Dasypus_novemcinctus Locus ENSDNOG00000017533
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000017533
Dasypus_novemcinctus
ENSDNOG00000017533
GeneScaffold_6302
SNORD49
1266..1337
2463
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTC
CCCACCAGCCAGACCACGAGGCAGGCGCACCGGGAACTCGCCGCACGTCTCCTGGCCCAG
AATTCCCGGGGTTGTGGGAGAGACCACAGACTCAACAGGAGGGGGGGAGTCCTTAGGTGG
ACGAGTCTACCCCTTCAAGTGGGCCGGAAGTTCCCGTGAATCGTCGACAGGCCCCCCTCC
CTTCTGTGAGAGTGAGACGTCCCGGCTCCTTAAATGCCTGGCGCACGGAGCGGACCGTCT
TTCCGCAGTTGTCGTCATGGGGTAAGGGCTGTTCGCGTGTGGGCTTAGTGGCGGGCGGTA
AAGGGAACTAAGGGACAAGCGCCTTTCTCATTTCTGGAGTGATGCTTCCGCAGAGGTTGA
CTCGCAGGGAGGAGGGTGCGTCCCCCTGTGCCAGGGCGGGCGCTGGGCTCCCTGTCCGAG
CGCGCGTGCTTGTCCCGCAGGGCCAACGCGGGAGCCTGGGGTCCCCGAAGGCCGGGCCGC
CCTTCCCCGGGCCCGCCGTGGGTCGCGTGCAAACCCGAGAGAGTTGGGTGAGTTGGGGTC
TGGCTGTGGTTTTCGGTGACCGGGGACCCTTCGCGGGGGTGAGGTTTGGAATGGGGAGGC
GTGGACTGTTGTGATGATACTGGTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATG
TTTTATGCCCGTCTGACCGCAGTCGTTGAGCCTCCACCGTTTAGTTGCATTTAACTTCTA
GAATCTGCTGTAAGTGTATGCTCTTGTTTCTCCGGGTTCCAGGTCACAGACTCACTGCAG
GCTATTGAAGACTGCAGCATCCCATCATGAGGTGTAAGGTACGGTTTTTGTTAAGTTAAA
TAACACTGAAATTGAACAGTTGTAGATTTCAGCTTTTCTAAAACTTACATACCAAGTCCT
TGCATAGTATGCTCCGGCGCTAGCCTGGAACTGTATTTAAACAGTTTTAAGCAGAAACAT
ACTGAAGCATGTCTCCAGTGCCCATCTTTTAGACAAGTTTAGTTTAAAGTAATCCAGGGT
GTCCCCAATGCCAGTTGAGCCAGAGGAGTGGTACTGGGAAGAGGTGAGGTGCGTGGCTGC
TCTGATGAAAACCATAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACTATTCTT
GGCTGACTGCAGTCACCAAGTCCTCCCCTGCTGGCTGGTGCCCAAAAATGTCAGTCTGAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1025..1034, 1036..1044, 1046..1063, 1066..1080, 1083..1149, 1151..1162, 1164..1186, 1422..1463
1001..1023, 1025..1034, 1036..1044, 1046..1063, 1066..1080, 1083..1149, 1151..1162, 1164..1186, 1422..1463
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved