Dasypus_novemcinctus Locus ENSDNOG00000008412
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000008412
Dasypus_novemcinctus
ENSDNOG00000008412
GeneScaffold_3286
SNORA65
3686..3815
5460
GCATAGGCTGTCTGGAAAAGCAGTCAGGCCTGCAGAGCTGGCCAAGCTCCAGCTGTCAT
CCCAAGATGACTGCAGGGATGGGGAATTGTCGCAAACAGCCCTGCCCCAACCCACCCTGA
TGAGCAGCTCTAACCCCCTACTGCCCGAGGATTTACCTTCGCTCACCCTCTCCTCAACAT
CCTGCCCTCCCCAAAGATCATTCCTCTCCAAAGACCAGCTCTTCCCAACCTCCAGCCCCA
CGTTCAGCCCTCTCCCATCCCGGTCCCGGCGCCTAGCCCAGATAGGTAGAACCACACCCA
TCCTTCCCGGCTTGGGGCGGGGGACCGTGCCGGACCTGGCTTTGGGGATGGAGAGGTCCC
CGACGGTCGGATCCTCGGCGGACCCGACCTAAGCCAGGCCGATCAATCGGAGATTGGTCC
TGGACTCGGGGCCTCACACCACCGGGTACAAGCCCGGCGGAGCAGGAGTCCGGTCTCCTG
CAAACGCAGGAGCTGGAGAGGAAACTCACAATCTCGGAAAGTCATGCAGACCAGAATGGT
GAAGTCTGAGACTCTGAGAACCGACGGATTTAGACTCGAATAAATATATCTTGATAACTA
AAATGCACACATATAACAAGAGGGTTAGGAGGCGGCCCTGGGTGGTACTGGAGTCCCGGA
ATGGGGGCGCGGACCTCTCAAGAAAGGGGCGGGGCTCAGGGATTGGGGGCCAGGGACCCA
GGGATGATCCTCACGGAAAGGGAGAATGGGGAACAGGGAGGCCCGGGATTCCTGGAGCGG
CTTCTTCTGGTATGCTTCCCTCACGGGCGAACTTCCCAGAACCCCTCTCCGAATCCCCAG
CCACAGCTCACCGCGGTGGCAGGCTCTCATCTGTCAGCCTCCGGCGCCTGCCCACAAGTA
ACATGGCAGCCAAGGCGTCTCCGAGAGAGTGGGCGGAGACGGTGGTTCTCGCGAGAGCTG
GGCTTTCCTGTCTATATTTGGCGTGGTCCGGGTGATTTCCGGTCTTTCGGCTTGGAGGAG
GCCAGGGTGCAACTTTCTTCGGTCGTCCCGCATCCGGGTTCATCCGACACCAGCCGCCTC
CGCCATGCCGCCCAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCTCTAGATGTGG
CCCGGGCTGCGGGATGGAGCATCCCTCTTCACCGCGGCCCGTCGGGCTTTCGGCGCTTGC
CCTGCTTGTCTTTCCCGTGTCGGGCTCTATAGCCGGCGCCTCCCAGAGGCTTGGCGGGAG
CCTCGGGTTCTGCGCTCAGGGCGCTGCACTCTCTTACCCTTAATGGGTCTCAGCTTCCCC
GCGTATACATGGGGAGGGAGGACCGGACGACCTGCGGCGGGTTTGCAGCCCGCACGCATT
AGGGTAAGGTTTGTTTTCGGGCTTTTTTGCTCTCCTGGACTGGGCTCGGTGGAGGCTGGG
GCTTTCTCCATGCCGGCCGGGTTCGAGGCTCAGCAGCGGTAGTGGAACCAAGGGCCGCCG
CCCCACGTGGCGCGCAGAGCTACTCACCCTGAAGCCGTGACGCGGCTCGCCGGAGTTGGG
GAAGGGGATCGAGTGGCTTTCGGTCCCGACCGAAACTTGTGCTGCTGGTTGCAGAACTAA
AGGGTGTTGGAAAGATGCAGTCGGGGGGCTACCTTTGCAGAGGACCTAATCCTTTATTTC
TCCCAGTGTACCTGAGGTGCACCGGTGGGGAAGTCGGTGCCACATCTGCCCTGGCCCCCA
AGATCGGCCCCCTCGGTCTGGTAAGTCATCCTCGGGGAGAGTTAAGGTCTGGCTTGTGCA
AACATGATTCCTAGAGGTGCCTACATCATTTGGTCGTTGTGTTAACCTCCGACCAGACCC
TCGAACCTGGGAAGAACTGGTACTACCTAGTGGAAAAAGTTTATGTTTGAAAATACAGAC
AGGTACTTTGAGGTTGTAATTTGCTATCCACGTGTGCGTATAACTGCTGCAGAGTGAGGA
CTGGGACGAAGAAGGTCAAAAGTGAGTTTTGGCATCAGGAGTGGTTTAATGAGAGTACTG
TTGCAGTACGGGTGAAGATCTTGGTTAATATAGTACCTTGTAAACCTAGGGCTTAATAAA
CTGGCATTGAATTTTATTTCTCTGAATATCTCTGGCCTTTATTCTTGGGACAGTGTTCTG
TCTGTCCCCCAAACCCTTATCTTGTTCAGTGCCAGTGTACGATTCTTCCTTGGTCCTAGC
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCTCCAATTTAGGCT
AGGGGTCCCTCGGGAATTTTTGAAGTAGCAAATGCCCAGACTCCATCCCTCACATACAGA
CTTACTAGTTTAATAGGAGAACCAGATATCTTTAAAGCTGCCCAGGTGGTTCTAATGTAA
CCAAGGTTGAAAACTTACTTTATAGTCCTTAAGGGACTTGGCCCTAAAGTGGCCCCGAGG
CTCTCCAGCTTACAGCCCTAACAAACTTAACCCTCAGTGTCATTTTCTCCGTTTCTACTA
TGGGGATAACTTGCCTTGAACCTTGATGGAGTGGGTAAGATGGGGTGTTGACAAGTGAGA
AGTACCAGGTAGACCTTAAGGGGCTGTGGTTGAACATTGGGCACAGTGTGATTGTTATGC
TTATTTTTACAGTCTCCAAAAAAGGTTGGTGATGACATTGCCAAGGCAACTGGTGACTGG
AAAGGTCTAAGGATTACAGTGAAACTGACCATCCAGAACAGACAGGCCCAGGTATTAATT
TGTACTTGGTTTGGGGTCAGGGTGGGGGAGAGGTAGCAACCTTCTGGGGTCCCCTGGCTT
TTGCTGACCCAGATACCTATCACCAGCCATAATCCCAGCTGGTGTGGTTATGGTAGAGTT
GAACTTGGATGCTAATACTCAGAACATGCCAGGGGTGCAGTGACTGAAAGACCACACCAG
ACTGAAAATTTCTGGAATACAGTTACCTCAATGTGTAGCCTGTGGTTTGAGTCAAAAGTG
CATGGCAGTGTTGGTTGTCTTCATTGGAGGTGGGGTGAGACTTCATCAAGAATCTCCTCT
GCAGATCGAGGTGGTACCTTCTGCCTCTGCCCTGATCATCAAAGCCCTTAAGGAACCACC
AAGAGACAGGAAGAAGCAGAAAAACAGTAAGTGTTCATCATTCATGTCGTCCGTCCTGTC
CGGGTCGTCCATTCTCCCCCCCCCCCCCCATTTTTTTTTTAGTAGTGGTCTGTGATGTTA
TGTATCCAGTGTTTGCCACAGGGCTTTTTTCCCCCCTTTAATGAAACTCTGGGGAATTGG
GGGGTGATTTGGTGCAGGCTGTGACAGCCAGGCACCAGCAGAGTGTTGTTTGCTTTCTCT
AGCACTTGACCTGGGTGGGGCAGGTTCCATTCTATAAAGCTTCCATGAAAGGAAAATCTC
AGGCATGAGCATCAGTGAGCATCTTTGCCTGTTCTGGGCAATGAGGTGTGGGGTCAGGCA
GCTGAGAATATTGAAAGTCAGGAGACTTTCCCACCTGGGTGACACTGGACAGTTCAGTAA
TTTAAGCCCACTTTTATTTCTCTAAAACAGATAAAAGAAGGCTCTTACATGTCAGATTAG
CTAAGACTTGGGTTTGCCCATAGCCACCCGCCACTGCACCTGACCAGTTCTCTGTTGGCT
GGTGCAATCCAGTGGTGAGCTGATATTAAACCCCAGCTTAGGAAACAGGGTTGTTCTTCA
TATGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTGGAAATGAATGAGGGAGGATATA
ACGCGGTTTGCTGTGGTTGTGGCAAAACTTCTGTTGTTATTTTTCTTTTCTACAGTTAAG
CACAGTGGAAATATCACTTTTGATGAGATCGTCAGCATTGCTCGACAGATGCGGCACCGA
TCTTTAGCCAGAGAACTCTCTGGTAAGAACTTTTAAATACTCAAAATTGAGGTGTGGTGT
GTTCAAGGTCTTGGGCTGGATGTGTTTAATTGGGTGTAGGTCAAAGGATTTACTTAACTA
GTTGGAAATGTGAGCTTTAGGATTAGAGATCATTCCTGGTTCCCACAAAAACTGTTCCTC
CCCCTGCCTGCTATAAAAATCGACACCCCCCCCCGCAATATCTGAGGATTGTGTGGGATT
GAGAACCCCTCTGATAACAGCTTTTTCTCAATTTCTACAGGAACCATTAAAGAGATTCTG
GGGACTGCCCAGTCTGTGGGCTGCAATGTGGATGGCCGCCACCCTCATGACATCATAGAT
GACATCAACAGTGGTGCAGTGGAATGCCCAGCTGTAAGTGGCATCAGTTTGTTTAAATTA
GGGGTTGAAAGTCCGGGGGGTGGGGGGTGGGCGCTGATATTCACAGATAGAAGCTAGAGA
GTTCTGGTGATATGGGAGGCATTTTCTGTGTGTTATTACTCAGGGCTTCTTTTTTCTTTC
TGCAGAGTTAAGAACTACAAAGGAAAATATTTCAATAAATGATGATTTGACAGCCAGTAG
GTTTTTTGATGTGGTATGTTTTCTGGGGGCTGCTAGATTCTTCAGGGGGATGGTTGATGG
GGCCCAGGTGGCAAAATATAAGAAGCAACAGTCTGGGCAGTGAGTACTTTGTAGATTACA
GACTGTTATCTCAGAAGATAAGAAAAAGACACATGGAGAAAAAGCACTGCTTTTTGCAGA
CATTTCAATATTCATGGAGCTCTTCCATAGCAAAAAACATTCTTAGAAAAGAAAACCAAC
TGTTCAGCCACAAACATGTTGGCAAGTTCTTCATCCCAAACCTGTTGAATCTATGGGTGA
GAGGCCCTTGCTAGCCATTCCAGTGTGCAGCCAAGGTTCAGAATCAGTGTCATGATAACA
GTTACCACAGATACAAATGTGCAGTTACCCATTTGCTTTGGACAGTAACTATTTTTGTAA
TGTTTTTCCCAAGTTTTTTAAATTTTCCCTTAGGTTGTTTTCCCTTTCCATCCACTTTCC
AGGGCCTGTCCTTACCATCCAATCCCTTTTTACATTGCATGGGCAGTAAAAGATTTATTC
CATTTATTTATTCCTGCCCCCCCCTCCCCCCCCTTTGTGCTTGCTGTCTGCTCTGTGTTT
GCTTATCTTTTAGGAGGCACTGGACACATGCCCAGGACCTCCTCCCATGTGTGCAGTAAA
AGAAGGTACCAGGGCACCTGGAGAGGGCTTCTGGGTATCATCCTAAGAGTTTGGAATTAA
ATTGTTGTAAGAAATTTACTTCCCTTGGACAAGTTGTCTGTTCCCATTAATTTTGTCATT
GGTCCCTTTAAAAATGTGGCTTTTAATCACCCCAGGTGTTCTAATGTGCACACTGGGTTG
AGATCTCTGCCTTACGGAAGAGGACTACCTGAGGACTGGGGTAAGAAGCACTCTAAGCAA
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 1015..1120, 1686..1759, 2712..2810, 3124..3205, 3895..3981, 4240..4433, 4437..4442, 4445..4458, 4460..4460
1001..1012, 1015..1120, 1686..1759, 2712..2810, 3124..3205, 3895..3981, 4240..4433, 4437..4442, 4445..4458
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved