Dasypus_novemcinctus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus GNB2L1
Dasypus_novemcinctus
GNB2L1
GeneScaffold_4182
SNORD95
2718..2784
6205
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCCATACCAAGGATGTGC
TGAGTGTGGCTTCTCCTCTGACAACCGGCAAATTGTCTCTGGCTCCCGGGATAAGACCAT
CAAGCTCTGGAATACTTTGGGAGTATGCAAATACACTGTCCAGGTAAAGTGACGGCATGG
AGAGAGCATATGTTGGAAGTCCTTTCCTTCCATTTTTCTTTACCTTATGTGGTGATTTCA
AGTCTTGTAAGGAACATAAAGTTCCAGGGGTGAGAAAAAAAGGCTGCCAACATCCATCCC
ATCCCACATGGCCAAGGAAATGAGTGGAGCAGCTAGAATGTTTTGACAAAATGGTTTCCC
TCTAATTCCTTTCCATCTGTAGGATGAGAGCCACTCAGAGTGGGTGTCTTGCGTCCGCTT
CTCGCCCAACAGCAGCAACCCCATCATTGTTTCCTGTGGCTGGGACAAACTTGTCAAGGT
GAGTTTTTAAAGTTACAAACTTAAAAAACAAGCATGCACATTCTCAATTGACTTTTTTTT
TTTTTAAGGAGCTTTAGTTTATATAAATGTTGCATTGAAAATATAGGGGATTCCCATATA
CCCCTCCCACACTTTCCTCCATTAACAGCATCTTTCATTAGTGTGGTGCATTTGTTAAAA
TTGATGAACACATACTGAAGCATTGCTGTTAAACATGGTCTATAGTTTGCATTATGTTTT
ACACTTTCCACTGCACAATTTTATAGGTTTTGACAAAATGTATAATAAGTTGTGTGTGTC
TCAAAAATGCCCCATGTTATACCTATTGTACCCTCTCCCTCCTCTCAGAACCTCTGGCCA
CTGTCTTTATGTCAGTGTTAAAAGTTTTCCATTACTAGAATAGTAAGTCTTCTGTAGGCC
ATAGTTGGATTCCTCCCTTATATTTGTTTGTTCCTCTATCTTGGGGACTTGGGGGCCTCA
ATTGACTTTTTTCCTTTTGCTATTTTTCCCCCCAGTTCTGGCCATAAGTTTCTGATATTA
ATAGCATGAGGGGGAAAGTACTGAATGGAGTAACTTAATTGATGAACCCAGACCCCTTAT
AAGACTCCACACAGCATACGACTAAATCTTTGTTATTGGTAGACTGATAAATGGTTATCC
TACCCAGGAATGCTGTTAAATGATGTGTCATGCCATTTGGGGAGGGACCCCAGCCCTGGC
AGGTCTGGTTGCTCACCTGGGTCCTTCTGCCCCTCTACTTAGGTATGGAACCTGGCTAAC
TGCAAGCTGAAGACCAACCACATTGGCCACACAGGGTATCTGAACACTGTAACTGTCTCT
CCAGATGGATCCCTCTGTGCTTCCGGAGGCAAGGTATTCAGGGACCAAGAGATTCCTCAA
AAAGAGGCAGAATAGTAGCAACTGCTATACAGTGGGTTGGCTTAAACCACAGGAATTAAT
TGGCTTGTAGTTTTGAGGCTAGAAGTCCAAATCAAGGTGTCAACAAATGCTTTCTCCCCC
AAAGACTAGCACTCAGGGCTATCAACTGATGATCCTTGACTTTCCCGTCACATAGCAGTG
CACGTAATGGAATTTCCTCTTCCTGCTTCCATTGACTTCCAGCTTTCCTTGTGGCTTTCT
CTTGTTCTATTTTGTTTGCTTACAAGGACTTCTGCCATATTGGATTAAACCTGTCTTCCT
TCAGTTTGAGCACCCCTTAACTAAAAAGTCCTACCTTCCTGCTAGTGTAGGTAACTGTGT
CTTAGGGGCCTAGGAGCGGAGCAGTGATGATCTCAACATGCCATCTGAGTGACTGTGCTG
AGAACCAGAGGCTGTTTCTGAGCTGCCTTCTGGCCCTGGTTTGGTGGACTCTAGAGGGCT
CATGACTGAAATTTCCCAGCTGGCTGGTACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGTCTGGAACTTAGAAGAGC
AGGGATTCTTTAAAGGGCCATCTTTTTTACCACTAGTGAGACTGCAGAGCTCCCTGACTT
TGACCTGATCTAATTCAGTGTGATTTCTCTTTTCTTGCAGACTCTGTTTGCTGGCTACAC
AGACAACCTGGTGCGAGTATGGCAGGTGACCATTGGCACCCGGTAGAAATTTGTGACAGA
GCTTTATAAATAAAGGAAAAACTGGCTTTCTGACATTTTTAAAGTGTCTTTCTCTGATAA
GCAAACAGCCATTTGATATTCATGCTCCTTATACTGGTTTAAAAAAAAACAACTTCAATT
ACAATGATAATGGCAGACAGTCAGCAATAGGGTAATGTGATGTGCGAACCAAGTAAATAA
GGATTTGGGCAGAGGGATATCAGTATGTAGGTCCCAACAGTGTTGTGGTGGTATGAAATG
TGTTACTGGAACATTGTATAGGATAGGGTTTCCCAGACTTTCCCCATCACAGTGGTGGCC
CAAGTTTCAGGTGGATGTTCTGGGGGCTTACCTGAGATTTAATCTATAGAAAAATTGTTC
CTTAGGGAAAAGGGCTGGTGATTCCAACATATAAGACTTTACACAAAAGAATGAACTGGG
AAAATGTAAAAGACCATAATCACAATTGGCTTTACTGGTTTAACTTCATTATAGCAACCT
CATGGGGCAAATTCAGATGGAAAAGCTAGTGCTGCTGGTCCTCAAATTACACCATTGAGT
AAACTGGATGTTGGATTTGAAAATTGTAAATCCAGCTTCAAATTCATGGGGCTTCAACTG
TTTCTTATGAAATCATAGTCCTAGAGCCAAAAGGCAAAAAATTCAGGTTGGTGCCAAAGG
GTATACAGTACATAAGAAACTAGGTAGGATATTCAAATGAGGTGGTCATTGGTTTGTACT
AGTCCTTTTCCAAACTAGTAAAGTCCACCAAATTACACACATCCTCAGTTTTACTCACCT
AAACGAATGGACTTCAGAGAAGAAGCAAATAAACTTTTTATTCATTTCCATAACACAGTC
CACCTCTCCCTCATCCCAAGAAAATGAATTAACCTCAGCCATCAAAGCAGAGGACAAAAG
CTGGTAAGTGGCAAAAGGCAAGGGGTTGGTTACTAGAAAAATAGATTATACCCAAGGCTG
TCCTCCTGGGGATCCAAACCCCTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 1030..1122, 1342..1437, 2202..2312, 3759..3899, 4000..4110, 5140..5205
1001..1027, 1030..1122, 1342..1437, 2202..2312, 3759..3899, 4000..4110, 5140..5202
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved