGCATCAGCACTGTGCATGGGCCAACTGCGCACAGGTCAAGGAG
GCCCTGGGTTTGAACCGTGGACCTCCCATGTGGTAGGTGGACGCTCTAACCATTGAACCA
AGTCCTCTTCCCTGTATTTAGGTTTATTTTTTAACAATGTTCCTTCTGACCTGTATAATG
TTGTATTTGTAATTATTATTAGTTTTTGAAATCTGGTTCAACCCAGATTAATGTAACCCT
AATTATTACAGATGTTTAAACTTTAGTTTCCCTAAGTTAGTGATATTCAAATGTGTTTGA
ACTTGTTCATAGCTCATTCATTCTTTTTATGACTTTCACTTCCCAGGTCCTCTGGAGTAA
TTAAAAAACTAATTAGTAAAGCCTCTAAAGATAAACCTGAGGCTCCCAATATCTCTGAAT
GACAAAGTAGATAAAGTAGGACTTTGGTACTCAGCCTAAGGAATGAGAACTGGCTTTTCC
TCAGGATTTAGAGTCAAGATGACATTTCACCATCTGTGAATCATTTGTGAAATAGACTGT
TTTGTGAATGTGGTCTTTAGCAGAACTTGATTGATTGTCTTGATCCCTGTGGATTTGGAG
GAGTCTGTGTGCAGTTATGTCTGTGGATGCCAAAAGGGCATTTGGTAAATTCATCTGCTC
TTTTTAAAAAAAAAAAAAATTATTTTATTTAATTTATCCCCCCTTCCCACCCACCCCCAC
CGTTGTTTGAGCCCACTGTCTGCTCTCTGTCCATTTGTTATGTGCTCTGGTCTGGTTGAT
CTCTTTAGCAGGCATCAGGAATCCAACCTGGGACCTCCCATGTGAGAGAGAGTCACTCAG
TCTCTTGAGCCACCTCAGCTCCCTGCTTTGTTGTGTCTCTCATTGTTTTTCTTCTTTGTC
TCTTCATTGCATCATTTTGTTGCATCATCTCCTGGAGACTTCCCATGTGGTAGGTGGAGC
TCAACCACTTGAGCCACATCCACTTCCCTCATCTGCTCTTGCTAATAAAAACTCTCAGAA
TAGAAGAGAACTACTTAAGCTTGTTAAAGAGTGTTACCCCCAGAGAAACAGCATATTAAA
CAATTAGATAAACTAAATATAGAGATGATTGTTGTTGTTTTTCTGGTGGCCAAAACCCCA
ATTTGAATTTGAAATAGCTTAAATGTCCATCAGTAGTGGAATGGTTGAAAAAATGTACTA
ACATCTGTACATTTCTTGTTGGACCATGAAGTACTGAGAAAACCAAGTTTCAGAGTAGTT
TATGTAATGTGATCCCCTTTTTGCAGTGTCCTTATATGTCAGTATATGCATTTACATGAG
TACAGAGAGATACGAACAAATATCTCCTCAGAAGGGTGGAATAAGGTGAAATTATTACTT
TTTTCTAAATCTTTGCATTGTCAAGTATGTATCATAAAGACCACCAGGCTATTCCTGATG
AGGTAAGAAAACTTTGCTCAAGATACATGATTTAAGGCCCGATGGAAGAATATTTTTCTT
TTTCTTTTTTCTTTTTTTTAGGAGGTACCAGGGATTGAACCCAGGACCTTGTACATGGGA
ACTAGGTGCTCAACCACTGAGCTACATCTACTCTCCAATGAGAATTGGTTTTTTTCATTT
GTTTGTTTTGTTTTTAGGAGGTACTGGAGATGGAACCTGGAACCTCATACATAGGAAGTA
GGCGCTTAACCACTTGAGCTACATCTGCTCCCTGTTTTTCATTTTTTGCTTCACTGGGCT
GAATTAACCTGATTCATTGTGGGTCAATGATGTATTCTTGTTGGAACTGAATCTAAGTGA
TCTAACTTAAAGATTCGTCACTATCACTGAGACAACGATGAATTAAACTATATGTGATTG
TTTTAAAATAAAATTCATGTTTCCTAAAACCTTGGAACATAAAGTGTACAGAGGAGAAAA
GGATATAAATTAGGGGTAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGATAAAATTTGGGGCCAGTCTAAATTACGGTGCAATAGAGGGACTGCTAGGG
GATGCTGAAAAGTGGCTCCAAGGAGTAGAAGTGGCTCAAGCAGTTGGGTGCTCACCTCAT
ACATTGAAGGTCCTGGGTTCGGGTTCTGGTGCCTCCTGAAAAGAGCAGAGGCAAGCATCC
AGCAAAGCAGGTGAAACCAAGGGAAGCCAATGTGGCTTGGTATTTGGGCATCAGCTTTCC
CACATAGGAGGTCCCAGGTTCTAATCCCTAGTCCCCAGTACCTCAATAAATAAATAGGAC
TTAACAACCAAAAGTGAAGGCAGAGACAAGTAAAGACTTCTCCTTATCTCTGCTATCATC
CCTTTGTTCCAGCCTTTAAAAGTACATATTATGAAGAGTAAACTTTTCAATAAAGAGTTT
TTTGTAAATAGTAATAAATCTAGAATATGATCTTTTTTACTTTTAAGAAGTTAAGTTTAA
ATAAGGGTGAAAACTAGGTTGAACTATAAAAGTAGGTAAAATGAAAGATTGAGAAAAGGA
AGAAGTTGAATAAAATTACTTTTTAATTGTAAAAGAGGATTAGAAATGTAAAAAGAAAGA
CTTATTAGAAAGGAAGATATAAGAATCAATACTGTACAAGATATAAAAGGTTAAAACTCA
ACAATAGTAGCTTGAATCCTAGTTTCTCAGTATAGAGACCCCTGCAAGGGCTGGGTAGTA
GCCAGAATTGTTTTGTCCTCACTTCTAATTATCAGATGGACTGCTAATTCAAATGGAGAT
GGCATCAGGAGGGAGGAGCAAGTACCTGACTGCCTTGAGTTTGAAATTGACAGACCTTCT
TTCCTGCTGGGCATGCTTTAGCCTCAACCAAAAGCCAAATATCAGAAGTGTTACTCCACA
AAGCTCCCAAAGATGGAGGTGCAGGACTAAGAAAGGATAAAAGTTAAAAAGTGGCAGATT
TAGAACTTGTCAGAAATGAAAGCTGTCCCTGGAATCAGATAGGCTACCTTGAGAGTAATA
CATTCTCACTGGAGGTTTATAAGCAGAGGTCTGATGACATATCTGGATCAGGGATTAGCT
AAAATAAGGCATGAAAAGGTTTCTTAGCCGTGCTTAATACTGTGGCAGAGCCTACAAATT
GATTGCACCCCTTTTTACCAAAGTCTTCACATGATTTTAGGATATTCCACAATCCAGAAT
GTAAATCAATCAATCAGAAATTACTTAGAAGAGTAAATCAATTTGTCATCCCCAAATAAT
CTAGCCCTGAATTAAGAGAAGAGTCATGTGACACAGGAAAGGTACTTTGGACATGGCTTA
ACTACTGGCTGTGGAGCAGAAATAAGAGTAATTGTTGATGATCAAATGCAATTGTGAAAA
GCAGAACTCGTAAAACATTTTTCTGTTCATTATTTTACTTTAGAAGTAAATGTTTAATAT
GTTTCTTTGGAAAAAAAAATTTTTTTTTTTTAATAAAAATTTTAAAGACTTTAATTTCTC
ACTGTTAAAAATTTCAGAGTTAACTGACTTACTTTTGGTTTTCTTTTCCCTGAAAAGCAT
TCACAGCTCTCATGGAGGGCAAAATCAATAAGCAGCTAAAGAAAGTTCTGAAGAAAATAG
TAAAAGAAGCGCATGAACCCCTGGCTGTAGCCGATGCTAAACTGGGAGGGGTCATAAAGG
TAAATCATGATTTTCTTTGATGCTTGTTAGTTAGGGCTTATAATAAGCTAAATTAAAATT
AAGTTTATTTTTTAAAAAAGTTTGTTAAATATTTAAATTTCATTTCAGTATTTCTATTAC
TGTTAGGTTATAAGGTTTTCTTTGATATTGATCTCTACGTCCCTTCAAGAGCCCACATTT
TGGGAAGTGGACATGGCTCAACTGATAGAGCGTCTGTTTACCATATGGAGGGTCTAGGGT
TTGATCCCCAGGGGCCTCCTGACCCATGTGGTAAGCTAGCTCACACACAGTGCTACCATG
TGCAAGGAGTGCTGTACCACGCAGGGGTGCCCCTGCATAGGAGTGCCCCACGCTCAGGGA
GAGCCGCCCCTCCTGAAAAAAGTACAGCCTGCCCAGGAGTGGCGCTGAACACAGAGAGCT
TATGCAGCGAGATGACACAACAAAAAAAAGAGATGCATTTTCCCAGTGCCTCCACATAAT
ACAAGCAGACACAGCAAATGGACACGAGATCGGGGGGTGGGGAAGAAATAAATAAAGTAA
ATCTTTAAAAAAAACCACACATTTTATTTCCTTTTTTTCCTCTTAGAAATCTTAAATTTT
AACATTTTAATTCAGCCTTCTAGGAATTGAGCATCATTCCAATTTTTGTTTCTAGTCGAG
CTGTGTGTGTATACATCCGTGTTTGTGTTTGTATGTGTATATGTTATGCACAAAAGCATG
ACAGCCTGTGAAAAGGTGTAATAAACAGTACCAGTACTGCTTTGAATGGGTTTATATGCA
CATGGTGTAAACATGCAAAGAACAGGCACCCAAAAGGTTGTTACTGCTGAATGGTAGGAT
TATTGTCCTTAAGCATATAATGCAATGTATGCAGTTTTGCATGCCATGAGCCAGAACTGA
ATAAAAAAGTTGTCAGTTATACTGCAAAGTGAAAAAAAATGGTGTGCAGAACAAAGTTTA
TTATATTTATGTAAGATGGATGGAGATTTAGACTATTTTTAAAGATGCATATGTAGGTGC
ATAAATATCAATACATTAATTATTTGGGAATGTTCATGGGGTGATAATATTAATAGCTAT
TTGTGTGTAGGGAGAGAACCTAAGGCTTAGAACTTTTACTTTTCATTCAGTCCCTTTCTA
TACAGTACTATTGATTAAAATTCTAGTGTACGTTATACTTTTGCAGTTTTAAAAAGAAAT
TAATTAGTGTATGGTAGTAAAAGATATCCATGAGCCGGGGCAGCGGACTTGGCCCAGTGG
TTAGGGTGTCCGTCTACCATATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCC
GTGTGGAGCTGGCCCATGCGCAGCGCTGATGCGCACAAGGAGTGCCATGCCACGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAGATATC
CATGAGCCAACAAATGAGAATGATAAGAGTAGTCGCATAGTGTTTCATCTTTTTACAGCT
TTTGATTAATATAGCCAAGCTGCCTTCCCAGGAACTTGTGCCACCAATAATATACAAAAA
TGCTCTTCCCTAAAATACAACTAGAAAACTATATACTTTTTATCAAATCAATAAATGTTA
TATTTAAATCAATGCTATTTTAATATTTAAATTGTTTCAGGGAAGCTTTTCTTTCCTTTA
TTTAAAACATCCGTTCTTTGTTTTTAAAGGAAAAGCTGAATCTCAGTTGTATCCATAGCC
CTGTTGTTAATGAACTTATGAGAGGAATCCGTTCACAGATGGATGGATTAATCCCTGGAG
TAGAACCACGTGAAATGACAGCTATGTGTCTTGGATTGGCCCATAGGTGAGATTTGCTGA
AAAGTAAAATCAGCTTATTTTTATCTTTTGAACACTTATATAGGACTGTTCTACACACAT
TACACATACTAATTTATTCCTCTTAGCAACCTTTTGCATAAGGTGGTAGTATTGTCCTCA
TTTTACAGGTGAAGAAACTGACACCAAAGATTAATGCAACTGGTAAGTGGTGAAATCAGG
ATTTGAATCCAGGCAGTCTGACTCCAATGCCTTGGCTCTACACCTCATCACAGGAATTCT
CTTATCCTCCAGCATTGGATTCCACATCCTCGGCTTTCTCTTCTCCTAAGTCACTCCTCA
CTCCTCCATCTACCTGTCAGCCCCCAAAATTCTCATCTGTTACGGTTTCCTCTTCTTTGT
ATGTGTTGATTCTTTTACTCTGGTTTTTATTGAGCTGTTAGAATGAGGCAAAAAAGCATG
ATACCCTACCATGTTTTAACCAGAGGTCCCCTAGAACAGGCATTTTTGCTGTTCTGATAC
ATGTGCTCCTAAAAAATGTGACATTCTATGAAATTGTATACTAAAAATAACAGGGTTTAT
AAGAAACAACAATATTTAATAAAAACCTATGCAGCTTTGTAACCAGAGATTAAAAACAAC
AAACCTGGGAAGCAAATGTGGCTCAAGCAATTGGGATCCCATCTACCATATGGAGGTCCA
GGATTTGATTCCTGGGGCCTCCTGGTGAAGGCAAGCTTGGCCCACATGGAGTGCTGGCCC
AAGCAGAGAGCTGGCATAGCAAGATGATGCAAGGAAAAGAGACACTAAGAAGAGACAATA
AGAGAGCAGCAGACCAGGGAGTTGAGGCGGCACAAGAGATTAAGCACGTCTCTCCCACTC
TGGATGGTCCCAGTGCCGCCTGACAAGACAAGCAAACACAGAATGCACAGCAAATGGACA
CAGAGCATACAACGGGGAATGAATAAATCTTTAAAAACAAAACAAAAACAATTTAACACA
GTTAAAAAGACATGTAAAAAAGGTCTGTCTAACCACAAAAAGGTTTCCGTAGTTTGGAAG
GGTTGAAACTGACAAGCAAAGTGTACAGGGATCAGGAAGAACCTTGCAACAAATGTTACC
CGGAGAAAACAAATAGCTAAAACTGATTGTGGAATAAGTGGGCATTGTTTGCAGCAGTGA
TTTTCAACAAAGGACAGTATTGTCCCTTAGGGAATCTTTAGCAACATCTGGAAACATTTT
TGGTTGTTACAACTCAGACAGCATGCTACTAACATCTAGTGGGTAGATGCCAGGGACACT
TCTAAACATCCTACAATGCATTGGACAGTCCCCTACACAAAGAATTTGTCAGATCTAAAA
TCAATAGTTGCAGGGTTAAGAAATCCTTCATGTACAGTATTGTTCCTCCACAGCTTTCTA
TTTCCAGTTGTAAGGTTCTATGTTCTTTCTTGGTGGTATAAAGCATTAATGTGCTGTAGG
AAAAATCACGAACCAGTATGACTTTTGTACTTCATTGGCATCGTTATCCTATTAGTAAGA
AATACATGTTACAGAAATAACAGGTTTTAACAGATTTTAACAGGAAGTTTTTTTAATGTA
TATTTTAATCGTGCATAGTGTATTGCTGTTCAACTGATTTTCCTACTTTGGAAAAAAAAA
CATTGCAGTTCTGAAGATATTAATTTGGGTTAAAAGATTGTTAAAGACGTTAATTTAAAG
GCATTTCCTAGATGCTATCTTAAAAATTTGTTATTTCCCCCCTTCTCCACAGTCTTTCTC
GATATCGGTTGAAATTTAGCGCTGATAAAGTGGACACAATGATTGTTCAGGCAATTTGTA
AGTATAGTTAAAGTCTACTCTATATTCCTCATGGTTTTTTCCTACTGTTGAAAACTGTAT
TGGTTCTATTTATTGAAAAAGAGAAAGGAGATGAGGTAGAACTTTTAGTAAAATAGATAA
ATGGGAAAGCACAGAACATAAAAGGAAAATTTTGGTTACTTGGAGAAGATGTGAATCACA
CTTAACATTGTGTAAATGAATTCATTTGTTTTTTTTTCCTATGAAAAATGTTAAAGCCAT
ATGTGGGATCTCTATAGTTTTATATTCTGCCTTTACCTACTTGTCTTTATAATAACCTGT
CATTAAACATTTTTTTAAAGTATAAAAGACAAAACAATTTTCACTTTAAAAAATCCCTTT
AAGTTGTTTTCATTTTAATTGATTGCAGCCTTGTTAGATGACTTGGATAAAGAACTAAAC
AACTACATTATGCGTTGTAGAGAATGGTATGGCTGGCATTTCCCTGAACTAGGAAAAATT
ATTTCAGATAATTTGACATACTGCAAATGTTTGCAGAAAGTTGGTAAGTAACTTGCTTAT
TCTTTAAGGCACTGAAAATAATGATTTATTTGCATCCTAAAACATGATTTATAGTAAAAA
AAAGTTCTTTCTGATGTGGGTCTCAGGACTGTAAGTTGGTGGATTCCATTTGTGTGTGCT
GACCTCTCACATCTGAAATTTTTTGGGGATGGAGACTAGAATATATTTTTTAAAAGCTCT
GCAGGGGTTTAAACTTGGACAGCATCGTTTATTAATATTTGTTAGATTTCCGAAACCAAG
AAATTTAACTTTGTGGGGGGCCATGGGGCAGCCAAGAATATGGCTAATTTGGAATGTCTT
AAAATGGCTTCTTATAGTGCATGCATCTTGTAGTTAATTTGCTATTAATTGGGATAACTG
TAGACTTGGGAGATCCTGTAATATGCTAATAATATTTAATTATTAGTATCTATACTATTA
GTGTTATATTGTATACTTATAGTGTAGTAAAAATATTTTAAAAGGTACATGAGGATTGCA
AATAAACATGGATTACTTGACTCGTTATTGGTGTTATGTCATCATAATACTACCCCAAGA
ATTCCTGGCCCTGTCTTGTTTGCTTCATTATAACCATAACTACAAATTTTATCTCTAAAA
TCAAGCCTCACCATAGGTAAAGCTACTAGGTCAAACTTTTTTACTCTTTGTTTTGTTCAC
CCTTGTCATTGGCTTATCTCTACTTTTTCTTTTGACCAGTTGGTGGGATTTTATATAATT
TGTTGAAGAGTGATTCTCCTTTATCCTCTGCAAACTTTCTGTAGGTGATAGGAAGAACTA
TGCCTCTGCTAAACTTTCTGAATTATTGCCAGAAGATATTGAGGCAGAAGTGAAAGCAGC
TGCAGAGATATCTATGGGAACAGAAGTTTCAGAAGAAGATATTTGCAATATTCTGCATCT
CTGTACCCAGGTAAATTGATACACATAAAGTAGTGGTGTAATATTACTTTTCTGATGGCA
ATGATGATTTTTTTAACTTGCTCACCTGATATGCACATATGAGGGTGTATAGTCACTACC
TCATCTGATGCCATCTTCATTTTTATATTTAAGGTGGAGAATAGATGCTAAAAACAAAGT
TAGATAAGTACTATTTAAATAATTATTTATATTATTAGCATTGTCTGAATAAGGAATTAT
CAAAATTGCAATAAGAAATCATAAATACAGCTTGACTTGTTTAGTTCTGAGTGTTCTAAT
GTTTTTTCTCTGGTTTGGAGATAGATATACAAGAATCAAAGAGAAGATAAGACAAATGTC
TAGCTCTTGGAGTTTTAAAAAAATATAATAATACTGACATGTTAATTTCAGGCAGTGTAG
TAGTTAAATCAGCCCTGTGAAGGAAGGTACTTAACCTCCATGTTATAAGAAACTGAAGTT
AGTCCAGGGTCACATAGCTGCTCTGTGATAATTCAGGATTTCAGTGTTTTAGACAGGTGT
CATTTTTATATTCTTACCTTTTAAGGTTTTTGTGGTTTATTCATTTTGTTCTTTATACTA
GGTGATTGAAATCTCAGAATACAGAACCCAGCTCTATGAATATCTACAAAATCGAATGAT
GGCCATTGCACCTAATGTTACAGTCATGGTTGGGGAATTAGTTGGAGCACGGCTTATTGC
TCATGCAGGTGATGGTTTTAATGTAATTCACAAACAGGATCTTGAGAAAACATAGGTTTT
TTTCTTTAAACTGAACATTAAAGAAATATTCAGTAATAAAAAGAGGTACATATCATGTGT
CTGAGGACTAAGGGCCAAGTGTTCAATGATGATTTTTATTTGTGTGCCTTACTTCTTGTT
GGATAATGAAGGCATCTTTAGTCACTACCTCTTCTGAGACACTTGTGGTCCATTGTCAAG
CTTATGTTTGATTAAAATGATCAAGTGAGGGAAGCGGATGTGGCTCAATCAGTTGGGTTC
CCATCTACCATATAGGAGGTCCAGGGTTCAATGCCTAGGGCCTCCTGGTGAAGGCAAGCT
GGCCTGCACAGAGTGCTGCCCCATGCAGGAGTGCTGGCACAGCAAGGTGATGTAACGAGT
GGAGACACAGAGAAGAGATAATAAGAGATGCAGCCGATCAGGGAGCTGAGGTGGCACAAG
AATGGACATAGATCTTTTAACAACAAAAAAAAATGGTCAAGTGAATACAAAAGTATGAAA
TCAGTTAATATTTCATAATAATAAAAACTCAGGGAAGTGGCTATAGCTCAAGCTCCACAG
GTTTGATCCCGGGACCTCCTGGTGAAAAAAAGGAAAAGTATCCCAGACCTGCACAGCACG
ACGCACCAAAAAGATGACAACCAGGCGGCGGACTTTGCCCAGTGGTTAGCGCGTCCGTCT
ACCACATGGGAGGTCCGCACTTCAAACCCCGGGCCTCCTTGACCCGTGTGCAGCTGGCCC
ACACGCAGTGCCAATGCGCGCAAGGAGTGCCGTGCCACGCAGGGGTGTGTCCCCCTCGTA
GGGGAGCCCCATGCGCAAGGAATGCACCCCATAAGGAGAGCTGCCCAGGAATGGTGCCCT
GCACATGGAGAAATGACACAACAAAAAGAAACACAGATTCCCGTGCCACTGACAACAATA
GAAGCAGACAAAGACGACACAGCATATAGACACAGAACAGACAACGGGGGGTGAGGTGGT
GAAGGGAGAGAAATTTTTTTTTTAAAGATTTATTTTTATTTATTTAATTCCCCTCCCCTC
CCCCGGTTGTCTGTTTTCTGTGTCTTTTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTTTT
GTCGTCAGCGGCACGGGAAGTGTGGGCGGCGCCATTCCTCGGCAGGCTGCTCCCTCCTTC
GCGCTGGGCGGCTCTCCTTATGGGTGCACTCCTTGCGCGTGGGGCTCCCCTACGCGGGGG
ACACCCCTGTGTAGCATGGCACTCCTTGCGTGCATCAGCACTGCGCATGGGCCAGCGCCA
CACGGGTCAAGGAGGCCCGGGGCTTGAACCGCGGACCTCCCATGTGGTAGACGGATGCCC
TAACCACTGGGTCAAAGTCCATTTCCCTAAATCTTTTTTTTAAAAAAAGATGACAACCAG
ATAAAAACAAAAACAAAAAACTAATCAGATTAAGATTTGAATAGTTTTAAGAAACTGCTA
CAAGTGATGTATATATATCCTTTATTAAGAACCTCAATTTCATTATTAAATGTGCTATTT
TAATGTATTTGACTTTCAAATATGTTTCAGATTAACTCATTTCTGTATATGGTGTATATT
GTATATGGTGATATTGTAAATAACAGTATGATACAATAATTGAAAAGTTAACTAGAGTGA
ATTTAAAGTATATTTATGCACTAAAATCTTAACATTAGAATAGCTCCTTCAGATGCCATT
ATTAATCAGACAAACATTCCATTGAAATACAGTCAGTTTCAAGGTCAGAATCTTTTGGAC
TAGTTTCATTGTCTTTACCAAACTTTCGTAGGTATAGCTAAACTTGGAGCAGTTAAGAAA
TGGGGATTAAAAGAAGTGTTTTGCAGTAGCTTGGTAACTAGTTTTAGGCAGATCTTATTC
ATCTGTGTCTTGAAACAGCAGGATTATTTTTTTTTTAATTTCTCTCCCCTTCTCCCTCCA
TTGTCTGCTCTCTGTGTCCATTTGCTGTGTTCGTCTGTGTCTGCTTGTATTCTTGTCAGT
GGCACCAGGAATCTGTGTCTCTTTTTTGTTGCGTCATCTTGCTGCGTCAGCTCTCCATTT
GTACGGCGCCACTCCTGGGTGAGCTGCACTTTTTTCACGCGGGGTGGCTCTCCTTACGGG
GCAAACTCTTTGCACTTGGGACGTCCTTATGTAGAGGACACACCTGCATGGCAGGGCACT
TCTTGCACACATCAGCATTGCGCATGGGCCAGCTTACCACACATGTCAGGAGGCCTTGGA
TTTGAACCTTGGACCTCCCATGTGGTAGGCAGTTGCTCTATCAGTTGAGCTAAATCTGCT
TACCCTAATAAGTTTCTATTTATTTTTGCGTAGCTTCTTAAAAAAGCAATAAATTGACTT
TCAAAATCTCGGAAAATGAGAATAGATTAGATTGGTGTGTGTGAAATACATGCTTACATG
TTTCTATCACTCCTATAGTATACTAAAGGAATACTACCATGCCTCAGATGGGTAAGTTAA
TAAGGTTAACCTTCCAATTTGTCGTAGGAATTCATCACAGTTTCCTTATTCGTTAGCTCA
TTTGTGGAACCACAAATGCTAAAGCATCAGAATTTTTTTTAAGAATTGTTTCAGGCTGCT
AAATGGCAGCACCCTAGGAATGACTCTATATTGTATCAGATTTTTATTTACACTACTGGG
TTTGATGCTTACATACCTAGAAGGGCATTTTTTAAAACTACTTTTTTTCTTTTGTAGGTT
CTCTCTTGAATTTGGCCAAGCATGCCGCGTCTACAGTTCAGATTCTTGGAGCAGAAAAGG
CACTCTTCAGAGCCCTCAAGTCTAGACGGGATACCCCTAAGTATGGTCTCATTTATCATG
CTTCACTTGTAGGACAGACAAGTCCCAAACACAAGGGAAAAGTGAGTTAAAATTGTTTTC
CTAAGGTGTGTGTAGGACTTTTTTCCTTTTTCCCCCAACAACTCATTTTCCTCCTTACCC
ATTATGTTAGTAAATCTTTCTCTTGTCTCTTTTTCATTAAATGGAGAAAAGTGAATTCTT
TAAATAAAAGGCACTTTCCTATACTGAAAGAAAAAGAACAAATTATATTTGGCCCTATTA
AAGCCATTTTCTTTTGCTAATTGAAAGGTTATGTAAATTCTGAGATAAACCCTTGTTGGG
GGAGAGTGCTCATGGAGGATTAAAATCTGCATAATCTGAAAATCATCAAGAAACCTTTAA
ATACATTTTAGGACATCCATACCAGTGTTTGCCAATAATAATAGTGTTTGCTTGCATTTA
TTTGGAATCTGCTTGTCGGTAGGGGTTAGGGTGGGTAGCACACTATAAGTATTCTGTGTG
ACAGGAACTATATGATTTAACATCAACATTTAATAAAATACATGTAATACATGTACTGTG
CTGAACACTTTATAACACGGGTTCTTAACCTTTGTTCCACAGGCCCCATACTATACTGCA
CATTACTTAATAAATACATTTCAGCTGCACCAACATCCCCACAAGAATGATGTGGTTTTT
TTTTTTTTTAATTTCAATTCGAGCTCATAGACTTCTTGTTAAGAACCCCTGCTTTAACAA
TCTTTTTGATAGTCCTTTGAAATCTAGGTGTCTTCTTTTGTAAATGAGGAAACAAATTCA
GACAGAGTAATTCCATTTTTTTTTAGGGTGCAAAACTTATAGAACCAAACTAAAATTTAA
GAAAATTCAGGCCAGAATACTGGAAGAAACGAGGGGATCAATAAAATAAAATACTAAATA
GTTCGGGGAAAGACCCACAAATAATTGAAAAACTTTTGAGAAAGAAGGACTACACACTCG
TTCTGGATGACTTTTAAGAGTCATTGAGTAGAAACAAAAGGGGAGGAAGGCATTGGAAGA
ACAGTGTCACCTAGTTTTAGATATGAGCTGCTACAATATCTTACCCAGAAGGTGATGGAG
GTGATATATACCCAGTTGGCCATTACAGTATGGAAACGATTCAAGCATAAGATGGATGCC
TTAAGTTACATGATTCATAATACTTTCGTAATTTTGATTTTAAGAATATCTCAGAGTGAA
GGATATGCTGATGTTTTGCTATAATTTTCTAATGAAAATAAATTATTGGGAGGTGTTTAT
ATCTCGTCAGTATATGGTTTATGAATGCCTTTAATTTCATGTTCTCTATTAGATTTCTCG
AATGCTGGCAGCCAAAACTGTTTTGGCCATCCGTTATGATGCTTTTGGTGAGGATTCTAG
TTCTGCAATGGGAGTTGAGAATAGAGCCAAATTAGAGGCCAGGTTGAGGACCTTGGAGGA
CAGAGGGGTAAGCACTACATCTTACCTATTTGTAGGTCTTTATAATATAAAAATTACTTA
ATTTATTCTGATTATATTTATTTTTAAAAATTAGCTAATTTTAAAGAACTAATGTGAAAG
TGTTTATTGCAAATGTTTAAAAAATAAAAATAATCATTGGTTTTTCAGTTTGTATCCTCT
CTTAAGTGAATTACAGAGGACTCTACTGTGCACACAGATCAGCTGCTTTTTCAGTTTATA
AATATTAAAAGTAACTATTTCATTAATCATTCCATTTTAAAAATTTTATTTCGTTTAGCA
TATGCCTCATAAACTATGAGTAGTTTTATGTACCTAGTCATTTCAGCTGCTAAAGTTTTT
GTAATAAGATATATTTTAGTAGGTTTTAATATAGTCTTTCTGTGCCTGCTATGGGCATTT
TGTGTATTTACCAAAAATAGATATCTTTAACAGTGTTTGCCATTAAAATATGCTATTCAA
AGTAAACAGAAAGAAAATTATCAGGTATTGCTTGTTGGACTATATATTTTTATTATATTA
TACTTACTCGCTATTCTTGCTTTTATTAGACTACATTTTAAAAAATAATATGGCTTAGAA
TTTTATTAGTAATTTTTCTTTTCTTAGATAAGAAAAATAAGTGGAACAGGAAAGGCATTA
GCAAAAACAGAAAAATACGAACATAAAAGGTGAGTAACATTGGAAGGCGAGGATACCATA
AACTCTTACTGCTTATCTAAATGTTAATTATTGGCAGCAACTTTTTTTTCTCTTTTTTTT
TTTAAGATTTATTTTATTTATTTATTCCTTTCCCCTCGTTTGAGCCTGGTGTCTACTCTG
TGTCCATTTGCTGTGTGCTCTGAATGTCTCTTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGGGAGAAAGGCATTCAATGGCTTGAGCCACTTCAGCTCCTGCTTTG
TTTTCTCTCTCATTGTGTTTCCCCTTTGTGTTCTCCTTTGTTGTGTCAGCTTGCCCCGCC
AGGTCATCATGCCAGCTTGCTGTCTTGCTTGTCCTCTCCAGGAGGCACTGGAAACCGAAC
CTAGGACCTCCCATGTGGTAGATGGGAGCCCAATTGTTTGAGCCACATCTGCTTCTCAGG
CAACTTTTTATTATAAATTTTAACTGCCTGAATATCCTTCTGATATTTTTCTTTGCCATT
TACAGTTTTCTGTATTCACTTCTAGTTTTTAATTATATATACTTACTTTTCATTGTTGTA
ATAAGTACATATAATGTAATGTGCTTGACTTTTATCCCCTTTTTAATATTTAACTTATTT
CCAGGTTTTATAGTAAATATTTGTCTTTCAAAGTTCTTTATGTATGCCATTTTTCCAAAA
AAAAAAAGAATTTGTAGTTAATCCATACTCAAACCTATAAAAAAGTCAAATGACTGGAGA
CAGGTATAAAAATGGTTATTAGAACTATAAAGTATTCAGACTTCATCATAAAATTGACAG
AAGATTTGCATGCAGAAAGGTGGTTTGGTTATTATTTGAGGTATTACTGGTATACTTGTG
TACTGAGGAGGTTGTGATCAGATGCACATTCTAGATTATACACCTTTTCTGGGAATCAGT
TTGACATTGTGTACTAAGAACCTTAAAAATGTTCCTAGTCTTTGACTCAGTAAATCCTAC
TTTTAGGAATTTTCTAGTATTAGGATGTAATTACAGAAATTTAAGCAAAGGTGTAGATAG
AAAGGTACTCCATTATGTAATATATAATATTAGTCCTTTAAGAATTTTAATAGTAAAATC
TTATGCTATTGGGGGCCAAAAAGCATGTACATTAACATCTCAACTATTACTATATATGTA
CATGAATATTTTCTATATTGTGAATTTTCCAAGTTTTCTACAATATTTTTTTTCTGTGAT
TTTAAAAAAAAATCTGTATAATTTGGTGCACTTATTTGACAGCTGAGGATCTTTTTTAAA
TTATAAATGTTTTAACTAGCCATGCTAATAAGCTTAAGAAATAGAGCAATTTAAACACAA
TGCACTTCAAGCACTAAGTAGTATTAGCTCACACTGCAGGCACTGAGTATTTCCATTTTT
GTTTTCCCGTTATGTTAGAACCAAAATAAACTTTGGGCTTTAGTGAATCGTTAATTTTAT
GTTATCCCCTTTTGTTCCCCTGCCTTTTGGATCTTCTAGTGAAGACTTCTGTATAAAACT
TTATTTTCATTTAAATGTTTTTAAAACTTGAATTGGTTCCAGTTTTATTTTCTAGTATAG
TAAGGTGGTAAAAAGACCAATTTTCCTTTGTGCTGAATGAATATTTTCCTATACCATAGT
AACTCTCCAGATTAGTAAATCAGAATTCATTTAACTCTCTATGAATAATTCATAGTAACT
CTCCAGATTAGTAAATCAGAATTCATTTCTTTTGAGTGTTATTGGCCTACTTGGAAAACA
TTATTAGCTTTACGTTCTAGAAACTGATAGTCTTCATAAACTATCCAAAGCAACTAAAAT
GAAATTGTATTATTTGCTTATATAGTATTACCTAATGGCATTTTCTTTACATCTCCTCTG
AGACTATTTGTAAAGATTTTCTAAAATTCTGGCTTTTTCAGTGAAGTGAAGACTTATGAC
CCTTCTGGTGACTCTACACTGCCAACATGTTCTAAAAAACGCAAGATAGACCAGGTGGAT
AAAGAGGAGGAAACTACTGAAAAGAAAGCCAAAAAAGCCAAAATTAAAATCAAAGGTTGG
TTTGTATTTTTATGTCATTCGTGCTCTTGTTCCTTAAGTACTCCAGACTTCATAAGTCTT
ATAGAAGTACCTGCCTTAGAACTTTCTTGTGGAACCGCCCATATTGAAAGCTAATGGCAT
TTTAATAAGCTGTCTTGTTCTCTGGTTAGGTTTTGTTAAATTTTTTATACAAGTATTTCT
TTATAAGTACTTGGAATTAAGTATTATGCTAAATATGCCAAAAGTTTAGCTTGTACCACA
TCAATATGAAAATTAGAATAGAAGAAAGAAAAATAAGTGATTTTGGTTTCTAAATTGGTT
GTTGAAAATTATTATATAGTTAAGAATGAGTGTAAGTTTAGTGCAGCCATTGCTTTCTTC
ATTGTTTCTGTTACGTGGAATGGACTAGAAGAGTCTAGTGGGTATCCTGCCACCAGTCAT
AATATTTAATAGGTATTCCAACAGTGAGTCAGGTTGCCTTGTAAAAATTCACTAAGTCAT
GCCCTGTTCATTAATTGCACCTATGTTAATTGAGCACCTACCAGCTAGTTTAGAAGAAGG
ATCAAGAAGCAAAGATTGATTTAACTTTTCATATCTAAATAGTTTCATGGTTAAAAGTAT
ACTATTTTTAATGCATGTGGACTCCTACCATTTACTCAGTGGGGAGAATATGAACAAGTT
CTTTAACTCCTGTGAAGTAAAGAAATCCCTAAACCTATCTGAATATTGTGAAGATTAAAT
GATACAAAACCAAGCACAGTGTCTGGCATGTTATTGAACTAGTCTTCAAGTATTAACTGT
ATATAAGAGCCATAAATATGACCATTGTTAGCACTACTAGAAATATTGGATACTATAATT
CTTTCGAGAGGGTAAATATCAGAGAAGCTGAGACCTGAAGAGTGAGAGTTGAGATTGGGG
TGCACAAAATGGAATATTAGAAAGGAATGCAGTTCTAATAAAAGCTACAACATGGATAAG
CCAAACAAGCCAGAAACAAAAAGACAAATAGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1077, 3422..3474, 16737..16858, 18749..18885, 20632..20696, 21088..21222, 22004..22149, 22741..22867, 25617..25780, 27052..27186, 27807..27868, 29861..29993
1001..1077, 3422..3474, 16737..16858, 18749..18885, 20632..20696, 21088..21222, 22004..22149, 22741..22867, 25617..25780, 27052..27186, 27807..27868, 29861..29993
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved