Dasypus_novemcinctus Locus LIN9
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus LIN9
Dasypus_novemcinctus
LIN9
GeneScaffold_6786
SNORD22
30915..31040
80789
CGCGCAGGGGCGAGCCCCGGGGGCCGGCGGGGCGCGGGCGCTCGGCTTACTCCTCCGGG
CGCGGGGCCGCGCGAGGCGCGCCGGTGCTGGGCCTCCGCCCGGGCCCCGGCCCTCCTCGC
CCGGCCCGGCCGCCGCCGCCGCCCGCAGGCCCGGCCCGGCCGCCCTCCCGCCGCGCCCTC
CCGCCTCAGCCGCCGCCGCCGCGAGCGCCGCGTTCGAACCTCCCTCGCAGACAGTCTCCG
CCCCACAATGCACCGCGGCGGGCAGCCTTTGAAAAAGCGGCGCGGCTCGTTCAAGATGGC
GGAGCTCGACCAGTTGCCTGACGAGAGTGAGTAGCCGCGCAAAGCAGCCCTTCCTCCCGC
CGCGCGCTCGCCCCGGGGCCGCACGGGCCGGGCCGGACGGACTGCCCTCCGCCAGGCCGG
GGGGCGCCGACCGCCAGCGCCGCGGGCCCCCGTCGCCCCGCGCCCGGGCTGCCGCCGCGC
CGCCGCCTTTGTTGTGGTGTCTGTGCGCTGCTTTCTGGGGCGCTGTGAGCGCCGGGGCCG
GAAACCGAAAGCCCGGGAGCCCGGCGCGTGCCGGCCAGGCGGCGGCTGCCCGGCGCGGCC
CCGGCCCCGGCCCCGGTGGGGACAGCGGGCCGGCCGCGGGGGGTCCTCGGTACCCGCCCC
GGCACATGGTGTCCGCCGGCTTACGTAACAGGGAGCGGGAGGGGGCGCCGCCTGGCCATC
CCGAAACCTCGCCCCGGCCACTGCCCCGCCTACTGCCTGCCGCATTGCCGCGCCGGGCAG
GGTTTCATGTGTAGAGGGGATACGACGTCCCGGCGGGCATGTGGCCGGGACTGCACAGGT
GTTAACTGGGACGAGCTTGGTCGGCAGTGCATGTGTGACTGCAAAGTACCACTTCCATGT
CCATAAGAAACCTCCTCTTATTCCACCACAGATACTCTGGGTTTTCTGACACTCTCAGAT
AAACCTAATACAAACTAATACAGTGGTGGCCATATTATGTGACATAAGACTGAAGGATAG
ACCATCTATAATTCGTTTTTCTGAGCAATCTCCAAAGCCTTCCCTTATTAATAACACTCT
TTGTTGGAAAGCTGAATTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGGTTCCTGTCTTAAGGAATGGCTGCACGAT
GCATTCATGAGGCAGGGCAGAAACCGGGGGTTACCCTTGGTGCTCCCTGCTCTTTCATTT
CCTGTAGTTAAGCCTTTACTAAGTTGTGTAACTTTATTTTTTGAGGTTCCGGGGCCTAGG
GATTGAACCTGGGACCTCATGTGGGAAGCTGGTGCTCAACCACTGAGCTGCATTGGCTTC
CCCGAATTCGTTTTTTTTTTAAACGATAGATTTATTTATTTATTTATTTCTCTCCCCTCC
ACCCCCCAACCCCGGTTGTCTGTTCTCTGTGTCTCTTTGCTGCGTGTTCTTTGTCCGCTT
CTGTTGTTAGCGGCACGGGAATCTGTGTTTCTTTTTGTTGTGTCATCTTGCTGTGTCAGC
TCTCCACATGTGCGGCGCCATTCCTGGGCAGGCTGCACTTTCCTTCGCGCTGGGCGGCTC
TCCTTACGGGGCGCACTCCTTGTGCGTGGGGCTCCCCTACACGGGGGGCACCCCTGCGTG
GCAGGGCACTCCTTGTGCGCATCAGCACTGCGCATGGGCCAGCTGCACACGGGTCAAGGA
GGCCCTGGGTTTGAACCGCGGTCTCCCATGTGGTAGACGGACACCCTAACCACTGGGCCA
AGTCCGCCACCCTGAATTTATTATTTGTTTTGCTTGTTGATTGTTTTGCCTTTTCAGGAG
GCACCGGGAACAGAACCCGGGACTCCCATGTGGAAGGCGGGCTTGAGGCACGTCACTCCA
CTCCTGTAACCTTTCCCTTCCAGATGTCTCACATTTGTCCACTTCCCTCTCCTACCCTAG
TCCAAGCTGTTCTAATCACTTCAGGCTTTCACTAACCCATTACCCCTTCACCCACATACA
TGATCTCCTCAAAATGTAAATATGTCATCTTCCTTAGTAGCTGCAAGCTCTTGCGTGGTC
TGCCCTGCCCCTCCTTTCTAGCCTCCATTTGGATCTTCCTCTCATTTGCTCCTTTGAGCG
ACGCTGGGCCTTTTTCATTTCCCCTACTCATCAATATCCCTTTCTCCAGGGCCTTTGCAT
GCGTTGTTCCCACCACCTAAAGTGCCCTTTCCTCCCCGAGCTTCCAGTTAACTTCTATCC
TTTAGAGCCCATTTTGAGCTTGTTCAGAGAACTGTTTTCTGTCTTCCCGGACTACGTTAT
ATCTTCTTATTAAACCTTTTCTTAGTACTATGTAACTCCTTGGTGGCCGCCGTCACGGTT
GCAGATATTTTTTGTTTTTGTTTTTTTTCCCCTGTGTTTCCCCTGCTGTACATAGCTGCT
ATTTTTGACTGTTCTTCCACAATTATTTATTAAGCAGTTTTATTGAGTTATATTCACAAA
TCACACAATCTAAAGTATTTAATCAATGGCTTTTTTTTTTCTAATGTGGCTTTTTAAAAA
AATTTCTCTCCCCTTCCCACCGCCTTCCTCCCCCTAGTTGTCTTCTCTTTGTTGCGTCAT
CTTGCTATGTCAGCTCCCTGTGTGTGGCGCCATTCTTGGGCAGGCTGCACTTTCATGCTG
CATGGCTCTCCTTACAGGGCGCACTCCTTGCGCATGGGGCTCCCCTACGTGGGGACACCC
CTGCGTGGCACGGCTCTCCTTGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACATGGG
TCAAGGAGGCCCAGGGTTTGAACCACAGACCTCCCATGTGGTAGGCAGACACCCTATCTA
TCCATTGGGCCAAATCCGCTTCCCCTAATCAGTGGCTTTTAATGTAATCACAATGGTGTG
CAGTCATCGTCACAAAAAGTTGCAGTTTTATATTTGTTTATGTGATTGTTTGGTTAGCAT
CTGCATCTAGCTCCCTTACTATAATAGAAGCCCCACCAAAGCAGGTACTGGTTCTGTTTT
CGCCATTCTTGCACCTCAGTTCTATTCATAAGTCCTAACTAACCTCCCTAATTTTTTTTT
TGAGATTTATTTTATTTATTTATTAACCCCCTCCCCCCCGCCCATTGTTTGCACTTGCTC
CTTCTCTTTGTGCTCGTCATCTTTTAGGAGGAACCAAACCTGGGACTTGGCTTGAGCCAC
CTCCGCTCCCTCTGCACAATGGCCTTTTTTTTTTTTCTTTCTATCCTTGAATATATTCTA
AGTTCATTTCTACCTCAGGACTTTTTAACCTTCTGTTTCTTCTGCATTGCTGCTGCTTGC
TCCTCTCATCCTAGACCTTCTCAGATATTCCCTCTTCTACCCTTTCCAAACCCCACTCTG
TAAAGTCACTCCCTCACGCTGATATCACTGTGTTTATTTCCTTTATAGCAGTTACAGTGA
GTTATAATTATAACTTTGTTTACTTGTTTATTGTGTGTCTCTTCCTACAAGAATGTCAGC
TCCCTGAGAACAGGAGTCTTTGTCTGTCTTGTTCCTTGGGGTATCTCTGGTCCTAGAGTG
GTGCTTATGGCAGGTATTTGGTACATACGTGCTGTGTGAGTGAATGAATATATCCAGCTA
GAGCAGGATTCTAACTTAATCAGATTTGCCTGCCTATAAAATTCATTATTTTAACATAAT
AGGTTTTTTTGATTGACCAAAGTAATTCTAACAATAAACACTATATATGTGCACTGTTCT
TAGCACTTTCCCATATATTATTAACTCACTTAATCCCTACTTTACAGATGAAGAAGCAGC
AGCACAGAGAGGTTAAGTGGTTTACTTAAGGTAACACAGAAAGGAAAATGCATCTGGTCT
CCATCTAGAGCCTGAACTCTTTTTTTTTTTTTTTTTTTAAGATTTATTATATTTATTTCT
CCCCTCCTCCTCATTGCTTTGTGCTCACTGTCTGCTCACTATTCATCTTTTTTTTTCCTT
AGGAGGCATCAGGCACTGAACTCGGGACCTCTCACGTGGAAGGCAGGCACTCAATTGCTT
GAGCCACATCTGCTCCCTTGTTATTTCTTTCTTTTTTTTTTTTTAATTAAATTTATTTCT
CTCCCTTTCCCCCCCCCCCCAGTTGTCTGCTGTCTCGGCCCATTTGCTGTGTGTTCTTCT
GTGTTCGCTTACATTCTTGTCAGTGGCACTGGGAATCTGTGTCTCTTTTTGCTGCTTCAG
TTCTCCATGCGGTACCACTCTTGGGCAGGATGTGTTTTTTTTGCACAGGGCGGCTCTCCT
TACAGAACACACTGCTTGCCCGTGGGGCTCACTTACGCGTGGGAAAGCCCTGCGTGGCAC
GGCACTCCTTGCACATATCAACACTGCACGTGGGCCAGCTCACCACACGGGTCAGGAGGC
CCTGGGTTTGAACTGCAGACCTCCCATGTGGTAGGCGGATGCCCTATCAGTTGAGCCAAA
TCTACTTCCCCCTAGTTATTTCTTTATTATAGTATAGTATAGTATAGTATAGTATATTAA
TTTACCTCCCCTTCCCCCTCCACCCCGTTTGTCTGTTCTCTGTGTCTATTTGCTATGTCT
TCTTTGTCCGCTTCTGTTGTTGTTGGCGGCACGGGAATCTTGTTTCTTTTTGTTGCGTCA
TCTTGCTGCATCAGCTCTCCGTGTGTACGGCACCATTCTTGGGCAGGCTGCACTTTCTTT
CGTGCTGGGTGGCTCTCTTTACGGGGCGCACTCCTTGCACATGGGGCTCCCCTATGTGGG
GACACCCCTGCGTGGCATGGCACTCCTTGCGCGCATCAGCACTGCACATGGGCCAGCTCC
ACACGGGTCAAGGAGGCCCGGGGTCTGAACTGCGGACCTCCCATGTGGTAGACAGACACC
CTAACCACTGGGCCAGGTTCACCGCCCTAGTTATTTCTAATTACTCATCCAACCATCACT
TCAGACTTAACATTGCTAAAACTAAGAGGATCTATTTTTACCCCCAAACTGAGTTTTTCT
CTCACTTGATAAAATAATTATTAATTTGTTTTATTTGTAATTGCAGGCTCTTCAGCAAAA
GCCCTTGTCAGTTTAAAAGGTAAGAATTGTAGCATTTTTAGATGTGGCATAAGCTAGGAA
TTTAATTCATTAAAGTAATTTGGATATAATGTCACTTTATCCTTCTAAGTTTTGATGCAT
TAAAGCTTGTAATTTTCACTGATAATAACTTTAAATTTGTATATTGTCGTAGAAAAATTG
GTTTTCAGTACTTAGAAATATTAAGGAAAATTCCCCGTAAAAGTATTGATTGGAGAACTT
TTAAAATTTTTAACTCAAGATTATAGATAGATCTTATTTAGATTTAAGACATTCATTAAA
CAACTGTGCTGAAACTTTGTTTGCATAATAGTTTTTGGGGTTTTTTTGCAAGAATCTTAC
CTTCTAAATAATAGCGCAAGAGTGATAGTACTTTGGTTTTTCTAAGAAAAAAACTAGAGG
TACTCCTTAGTCTTGCTATTTCTTTCTGTTGGTACATTAGCTCAACCGTCTTGATATAGT
TTATTTTGTAGTTTGCCTCTAGGGTAAGATTCTATTAGGTAACTAAATTTGGAACCAAAG
AAGACATTCTCACAGGTTTTTAGTACTTTTGGTTTGGGAGGTTACTAGGTAGTGCTTTGT
ATTTATGGTTTACCATATTATGTGCTTCTGGCTTGAGGAGACCACTTATCTTCCAGAATG
TCCTGATTTTTTTGCCTAGCAGTATCAGTTCCATCCCATCTCTTTTATTTTTTGTTTCTT
AAAATATACATCTGAAGAATTATTCCAATTATTCTCCCCCCCAATATTCAACCCGTTTCT
CTTTTTTGAACATATAATAGAGAAAAATTACACAAGTAATATAAATTTCTTATAGGAAAA
ATTAGAAAATGCTAATGAGCAAATAGAAGGAAATAAATAAGCCAATCTTAGTGTACATTC
ATCCCAGGTTTCTATGTATTTCTCTACATATAAGCATATTATTTTTTACAAAAATTAAAC
ACACCCAGTTTATTTCTTTTTTTTTTAATTCTTTTTTTTTTTAAGGTACTGGGTGCTACT
TTGGCTCCCCTGAAGTTTTTCCTCGTTTTTGCTTGTTTTTGTTTTTAGGCGGCACCCGTG
CGGGAAGCAGGCGCTCAGCTGCTTGGGCCTCATCCGCTCCCCCAGTCGCTTCTTTATTGA
TTTTCTTTCTAGTTGCAGGCAACCCTGAAGACATGTCTTTGAATTAAAACAGAAATAGCA
CACTAATTTCAATTTAATATACCAAAGATTTCACGTATTGAAGCAAAAAACATAGAAGTA
TGTTCTAAATTCAAGGTTAGATGGAGCATTTTCCATGCTTCCATTGTTCTACTTTCAGAA
ACAGTTCTTGGCAAATTAGAATGGAGGAATTATTAAAAAACAAAAATAAATAAAGAAAAG
AAGCCACAAATATTTCTGTGTAGAAATTAATACTTTTAAGATGCAGTATTATTTAGGGAG
TTTGACCAAAAAAAAAAAAAGCAAAAGAAAATTTTCATCTGTAATAGCTTAAAATTATTA
GGCAGTATATTTCACACATATTTCTGTTATTAAAAAGTTAGTGTTCATCATACAAAATCC
ACTGAACTTAACTTACATTTTATTAATCATAATTATTTATTACAGAGGGAAGCTTATCTA
ATACATGGAATGAAAAGTATAATTCTTTACAGAAAACACCTGTTTGGAAAGGTAGAAACA
CAGGCTCTGCTGTGGAAATGGTAAGGAATGAGTTTTTCTTACACTTTGGAATAACTGTAG
CTAAACTGTATTATTGTCATATAAAATTCCTTTATAGAACAGTGAAAATAATTTTGAAAA
CTTTTCCTAATCCCAAGCTTTTGAGTCCTCAAAAGCATCATTGAGCAATATTTGATCACA
CTTAGGTGGTTTGTCTGGTCATAATTAAGCATTTGTTAAATAATTGTGTGTTCTTTAAAT
AATAATAATAAACTAGCAACCCCCAAACATATGTTCATAAAACGCAAAAATTTTACATGG
CTCTGGTCCCTGCAAAAAGATACATAAGTAAATGGTAAGGTATTAAAGTATTATAGGTCA
AGGGTAGGTGATTTAGGGATGGGAAGTAAAGGTGAGCAGGTAATAGGCATGCTTTGGGGA
CCTCTGCTCCTCCCCTGCCCAGCCACGTCGTAGCTGATGCAATAGTGTGGAGCCAGGAGG
ACTTGGGGGTCACGCACGAAGCAAGCCTGGAGCGGGCATGCACAGCAGCAGGCGTGGCAG
CCTCGCAGCTGGCCGCAGTGAATGCCAGGGACTTTTTCCACTGTCAGTTCCCCAGCATCT
TTCCATTTTTCCTCTCTGCCTGTGGTCAGAGGATGGGCTCAGGACAGGGGACTTGCTCTG
AGGGCCCTGGAGTCTTGAGACTGGGTAGAGTCCATACCTCTAACCTGGCCCACTTGGGTT
CTGCCCGTATGTTGTGAGCCTGGAGCTCATCTGAAGCCGTCAGGACCTGCCTCCTTTCCA
CATGGCCCTGAGAGTTTGTCTTAAGTGGTGGGAGAAGGATTTGAAAAAGGATGCTGGTGC
TGTTGGGATATTATTTCCATTATTCTCTCTGTTAATGAAGCCTCTGTATCTAGGGTAGAC
TGTGGTTTTGTCATGTTAGAGTCCTTTTAAATCTATGATGTTATTGTCCTTTGGGTACTT
TATTTATTTTATTATATTATTTTTTTAGTTCTACAGGTACTTATCAAGTAATTTGTACTT
TTATTCACAAATGGGAAGTTGGTTAACACTTCCTGGCAGCAGTTCTAGTATATTATTATA
TACATTTAGGCTTATTGTTCTTGAGTGATCCAGTATCTTTTCCCCAGCTCAGCCCTAATT
AAGACACAGCATGTGATACATCCAACTGATACTAACCCAAATACCAACATAATATGAACT
GGAATTTCCAGAACTTAATTTCCTGTCTTCACCATCCAAAGTTGCCAGTGTACTAAGGAG
ATAGGATATTAGTTTTAATTTAATCATAGCCAGGTGTTTCATTTGTAAACAAATTGCATA
AATGTATCTTATTGCTCTCTAAATCTAAGATTATTTAAACTTGTCATTATATACTTCATA
TTACTCATACTTCCTCCTTCCATATTACCAATAATCCAGAGTTAGCAATATTTTCCAAAA
ATAGAATTGTACTTAGGGACAAAAGAGGGAAGTGTTCAGCTTTTTCATTAAATAAAAAAC
TTTCTACCATAGCCTTTCAGAAATTCAAAACGAAGTCGACTCTTTTCTGATGAGGATGAC
AGACAAATAAATACAAGGTCACCTAAAAGAAACCAGAGGGTTGCAATGGTTCCACAGGTA
CGTGTGGGCTAAAACTTTGATATCAGTGAAAGGAAGTGAGTGATTGGTTAGCATAATAAA
GTTTTTATATTATTCTCTTGCATTTTAAATAACAAATTCTTGTCTTTAAATCAGTACTCC
AATTTAGTTCCTGTTTTAGTTAACTAGAAAGGACACTTTATTGATAAGTTTTAAACCTGA
GTAGACAGCCGGTCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAGTATAGTGGACA
TGTCATAATTCAAAGGAATGAAAACTGGATAAGGAAAATACTTCCACAATATAATAATTT
TTCTTTTATCAAGATGATGAGCTCTGATACAGACATTCCATACTTCACCTTCATTGTTTT
TCCAAACGTGTTCTAAAACAAGATTTTCCAATACAATAGGTGATAACAGAGGTGGTTGCT
TCACCAGCAATTTGGCATCAAACAAATTAAAAGTATGGCCAGCAATATACTCTACTGAAA
ACCAAAAAATTCAAATAACTTTATGATAATTTCAAACAGTAAACTATTCCTGTACCATAA
AATGAACAAAAATGTGTTTTATACTCTTTTTTTTAAAAAAATGTGAAGGATAAGTGTATG
TAAGCATCTAAAATGCAATTTAAAAATTTGACCCAGTTGAAACTAATAGGCCAGTCTGCT
GTTTGATTTGGTATGTGTTGTATAATGTTAAGTAAATGCATGAAATAGTTAAATAAAAAA
ATTTGCTAGCTGTCTTAACTTTAAAAGAGCTGTGTTAGGTTAATTAGGGTGAATTAACTT
TACTTATATATTTTAAGTGTCCAAATGTATGGATATTTTTAAGTTCTTTTTTCCCTCTAC
CTTATTATTTCAAAAATAAAACTTGAAAGAATAGTACAATAAACCTGTATACTAGTCAAT
CCACCTAGTTCAACAATTTTCATTTTTCTGTGTATGCTTTGTTTTTTGTGAATACATGTG
TCTATATTTCTTTTTCCTAACCCATTTATGTTGCATATTACAAAATACTTCACTATGCAG
CTTCTTAGAATAGGACATTTTCCTGCTTAATTGAAACCAACCTTTAGGAAAATTAACTAT
AATTCCCTAATATCACATACCTAGTCCATATCCTAATTTTTATAATTATATCCCAAATAT
CTTCTGAGCTAAGAAAGTTTTCTCCTGACTCATTTTGGCTCATCATCATCATCTTCTTTA
AGATTTATTTATTACCCACCATACCCCTCTTTGTTTTGCACTCACTGTCTGCTCTCTGTG
TCCCTTCACTGTGTGTTCTCCTGTGTCTCCTTGTCTTTTTCTCTTTACATGGCACCAAGA
ACCGATCATGGGACCTTCCAGAGTGGGAGAGAGGTGTTCAATCTCTTGCACTATCTCAGT
TGCCTGGTGTGTTGCATCTCTCTTTTTTTTTTTTAAGGCTACCAGCTGTTGCATCTCTTC
TTATCTCTCCTCTGTATCCCTTTTTGTTGTGTCATCTTGCTGCACCAGCACTCCATGCAG
GCCAGTACACCTGTGTGGGCCAGCTTTCTGCTCAGGCCAGCTCACCCCACAGGCCAGCTT
GCCTTCACCAAGAGGCCCCAGGAATCGAACCCTGGACCCCCCATGTGGTCGATGTGAGCC
CAGTTGCTTGAGACATTGTGAGGATTTATTTTTGAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATGCCAGTATCACACACTTATATTTAATGTTGCTTGTATAATTT
CGAAATTGGGAAGTGGGGATTCCTCCAGCGTGCTGTCTTTCTCGAGCTGGTTTGGCTATT
CAGGACTCCTTGCCCTTCTGTATGAATTTAATGATTGACTTTTCCATTTCTGCAAGGATG
GCTGCAGAAATTTTGACTGGAATTGTGTTAATCTGTGAATTGCTTTGGGCAGTATTGACA
TCTTTAACATTAAGTCTTCCAGTCCGTGAACATGGAATGTTTGTTTTTCCAGTCTTTCAA
GTCTTCTTTAATTTCTCTCAGCAGTATTTTGTCGTTTTCCACATACAAGTCCTTTACCTC
CTTGGATAAGTTTATTCCTTGATATTTGATTGTCAGTTACTATTGTAAACGGAACTTTTT
CTTGATTTCCTTTTTATATTGTTCCTTGCTGGTGTGTAGAAACAGCACTAATTTTGTGTG
TTGATCTTGTAGTCTGCCACTTTGCTGAGTTTCTTTATTAGCTCTAGTAGTTTTCTTATA
GGACTTTCCATATATAGGTTCATGTCAACTACATAAAGGTCAAGTTTTATTTCTTCCTTT
CCAGTTTGAATGGCTTTTATGTCTCTTTCTTGCCAGAATCCCTGGCTAGAATTTTCAGTT
CAGTGTTGAGCAGCAGTGGCGATGCGGGCGTCCCTGTCTTGCCCCTTATCTTCGGGGAAA
GCTTCCACCTTTCACCATTGGGTAAGATACTAGCTGTTGGTTTTCCATATCAACCTTTTA
TGTTGAGGAATTTTCTCAGTGTTTTCATCCAGAAGGGATGCTGGATTTTGTGAAATGCCT
CTTTCTGTGTCAATAGAGATTACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAAGTATCAGTTTTTTTCTGGTCATTATAACTAAAGATTT
GCTGATTTTATGTCTTTTCCAAGAACCACTTTTGGTTTCATTGGTTTTTCTATTTTTTTC
TATTTCATTTCTTTCTGCTCTAATAGTTATTTTTGCCCTTTCTTCTGTTTAGTTTGGATT
TAATTTGCCCTTCTTTTTTTTAGTTTCTTAAGGTGGAAGGGTAGATTATTTATTTTCGAT
GTTTCTTATTTTCTAATATAGGTATTTACAACTGTAAATTTCCCTCCAAGCAATGCTTTA
GTTTCATTGCCTAAGTTTTGGTATACTCTGTGTCTTCATTTATCTCATCTATTTCTATTT
TATTAAGAGTTGTCTTGATGAATATTGAATTCTTTTTTAATGCCTTTATCATCAGTAGAG
ATGATTATTTTTCTTATTTGATGTCTCACAATGGTAAATTATATTAATAGTTTTATACTT
GTCAATCCTTGTTTTTTATTCTTTAAAAATTTTGTTATTTATTTTTTAAAATTTTATTAG
AGAAGTTATAGGTTTATAGAACAATCATACATAAAATACAGGATTCCTATACATCACCCC
ACCACCAACACTGTGAATTGGTGTGGAACATTTGTCACAATTGATGATAGCACTTTTTTA
TAATTATACTTTTAATATTTTTTTAACAATAGTAGCCAACATTTATTGAGAGATTCTCTG
GCCTAGGCACTGTGTGGCGTATTTTATACAGATTATGTCATTTAAAATACCCAATACACA
GGCCTGTGAAATATGACCTATTATTGTATTTTTAAAGCAATTTTATTGAGATATGTTCAC
ATACCATACAATCCTTGTAAAGTGTATATTTAGGGAAGTAGATATGGCTGGAGTGATTGA
GCTCCCGCCTGCCACATGAGAGATGCCAGGTTTAGTTCCCAGTGTCTCCTGGAGAAGACG
GGCAAAACAGTGAGCTGGTGTGGCAAACTGTCGCAACAAGGTAATGCAACAAGGAGCCAC
GAAGAGGAAAGACAGTGAGAAACAAAACAAAGCAGAGAGCTGAGGTGGCTCAAGCAATTG
TGCCACATGGGAGGTCCCAGATTTGGTTTCCGGTGCCTCCTAAAGAGAAGATAAGCAGAC
ACAGCGCATACAGCGAGTGGATGCAGAGAGAGCGTAAACGATGTGTGTGTGTGTAAATAA
ATAAATAATCTTTTTAAGAAAGTGTACTTTCAGTGGCTTCTGGTATAATCACAGAGTTGT
GTAAGAGTGTGTATTCATCACCACAATCAGCTTTAGAACATTTTATTCCAAAAATAAAAA
CCCCCTACCCCTTAGCAGTCACCTGTCAATCCCTTAACCCATACTCAGCTGTGCATGCCG
CTCATCCAGTTCCATCTCTAAACCTATTTATATTACAGTAAACAGCCCATATCTTACTAT
TTTCCTGTCAATTGTAAAATTTTAAATTTGTGCTTAAGTGAAATAAATGAGACACAAAGT
ACTAGATAAAATGTAAATATGTTTTTTTTTTAAGTTTTATTAAATTAGAGAAATTAAAGT
TTTACGGTAAAATCATGTAAAAAATACAGCTTTACTGTATATTCCTCTGTGGGCGACACG
TTGCGTTAGCATGGTACCTTTGTTACAAGTGATGGAAGAACACTGAAATAGAGCTACTAG
GTGTGTTTTCCCCGTAGACCACCCTATTATTAACACCTTTTGTGAGTGTCACACATTTAT
TATCATTCATGAAAGAACATTCTTACTCTGTAGCTACAGTCCGTCATCTACAATAGGGTT
CACTGTGTTGTCCAGTCCTTTGTTTTTTGTTTTTTAGGATGTATTTACTTCTCCGCACAC
CCCCTTCACCTTTCGTGCTCGCTCTCTGCTCTCTGTGTCTGTTCTTTGTGTGCTCGTCTT
CTTTAGGAGGCCCAGAAACCGGACCCGGGACCTCCCATGTAGGAGGGAAGCACCCATTCG
CTTGAGCCACATCCGCTCCCTGCTTGTTGTGTGTCTCATTGTGTTTCCTAGTTGTGTCAG
CTCGCCGTGCCAGCCTGCCACACCAGCTCACTCGCTTGTCTTCTTTAGGAGGCACTGGGA
ATTGAACCCAGGACTCCCATGTGGGAGGCTGGCGCCCAACTGCTTGAGCCACATCTACTC
CCCAATCCTATGTTTTATCTTTTAACTTTTATTCTAGTAACATACACGACTTAGAATTTC
CCCTTTTAAAGACATTCACGTATGTAATTCAGTGTTATTAATTACACTCATGATAATGTA
CCACCATTATCACCATTCCTTTCCAAACCATTACAATCAATCTAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATCAACCTTTTATGTTGAGGAATTTTCTCAGTGTT
TTCATCCAGAAGGGATGCTGGATTTTGTGAAATGCCTTTTCTGTGTCAATAGAGATTACC
AAGTAGTTTGTGTTGTTGTTGTTTTCATTTTATTAATGTAGCATATTATGTTAATCAGTT
TTCTTATGCTGAACTACCCTTGCATTCCCGTGATAAATTCCATTTAGTTGTGGTGCATAA
TTCTTTTAATGTGCTGGTGGATTCAGTTGGCTAGTGTTTTGTTGAGTATTTTTGCATCTA
TATTCTGAAGGGATGTTGATCTGTAATTTTCGTTCCTTCTGGTGTCTTTGTCTGGCTTTG
GAGTGAAGGTGATGCTGGCGGTGTAGAACAGGGTGGGTGGTGCACTCTTCTCTTCACTGT
TGTGAAAGAGCTTGAGCAGGCTTGGTGTTAATTCTTTCCTGAGTATTCTTGTGCATTATT
TTTCTCTATGAACTTTAGAATCAGCCAGGCTAGGAAAAAAGAACGTGTTAGCATTTTTAT
TGGGATTGTGCTAATACTTTAAATTAATTTACAGGAAATGACATCTATATATAACATTGA
GACTGTCTATGTAAGAACTGGTTGTCATTCCAATTATTCAAGTCCTTAATGACCCTCAGT
AGACTTTAAAGATTTTCTCCATACAAATTTTATACTTTTCTTGTTATAAGTATATTCCTA
AGTATTTAATCTTTTTATTCTTGTCACTGTTGCTGTCATAAACTGGGTATTTCTTGTTTA
TTATCTAACCAGTTCTCATTTATATATCGGAAAGAGTAATTTTTTAAGATACTTATTTTT
GTATATCAATTCTGTAATCACCCACTTTATTAAATTCTCTTATTTTTTAAATAATTATTA
CAGTTGATCCTCTTGCGTTTTCTGGGGCAATCATATCACCTGGAAATAATGATAGTTTTG
TCTTCTTTCCAATTTTTATTTTATATAATGTTATTTCCTTCAAAAGAGTGCCAAAAATAG
TGGTAAAATTGGTCATCTTTGTCATGTTCTTTACTCTAATGAGAATATTTTTAGTATTTT
ACATTGGGTATGATACTAGCTTTTGGACTTAAGTGGAGAGAAATGTGGTGCTATATCTAT
TTAATTAGGTTAAAGTATCAGTTTTTTTTCCTGGTCATTATAACTAAAGATTTGCTGATT
TTATTGTCTTTTCCAAGAACCAACTTTTGGTTTCATTGGTTTTTCTTATTTTTTTCTATT
TCATTTCTTTCTGCTCTAATAGTTATTTTTGCCCTTTCTTCTGTTTAGTTTGGATTTAAT
TTGCCCTTCTTTTTTTTAGTTTCTTAAGGTGGAAGGGTAGATTATTTATTTTCGATGTTT
CTTATTTTCTAATATAGGTATTTACAACTGTAAATTTCCCTCCAAGCAATGCTTTAGTTT
CATTGCCTAAGTTTTGGTATACTCTGTGTCTTCATTTATCTCATCTATTTCTATTTTATT
AAGAGTTGTCTTGATGAATATTGAATTCTTTTTTAATGCCTTTATCATCAGTAGAGATGA
TTATTTTTCTTATTTGATGTCTCACAATGGTAAATTATATTAATAGTTTTATACTTGTCA
ATCCTTGTTTTTTATTCTTTAAAAATTTTGTTATTTATTTTTTAAAATTTTATTAGAGAA
GTTATAGGTTTATAGAACAATTCATACATAAAATAACAGGATTCCTATACATCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCTAAACCTATTGTATATTG
CAGTAAACAGCCCATATCTTACTATGTTACTGTCAATTGTAAATCTCTTAAATTGTGCTA
AGTGAAAGAGATGAGACACATAGTACTAGAATATAATGTAAATATGTTGTTTTCTAAGTT
TTATTAAAATTAGAGAAATTAAGAGTTGTACAGTAAAATCATGTAAAAAATACAGCTTTC
AGGTATATTCCTGTGTGGGCGACACGTTGCGTTAGCATGGTACCTTTGTTACAAGTGATG
GAAGAACACTGAAATAGAGCTACTAGGTGTGTTTTCCCCGTAGACCACCCTATTATTAAC
ACCTTTTGTGAGTGTCACACATTTATTATCATTCATGAAAGAACATTCTTACTCTGTAGC
TACAGTCCGTCATCTACAATAGGGTTCACTGTGTTGTCCAGTCCTTTGTTTTTTGTTTTT
TAGGATGTATTTACTTCTCCGCACACCCCCTTCACCTTTCGTGCTCGCTCTCTGCTCTCT
GTGTCTGTTCTTTGTGTGCTCGTCTTCTTTAGGAGGCCCAGAAACCGGACCCGGGACCTC
CCATGTAGGAGGGAAGCACCCATTCGCTTGAGCCACATCCGCTCCCTGCTTGTTGTGTGT
CTCATTGTGTTTCCTAGTTGTGTCAGCTCGCCGTGCCAGCCTGCCACACCAGCTCACTCG
CTTGTCTTCTTTAGGAGGCACTGGGAATTGAACCCAGGACTCCCATGTGGGAGGCTGGCG
CCCAACTGCTTGAGCCACATCTACTCCCCAATCCTATGTTTTATCTTTTAACTTTTATTC
TAGTAACATACACGACTTAGAATTTCCCCTTTTAAAGACATTCACGTATGTAATTCAGTG
TTATTAATTACACTCATGATAATGTACCACCATTATCACCATTCCTTTCCAAACCATTAC
AATCAATCTAAATATAAATTCTGTACAAATTAAGCATCAGCGCCCCATTCTCTAACCGCA
GTCTATCCCCTGGTAAACTATATTCCAGATTCTAACTCTATGTGTTTGCTTATTATAGTT
AACTATATATAGTTAGCTGTTATAGGTAGCTCATATCAGTAGATCATACAAATTGGACTT
TTGTGTCTGGCTTATTTCACTCAGCGTAATGTCGTAAAGGCTCATCCTCGTTGTTGCATA
CATCACAACTTCATTTCTTTTTGTGCCTAAATAAATAAGTGGCCTCCTGCCTCTATGGTT
TCTGTTAAGAAATCACACTTAGTCTTACTGAGGATCCCTCGTATGTGATGGATCGCTTTT
CTCTTGCTGCTTTCAGAGCTCTCTCTCTATCTTTGGCAGCTGACATTCTGGTTAGTATGT
TTCTTGGAGTAGGTTTCTTAGAACTTACTGTGTTTGGAGTACATTGAGCTTCTTGAACAT
GTATATTTATGTCTTTCATAAGAATTGGGAAATTTTAGGCCATTATTTCCTCAGATATTC
TCTCTGCCTCTTTTCCCTTCTCTTTTCCATCCAGGACACCCATGATGCATGTGTTTGTCT
GCTTCATACTTCACTCAAATCCCTGAGACACTGCTCAATTTTTTTTCTCTATCTTTTCTT
CCTACTATAAGATTTCAGTTGTCTTCTAGCTAGTTGAGTCTTCTGTATGTTCAGATACGC
TGTTGTATACCTCTAGTGGTTTTTTGCTTGTTAGTTAGTTTTTAGGCATCGGGGGCTGGT
ATTGAACCCGGGACCTCCCATGTGGGAAGCAGGTCTTCAACTACTTGAGCCACGTCTGCT
CCCTCTAGTGTATTTTTTTTACCCCCCCCTTTGTGGCTTTTTACATGCTGTCTGCTCTCT
ATTTATTTAATTTCCCCTCCCTGCTTGTGGATTGCTTGCTGTCTGCTTTCTGAGTCCATT
TGCTGCGGTTCTTCTGTGTTCTTGCTTGTCTCCCTTTTTGTTGCGTCACCTTGCTGAGTC
GGTGCTCCACAGCATCTGCGGGCTGGGTGGCCCTCTGTGGCGCTTGTGTGCTTGCAGGCC
AGGTGTCTCTCCGCAGCATGCGGGCCAGCCTGCCTTCACAAGGAGGCCCTGGGATGCGAA
CCAAGGGCTCCCCATATGGTAGACGGGAGCTCATCTGATTGAGCCACAGCCGCTTCCCCC
TCTAGTGTATTTTTAATTTCTACTATTGTGCCTTTCATCCCCATATTTCTGTTATGTTTC
TTTTTATACTTTAAAATTCTAGTTTATGCTCATACATTGTTTTCTTAATATTCTTTTTTT
TCAAAGATTTATTTATTTATTATTTATTTCTCTCCCCTCCCCCCCCAACCCTGGTTGTCT
GTTCTCTGTGTCTATTTGCTGCATCTTGTTTGTTTGTCCGCTTCTGTTGTTGTCAGTGGC
ACGGGAATCTGTGTTTCTTTTTGTTGCGTCATCTTGTTGTGTCAGCTCTCCGTGTGGGTG
GCACCATTCCTGGGCAGGCTGCACTTTCTTTTGCGCTGGGCAGCTCTCCTGACGGGGCGC
ACTCCTTGCGTGTGGGGCTCCCCTACGCGGGGGACACCCCTGCGTGGCAGGGCACTCCTT
GCGCGCATCAGCACTGTGCATGGGCCAGCTCCACACGGGTCACGGAGGCCTGGGGTTTGA
ACCACAGACCTCCCATGTGGTAGACAGATGTCCTAACCACTGGGCCAAGTCTGTTTCCCT
TCTATATTTTTTAAAGATTTATTTTATTATTTCTCCCACCCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCGGCTGGCAC
TCCTGCACGGGGTGACTTTCCTGCGTGTGGGTGGTATTTCCACACCGGGCAGCACTCCTA
TGCATGGTGGCATTGCCACGTGGGCCAGCACTGTGCGTGGGCCAGCTCGCCCTCACCAGG
AGGCCCTGTGCATCAAACCCTGGACCTCCTGTACAGTAGATGGGAGCCCAGTTGGTTGAG
CCACATCCTTTTCCCTGTTCTTTATCTCTTTATGCATGTTTTCCTTCCTCTCCTGAGTTG
ATTTAGATTTGTTTGAACTTCTTTGAGTAGTTGTTTCAAATTCTTTGTGTCCTCTGATTT
TTTGTTTGTTCCCTTGACTGAGCTGTATCTTCCTGTACTATGGCTTGTACTTTTTTGCTG
ATATTTAGGCATGTGGCTATCTTGATGAGTTTACTCTGAAGGTCTGTTTTTCCCTCTTTT
CTGGGGTTTTCTTGTTGATTGGCTTTGTGTTAAGCTTTTTGACACTTGGTCCACCTTATT
CTGACCTTTAGAGCAGCGGTGTGTGATCACGTCTTCTCAGCTCTTCTTCATCTGTTCTTG
GCGTGGGTATGCACGCTGTGCATTTGGTTCACCTCCAGGAGAGAGCTTCCTTTCCTCTGT
TCCTTCTCCAGGAATCTTGATCCATTTTGTTTGTTTGCAAAGGTTTTTCTCCCTAGCTCC
TGTGATTTGTTTAAATTCTCTCCCTCACTCAGTGCCCTATTTTTCTTTCACTTTACAGTC
CTGGGACCTGTCCTGTCTTACAGCAGTTTAATGTGACACCCCTCCCCTTTCCCTGAGACT
TTTCAGACTCCAGTTTCTTCCCTGTTAGGGTAGCCTGCCCCAGGGAGCCAAACGGGGTCA
GTCCAGAAAGAGGAGTCGCCTAGAAAAATCCATTTGTGTTTAGGTGGCCCAGGCCACAGA
AACTGGATTAAGTAAGCTTACCTTTTGTCAGCCTTTCTACCACAGTCTTTCTTCTTTTTC
TTTCCCACTGGGAACAAACGTGGGAATGCCGCCACGTACAGGAGTGCTGCCCTGTGTGGA
AATAGCGCCCCGTGCAGGAAAGCGCCCCCGTGCAGGAGTGCCGGCCGACACATGCACCAT
CCTCAGCAGCTTGTGTTCCACCCTGGGTCTCTGCTCACTTGGGCTCTGAATCTGACTCGC
TGCTGTGCTCCCTGTCTGCAGTGGGAGCGAGCTGGGCCGTTACTTCTGAGCAGCTCCCAA
GCGGTGCTGGACAAGTGGGGAGGAGAACGGACTGTGGTCGAGTGGAAGTGTCTTTCATGA
TATTTTTCTTTTTCTTCGATTCATTGCTTGTGGGAGTTCTTGTCCAGTCTCTACCATCCT
CCTGAGTTCTAAGCAACTGGTAGTCGTCCTTTTATTAGCTGATTCTCTAGGGAGACTTTT
CCAGAGGATGACTTATGTCTCCATATTGATAATATCACTTCTCAATCCTTCCATTCTTGA
CATGAATTCCACTTGGTTGGGTTGTATTCTTTTGATGGCTTTTTTTATTTTTTAGGAGGT
ATTAGAAATTGAATCTGGAACCTTGTACATGGCTTGACCACTGAGCTTTACCCGCTCCCC
TCTTGTGATGTTTTGATTGTGTTTATCTGTTAACTTTTTTTAAGTCGTCTTTTGGTTTTG
TTTGTTTTTTAATCTGTACCCATTCATGATATTTTCTGAGGTTTTCTTTTAATATACTTT
GGCAGATGTTGTCTGTGTTGTGCTGACTTCATGACGAGTTGGGAAGCTCTTTCATCTTCT
GTGCTCTGAACACTTGATGAACGCTGGCGCCTCAGTTTTGCCGTCCCAGTCACCATGCCC
CTGGGCTGGTGGGCCGTGTGCGTTCCTGCTTGTCTCCCTCTCGCTCACTCTCAGTGAGAG
CAGAGTTCTTCTCACTGATCTTCTCTGAAGTGTGAAGTTTAGGAAAATTTCGCCCACGTC
TCTTCTTCCTGCACACCTGAACTGAAATTGTACTGCAGTGCAGACATAATGGGGTCATAT
TTACCATTTTTTGTCAGAAAATGTAAAACGAGAGGCTTTTACTTTGTAAGAAATAGACTG
TTTATTTGTTGAACGATAACAAAGCCCCTATTGTTGACTATTGCTCAGTGTTTTGAATAC
TTAACCGTAGTCTACCTCTTACAAGGTGTTCGGTGTTATGGCTGTATATTCTCACCTGGG
TGGACCTGTAATCGATTTCTGTTTTTTATTATAGAAATTTACAGCAACTATGTCAACACC
AGATAAGAAAGCATCACAGAAGATTGGTTTTCGATTACGTAACCTACTCAAGCTTCCCAA
AGCACATAAATGGTGCATATATGAGTGGTTCTATTCAAATATAGATAAGTATGTGTCGTG
AATTTTATCATGAATATTACTTGAATCAGAAATTAAGTTTTTCAAATGTTATAAACTATA
ACATTTTCTATAGATTTTTTCTATATTTTTCTGAATTCCTTTTTCTATTCCTCATTCCAA
TTCATTGTTTTCATTTCTCATAATTCTGTTTTGTTTTATTTTTTTCCTTTTTGAGAATAA
GGTATACATTTTTGTGAAAAATTAAATGAGAGACTCTTTGAATTAGAATTTACAAATGGA
GTGGAGATATCCTAAAACAAACCACCATTATTCGTAGTGAATGAGACTTGATTTTTAAAT
CTTGAGATTTTTAAATGCTAGTGTAATAGTAGAGAAACTGTTGTTTAATAGTAAAAATTG
TTTAATAAGTTTTTTTGGAGGTTAGTTTATTTTATGGATACTGCTTAAGCACCATAATTT
TACATAAATGTTTAAGTAAAACATAAGAGATTTGGCTGAAATCCAGTTATACAGCAACAG
AATGCATTGAGGAAAAGTATGAAAGATGTCTAACCTATTTTCATTTCCTTGGCTGCTCAA
GCAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGAATTGCGTCTGCTTATGGAGGACTCCAGTAACAGGATTGAGCCTCGT
CCTGATTGAGGAGAGCCAGCCTTAACTGAAGTACCCTCCTCGAAAGAGTCCTGCTTACAG
TGTGTGGATACGCACAGGAGTGGATTAAGTTTAAGAAGGTGTTTTTCTGGGGTAACTATA
GCCCCAAACCACCAGAGGCCGTCATTGGTGCTTGCGTTGCTGGCTGTTCATCGGCACGTC
CCTTCTCTGCTTTCTAAACTAGTTGCCTATTCTGGAGCTTGTGACTCTCATGGAAGTTCA
TAACTGAGCTGAAGATATTCCTGTATCACTGCCAAGACTGGTTTCTGGTTTGCCAAACTT
GTGAATTGAATTGCTTTATTACTATCCACTGGTTTTGCCTTCGGCTTTTCACATCGTCCT
AGTATGATCTGAATTCTTCCAGGATTCCCAAGAACTACTCTAATCCTCTCGAGTCCTCCA
GATGTCTAAAACTGATTGAATCCCAAAGAGGACTCCTTGGTGATGGTAGTACCTTTGGGA
CACAGTTACCCTGTAGCTAGGAATTGTTTATAATTACCAGATGTAAGGTCAGTGCTAGGA
TAACCTCCCAAGGAATATACCTGTACGGGAGATTTAACAAAAATCTGTATCTCCTGGAAT
CTCAGTCACAGAAAATATTCTGAGTAACTTTTTCAAATAATTTTTTTCACTAATGCCAAG
GATTTAAATCAGTTTTAGCACTTTGAATTTTTGCCTATTTTGTATATGTATGAGGTAGAG
TGAATGTTTTGCATTTTATGATTAGGGTGACATTGAAAATTGAATGTGTATTTCATATTT
TGTGTTTCATAAGAAAGTAACACTTTGCATATTAACCATTAGAATATTACTTCTATTTTA
CAGACCACTTTTTGAAGGCGATAATGACTTCTGTGTGTGTCTGAAGGAATCTTTTCCTAA
TTTGAAGACAAGAAAGTTAACAAGAGTAGAATGGGGAAAAATCAGACGACTTATGGGAAA
ACCACGGAGGTAAAAATGTTTTGCTTGTTTAAAATAAAATACCTTTTGAAAATAAATTAT
TATCTGTTAAATATACTGATTAACCAACTTTAATGTGGTTGCTTTTTATACTTATATACC
TTATAATTAAATATACAATTTCATTTTGTTCATGTCATAGACTTTGAACTTAATTTTATT
GTTTTGTCCCCTACTGTGTTCGAAGAAAGATTAATAACTATCCTAAAAAGTATTTAAGGA
AGCTATAAGGCTATATATGTACATTGTTATTATCTTTTGTGAAACTCTTTATTTCCACAA
AGCCTGTTTGAATTGCTATAAAAACAAAGTTCATCTAGCTAATACGTTACTTTCTAGGAA
TTACTTTTCAATTGAAATAACAGTTCCATTATTATCCTGCTTTCTAACATATTGGAAAAC
CTTATTTTGAATGAAATTATGAAATATGGTAGAAGAATAATTAGATAATTAATTCTCATA
TTCTCTCTTTCTGTCCAATGAAAGCATGTGCAAGACTTCCATTTGTATTTGTATTCATTC
ACCTACTAAGTGCTGTGATTTTTTAAAAAATGAATTACTGTAGAATGAATTGGCAAATTG
AAGAAAGTTGTTAAATTTGAAGGAAAAAAACATATAATACCAGAAACAATATTTTAACAG
GAAATGTGTAAGATACATTTGAAGAAGTAGGAATAAATATCAGTAGTCCTCTTTTTAACT
AGATGAATTAATTTTCAAATTCAAATTTAAGAGGAGAGAAATCAAGAAGGAAGATCCGAG
AATATTTTGAAAAAAGGAAGTAATGAAGGGAGACTACCTTTATCAAATCTTGAAATACAT
TATAAAAGCTTCCTGGATCAAGATGGCTGTGTAAGATGCTCCAGGGTGCCATTCCCCAAC
AGAAATTTCAACAACTACCTAAAGTCAGAGACATCTTCCTCAAGACAGTTAGAGTTGAAG
TAACTAGGTGAGTGCTGAATAGAGGGAATACTTAGAGATGAATGAAAACAATAACAAAAC
TTATCAAAATTTTTGAGGTATGAGGCAGGCAGTGCTCAAAGGGAAATTTGTAGCTATAAA
TGCCTACACTAAGTTAGAAGTCAGATGTCCAAGATACCAAGAGAAGTTAGAAAAAGAAGA
GTAAACTAAACCCAAAGAGCAAAGAAATAACAAAAATTAGAGTAAAGATAATGAAGTAGA
GAATTAAAAACAAAGAAACAATAGAATAAATAAAACTAAAAGTTGTTTCTTTGGAAAGAT
CAGGAAAATCAACAAACTTTGGCTAGAAGAAGTAAGAAAATAAAAGAAAGCGTGCAAATA
ACTAAAATTAGAAAGGAAAGCAGGGACATTACTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CTCAATAAAAACGCTCCAAAACCAGGAATAGAAGGGAGTTCCTCGGTATAATAAAGGCGT
ATATCAAAAACATACCACTAAAATCATACTCAATGGTGAAAGACTGAAAGCTTTCCCCAT
AAGATCAGGAACAAGACAAGGATGCCCTGTCACCACGTGTAGTCAACCTTGTATTGGAAT
CCTAGACAGGGCAATTAGACAAAAAAAAAGAAGTCTCCAAATTGGAAAGGAAGAAGTGAA
ATTTTCACTATTTGCAGATGAAATGACTTTTTTTTTTTTTAAGATTTATTTATTTCTCTC
CCCTTCTACCCTCTCCCCCATTGTCTGCTCTTTGTGTCCATTCGCTGTGTGTTCTTCTGT
GTCCATTTGTATTCTTATCGGCAACCCTGGGAATCTGTGTCTTTTTGTTGCGTCATCTTG
CTGAGTCAGCTTTCCACACGTGTGGCACCACTCTTGGGTGGGCCGCACTTCTTTCATGCG
GGGCGGCTCTCCTTGCAGGGCACACTCCTTGCACATGGGGCTCCCCTACACGGGGGACAC
CCCTGCGTGGCACCACACTCTTTGTGCGTGGCAGCGCCGCATGTGGGCCAGCTCACCACA
CGGGCCAGGAGGCCCTGGGTACTGAACCCTGGACCTCCTATGTGGTAGGTGGGTGCTCTA
TCACTTGAGCCACAATCACTTCCCTGAAATGATTATATATATGGAAAATCCTGAAAGATC
CACAGCAAAGCTAGAGCTAATAAACAAATTTGGCAAAGTGACAGGGTACAATAGCAACAC
ATAAAAATCAGTGGTGTTTCTATGCACCACTAATGAACAATCTGAAGAGGAAATCCAGAA
GAAAATTCCATTTACAATAATACCTAAAAGAATAAAATGTCTAAGAATAAGTTTAACAGG
AATGTAAAGGACTGACACACTAAAAGCTATAAAACATTGCTACAAGAAATCAAAGAAGAC
CTAAATAAATGGAAGAACATTCTATGTTCATGGATTAGGAGACTAAATATTAAGATGTCA
ATGCTGGGAAGCGGACTTGGCCCAATGGATAGGGCACCTGCCTACCACATGGGAGGTCCG
CGGTTCAAACCCCGGGCCTCCTTGACCTGTGTGGAGCTGGCCCATATGCAGTGCTGATGC
GCGCAAGGAGTGCCCTGCTACACAGGGGTGTCCCCCGCGCAAGGGGTGCGCCCCGTAAGG
AGAGCCGCCCAGCGCGAAAGAAAATTCAGCCTGCCCAGGAATGGTGCCATACACGTGGAG
AGCTGACAGAACAAGATGACGCAACAAAGAGAGACACAGATTCCTGGTGCCACTGATAAA
GATAGAAGCGGTCACAGAAGAACACACAGCGAATGGACACAGAGAGCAGACAACTGGCGG
GGAGGGGGAATGGGAGAGAAATAAATAAATAAATAAATAAATAAATAAATAAATCTTTTA
AAAAAAGAGAGAATGATCACCTCTCTCCCACTCGGGAAGACCCCAGGATGGGTTCGTGGA
GCTGCCTAATGAGAAGACAACAGACACAGTGAATGGTCACAGAGAGCGGACAATGGAGAG
GGGGGAGGGGAGGCAAAATAAAAAAAGAAAACTAAAGCAGCATGGTACTGACACAAGGAC
AGACATATAGACCAATGAAATCAAATTGAGTTTCAAAATTAAACCCTTAAATCTGGCCAA
TTGATTTTTTTTCCCTTCTCCTCCCCTGTTGTTTGCTCTCTGTCCATTTGCTGTGTGCTC
TTCTGCGTCCACTTGGCATTATCCAGCAGCACTGGGAAACTGCATCCCTTTTTTGTTGCG
TCATCTTGCTGCATCAGCTCTCCATATGTGCGGCGCCACTCCCGGGAGGGCTGTGCTTTT
TTCACCTGGGTAGCTCTCCTTGCGGGGCGCAGTCCTGGCGTGTGGGGCACCCCTACAAAG
GGGCCCCCCTGCATGGCACAGCACTCCTTGCTTGCCGCAGCACTGCGCGTGGGCCAGCTC
ACCACACGGGTCAGGAAGCCCTGGGGATCTCCCAGATAGGCAGATGCTCTGTCAGTTGAG
CCATGTCCTCTTCCTGCCAGTTGATTTTTGATGAGGGTACTGATTCTTTTCAGTGGGGAA
AGGATAGTCTCTTCAACAAATGGTGCTGGTAAAACTGGATCTCCATGTGCAAAAGGACCA
TATGGAAATATTAACTCAGAATGGATTAAAGATATAAATGTAAGAACCAAAACTAAAACT
TCTAGAAGAAAACATAGGGAATTGTTTTCAGGACCTTGTGTTGGACAGTGGTTTCCTAGA
CTTTACACCCAAAGCACAAGCAACAAAATTAAAAGTAGATATGCCAGTGCAGAGCAAACA
TCTTATTTTAACCCCTGTTCTGGTCCCAGAGCCAGTAAAGGTGACCCCGCTGGGGCTAAC
TGGGAGAGAGGATAAGAACTTATTCCATAAGGAACTGTCTGGGGAAGCGGACTTGGCCCA
GTGGATAGGGCGTCCGCCTACCACATGGAAGGTCCACGGTTCAAACCCTGGGCCTCCTTG
ACCCATGTGGAGCCGGCCCATGCACAGTGCTGATGTGCACAAGGAGTGCCCTGCCACACA
GGGGTGTCCCCGCATAGGAGAGCCCCATGCACAAGGAGTGCGCCCTGTGAGGAGAGCCAC
CCAGCGTGAAAGAAAGTGCAGCCTGCCCAGAAATGGTGCTGGACACACAGAGAGTTGATG
CAGCAAGATGACGCAACAAAAACAAACACAGATTCCCGTGCCGCTGACAACAACAGAAGC
AGACCAAACAAGAACATGCAGGAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGTCTAC
CATATGGGAGGTCCGCGGTTCAAGCCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCATG
CGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAGGAACTGTCTGAGGTACATCGATG
GCTAAGCGTTTGTTTAGTCTTTCATATCCAATACCATGGCTAGAATAGCTTTTAATATTT
AGAATACTTAACTAATTAAAACAGTTTTCCCATTCAGAAGCAGCTCGTTTCTGAATGACA
ACTGAAGATGCCAGCCTTAAGAGGTGCTGTCAGTAAGCAGTTTGTTCACTGAGGAGTCCA
GCACCTTGCCTGGAGCCCAAGCAATGATTTGAGGGAAATTCGAGTCACATTTCTGCTGGA
CTCCATTCTGCCGTTAAAGGAATTCAAATCTTGGAGAACATTTCAAGGCAATCCAGTCTA
GGTGTTCAAATTAGAATATAATTCAGCCTTTCTACTATGTCCAAAAAAAGTTTTTTTAAT
CTTAAAAAAGTAGATATATGGGACTTCATCAGAATTTAAAACTTTTGTGCATCGAAGGAC
TTCCTCACGAAGATAAAACAGCAACCTGTAGAATGTGAGAAAATATTTGGAAAGCACATA
TCCAATAAGGGTTTAACATCCAGAATACAAGGAAATCCCACAACTCAACAACAAAAAGAA
AACCCAGTCAGAAAATGGGCCAAAGACTTGAATAGACATTTCACCAAAGATGATATACGA
AGGACCAAAAAGCACACAGAAAGATGCTTAACATCATTAGCCATTATGGAAATGCAAATC
GAAACTACAATGAGATACCTTTTCACACCTAGCAGAATTGCTTCTATTAAAATTTTAAAA
AAGGAAAACAATGTTGGAGAAGATGTGTAGATAATAGGAAATCATGTTCATTGTTTGTGG
GAATTTAAGGTATAGTCATTGTGGAAAATTGTTTTAGAAGTTCCTCAGAAATTAAGTATA
GAATTTCCATATGAACCAGGAATCCCACTTCGAGGTATATACCCAAAAGAATTAAAAACA
AGGACTCAGACAGATATTTGCACACTGATGTTCATAGAAGCATTATTTACAGTTGCCAGA
AGATGAGTCAACTCGAGTGTGCGTCATCAGGTGAATGGATAAGCAAAATATGGCCGTAAT
AATGAATGACGTTCCAGCACATGCGACAACACGGATGAACCTTGAAGACATCGTGTTGAG
TGAGAGAAGCCAGGCACAAAGGACAGAGAGTATATGATTTCACTTTTATGAAGTAATTAG
AATAACAGTTTCATAGAGTCAGAAACTAGAATACGGATTACTAGGGGTTGGGGGTAGGGG
TAGGGAATTACTGCTTAATTGGTACAGAGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGTTTCTCTTTAGGGTGATGGAAACATATTCATAATAGATGGTGGTGA
TGGTAATACAACAATATAAATATAATTAACACCTCTGAATTATATATTTGAATGTGGTTA
AAGGGAAAATTTTAGGGCATATGTATGTTACTAGAAAAAAATTTTTAAAAAGTACAGTAC
AGTTCAAAACCATCAGTTAACACTGGTGTATTCTGTGAGCTATAGACTATAGTTAATAGG
ATAATTATAATATTGTTTCATCAATTGTAACAAAAGCACCACACTAATGCAGAGTATTAA
CAATAGGGAAAACTCCATGTGTGAAGGGTGGTGTATGAGAACTCTATTTTATGCATGATT
TTTCTGTAACTTCTCTAATAAAAACATACAGTATAAAATAACAGTAATAGAACAGAGTAG
TAGTGATACCATGAATAGAAAGATCAATGGAAAAAAGAGAAAGTCCACATACAATCACAA
ATGAAAATGGGAATCTAGTTATAAAAATTGGGTTAGTTGCATCTCAAATAAAGGAAGATG
AATTATTCATTTAATGGGGATTTAGACCACACGGTGGCAATTTAGAGGAAAAAAATAAGT
TTCTTAATATAGCTCACACTTTATACCAGGATAAATTTGAAATGGATCAAAAATTTAAAG
TTTTTAAAAATGAAATGATGAAACTATAATACTAGAGGAAACCATAGGGAAAGATATTTC
TGAAAGGCTCCGATGTTAGGCACCATTAAGGAATATTGTTAAATTTGCAAGTATCACTTC
ACAAAAATAAAATTCTTGCCAAAACAGAAAAAGTCTGATAACCCATAATAAAAATAATTA
TAAGTAGACAAGTCATAGGAAAAGGGAAGAAATGTCTCTTCTAAACTCAATTTTACTTTT
ATTTTTCATTTCTCATGATGAGTCTGTTGAGATACTGTATTTTAACTATCAGATTGACAA
AGTTCATAATGCTTTAATGTGTTAAATTGACAATGATGTGGAGAGATAGTACTCTCATAG
TTGCTAGTGAGCGATTAAAGTTATATAACCTCTGCAGAGAGCAATTTGGTAATATCTATC
AAAATTACAAATTTCCATGCCTTCTAACAATTTATACCATGGTATTGTTTGCACACGAGT
GAAAGGACAATACAGGTTATTTATTGCAGCAGTGTTTGTAGCAGCAAAGGAGTGGCAACC
ACCGAAATGTCCATAAATAAGGGAAAGATTAGATAAGATATACTATCTCCATATGATAAA
AACCTATGCAGTCATTTAGCACAAACAAAACAGAGAGGAAACTCTTTATGTCTGCTATGG
AAGTGATTGTTAAGATTCATTAAGAGGGAAACGGACNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAAAAATACAGAAAATGACCATGTACAAAATTATATATTATCAGCTAAGGTTT
TTCTTTATATTTCCAGTCCTTATTTGTAATAAGCAATGATCTACTTTGTAAATCATGCTC
ATCTCAATTTTCTTTTCACTTAGGTTTATTTGGTTTCTGAGAAATTATTTAAATGGCAAT
AAAGCCCATTATGTATCTTTAAAGGAGGTGGCTATACCGTGGCATAAAAGCCATGTTTGA
ATACTTTTGGTTCATCCTAGAATTTGAAAATGGGAAGCAATACAGGTCCTAATAAGAGGG
AGTGCAGCATTCAGACTTCTAGGCAGGAAGTGCGATTAAAGATTGGCACAGTGGCAAGTC
TCTAATTTCTTTATTGGTAAGCCCCCTGGGACATAGAGAAAATGTCAGGTTCTCCAAGTT
AGAAAATTGAAATTGAACTTTGGCCTTAAGGTTCCTGGGACCCAGGCAAAATTCTGTCAA
AAGATAGTGAACAAACCCTCATGCTTTGTAGGAAGGGATAACTTAAACTTGCTTTTGTAT
CTTTGAGTCTTGCAAGGTCCTGTTTTTAAACAGATTAAATGTAATTTAATTTGAAGAGAA
GCAGTTATTTCTGAGAACCAGTTTTAAATACAGTGCTTAAAAGAATGAGTATAAAGGGAG
CAAGGATAGTCAGATTTATGTTTTATATCAGGTAGTTATATGATTTTTGTAATTTATTCT
AGATGTTCTTCTGCATTTTTTGAGGAAGAGAGATCAGCATTAAAACAGAAACGGCAGAAA
ATAAGACTCTTACAACAGAGAAAAGTTGCAGATGTTTCACAATTCAAAGATCTCCCAGAT
GAAATTCCTTTACCCCTGGTTATTGGAACCAAAGTTACAGGTAAGCTTTTTAATATTTTG
ACATTTTATCTTTTTACCAAGATAATTTCTAATAGAGGAATGGCTTTTACATTTAGAAAG
CTTAAACCCTATAGTTCTGAAGCTATTTACTGTAGAAGTTACTCTTTCCTCATGTATGAA
GTTTGTTTTTAAGGTAATTGGAAAAAAGTGTATTGGTTCAAAGTAACATTTACCACAATG
TAAACTAAATTAAACTGCCACAAATGTGAAATGTAAAATCTGCTGGAATATGTAGAGATA
TGTATTATTTAAATTTTAAAAGGATTCTAATTTTTGCTTCCACATCATTTATTTTTCTTC
ACTAACCAGTCTTTACCAGTTAATTAACAAACACCATTGGTTTTGTAATCCTTGAACCTA
AAAATAGTCCATTTCTAACATGAATAAAACTAAATTATTTAGTAGGTAATTTGCTCAAAA
ATTTTTAAGAGTGCAAGTTCTGTCAGTTTATAGGAGTGATTCTGTGTACTTACTTCAATT
ATAACACATATAACGTTGGGGACTGAGTCTTGCAGCCCCCAGGGGGGATGTTCCTGTGGG
TGTGAAGCCATTGCACACAGGACTCCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTCGTACATGCAAAGCAGGTGCTCAGTCACGGGGCTACAGCCACTCCCTTT
CCTTCCTTTTCTTTTTTTTTTTTTTTTTTTTTAAGATTTATTTTCTTTATTTAATTTCCC
CCCCTCCCCTGGTTGTCTGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTTGTCCGCT
TCTGTTGTCAGCAGCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCTCTTTCT
TTTCACGCTGGGCGGCTTTCCTCACGGGCGCACTCCTTGCGCGTGGGGCTCCCCCACGCG
GGGGACACCCCTGCGTGGCACGGCACTCCTTGAGCGCATCAGCACTGCGCATGGCCAGCT
CCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGTGGACCTCCCATATGGTAGACGGACG
CCCTAACCACTGGGCCAAAGTCCGTTTCCCTCCTTCCTTTTCTTTTATGATGACATCTTA
AAAAAATTTTTCCCTCCCCCTCCCCCTCCCCCTGCCGTTTTTGCTGTCTGTGTCCATTCG
CTGTGTGATCTTCTGTAGATATTTCTCTTTTTGTCTTCTCGTCTGGCTTTTCTCCTCTAG
AATTCACCAGGATTCAATTTTGACAGGGAGAGAGGTTCCCTGTCAATTGCGCCACCTTAG
TTCCTGGTCTCTGCTGCGCTTCACCTTGACTCTCCCCTTGTCTCTCTTTTGATGTGTCGT
CACCTTGCTGCGTGACTCACGTGTGTGGGGCACTGGCTCACCACGCTGGCACTCGCGTGG
GCACTTGTGCAGGCACTGGCTCACCACGCAGGCACTTGCTTGGGCACTGGCTCTCCACGC
AGGCACTCGCGTGGGCACTGGCTCGCCACGCAGGCACTCGCGTGGGCACTTGTGCAGGCA
CTGGCTCACCACGCAGGCACTCGCGTGGGCACTGGCTCTCCACGCAGGCACTCACGTGGG
CACTGGCTCACCACGCAGGCACTCACGTGGGCACTGGCTCTCCACGCAGGCACTCGCGTG
GGCACTTGTGCAGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACTGGCTCGCCACG
CAGGCACTCGCCTGGGCACTGGCTCGCCACGCAGGCACTCGCGTGGGCACTGGCTCTCCA
CGCAGGCACTCGCGTGGGCACTTGTGCAGGCACTGGCTCGCCACGCAGGCACTCGCGTGG
GCACTTGTGCAGGCACTGGCTCACCACGCAGGCACTCGCGTGGGCACTGGCTCTCCACGC
AGGCACTCGCGTGGGCACTGGCTCACCACGCAGGCACTCGCGTGGGCACTGGCTCACCAC
GCAGGCACTCGCGTGGGCACTGGCTCACTACGCAGGCACTCGCGTGGGCACTTGTGCAGG
CACTGGCTCGCCACGCAGGCACTCGCGTGGGCACTTGTGCAGGCACTGGCTCGCCACGCA
GGCACTCGCATGGGCACTTGTGCAGGCACTGGCTCACCACGCAGGCACTCGCGTGGGCAC
TTGTGCAGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACTGGCTCTCCACGCAGGC
ACTCACGTGGGCACTGGCTCTCCACACAGGCACTCGCGTGGGCACTTGTGCAGGCACTGG
CTCTCCACGCAGGCACTCGCGTGGGCACTGGCTCTCCATGCAGGCACTCGCGTGGGCACT
GGCTCACCACGCAGGCACTCGCGTGGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCA
CTTGTGCAGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACTTGTGCAGGCACTGGC
TCACCACGCAGGCACTCGCATGGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACTG
GCTCACCACGCAGGCACTCGCGTGGGCACTGGCTCACCATGCAGGCACTCGCGTGGGCAC
TGGCTCTCCACGCAGGCACTCGTGTGGGCACTTGTGCAGGCACTGGCTCTCCACGCAGGC
ACTCGCGTGGGCACTGGCTCGCCACGCAGGCACTCGCGTGGGCACTTGTGCAGGCACTGG
CTCACCACGCAGGCACTCGCGTGGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACT
GGCTCACCACGCAGGCACTCGCGTGGGCACTTGTGCAGGCACTGGCTCTCCACGCAGGCA
CTCGCGTGGGCACTGGCTCTCCACGCAGGCACTCGCGTGGGCACTGGCTCACCACGCAGG
CACTCGCGTGGGCACTTGTGCAGGCACTGGCTCTCCACGCAGGTACTCGCGTGGGCACTT
TCTCGCCATGCAGGCACTTGCGTGGGCACTGGCTCGCCACGCAGGCACGCTTTCTCTTCT
TCTTTTTCACCAGGAGGCCCCAGGGATCACACCCAGGTCCTCAGAATCTCTATCACTTGA
GCCACATCTGCTTCCCATCTACTGATCTATTTTTAATAGGTCAGAATACAGAGTTGCTAC
AGTATATTATCTAAAATGTTCAGTTTTTTATCTTTTGCTATTTCTAATCTGCTGTTGAGC
CCCTCTAGTGAATTTTTCATTTCAGTTATTAAACTCTTAAATATCAAAGTTTTCATTTGG
TTCTTTTGTACAATTTCTATTTATTGAAATTCCCTATTGAGTCCTTGTCATATTTCCTTT
TAGTTCCTTGCATATTTATAATACCTGTTTTTTAAGTCTTTGCTAAATCTAACATCTCTG
TCACTTTCTATTTAATGTATTTTTTCTAATAATCCTCACACTTTCCTATTTCTTTGCATG
TCTAATAATGTTTGGCTGAAAACTGGACATTTTAAATAATGTTGTAGCAACTCTGTATTC
TGATTTCATCTTGAGAATTTAGGTTTGTTTCAGTAACTTCATATACAACCACTGATGTCT
CTGCTTATTTTTTTCATTCTTTTATTTTTTGACCTGATTTCCTAGGGCTCTTTCCTGTGT
TCTATATATCATGGTGGTCATCCAGTGATTTGGACAGAGGTTGTGCTTAGACATCCTGTG
TCCAGACAGCCTCTAGTTCATGTCTGTGTTGACTGGGGAACAGATTCAAAGTTGCTGCCA
GTATTAAGTCATACTTAGCTTTTACATTTTGCCAGACTCTTTTGGATCTTCCCCAACATG
TGCATAATTTCCTAGTTAGCCAGGGATATGAGGTGAGCATGCTGCTCTCCTTCTCAGGAT
CTCTGGTTAAGTTTCTGGCTAGCCTGCTGCTTGCCCCAACAGGACCACAACCTCGTACTT
ATAAATCTACAGATATTTCCAGTTCATTCCAGTTCAGGTGTGCCACTTCGACCTGGCACA
GCTTTTGGCTTTGCCCCCTGGCCCATATCACGCCCCTTCCCGGGCGGTTTTCATGAAGAG
GCGACCAGAGTAAGGCTGCGTGCTGGTGGCCGAGGCTCAGGTGTCGAGGGTGGCCAGCCG
CCTGAGGCCCCAGCAGTGGTCAACACAGTCATTTCTGTTTGTTGTCTTTATCTGGTTGAT
TTCCAGTGCCCTGAAATGGTCTTTTTTGACAATTCTGTCACATTTATACTTATCTTTTGT
GGAGAAGAATCTCTGACATCTTGACATTGCCGTAACTGGAAGTTCTTTTCTATGTTTGTT
TATTCAAGTCTATTTATTATTCATATCTTCTGTGTCCCTATTTATTTTTCTCTTAATCTT
TCCAGTAGAGACTGAAAGTGATATTTTAGTTTCCTACTACAATTTGTATTTTTATCCATC
AGTCCTTTTATTTTAAAGTGTTTACGTTGAATATTTCTTTGCCCTATTAAATGATATTCA
TATTGTACTTATTGTCAATATAAAATATGTTCCTTTACCCAATTTAATGCCTTAAGTTCT
ACTGTTGTTATATTTTTCACTCCTGCTGGGTATTTTTCTGGATTTTTCTGGTTTCAGACT
GGACTTCAACAATGATGACACAAATGGGCATCTGCGTCCCAGGTCCCCTGGACCACCCCG
TGTGCTGATCCACTAGAAATACCCGCACTGAGATTTACTATAGCAAGAAGAATTTTACAG
AGCAAAATTAGTAAAAGGAAAAGTGCACGGGTGAAGTCCACAGGAGACCAGGCACAGGCT
TCCCAGGGGCACACAGGGTTAGTCAGTCCCTCCAGCAGCAAGTCCTGACAGCACATGTGA
AGTGTTGTCAGCCAGGACGTTCCCTGGAGGCCCAAAGCCGGAGGTTCTTCTTGAGGTTGG
TCATGGAGGCACCTCTGTCAAGCACAGACCCAAAATTCCAGACTCCCAGAAAGAAGGTGA
GTCCAACGTAAACCACTGCTATTTGCAGTCTAGACATGGGGAAACTCCTGAATCCCAGGT
TTCCTGATGTCAGCCAATGGCCAACCTTGTAGGTTGTCCTTTGTAAGTTTAGCAGCCTCA
GACCTGCTGTAGTAAGTCTTTCCTGCCCAGCATCCTTGTCTTTTTTTTAATTTTTTTATC
TGTTTTGCAATTTGTGGTTCGAAGCAATGAATATAAAAAAGTTTTTCCAGGTGGCTTAAG
CAGTTGGGCACCTACCTACCACACGGGAAGTCCTAGGTTTGGTTCCCAGTGCCTCCTAAA
GAAGACGATGAGCAAGACAGCGAGCTGTGCAACAGGCTGGTGTGGTGAGCTGATGCAACA
AGATGATGCAGCAAGATGACAAAACAGAGACACAATGAGGAAACACAATAAGAGCAACAA
CAAGCAGAAGCAGAGATGGCTCAAGCCATTGGGTACCTGCCTACCACATGGGTAGTCCCA
GGTTCAGATTCCAGTGCCTCCTAAAAGGATGATGAGCACACACTGAACAGACACAGGGGG
CACACAGCGACTGCAAAAGGAGTGGGGGGTGAGGGGCAATAAAAATAAATTAAATTTTAA
AAAGTGTTGGGAGTTCCTTTGTAAAGAATACTGTAAAAAGTTTTTCCTTTAAAAACAAAC
TTTTTAGTTGGATAATTATATAATTTTATTCATATAGCAAATTATTGATTATTCATAACA
TTTCCTTTGTTTAGAAAATTTTTTAAAACCTAAAATGTGCTTGTTTTTAAATTATGAGAG
AAGATAATTCTGTACTTTCTGATGTTAAATTACGTTCTTGGAGCTTATCGTGTGTCTCTC
AAACATCACAGTACCTTTGTTCTTTTCTCAGCACGATTACGTGGTGTTCACGACGGTCTG
TTCACTGGACAAATAGACGCTGTGGATACTCTGCACGCCACGTACAGAGTGACTTTTGAT
AGGACAGGGCTCGGGACGCACACCATCCCTGACTACGAAGTTCTCGTAAGTAGCGCTTCT
AGTGCTGCGTGCGCCGTGCCTGCTAACCACGGCAGGTGGCGCCCTCGAGGACACGGTGTT
TCATGACAGCATCTAGACTTCAGGTCATGGGGAAGAGATGTCTCGGGGTTCCCAGCCCTG
TCTAGTAGGCCCCTCATTCTCAAACTGTACTCAGGTCCTCCACATTGAGGAGAAACTTGA
GAGGACGTGCTCTGGACTTCTGTTGGACCTTACCCCCTGCACGGAGTGTGCAGACTGATC
CCCCTAACGGAAGGAGCTCGGGGCGAGCACAGCACCCTTCCCTTCAGGCTGTTGGGTTAA
AGTGCGGGCCTCTACAGAGACCTTTGGAAGTAGGAAGTAGCATCTTCTTTGAAAGTAGAG
CACATCTACTTTCACGTGTGTTCTTTTTTATCTCAGAGTTCTTTAGGGTGGGTATTAATT
ACCACTTCAAGACTGTAGCTTACGCGAGAATCTGGATCTCTTGTCTGATACAACCCACTA
TCTCATGATCATGCTTGATTTAGCAAGGGCGTGGAAATTATGTACCTTTTTAATAAGGTA
AAATAATTTTGAGAACTGATATAAATCTGCAATCTAGTAGTTTTTTAAAAGTGAATAATG
AATTTTATAATAAAATAGCCTTTCTCTAAGCGGTATGGAAGTTAGATTGTCCACTGTTAG
CCTCCCTTTTATCATGAGTTTTAACTTGATTTTTTTTTTAAAATTTATTCCCCCCTCCTT
GCAGCTTGCTTGCTGTCTGCTCTCTGTGTCCATTCGCTGCGCATTCTTCCGTGTCTGTCT
GTCTCCCTTTGTTGGGTCATCTGCGGGTGCGCCGGCTGTCAGCTCTCCACGGGCGTGGGC
GAGGCTGCCTTCACAAGGAGGCCCTGGGACGGAAACCCAGAGCCTCCCATATGGTAGACG
GGGGCCCGGTGGCTTGAGCCACAGCCGCTTCCCTTCGCTCGATTTTTAAGGATTATGAAT
TTATAATTAAAAATAAAAATTTCTTTGTCTCCTTAGTTCAAAAATAGAAGTGAAGAATTT
TTTTTTTTAAATGATGGCTCCCTATTTATTCTGAGGATTTCCTTATCAAATATCCTCGTT
AGAGCAGAAAATAGGGGGAATGAAGATTCAGAGTAAATATATGGCAAAAGACACCAACCT
TATGTTACTTGGAAGAAAGCAAGATTGCTTTTCTGTTTGTGTAATTTTCTTGATGAGATT
ACCCAAATATTTCTCTTTGACCATGTAAGAGTTCGCTATAATTACAGTAGGAAGTATTTC
AGATTCTCTCTAACACACAGATCACGTGGCCACAGAATACTGTAATATTAATCTTTGATT
CTCTGAATTGTTTGATCCTTGGTCTTTTTCTTTTCTTAATTAGTATTCTGTTTTATGGTT
CAGCCTTTTAGCAGCAATGTAGTGTTTTCTATTCTGACTTAAGTTCTAGGCTTTAATCTT
GATAGAACAATATATTCTATGATAAATTATAGCATATGAGCTAATGTATATCTCAAACTA
AAATACAATGTTTATAAAGCTTAACTGGTCGGTAAAAGTTTTTAAGTCTTGTGGACATTC
TCTTTTCTTAAAGAGTAATGAGCCCCATGAGACGATGCCAATTGCTGCCTTTGGACAGAA
ACAGCGGCCTTCTCGGTTTTTCATGACTCCACCACGGTTACATTATACTCCTCCTCTCCA
GTCCCCTGTTACAGTGAGTAATATTTTAGAAATGTCATCAGTAATTTAAATGTTATATGC
ATGTGAGCTGTGTTCTTATGAAACATACCTGTTATGGCAACTTAAGCAAGTAGCCGGATT
ATGTTGAGTTGTCACATATTAAATAAAATAAGTTAATAATTGTCTCAATTCTGGAAATAT
TTTCCTTTTTATAGAATTTAAAATATATAATTTGCTCTTTATCTAGAAATAAGATGTTCC
TTTTAAACAGTCAATAGGTAAATGGTTCCCTTTTATTCCCACAGGATAATGATCCTTTAT
TAGGACAGTCACCTTGGAGAAATAAAATTTCTGGCTCCGACACTGAGACATTAGGTGGTT
TTCCAGTAGAATTCCTTATCCAAGTGGTAAGAATTGCTCTGAAAATCTTGGCTGCCTGTT
AAAAATTATCAATGTCTTTTGTGTTACTAAAGTTGAAAGTTTTTCTGGGACCACATATTT
CCACATATGTATATATATATATATGTTTGTTTGTTTTTTAAACCGTTGTAGTGGTCTTAA
GAACTCTGTTATTTCCAACAGAGCTTTAAAATAAAAAGTTCCAACAGTAAAAAAAAGAAG
ACTTGGAGATATTTTTTCTTTGTTTTTTTTTAAGCTTTGGTACTTATTATTGCCCTGTTT
TAAGGATATTTTATTTTAGCATATGTTCTGTGGAATTCCGAATGCTTATCTGCTAATAAC
GTGTGTAATTATGAAGGCTTTTATGTAGTAACCTCAATGCATACTGCCATTTTCATCCTT
TTCATTAACACTTATGCTGTCTTTGCTGCATGGTCTGAAACAACTCTGTTTATTTTACTG
ACAGTAGAAACAGCTATTCATTTGCAAAGTACATAGTGATTAGAAACTAAGAAATCTAGG
GAAATGGACTTTGCCCAGTGGTTAGGGCATCCGTCTACCATATGGGAGGTCCGAGGTTCA
AACCCCGGGCCTCCTTGACCCGTGTGGAGCTGGCCATGCGCAGTGCTGATCGCGCAAGGA
GTGCCCTGCCACGCAAGGGTGTCCCCCGCGTAGGGGGGGGAGCCCCACGCGCAAAGAGTG
CGCCCGTGAGGAGAGCCGCCCAGCGTGAAAAGAAAGAGCAGCCTGCCCAGGAATGGCGCC
GCCCACACTTCCCGTGCCGCTGACGACAACAGAAGGGGACAGAGAAACAAGACGCAGCAA
ATAGACACCAAGAACAGACAACCAGGGGAGGGGGGGAAATGAAATAAATAAATAAATCTT
TAAAAAAAAAAAAAAAAAAAAAGAAATCTAAGCCTAAATTGAAATGTGTAGAATTTTTAT
ATAGAGCATTTTTACTGAATAACCTGAATCTAAAGAATGTTAAGTAGTTTGTTTTGAAAA
TTAGATTTAAAAATTATTTAGTTTCAATTATAGTCTAATTATGTTTGGCTTGCTTCTTTT
TATTTTCCTTCTTTAAAAGAAAAACTACTTTAACTTGGGATAGATAGGGTCTTTATAAAT
AAAAATGTTAACACATCCATTAAAATATTCACAAATGTTTACCTTTTACAATTGATAACA
TATTTTAAGGAAAATCTTGTCATTTGTGTGTGTGTGTGTATGCATAAGTATAAAATTCTG
TATTCCTTAATTATATATTGTTCATTATCCTTGCAATATAGAAATTTCTTCTGCCTTTTA
ACTTCCATAGGTAGATATTTTTATGTGAAAAGTTGAAAATATGAAAAGAAGCCAAAGTGT
AGCCTTTTTTTAAATGATTTAAATAGTGGAAGTAAAAAAAATGCTATTATATGTCATATT
TAGATGTGTGTGTGTATTAGACAGATAGAGGGAGGGTGGGAAGAGAGAGAGAGAGAGAGA
TCAACCAGCAGAGCTCTTTTGCATTATTCCTAGTACTGGACTACTGCAGTGTTGATATTT
TGAGTATCTAAGGGGTCATTTATAGATAAAATTAAGGTGTTTTAATGTAATTTTACCTTT
GTAATATGTAAGGGTTTACTCATCTTAATATTAGGCTTTGAAGTAGATAAGTATGTTTTT
TTCTTTCTCTGTTCTCTTTTTAAAAAGATTTCTTTCTTTCTCTAATCCCCCTACCTCCTC
ACCCACCCCCATTGTCTGCTCTCTGTGTCCATTTGCTGTGTGTTCTTCTGTGTGTCTGCT
TGTCTTCTTTTTAGGCAGCACCAGAAACTGATTCCTGGACCTTCCGGCGTGGGAGAGAGG
TGCTCAATCTCTTGTGCCACCTCAGCTCCCTGGTCTGCTGCATCTCGTATTGTCTCTCCT
CTGTGTCTCTTTCTTTTGTGTCATATTGCTAAGCCAGTTCTCCATGTGGGCCAACTTGCC
ACAAGGGCGAGTATTCCTGCTCAGGCCAGCTCTCTGCACAGGCTAGCTCTCCACACTGGC
CAGCTTGCCTTCACCAGGAGGCCCCAGGAATCGAACCCTGGACTTCCCATATGGTAGGCA
GGAGCCCAATCACTTGACCACATCTGTTTCCATCTTTCTCTGTTCTTAATAAATACTTTT
TTCTTGTGGCAAAATAAATACCATTAAAATTTTCATAAGTTTTATAATTTATAGTTTGCA
ATGAGTTTTCTTTTTAAGGGAGTTTCTATTTCTTGGGATTAGGAATTTTGAGGATTCCAA
AAAGACTGGTCTACTTTTTCATTTTGAAAAGAATTAAAACAGTATCAGTTTTCTATCAGA
AACAAGCAAAAAACTCAAGAAGAACCGAAAAAAGAAACAAAGGGTCGGAGAAACTATTAA
CTGCATTCCAACCTCCTTTTACTGCTTCTCATCCTAAAGAAATATACAAGACTCCATTAA
AATCTAATACCTTAGAGAAGAAGCAGGCCAAGTCAGAGCTCTGGGTCTCCTGAGCCTAAA
TGAAGGTGTTTAGGCACGTCTTACCCTGGAGCACAACCGCACTCAGGACTGGAGTGGGCA
CTCCCGCTTTCTTTGTGTGTGTGGTTTTTTTTTTAAGATTTATTTTTTATTTATTTCTCT
CCCCTACCCCCCCTTCCCCAGTTGTCTGCACTCTGTGTCCATTCGCTGTGTGTTCTTCTG
TGACCGCTTCTATCCTTATCAGCAGCACCGGGAATCTGTGTCTCTCTTTGTTGCATCATC
TTGTTCTGTCAGCTCTCCGTGTATGCGGCACCATTCCTGGGCAGGCTGCACTTTCTTTTG
CGCTGGGAGGCTCTCCTTATGGGGCACACTCCTTGCGCGTGGGCCTCCTCTACATGGGGA
CACCCCTGCGTGGCAGGGCACTCCTTGCGCACATCAGCACTGGGCATGGGCCAGCTCCAT
CAGGAAACAGGAGGCACCGGGTAATGAACTGCGGACCTCCCATGTGGTAGACAGACGCCC
TATCCATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTTAGTATAATCACAATGGTGTGTATCATCCTGCTCTCT
TTTGGTTACTATTTGCCTGGAATATCTTTTATCAACTTTCACTTTCAGCTGGTTTGTATT
CCTGTGTCTAAGGTGAGTCTCCTATAAACAGTATAAGGATGGCTCATATTGTTTTGGTCC
ATTGTGTCAGCCTATGTCTTTTTTTTTAAGATTTATTTAGTTTTATTTCTCCCCATCCCC
CTCATTGTTCGTGCTTGCTGTGTCTGTTCATTTTCCTTGTTTCCTTAGGAGGCACCAGGA
ACTGAACCCGGGGACCTCTGATGTGGGAGGGAGGTACCTAATCACTTGAGCCACCTCTAT
TCCCTGCTTTTGTTGTGTCTCTCAATATGTTTTTTTCCTTGTGTCTCTTGTTGCTTCATC
TTGTTGCATCAGCTTGCCACACCTGCCCGTCATGTCAGCTAACTGTCTTTGCTCTTCTTT
CTTTAGGAGGCACTGGGAACCTCTGCTCCCTGCTTTGTTGTGTCTCTCTTGTTTTTCTTC
TTGTGTCTCTTTGTGTCGTCTTGTAGTGTCAGCTTGCTGCACCTGCCCTTTGTGCCTGCT
CACTGTCTTCTTTAGGAAGCACTGGGAACCAAACCACAGACCTCCCCTGTGGTAGGCAGG
AGCTCAATCGCTTGAGCCCCATCCACTTCCCAGCCTATATTTTTTCATTGGGGAATTTAA
TCCATTCACATTCAATGATATTACTGTAAATGCATTATTTACTTTCACCATTTTATTATT
TGGTTTTCATATGTCATATTTTCTATTTGTCTTTTTACTCTTTTGGTTACCCTTTCTGCT
ATTCTTTCTTCTATACTCTCCTCCAAGGCTCTCTCTCCTGTCTTTTTTTCTAGGCTGTAA
GACTTCCTTTAATATTCCTGTAAAAGTGGATACTTTTTTACGAACTCTCTTAGTTTCTGC
TTGTTTGTGAATGTTTTAAACTTACGTTCATATTTGAAGGAGAGTTTTGCTTGATAAAGA
ATTCTCAGCTGACAGTTTGTCTCTTTCAGTATCCTAATTGTATCATACCGCTGTCTTCTT
GCCTCCATGATTTTGATGAGAAATCCTCACTAAGTCTTACTGGGCGTCCCTTACTGTATG
TGTTGGTTTGCTTCTCCCTTGCTGCTCTCAGAAATTTTTCTTTATCTTTGATACTTGACA
TTCTGGTAGTATGTGTCTTAGAGTAGGTCTATTCAGATTTATTCTGACTCATGTATGATG
TCCTTCTTGGATGTGCAAGTTAATTTCTTTTGTGAGAGTTGGGAAATTTTCAGCCATTAT
TTCCTTAAATACTGTTTCTGCCCCTTTTCCCTTCCCTTCTCCTTCTGGAACTCCCATGAC
ATGTATGTTGTTGCACTTCATGTTATTATTCAGCTTCCTAAGCCCCTGTTCATTTTTTCC
ATTCATTTCTCTTGGTCTTTTCTCTCCTGAACTTCAGCTATTCTGTCTTCTGTATCACTT
ACTCTTTCTTCTATCATTTTGAATCTGCTGTTTATGTCTCTAATGTGTTTCTGGTTTTTG
CTTTTTTTTAAAGATTTATTTATTTATTTAATTTTCCCCCCTCCCCCGGTTGTCTGTTCT
CTGTGTCTGTTTGCTGCTTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCGGCACGGG
AAGTGTGGGCGGTGCCATTCCTGGGCAGGCTGCACTTTCTTTCGCGCTGGGCGTCTCTCC
TTATGGGCGCACTCCTTGCGCGTGGGGCTCCCCTACGCGGGGGACACCCCTGCTTGGCAC
GGCACTCCTTGCGCGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCC
CAGGGTTTGAACCTCAGACCTCCCCTGTGGTAGACGGACGCCCTAACCACTGGGCCAAGT
CTGTTTCCCTCTAATGTGTTTTTTTTTTGTTTTTTTTTTAAAGATTTATTTATTTTATTT
TAATTCCCCCCCCTTCCCTGGTTGTCTGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCT
TTATCCGCTTCTGTTGTCGTCAGCGGCACGGGAAGTGTGGGCGGCGCCATTCCTCGGCAG
GCTGCTCTTTCTTTTCACGCTGGGCGGCTTTCCTCACGGGCGCACTCCTTGTGCGTGGGG
CTCCCCCACGCGGGGGACACCCTTGCGTGGCACGGCACTCCTTGCGCGCATCAGCACTGC
GCATGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGTGGACCTCCCATAT
GGTAGACGGACGCCCTAACCACTGGGCCAAAGTCCGTTTCCCTCTAATGTGTTTTTGATC
TCACCTGTTTTGTCTTCCATTCCCATGAGCTGTTTCTTTTCTGTTCAGGTTTTCAAATTC
TTTGTGCTCACTCAGTATCTTCTTGGTGTCCTTTATTTCTTTAGACATATTGTCTTCCTA
ATCACTAATTTGATTTTGGAAATTTGTGTGCATCTCATTGATTAATTGTCTCAAATCCTA
CATCCCTTCTGGAGCTTTGATATTTTCCTTTGCTTGGGCCATTTTTTCAATTTTCTTGGA
ATGGCTTGTAATTTTTTAGCTGATGTCTAGGCATCTGATTAGGGTGTTTGAGTTTATTCA
GATGCTCAATTTCTCTCTCTTTCATAAACCACATTTTTTATTCCATTCTTCCATTGATGG
GCACTTGGGCTGCCTCCCCTTTGGCAGTTGTGAATAATGCCTCTATGAACATTGGTATGT
AAATATCTGTTTGGTTCTCTGCTTTCAGGTCTTGTGGGTATATACCTAGAATTTGGATTG
TCAGGTAATATGGTAATTCTATGCTTAATTTTGTGAAGAACTGTCAAACTTTCCCACAGC
AGTAGCACCGTTTTACATTCCTACCAAAAATGTACAAAGGTTCTTATTTGTTTTACATCT
TCACCAACACTTGTTATTTTCCTTTTTTTCTAACAATAGCCATTCTGTACGAGTGAAGTA
GTATCTCCTGGTTTTGATTTTCATTTTCCTGAATGGCTGATGACGCCGACCATCTTTCCA
GGTGCTTACTGGCCATTTGCATACCTTCTTTGGCGAAATACCTATTCAAGTCCTATGTCT
GTTTTTTTTCAACTGGAGTTGTTTGGTGTTTTCTTGTTCTTTGTTTTTATGTTACTCCTC
TTATAGGTGATTTTTGTATTCTGATTAGAGGCCATAATACTTAATCCTTTTGTTTTTAAT
CCTGTTAGTAGCCATCAATAATTAGTTCCTAGGTCCCATTCATTCACTAGAATTACGAAA
TGGTACTATCCCTATTTCTACCATTCCTTCTTTTATTAGCTGATATAGATCTATAAAGAA
AAACCTCCTAATCAATTCTTTGGTTGCATAATGGTATAAATTGTATAGGAAAGGCAGGTT
TGATGCTTTGTATTTCTCTTTGTTTTCCATTGTTTAACATAATGAGTTTGGTCACAAGCA
TTCTCTGACAATGGATATATAGATTTTAACATATTTATACTTCAGTCCTTTGCAGTTATT
ACTCTTATTGATGCATAAATGATCCCATTACGGTCAGTAGGGGCCTGTTCAGGTTGATGC
CCTCGTCCCTTTGGCATGGCCTGTTACAGTGGATTTTAAAATAATATTTTCTTCAAACTC
AATAGAGTTAATAGTTAGAATATCAGTCACTCAGAAGGTAGAATGAAGTTAGAGAATGGA
AAGCTAAGGTTTAATCTGCAGAATTTGTGCAAAGATTGTAAATGTTTACACATGAATAGA
AATGTTGAAAGCACATTGTAGTATTTGTAATTAGCAGTGCTAATATATGGTTATGACAGT
GGTTGAAATGGAAAGTCTAAGATCATTGTATATCACTAGAAGGAAAGCTAAAAAATGAAA
CATGGGACTTTATAGCATAGCAAACCCAAACCCTCTTGTGAAAAATGAGTATAGTTAATA
ATGTTTATGTAAGAATGTTTTTCTCTGAAACAGAATAAATGTATACTAATGTTATAAGAT
ATTAATAAAAGAGTGTTGTTTGGGCAAAAATACTACCAAAACGAACTATGGCAATGGTAT
AGCAGGGTTCTTAACCTTTTTTGTACCACAGACCCCTTTGGCAATCAGGTGAAAAGAATA
CTACTGTAATTTATTTATTGCATACATTCGTAAGTGACGTAAATGCTAGATTTCAGTTAG
AGGTCAGAGAAAATAAAGATAATAAATTGAGTGTTTCAGTTCAAGCTCACAGACCCCCTG
GCACCCCTGGTCAAGAACCCCTCCTTAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCCAAGAACCCCTCCTTTAGAACATAGCAATGTATAAGGAACATAGTGT
TTAAATATGATCATACTTTTAAGAAGGTATAGTGCTTATGGACTACAGCTGAATTAATTT
TCTGGGATTTAGAAAATGTAGACCCCTGGTGTATAGTAATATATTAATAATTTTGGGAAT
TGGATGTGACTCAAAACACTGAGCGCCCATCATTCGATTTCTGGGGCCTCCTGGTGAAGG
CGAGCTGGCCCGTGTGGTGAGCTGAGGGCCCGCACGGTGGAGAGCTGGCACAGCAGGGCG
ATGCAGCAAAGGGAGACAAGCAGACACAGAAGAACACGCAGCTAATGGATACAGAGAGCA
CTCAGCGAGCACAAGCAGCAAGTGGGGGAAATAAATAAAGTAAATCTCAAAAAAAGGAAA
AAGTAAGCTGATACTCAATCTGTTTGTATAGGAAGTTATTTTAAAAAATAATCTGTCAAT
GGTTAAAAAAAAAGAAAGGAGTGTATGCTAAGTGAAATGAACTAGACAAAAAGTACTACA
AATTGTTTGACTCCATCTATACAAAATATAATACAAGTAAATTATAGAGATGGAAATAGA
TGAGCAGTTTCGTGTGGCAGCAGGAGGGTAGGAGAGTGCGAGGTGACTGCTTCAGGGTGA
GGAGTTTTTCTTTTTGGACTAATGAAAATGCTCTAATGTTGACTGAAGTGATGAATGCAC
ACTCTGATTATACCATATACCATTGATTGTATCCTTTAAATGGATTATATGGTTTATGAA
TACATTAAAATTGATTATAACAATATTTTTCTGTCAATCAGATTTATAAAAAAATACCTT
TGCTATATTTTTATTGAAATACTCAAATCTGTTTAAATGGCTTAATGAAAAAAATTGAAA
ACTGGAGGTGTAATTGATATACTCAAATGTTTCTATTTATTCCAAATGTTTCTTCTTCTT
TGTAGACCAGATTATCAAAAATTCTCATGATTAAAAAGGAACACATCAAGAAATTAAGAG
AAATGAACACAGAAGCAGAAAAATTGGTAAGGATTTGTTTCCTTTTTTTCTTCCTCTTCT
TTGCTTGTCTAATTTTTTAAAAGTTCATTATTTATTTTTATTAGAGAAGTTGTTAGCTTA
CAAAACAATCATGCATAACGTGCAAGGTTCCTGTATATCAGCCTTCCACCAACACTTTAC
ATTGTCGTGGAGCATTTGTTACAGATCATAAAAGAACACAGACTGTTACCACTAACTGTG
GTCTAGAGTGCACACGTGGTGTGTTTTTTCCATATACCCCCATCGTTAACACTAGGCATT
GGTTTGGTGCCTTTGTTATAGTTCATGAAAGAACGCTAACATCTGCACTGCTAACCACAG
TCCCTCTCCCACCACAGGGGTCACTGGGTTATACAGTCTCATGCCTTGTACATTCTATCC
AAAGTGTATACCCAGTGGCTCTCACTTTCATCACAGAATTATGCAGTCATCACCTACGTA
AACCTTTGAATATTTCCCTTAGTCCAAAAGAAAATATCTCATACCCTAAACTTTGATACA
GTACCTTCTTTGACATTGATACAAGAATATTACAATATTGCTGTTAACTACAATCCATAA
ATTACATTGATTGTATTTTCCCATGCATCACTGTATTCTTACCACCTTATAGTGACGTGC
GTTTGTTCTAGTTCACAGGGGGACTTTCTTATGTTTGTGCTATTAGCCTCTGGGTTCACC
ATGCTATTCAGTCCCTAGATGATTCTCTAGCTTTCTTTCATTGATGTTTACATCCCTAGA
CTACCCCTTTCAGCCACAATCCCATTTATAAACGAGCTATGTTATACTTACCATAAGGTG
TTACCATAAACTCTATCCATTTCCATACTTTTACAGTCATTTGCTTGTCTAAATTTGAAA
TGATGGGGCTTTCTCTAAAAATTTAAAAATATTTTATGGATGAAAATCTTTTTTTTTAAA
CATTGCATATGGTTGTCTACTAGGTAGGTATTTTATTTTATTTTTTTATTTTTCTCCCCT
TCCCCCACCCCCCCAGCTGTCTGCTCTCTGTGTCCATTCACTGTGTATTCTTCTGTGTCT
GCTTCTATTCTTGTCAGCGGCCCCAGGAATCTGTGTCTTTCTTGTTGTGTCATCTTGCTG
CATCAGCTCTCTGTGTGGGTGGCGCCATTCCTGGGCAGGCTGCACTTTCTTTCATGCTGG
GCAGCTCTCCTTACAGGGTGCGCTCCCTGCGTGTGGGGCTCCCCTACACGGGGGACACCC
CTGCATGGCACAGAGCACCCCTTGCGTGCATCAGCACTGCGCATGGGCCATCTCCACACG
GGTCAGGAGGCCCGGGGTTTGAACCGCGGATCTCCCATGTGGTACATGAACACTCTATCT
GTTGAGCCAAGTCCGCTTCCCGAAAGAAAATCTTAAGATAAATATTATTTTAAAATTCTT
ATTACTATCACTCTCTGTCGTTATACTGAGCACATTCTAAGTAATCTAGCAATGCAATGA
AACACCCTACGCTATTCACCTGAATAAGGTTAACGGGCCTATGAGGTTCTTCAGCAGTTT
ACATGACTGTGTCATCCCCAGAACAGGGGCCTGTGACAAAGGAAGTTATGATGACAGGGT
CACTAAAAGAAAAGAGAGTACTTTCAAAAGGGTAACAATTGTGTGGCCACTGACTTTCTG
CAGAAACAGTGGTGGTCAGAAGAGAGGAAGAACATCTTCATGGGGCTGAAACAAAATAAC
TGCCAGCCTCGATTTCTGCACCCAGTGGAAATCCTTCAAAAAGTAAAGGGATTGTAGTAG
CAGTGTGAAGCTGGGTGGGTCCCACGAGACGCTGTGCTTAGCGCGAAGCCATTCCTGTCA
GTTTAAACCTACTGTAGATGTGTCCTTTCCGTTAGGTTCACTTAATGCACTCATCTTTTG
ATAGATCACTTCAGTATCTTAATCCTCTTACCGGAGTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTTAATGTCTGATTAAG
TATCACCGTGCAAAACACCCAAAAATGTAATAATAAGAAATCCCAACAAGTAACCATGGC
CTCGTCATTGAGTAATAAAATATTTTAAACTAAAATACCCTTTATATTTTCAAACAAGGA
GAAAATAGACGCCAATGGTTTTTTTTCTCTTACCAAGTTACTGTTACTTTAACATAAGTC
TGGAATTCAAGTTTTTAGGATTAAAGCAAGGCAAGAGGTATCAGATTGCTGTGGAATAAT
GTTTCCAAAAGAAGGAAACCATAGGTCACATGCTTATCTTGTGAAAGAGCTTCAGATTAA
ACTTGTTTAAAGTAGCAGGCACAATGGATACTGTTGCTAATTGTGCTGACTTTTGAAACT
GCTATTGGTAGTATCTCAGGGAGGGAGTGTAGCTCAGTGGTTTGACTGCCTGCTTCTCAC
CTCAAGGTCCCAGGTTCAATCCCTGGTACCTCCTTTTAAAAAACAAACAAACATTCAGGA
TTGTCTTCATGCCTGCATTTATTAAAAACAGATGGTGGGGGAGCAGATGTAACACAAGTG
GTTGAGTGCCTGCCTCCCATGTACAATGTCCCAGGTTCAGTCCCCGGTACTAAAAAAAAT
GGTGGAAAAGGGTGGCTTTCTGTTAAAAGTAGCTCCTTTGTATTACATGAACAAGAATGG
TAAATATTTCTTTATAGTCTATGTGGAATTATCAAAAAGGAAATAGGTGTATGGATATGT
GAATTTGAGATTCTTAAAATGTAAATAAAATGTGGTAACTTTTCCCACAGACTATGCCTT
TTCTATTATATTGATGTAATACACATATAGCACCTTACTAAGGTAGTAAAAATCAGAATA
TTTCCACCTTGTAAGCTACATACATCTTTTATTTATCCTATTTTGTATATTATTTGTGAA
TTGGAATTTTGCAGAGTATTTCAGGGACATAGTACCCAGTTAGGTTAATTCCTTCATTAT
AGGAGGAATCATTTCAGGTAAAATATATATATATATATTTTTTTAAGATTTATTTATTTT
ATTTCTCCCCCCCACGCTTGTCCGTTCTCTGTGTCTATTTGCTTTGTGTTCCTTTGTCCG
CTTCTGTTGTCAGCGGCACAGGAATCTGTTTCTTTTTGTTGCGTCATCCTGCTGTGTCAG
CTCTCCATGTGGGCAGCGCCATTCCTGGGCAGACTGCACATTCTTTCACGCTGGGCGGCT
CTCCTTACGTTACGGGGCGCACTCCTTGCACATGGGGCTCCCCTACGTGGGGGGCACCCC
TGTGTGGCAGGGCACTCCTTGCACGCATCAGCACTGTGTATGGGCCAGCTCCACACAGTC
AGGGAGGCCCGGGGTTTGAACCGCGGACCTCCTATGTGGTAGATGGATGCCCTAACCACT
GGGCCAAGTCCGCCACCAGGTAATATATTTTGAGATTTTATTTTTCATTTGTCTAGAAAT
ATCATTTTAAAGACCTTTAGAAGAATAGCAGTTCTTTCAGAATTACACATTACAAATTAT
CTTGGTATACATTCTATTTCTTTTAAAATCTTTTTTACTCTGTGGAATATCAGCTTAACA
GCATTGAACTAACTGAATATTTACATTAACCCAAGTAACTCTAACATAATGAATATTAAT
TTTATCTGCCCTACCCCTATACAACCTCTGCCCTAGCAAGTATTTAATTTTATTTAATTA
ATTCAGTTCTCAAGATGATGAAAGCTGATTTATAGCTTTTACTAAAATGACATGAGTAGT
TCAACCTGTTCTTTACTTAAAAGGACTGAATGTACTACTTTGTTGAAAGAACTCCTTTTT
TATGGCTTTTACAGAGAAAAATAGAAATTTTGTCTATTGAAGTCCCCTTTAATTTTTGAA
AGCTTAACCATTTTTCTCATACTTTACCCCCAGCAAAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCACTTTTCTTTCACGCTGGGC
GGCTCTTCTTATGGGGCGCACTCCTTGTGCATAGGACTCCCCTACGCAGGGGACACCCCT
GAGTGACAGGGCACTCCTTGCGCACATCAGCGCTGAGCATGGGCCAGCTCCACAAGAGTC
AAGGAGGCCCGGGGTTTGAACCATGGACCTCCCATGTGGTAGACGGACGCCCTAACCACT
GGGCCAAGTCCACTTCCTAAATCAGGTATCTTGGCCTCAGCATTGTAGGCTATCTTCTGG
TTCATTTCAGCCAGCCATGAGAACAAACTGTTAGAGCCCTTTCTTTCTTTTTTTTTCCCC
CCAGAAACAGGTGAGTCTTTTATTTATCTATGCAAATAAATGTGCACTTCCACCACTGCC
TAATCATAAAAGACAAAATAGACAAAACAAAAATTAGAGTAAATATGGTGCTTGGTGCTC
TGGTTGAGGGAAGGAAGATGGGGGAGAAAGAGGAAAGGCAATGAAATGAGAGACTTAGTG
TGTTAGAACCCTTTCTAACCCTGGAGCTACAACACTGAATCTAGAATCTCTGCTTAGTGG
GCCCATATCAATAAATTCAGCCTTATCCAACTTTATATTCCTTCCACCATTATCTCATAC
TCTTAATATCCATTCCCACATATATTCCCTTGATTTCTTGTCTACATAAATTGGAAATTC
ATGCCGTTCTTTTAGAGTCACATTTTGTACTTCACCTTTGGAGGCTTGCGATTTAGTCTA
GTTATAGATCTTGAAGAGAAGATGGGTGGTGTGGGTGAGTAAGGAGAAGAATTAGAAGTC
TTTTGCAAGCTAAATACCTTAGGGCACTCCCTTTCAGTTTTATCTGGTGAGACAGAATTC
ATCCCTTTAAGTGGTCTATCCTGGAATATGATCCATGTATAGTTGAAAAGAATGCATAGT
CTGTTTTTGTTGGGTGAAGTGTTCTATATATGCACGTTAGGTCTAGTTGCTATAGAGTAT
CATTAAGTCTTGTACTTTCTTATTGATCTTCTGACTAGATGATCTATCCATTTTCGAGAA
TGGTGTATTAAAGTCTTCTACTATTAATATAGAATCATCCATTTCTACCTTCTAATTTGT
CAATATTTGCATGCTATATGTTTTTTCCACCCTTTTACTTCAACCTTCTTGTATCTGAAT
TTAAGGTGAGTCTCTTGCAAACAGTGTCTAGTTGGATCATGCTTTTTTTCCATCCTGCTT
ATCTCTGCTTTAATCCATTTATGTTTAAATGGAGAGTTTAATCCATTTATGTTTTAAAAA
AAAAAGATTTATTATTTATTTATCTCCCCTCCCACTTTTTGCACTCATGGTCTGCTCTCT
GTTCATCTTTTTAGGAGGAACCAGGAACCAAACCCAGGAACTCCCATGTGGGAGGAAGGC
ACCATTCACTTGAGCCACCTCCGCTCCCTGCTTATTGTGTGTCTCATTCTCTTTCCTCTT
TGTGTCTCTTCGTTGCATTATCTTGTTGTATCGGCTTGCTGCGCTTGCCCACCTCCTCCA
GGAGGCACCGGGAACTGAACCTGGGACCTCCCATGTGGTAGGTGGGAGCTCAGTTGCTTG
AGCCACATCCGCTTCCCAGTGGTTGAGTTTTTGTGCTAATAACTTCTTCAGTCCTGAAGA
CAGTTCCACCCCTGGTGATTTTATCAATACCCTTGAATTGGCATGAGGCCAGTGACCTGT
GGATACCCATACCAAATTCTGAGTACATTTTGCTTTTTCCTCTAGTCTTCTGTCATTATT
TATTTTTATTTTCCTGATAGTTGTCAGTCACCTATATAGCAATATTTGTTTTCCCCTTGC
ACCAGCAACTATCCACGAGACGTACAGGCCAAACAATCCAGAATGTCACATAACACAGCT
GATGATACATGTAGAAATGGATTGGTCATAAAACTTTTTGTATAATTTCATTATGTATCC
AGGGCCATTTGTGATAGGCTCATTTTCTAATGAACTAAAAATTATTGAATTTTCACAAAC
CTCTGATGGAAGTACAGTATTGATTGTGAAATAAAAACATATCAGAGGAAATAGTATGAC
TAAGCAATTCTCCTCCTCAGTATATCCCCAAGATATGTATGTGCTCACCAAACGGCAAGA
ACGCTGAGCACTGCTGTTACAGCCCAAAACTAAAACTGCCGGATGCCATCCACACAAGTA
ACTGGGGTAGCTGCGCAGAGGGACACCATCCAGGGTGAGAACGGAGGGCTCAGACGCAGG
GAGGAACCTCACAGATAAAACGTAGAACAAAGGAAGTCAGGCGCAGAATACACAGGCACG
CTTCTGCGCCCGAGGCTGGCGAGGCGGATCCCTGCGGCCGAGGCCAGGGCGGTGGGCGCC
CTCAGGAGGGCCGCGGTGTGGGCAGCGGTCTCCATCTGCGCCTGTAGTCCTCGGGCGTTT
GATTTGTGAAAACTCATCAGCCTGCACACTGTATGACTTGTGCACTTCCATCTGTTCATG
TTTTAAAACATTTTAAGGGATGAAGTTATTCATTACAGCGTGATTGGTAATTGTAAAACA
AGAAAAAATCTTATGTAGATACATAGGAAATTAGCTAAATAAATTATGGTAAATCCACAC
AATGAAGTACTATGCTGCTATAAGAAAGAACAAGGAAATTCTCTATTCACTGATAGGGAG
TGAATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAACTTGAAC
ACAGGACTTTTGACTATATACCCTCAGGCTTAAGACAAAACAAACTTCAAATATTGAACT
CTCAGTAGTAAGCTTTTTCTCATAGTGATATGGCTGAGCATTTCTGAAATTCTTGCTGTA
TATTCTTAAGCAAATGAGTAAATATATTAAGAGGTGGGTGGGGAAACCAGATGTGGCTCA
AGCGATTGGGCTCCTGTCTACACTATGGGAGGTCCAGGGTTCAATTCCTGGGGCCTCCTG
GTGAGGGCAGGCTGGCCCTCATGGAAGCTGGCCTGAGCAGAGAGCTGGCACAGCAAGGTG
ACACAACAGAAGAGACACAATAAGAGACGCAGCAGACCAGGGAGCCGAGGTGGTGCAAGA
GATGGAGCTCCTTTCTCCCACCCCGGAAGGTCCCAGGACCGGTTCCCAGAGCCGCCTAAT
GAGAACACCGGCAGACACAGAAGAACACACAGCAAATGGACAGAGAGCAGACAACGGGGC
GGGGGGAGGCGGGATAAATAAATCTTTTTTCTAAAAAAAAGGATACTGAGCCAGGCTCTC
ACTGTTGGAGGAGGGAGTTAGGAAGAGAGGAAAGCCTGGAATGACCTCTGTGGGGCTGGG
TTGGGACAGACAGAATCTGTGAATCTGTGGTTTATTTTGTTTTTATAATATTGATATAAA
TAAATGTGTGCGTGATTTCTGGAAGAGCCTAGAAGCAATGAACTCCCCCAGCACCCAGAT
CTGGGTTACTAAGTAGCGTGCTTAAATAGGAGGGAGCAGAGCTTTCTGAGAAAGACCAAT
CCAGGGCCAGGGCAGAAAAGTCACAGGGTGAGCCGGGAGCACCCTCTTTGTTAAAGGACC
CCAAAAATGATGGTGGCGCGGCAGAAGGAGCCGGTTTACCAGGGTTTCCACTGGCCAAAG
CTGGGTTAATTAGAGCTTCAGCGTAACTAACTAATGACAGTGAGAGGAAAACCCATTGAA
CAGTAAGAATCCACGGGTCTACACCAAAATCAATAAGGGCGGGCGGAAGAAGGAAGGAAA
GCTCTTCCAGAGCAGGGCACCGACTCATCAGTGTCTGTCGGTGGTGCCGGCTGGAGCCTG
GAGGGCTCCCGAGGCACGTCTGCAGCTTCTTGCGTGGTTGGGTGGGGATAGAGGACACAG
GCCGCCCAGAGGGGAGCCGGGCCTGAGGCCGCGAGGCTCAGGCGGCTCGTCCCCCCAGCT
TGCTCCCGACCAGGGCCTGCAGCCCGCAGATCAGCCCACAGACATGCGGCGGAGGTGCCA
CGAGGAAGCCCAGGAGATCGTGCGGCACGCCAATTCCTCAGCGGGACAGCCCTGCGTCGA
AAATGAAAACCTTACAGACTTAATCTCCAGACTTACAGCTATTTTGTTACAAATTAAGGT
AAATTTCAGAGGGAAATATTTTGGCATTAAACTAAACTATGCTAATTTGTTATTAAGAAA
TAATAATTGATTATATCTGATACTTCATGCCTGTATTTGGACTACAATTAAATTTTGAAA
TGTTTCTTTCCTTTAGTGTCTAGCAGAAGGAGGAGACCTGAATTCCTTTGAATTCAAATC
ACTTACAGATTCATTAAATGACATCAAAAATACAATAGATGCTTCTAATATCAGGTAATC
CATTAGGTGCATCATACCCATTTTTTTTTTAATTAATCTTTACCTTTTTTTTTTTAATCC
CCCCCTCCCTTGTGGCTTGTTTGCTGTCTGCTCTCTGTGTCCATTAGCTGCACGTTCTTC
TGTGTCTGCTTGTCTCCCTTTATTGTGTCATCTTGCTGTGTCAGCTCTCCACAGCTTGTG
GGCCAGACTGCCTCCACAAGGAGGCCCCAGGACGCAAACCAGGGCCTCCCAATCGACTGA
GCCACAGCCACTTCCCCACTCTACCCATTTTTATATTAAATGTATAATTATTTCCTGTGT
AAGTTTTAAGAATTAAACATTTTTGTAGAATATTCATATAATATTACCCTTTAAATAAAA
TTATTATAAAGAACTTTTCAGTTGATAGAATAGACTTTTCAGTCTATTGATAGAATAGAA
ATTTCACATGGATTTTTTAATATAAAGAAATCAAGAGGCATATTTATCATTTAGGTAATA
GTTTAAAGTTCAATCTGTAAGTAAAGCTTCCTTAGGAGAAGTCCGTCCTCACTTTCCACT
CCTCTTGTAGCTCCCCTTGACCTCTTCTGAGCAAAGTAGTTACGGCTGTTTCTTCTTTCT
TCAGCTGCTTTCAGAATAACGTAGAAATCCATGTTGCACATATCCAGAGCGGTCTGAGCC
AGATGGGAAACCTCCACGCCTTCGCAGCCAACAACACGGGCAGGGACTGAGCACATGGGC
TGTCCCAGCCGCGTGGGGCCTTGTTTTTGAGAAGTTCTTTCCTTTATGTAGGCTCCCAAC
ACCAATAGACAAGCTGATGGAGAACAGAGAGACAAAAGTCTCCGAGTGAGGCATTTCAAT
ATACTGTGCTGCTTCTTAGACCAGCATATTTATTTTTCTCTTTTATTATTCTGCCGCAGT
AGTATTGCTTCTGTTACTTATGTTTATTAGCAAGTATTTTTAAACTGAAAAATGTCTGAA
CATATTAATATAATTTCACAAAAGAATATGTTGACCATTTTTTTAATATGCACAAATCCA
GTACAACGCATGCAGGCAACTGCTACAGTAGAGAACCTGAAGAAGAATGGTCTTTGTGTG
CAGACAGTGGCAGTGTGGAAATTCCATCTAGAAATTTACAACTCCAGTTGATTTAATTGA
TCAGCATTTCAGATTTCAAAAGATAACATCATAACACGTGGGGAATCCTATTTTTAAGGA
AGCCACTGGAATACTGATGATAAATATGGACTCTACAAGTAAATGTGATAAATACTTGCA
ATGCGACATGGTTATGTAGATCATTTTATGATATTAAATATTTTAATTTATCATAATTTA
TAAAAGAACCTTTGTTGTTTATCTGTTGAAAGAAAATGAAGGACAGGAAAGAAACATTAC
TGCAAATCCTAAATGTCAGCAGTAGATTGGACATGTTCTTTTCCCATTAATTCAGGGCAA
AAAGTGCTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAA
AAAAAAAAAGACTGATACACTATTTCATATTTGTTTATTTGCACACTTTTAGCCAGATTA
CTGGTAAACCTGACAGTACACAACTTATAAAGTAAAAAGGATTTTATAAGGAAAACGAAC
ATAATAACCAGTGCTGTGAAATGCAGAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1071..1087, 1092..1142, 1145..1171, 1176..1184, 1187..1195, 1198..1221, 1223..1319, 7220..7252, 8839..8933, 10426..10530, 24308..24441, 26137..26262, 37116..37273, 43085..43218, 44807..44926, 45198..45299, 54039..54119, 66967..67092, 79652..79831, 79970..80067, 80678..80783
1001..1052, 1071..1087, 1092..1142, 1145..1171, 1176..1184, 1187..1195, 1198..1221, 1223..1319, 7220..7252, 8839..8933, 10426..10530, 24308..24441, 26137..26262, 37116..37273, 43085..43218, 44807..44926, 45198..45299, 54039..54119, 66967..67092, 79652..79831, 79970..80067, 80678..80780
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved