Dasypus_novemcinctus Locus GNL3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus GNL3
Dasypus_novemcinctus
GNL3
GeneScaffold_5765
SNORD19, SNORD69
4023..4099, 6660..6736
10566
AGTATTTATTTCTGCTACTCTTTCTGCTCCTTTCATCTTCCCTGTAACAACAAAACTAT
GCTTCTCAGCAAAAAGTAGTAAGAGTTGGGAAAATACTAAAAGCCTGGAAATGTACAGTG
ACAAAAACCTCCAATCTTTGTGATTTTGCAGGTGAGTGCTGAAATATTTGGCTCCACTGA
TAAAAAACATACGGTCTGAAATAGTCATCTGTAAAGCGTAAAAAAAAAATCAACCACTAG
AAGAATGTGTGTTCGAACCCACAAGAAGCAACAACAAAAATGAGGTCCTCGCCGGCAAAG
GAAAGGAAGGACTTTGCCGACCTGTCACTGGGACGGGGACTGAAGGAAACGTTGACAGCT
TCGACGATATCCCGCGGCGAGCTCTCCGCCAGCCGCCGGGGGCGGGGGAGATGGGCACCG
GGAGTTTCCCGGCCGCGGCGCGCCTTTGTCCAGGTCAGCAGGTGCGGCGAAGCTGCCGGG
CCAGCTCCCGGGCCCGCCGCCGGGCCGCCCCGCCCCGCGCGCCCCGCAGGACCGGCGCGT
CCCCACAGCCGGGGCGGGGCCTCCGCCGCCGCTCCCGCCCGCCGGGGCCCACACAAAGGC
CCGGCAGCCGGCCGAGGGGGAGCGGCCCCGCCCGCCCCGGGCCCGGCCTTACCCAGCCGC
TCCGCCGCCTGCAGACCCGGCCGCGGTCACCGGCCGCCACGCCCCGCCCCGTGGCCGCCA
CGGCTGCTGCTCTTGCTCCTCCCGCCGCGGCCGCCGCCGTCTCTCCCGGCACCCGCCGCC
CTCGCCGCCCTCACCCCTCCCGGCGCCGCCGTAAAGCCAGCCCCGCGGTCGCCAAGCGAG
CCCGGCTCCGCGCGACCCTGCGTGCGCGCGCACGCAGGGGTGGCGGTGGCGCGCTTTACG
GCGGCAGCGTGAGTGCGTGACGTTTGCCTGTGGCCTCATTTCGCACGTGGCGCTGGAGAG
GAGAGGTCGCGGCTGCTGGTGCTGCCGTCCGTACCGCCGCTATGAAGCGGCCGAGTGAGT
GGGGTCTGGGGGCGGGCGGAGGTAGAGAAGTCCCGCTGTCTGCTGGCCGTCGGATCCACC
CGGGTCCCCCGCCTCCACGGCTTGTTCTGTGCCGGAGGAGCGGGTAGGCCGGCCCCTTGT
CCCAAGAGTGGATAGGCCGCTACGTCAATCCCACCGACCTGCGGGCACAATGCGCAGAAG
GAAGGCTGGGCCAGAGGCTCGTGAGGAGCGTCTGAGCGAGGTTTCGGGCCCAGCCTTTCC
CCTTCTGCGGCCACGTGCAGACCGGCCGGGCGGAGTGCTGAGAGTCCATCCCTACCTCGT
CTTGTGATTAGTGGTTTTTGAGCGAAGCGGTTATTATTTTAGTCGAGAACGCTGTAGTGT
ATAGTACCAGTCTAATGTGGGGAGAGTAGGAGAGGCAAGCTTGGGTTCCACTTCGGATCA
GTGAGTCATATTCTTTTAATATTTGAGAGTCACGTATATATTTTTTTCCAGCTGTCTTGA
TAATTCTTAATTTTAGATTTGAGGGGTAATGGCTTAAAATGAAAAGGAACACGACCTCCC
TTAATGCAGTCATCAGAAACTAAACAAACTGATCATATGTGTCTAATCCTTTTGTGATGT
GTTTTTTTTTTGTAGAGTTAAAGAAAGCAAGTAAACGCATGACCTGCCATAAGCGGTATA
AAATCCAAAAAAAGGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGAGTTCTTTGCAACAGAGAAAACACCCACACCATTAATGCTGCTT
TATATATAATTATGCATATTGTTACTATGCCAATTAGAACTGATTTTTCTGGGTCATTTT
GCAGGTATCACTAAATGGCTAGATTGTATTCGCATATGAATTCAAGTAGGAAGATGTTTT
TGGAAAGGCACATCGTGTTTTCAATACCATAGGTACGGGAGCATCATAGAAAATTGAGGA
AGGAAGCCAAAAAACGGGGGACGGAAAGAAACCTAGGAAAAGATCCAGGAGTTCCAAGCA
GTGCTCCCTTCAAGGAGGCTGTTCTTCGAGAAAGCTGAGCTAAGGAAAACAGCAGGTAAG
TTATAGTTGGTGAAATTTTCAGCGACTGTGGGTAAACTTTTTTTATTTTTTTCAAAGCAA
GGTAACATCAAATCACTGTCTTAATCTATTTCTCTTATGACTTGGACACAGCTTGAAGAA
CTAAAACAGCAGCAGAAACTTGACAGACAGAAGGAATTGGAAAAGAAAAGAAAACTTGAA
GCTGACCTTGATGTTAAGCCTTCTAATGGGAGTCCTGTGAAGGAGGTATGATTTAGTCTC
TGTAAATGAAAGGTAGAGTTCTGATATGTAAGTACATAGGCAGGCTGAGGGCTGCTGGGC
CTCTTAAGGAAAAGATTGAGTTAAGGCTCTGACTGATCTGCTTAAAGTATCAATTGCAGT
ACCTTTTAGTCAGCCATGGAAATTAGGAAACAGGCTATAACTGTTGTACTTCTAATTTTG
TGACATTTTCCCTTTGTTTTTATCATCTAGGAATTTGAGCAGCACAAAGCAAAGAAAAAA
GCCAAGTTGGGCAAACAGAATCCAAAGAAGTTATACTGTCAGGAACTTAAAAAGGTATCT
TAGTCTAGGTTAGTGTCTAAAAATGGTAATTAGGTTTAAAAGAAAAGAAGTATTCCTCTT
TCCTGCCCCTGTGACCTTACAAAGGTGGGAGAGTTCCTCAGGAGGTTTTCTTGTCTCCTC
TAAGGTTTTTCCTGTTTACATTTAGCTAAAAGAACTATTTTTTTAATTGGTTTTAAATTT
TTGCAAAGGAGTGTGGTCTAAAAATGACTGTTAGACACACAAACCTTGTATCGACAGTGG
TTTTTAAGGTTGAGGAAAATACTTTGGGGGTAAGCAGTGTTAAAATAAGGGTCTATAGCA
TGCTGTGGATACCTAAGTTAAAGTTAGTCAAGAGGGTATTGTCCTTTGGTGTAAATGCTC
CTCGGCACTGCTATCCCGGACCTGCACTTTACCAAGCTCATTCCTCCCTGTGAGTAGAAC
CTGGTTATGCTTCTCAGCAGCTTGGCAGGCTCACGAAGGCCTAGCAAACTACAGAGGGAG
GAATGTACATTCAGATATTTGGGGGGTGTTTCCACTTGGAAGAGAGGCTGAAGGCTCCTG
TGTAAGCCTGTTTTACTTTTCTTGTGAGATAAGCAAAAAAACATTAGTCAGGGAAGCGGA
TTTCGCCCAATGAATAGGGCGTCTGCCTTCCATATGGGAGGTCCAAGGTTCAAACCCAGG
GCCTCCTGACCCATGTAATGAGCTGGCCCATGCGCAGTGCTGATGTGGGCAAAGAGTGCC
GTGACACGCAGGGGTGTCCCCAGTGCAGGGGAGCCCCACGTGCAAGGAGTGTGCCCCATA
AGGGGAGCTGCCCAGCGTGAAAAAAGTGCAGCCTGCCCAGGAATGCCACTGCACACACAC
GGAGAGCTGATGCAACAAAAAGAGACACAGATTCCCACAGAAGAACACAACAGCGAGTGG
ACATAAAGAGCAGACAGTGGGGGGGGGGGGGTAAAAATGTAAAAAAAAAAAAACTTTCTT
CATACAAAGTGGAGACAGGAGATCCAACTCTGAACTCACTTAAAATGGATAATGCCAGCA
CACTTGTGTTAAAGGTGTCCCCAGAGCAAATGATTTGGTTTTGTTTATTCTCTGCTTTGA
CAGGTGATTGAGGCCTCAGATGTTGTACTAGAGGTGTTGGATGCCAGAGATCCTCTTGGT
TGCAGGTGTCCCCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGTTGGTACTT
GTATTAAATAAATCAGGTGAGCAAAAGGGGTGGGTGCCCTTGGTGTCTTGCATGTGCTCT
AGTGAGGTATGAGGAAAACGTCTGAACAGTCTGATTGTCACTGAAGACTGATAAGATCCA
ACTCTGACCTCAGTTAAACCAGTGCATGTGCTCTCTCCCTCTCAGCAGTATTGGGCCATG
GGCAGAGGGTGTTTCCCACAAGTGATTCAGCTGGTTTTTGCTGTTCTTTTGCCATTACAG
TACTGACCTTCTCTTATTTAAGATTGTAAGTTTCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGAGTGGAGCTGCCTGATAGGAAGCGATAGCTGAAATGAATCAAAGTTTGCCAAAACT
TTGTTTGCCAAAGAGGGAAAAAATATTAATGGTAGAAGAAACCGCATGTTAGGTCTATAA
ATAAGGTATAACATGGAGTTATTTCTCTTTAGAGGGGGAGGGCACACTGGGTTTCAGATA
AATAAGAAGCAAATGATGATAAACTGGATCTGACTGACTGTGCTGAGTTTGTTCAATCCA
ACCCTGAGCTTCATGTTCTGTCTCTTGCCCCCTAAATGAATTGGTGGCCCCTTTGATTAC
CATTTCTCTTTTTCCAGGAGCATGCAGATTGTCCCTTTGGACAAACAGATCACAATCATA
GACAGCCCCACCTTGATCGTGTCTCCATTTAACTCTGCCTCTGCACTTGCACTGAGAAGT
CCTGCAAGTATTGAAGTGATAAAACCAGTGGAGGCTGCTAATGCCATCCTGTCCCAGGCT
GACACACGGCAGGTAAAGGAACCCCTCTTTGTGCACCTCGCCACCATTTCATCTTTACTG
GCAGAATATAATTCTGATATTTGGTGTTTGGTCCTAAAAGTCTCATTATGTTTGATCCTC
CTAGAACTATAACACATAACAAAAATTGTACAGGTGCTTGCTACTTGTGATGAACTAAAT
TTCAACTTAAGCATCTCTTTTCAATAGCTTTATCAAGATATAACTCATAAACCATACAGT
CCACCCAAATTCAGTAGTTTTTAGTGTATTCAGAGTTGTGCAACTATCACAATAAATTTT
AGAACATTTCATCACCTCAGAAAGAAACTCTGCCCATTTCCAGTTAATCCCCATCTTCCC
CTAGCCTCCATCTCTAGTCATCTTCTGATTTGTCTATGGATTGGCCTATTAGACATTTGG
TGTCAGCAGAATCATATAACACATGCCCTTTTGTGACTTTGTTTTGCTTAATGTGTTTTC
AGGGTTCGTGCATGTAGCATGAATCAGTACTTCATTCCTTTTTGTGGCTGAGTAGTATTC
CATTGTATGTATATAAACTACATTTGGTTATCCATCCAGTTGATTCCGGACATTTGACCA
TCACTAATCATGCTGCTATGAATACTTGTACAAGTTTTTGTATGGGTGTGTTTTTTTCTC
TTGGATATGTTCCTAGGAATAGAATTGCTGGGGCAAATTGTAACAGTTTAACTCCCTGTG
TTCTTCAGAGGCTATACCATTTTATATTACCATTAGCAGTGAATGATGTTGCCAATTTTT
CTATATCCTTGCCAACACTTGTCCTTTTCCCTTTTTGATCACAGTGACCTTAGTGGAAGG
GAAGTACTATCCCATTGTGATTTCAATTTGCATTTCCCTAAATATCTTATANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCAGTACCACAATGTTAGAAACATTCT
GAGTTTTTCTTACTTTTACATTATATCAGATGAGTGACAGTTTGTTTTTGTTTTTTAAGG
TAGTACTGAAATTTACTGTTCCAGACTATAAGAATTCCTTAGAGTTTTTTACTTCACTTG
CTCAGAGAAGAGGACTGCATCTTAAAGGTGGAAGCCCAAATGTAGAAGGTGCTGCCAAAC
TGCTATGGTCTGAATGGACAGGGTAAGGCATCTTTATATTGACCTTTTCATGCCCATATA
GAATAGTGGAACTGATTTTTTTGACAAATTGGTTTTTAATTCTAGGGCCACCTTAGGCTT
CTATTGTCAGCCCCCTACATCCTGGAGTCCTTCCCCACATTTTAATGAGCGTATTGTGGC
AAACATGAAGTTGGGCTTTAATCTGGAAGAACTTGAAAAGAATAATGCACACAGCATTCA
AGGTGAACAAGACTTGTGTGTTGCTGATGTCTCCATTGGCTGACAGGCCAGAAAGGGTCT
CATCTGTTTACAAGGGCTATCTTCCTTTCCTAGCCATCAGGGGCCCTCGTTTAGCCAGTA
GCATCCTTTTCCAGTCTTCGGGTCTGACAAATGGAATAATAGAGGAAAAGGACATACCTG
AGGAATTGCCTAAACACAAAGAGAGGGAGCAGGAGAAGGACGAGGAGGACAAGGACACTG
ACCAGGAAAGTGGTGGTGGTGAAGAAGCTGATGTAAGTGCATTCTCCGTGAGTTTTTTAA
AAGCCAAAGTAAGTTTTCCGTCATTGTAGTATATGAAAAATGGGAAGCAACTGAAGGTGG
GAAGTATTTTGTACTAGAAAATACTCAATAAGTATTTTCTTATTAGTAATACTAATACTA
GTATTAGTATTAGTACTAGACTAGAAAGACTGCTCAATAAGTTATGGAAGCATTACTCCT
AAAAAGTTCTGTTCAGGCACTTTTAGCTCAACTAATTCAACTATTCAGAAAGATACACAG
ATTAAATGACATAGTCAAGGTTTCCTTATTAACAAACAGGAAAAATGTTTAATACTTTTC
ATATCTCAACAAACAAAACTCCATATTTTTTTTACCTTTAGCATTAATATAGTACCAACT
TTGACTTTGCTGCAAAAACATTAGTGATGTTAACTATAGTCCATAAATTACATTAGGTAT
ATATATATATCACTAAGTTGTTAACTTTGTAGTAGAAAAATATTCCTGTACTTATATTAA
CCATAATCTCCCATCTACTATGGAAATTATTAAACATTCCCTATACCATCCTCCAGCTGT
CTTCCACCTGTTATAATCCAGCACTGTTTTTTTCTCCAAGGAAAAGAACACAGACCTGTT
CCCTCCAGAAGAGATACAGGAGGCACTGCCTGAGGAATCTAAATCAGGTGAGCCTAGGGT
GGAGGAATTTTTTCTAATAGCAGCAAAGCATAAAATCACTTTCACTGTTGTTTGTTTCAT
TTTTGTTTTTGACCCCATTTTTGTTTTTGACCCCACTTTGCTTCCAATGTAGATGAGCAG
TTGTATAATCAAGAAGCAAGTGATGTCTTCAGTAAAATGCCCGAAGAGGAAGATGACACT
TATGACTTCAGTACAGACTATGTATAACAGAGCCTCGTCCTCTGTAAGAAGTTTTCTCAA
CATTTTGAGCAGACCACAAAACTGTCCTATTATGTATAATATACCAATGTTATGCTCTGA
CATAAGCTGTGTAAATTTTGTGAATACATATCATGAGGTACTTATTAAAAGAACCAAGTA
ATTTAGACTTATGAATTCTGTAAAAAACTCATCTCTGGAAGCAAAAAATCAGAAATTGAA
AAAAACTTTTTATTTACAGATTTACAGACCAGGCCACAATCTTTACAATCTTTCACAAGA
TTAAACCAAGCAGCAGTTTTTAGGCTAGCTGTACCAGCTAGCTGTATCAATCCATTCCTC
CCATATTAAGAAAACACTTGGTAAAGCAGATGGAGACATATTTCTGGTTGATCTGGGAGG
CTGACTACAAGACTGGGCGTAGGGCAGCTCGTTATATTTATCCAGCTGAAGAGCCCAAGC
AGCTATGTTCTATCTTCCAGAACTTCCTGAGAAATGCTAGTCACTTAAAAATTTTACTTT
ATATTTTGAGATGTCCATGTGTCTTCGAATTAGGCTGAATTTGCCTGTTGGATCTGGGAT
ATACCATTTTTCCCAAATATCAGAATATGAAGCAGTTCTTCCCCATGGTTTAAAGTGCCC
ATTCCAGTGGAGTAACTTGGCAGCCTTTACAAACTGAGGTGAATATCGTTTTCCAGCACT
GGAGCCTTACCATTGAGAAAAAATGATTGTACCAGTCAATATAAAAGCAAGCCCTTTCAG
CAGTTGCCTATTAGTCCCCCAAACATGGACAAGCCCCATCCAGAAAACGCAAGTTCAGCC
AGTTTTAAAGTCATTCAATTAAGTCTTTTTATAATTCGTTCGAAAAACCAAGGTTTGCCA
CACACAACTTAATTCTTCATCATTTAATCAACAAATATCCAGAGAGTCCATGAATGGTGT
TGTGATGCTGCCAGCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1635..1693, 2072..2118, 2121..2139, 2141..2191, 2193..2207, 2209..2214, 2331..2444, 2670..2753, 3843..3975, 5095..5207, 5308..5434, 5535..5622, 6797..6971, 8039..8181, 8265..8401, 8493..8671, 9280..9346, 9472..9479, 9482..9484, 9488..9489, 9500..9566
1001..1013, 1635..1693, 2072..2118, 2121..2139, 2141..2191, 2193..2207, 2209..2214, 2331..2444, 2670..2753, 3843..3975, 5095..5207, 5308..5434, 5535..5622, 6797..6971, 8039..8181, 8265..8401, 8493..8671, 9280..9346, 9472..9479, 9482..9484, 9488..9489, 9500..9563
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved