Dasypus_novemcinctus Locus UBAP2L
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus UBAP2L
Dasypus_novemcinctus
UBAP2L
GeneScaffold_3994
SNORA58
56886..57022
59982
TCAACTAAGTCATCTTGCCAGCAGTAATGTCTCAAGTTTAAAATGACTTCCCAGAAGCC
CTTTCTTCCAAATAATACTTTGTGCTAGATGCTTTTGGTTTGAGACATATTTGGGATTCT
CTGTATTTTAAGGTGAGTGGTGGAAGGTAATGGCAATACTGGTTTCTTGGAACTGTGGAT
TAGGAGACCAACAGAAGCAGCTGCAAAAGCAGTACGTTGGAATTATTGTCCAGGGAACTG
AGATTCTGGGCAAAGTCAGTGGGGCTGATACATACCCAGTTCAAGGCTGTGCGTTTATTA
AACAAAACAAAACAAAAAACCACAGCATGCAGAGGAATAGAAACTTAAGGGAGAAAAATT
AGACTTGAGCTTGTCCTTTGCCAAGCCAGGTGAAGGTCACATGCAATTTACATAAAATGG
TTGTGAGGCAGGTAAGGCTGTTTTTCTTTGGTGTAGAGTACAGTATTTTAATTTCTATTA
TTTATTTATTTGTTATTTTTTTGGATTGTAGACTTCAGTCCCTTCCTGGAAGGCTTTGTT
GATTACCTTTCCTTCTGTTAAAGGACTTCAGATGCTTTCTAGGCTATATGGAAGGCTTTT
GTTTAACATTGTTTTGCTTACTAGTAAGGTGGCAGAACTTCACAAAGCCTGCTCATAGGG
GACTAATAACCAAACAATGCCTTTAACTTTTTAAATAATAAAACCATTACTTACCAAGCT
AGAGTGCACGCTCACTTACACAGGTTTTATGCATTTCTTGTTATCCAAAATTAGATTAAC
AGCCATAGTTTCTTAAGGAATTTATCAGATTAAACATGTTGCCAAGAACAGGCGAATATT
CTTGGTTCGTTGTTCCTTTGAAAAACTGAAAACGTTTGGTGGTGAAGTTACTGAGAGGTT
GTATACCTATTTTGCCCTCATTTAATATATAAACTCTTTTTTTTTCCCTTAATCTTTTCA
GTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACGTCGGTGGGCA
CTAGCCGAGCCCGGGGAAACTGGGAACAACCTCAAAACCAAAACCAGACACAGCACAAGC
AGCGGCCACAGGTAAAGAAGCCCAGGCATATTGATCCATAGGTAGCCTTGCTGGTTGCTA
CTGCTTTTCATCTAATACAGTATCATCCTGTGCTTGGGGTTATTGATTTGGGTTTTTTGT
TCTTGTTTTCTAGTCCTTGGATCTTTTTTTACTTAGGGCCTTATAATTATTGTTGCCATG
TTATGAGGCAACAAGCTTACGTTTTTGTTAATGCTGTATCGTGAAGCTTAGAAATATGGG
TCCTGTGTTATGTATCTTTAAGGTAGATTTTCCTTTCTCTTATCTGGACCATTTTAGCAA
TACATTCCTTATTTCCTGGACCTTCCATCTTCACATCTCTGGCCAACTTTCATCTTGCCA
CCTCTTCCCCTCCAGATTTTATCCATGGTTTTTCTTTTCCCCGACTTATCTTTTACTTTC
TTCTCTGATCTCATTGAGAACTTATCTGGCTTTTCCTTTCCCATGAAGAGGTGACTTCTT
CACTTTCCCTCAGAATTAACTATTGAGATATCATAAGTAAATTAACTTCCTGGGTATTGA
GGTTTATGGGTTCTCCTTTTTTGGAAGTTTAATTGAGGTATACTCTTTTCCTTAGTCAGT
TTGGTATTAGTCTGTAATGTAAATGAATTACTTATATTTGGTTTTGGTCAGATAAACTGA
ATATGAAAGACTAGAACTTTCCCCTTCTTTATTTTTCTTTCATCAATGTTACCAAATGAA
TTTTAGTAATTAATTTCATTTGGGACAGTAAAATTTCTAGTATTCTATAAACAGATGGAT
ACTCAGAAGATATGGTGAGTGTATCCTCAGGCTAAACCTTATGGTATTCTCAGTCCTAGG
AATAAGAGGGTGACATTGGTAACTTAGAAACAGGAACTGGGTTTAAACACATGACTTTGC
AAGTACATTAACATGAATTAAGGGGTAGATATTTCAAAGTGGTCCTGTGCTCCAAAGATG
AAAGTCTGACTGTAGCTATAGACATTGGGGAAAAAGCTCCTTGAAGGGTTAGGACTTAGA
GTAAAATACAGTGACAGCATCACTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTGCTTTGCATGATTGCAATGGAGATGTCAACAGAGCCAT
CAATGTATTGCTGGAAGGAAACCCAGACACGGTAGGGTTCTAATAAAGGGTTTTAGAAAG
TGGTCTCCCATTTAGGGGTGGGGTTCATGATATTCTAAAAATAGCAAGTGGGGTAACTAA
GCTTAATAAAGCAGAGTATGTTATTATCCAAATAGAGTAGGCAACATTTTTGGGGGTGTT
TTGATTTGCTTTGTTTTAAACTGTACATCCTCATCATAGGAGAAAACAGATGAAATCAGA
CTCTTCTAATTGGCCTAGTCAGTGTGTTTTCAAGGCTGGGTTAGGCTAAATTAGAAGTGC
TATTTCATAGCCTTGGTCTTTCGTTTTTTTTGTTTGGTGTTTTGTTTTGTTTTAGCCTTG
GCTATTAATTATGGAAGATTTCTGCTCACTTTTTTGTCGTTGTTGCTATTGAACATCAAG
TCACAAAACTGCCCCCCATTCTGAATTCAGGACCTTTCCATCATTGTCAGCCTAACATCT
GACAATACTGTTCGTTGTGTGAACTTATTTGTGTTGAGGTAGCATAGGTAAATATAAATA
GTTTTTTAGACTGTTGAGCATCCCTGGAGATGATAGGGGTATCTTGGAGGACCTCTTGCC
CTGGAATATAGAGAAGCTGCTTTCACCTCTTCCTCTCCGTTCCACTTAATGAGAATTGTA
AACTTTTTAAATTTCTCTGCTTGTCTTACTGTACCAAGTCGTAAGTCCCTGAAGAACAGG
ACTACTGCATTACCAGCCTTTGGATGTTCCTGTAGTGCTTAGTATAGAGTTGTTTTGTTT
GTTTGTTTAATGAGCACCATTTTGAGGTAATTTTCATTTACTATGTTCTATACAGGGAAT
CTTTGGTTGGAATAGATAGCTGAGTACATACCTAGTGGTACCATTTTACTGGTTTTAAAT
GTCACTTCTCTTGTGGCTAAATGCTGGAGATTTGTCACTTAACCTTGAGGCAATGGGAAA
TAGTGGAAAACTTTTAATCATTGAGTTTAAATGTGTGGATTTATCTTCAAAGAGTATGTT
CATAGGTTAAATTTTATAATTTTATTAAATTTGAATTTACCTTATTAAATTGACTTTATT
TGAAAATTCACTACCTGGACAATCAAGATAGTGTCTTTGATTCATGTTTACTCTAAAATA
GCTGTCTCAAGATTTGAGGGTGGGAAGTTGGACTACTCATGCTTAAAAAAAGTCTGAGTG
CTTTTTTCTTTTTTAACCTACGTCACATTTTGTTTCATCTTCTAGCATCTGCCTAGTGCT
ACAAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGATAATAAAGGTACAATATTCTTAGTGTT
TCTTCTAGAAACTTTTGTTTGTACAGATTTTCTGTAACAGTTTAATGGTGTATAAATCAA
GATATGTGGTATAAAATTTTAAGTTTCAAAAAGCTTGTTTTCCTCGGGAATGAGAGTGTT
TTGCCAAGGTTTTTAGCTAATTTTTCATATCACACATTTTCCATCCTGGAATCGGGGCTA
CATTATAGATTGTTCTTTGGGGAAAGTTGAATTGTATTATATTCAGGAAGTATAGGGAGA
GCACAGCAGGTAAAAGATGGATGGAAGGCTTCATATTCATATAACCGGTATTCTCAAGGT
CAGGGCTGTACCTTCCTGGCTGCTGTTTGAGTTTCTTTTTTTCTTTTTTTTTTTTTTTTT
AAATAGTGGCAACATACAACAAAAAGTTTGTCATTGTCAGGTAAACCTTTTCTTTTTCTG
AGGTACCAGGGATTGAACCCAGAAACTTGTATGTGGGAAGGTGGCACTCAACGATTGAGC
CACTTAGGCTCCCCTGAGTTGGTTTCTTCATTTGTTTGCCTGTTGCTTGTTCTCATGTTA
TTAGGAGGCATCAGGAACCCAAACCCAGGATGTCCCAAGTTGGAAGAAGGCTCTCAACCA
CTTGAGCCATATCCCACTCCCCTAAATTAAGCATGCAATTCAGGGGCATTACTTTTTACA
GTGTTGTGCTACCTGATGATCACTACCTTCCATTACTAAAACTTTTTCATCACCCAAAAC
AGAAACTCTACCCAGTAAGCAAATACTCCCCATTTTCCCCTCTACCAATAACCTTTAATC
TACTTTTCTGTTTCTATGAATTTGTATACTCCAGACATTTCATATAAATGAAATCATACA
TACATCATACATGTTCTCAGTTCATTTATGTTGTAGCATGTATCAAATGTCACCCCCCCC
TGCCGTTTTTTGTATACTTTAATCATTTAACTGTATGTGTAGTCATCAGTAAAAAAAAAT
TTTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCCTCCTCTACAAAAAGGATTTA
AATTTTGTCAATGATATGTGTAGAATTTGTTTTGAGTTTCTGCTTGTACTCGCCATTTTT
ACAGAAGAGTAAACAGTGTCTTAGACATGGATGCTGGGAGCATGGTTAAATTAATCAGCA
GTGTGGCTTTCATCTCTAGTGTTCTGATAGTAGTCCATACTGATTAGCCGTGAATGTTCT
GCCTTCCTTTAGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTCTCAGGACAGAAG
GATGGTGGCCAGACGGAATCCAACGAGGAAGGCAAAGAAAACCGAGACCGGGACAGAGAC
TATAGTCGGCGACGTGGTGGGCCACCAAGACGAGGGAGAGGTGCCAGCCGTGGACGAGAG
TGTATGCATGGGGCTTTATCAAAACCAGCTGTGGGTCAGTAATGTCTAGACTCCAGGGAT
GTGTCAGGGCTCTGCCAGGCAGGACCCAGGAACTATTATCTCACCCTTTTGTTTTTGTTG
CTCTCATCTCTTAGGAGACCTTGGCATCTCCCTACATGTAGCCTTTTCTAGCAGTAGCCA
CCAGTTAGGCATGAAATTACCCTTTAGTCATTTGTAAAGTTATTTAACTTGTAGTTCTCT
ATTGTGGTTCATCACCATTCCCCAGGTAACCCTTATTTATGTTCCATCCTTCCAGCTCAG
TCTCTCTCTTTTGTTATTGTCCTTTTGCATCAAATACACAAATTTATATATTTTATTGAC
TCTGCTTTGGTTGTTATCTTTTGTGTGTGTGTGTGTTTCAGTTCGGGGGCAAGAAAATGG
ATTAGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACGGAAAGAGGAAGAAGGGG
CCGTGGCCGAGGCAGAGGTGATCAGTTTGTGGGGGGGATGGATACTGGGGACACGGTACT
TTTATTAGGTCTTTAAGGGTATCCCTTAATTAAAAAACAAATAGAGTTGGTTACCTTAAT
TGTTGAGGTGTCAAATTTTAGATAATGCTGAGTAGGGAGTAGGAAGAAAGACATTATTTC
CTCTGGTCTTTATTGCTGTATTTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCATGTGTGTG
GTGCCACTCCTGGGCAGGCTGCACTTTTTCCACTCTGGGGCAGCTTTCTTTGCAGGGGCA
CACTTCTTGCGTGTGGGGCTTCCCTACACGGGGGATACCCCTGTGTGGCACCACACTCCT
TGCATGCATCAGCATTGTGCGTGGACCAGCTCACCACATGAATCAGGAGGCCCTGGGTTT
GAACCCTGGACCTCCCATGTGGTAGGTAGATGCTCTATCAGTTGAGCCAAATCCGCTTCT
CAATTGTCTTTTTTTTAAAAGATACATAGATCACAAAAAAATAAGAGGTTTCCATATACC
CCATCCCCAACCCCTACATTTTTAATGATTGTACTGTTAACCATAGTCCATGGTTTAACT
TGGGATTTCATTCCTTTTTATGGGTAAATAGTATTCCATTGTTATGGATATACCACATTT
TGTTTATCCATTCATTTGTTGATGGACACTTGGGTTATTTTCACCTTTTGACTATTGTGA
ATAATATCCAAATCCTTCTTTCACTTCTTAGGAATATATACCCAAGAGTGGAATTGCTGG
TTCGTATGGTAATTCTATGCTTAACTTTTTGGGAAACTCCACAGCAATGCATGAGAGTTA
CAGTGTTACAGCATCCTTGTCAGTACTTCTTTTTTTTTAATAGCCATCCTAGTAGGTGTC
ACGTGGTATCCCATTGGATTTTTCTCCCCCGTTGGGTTTTGATAAATGCATCTCACTAAT
GGCTAATGATGTTAAGCATCTTTTCATGTGCCTATAGCCATTTGTATGTTTGTTTGTTTT
TTTAGCCAGGAACACACTTGAAAGTAGAAACCAGTAATATGTCCTTTACTATTACTCCCA
AGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGCACCTCTAATTCAACAACCAAATAGCGCGCTTCCTCTTAATGCTGGC
CGTCAGATCTTCGATCATGTTGAGTAGGGCGTAGGAAGAAAGACCTCTTTTCTCTGCTCT
TTATTCCTGTATTTACTCCGAGGACCTCGTAGTTCGGCGCGCCAACGAATATCCGGTCGA
CAATAGCGATTGTATTGCTGTATTTCTGATGTGCTACATGGAATTGAGGGAAAGAATATT
TGATAATATCAACCACTTACACATCTAGAGCTGCCTCTGCTGGCAAGGTGGTTTTACTTA
TATCAACCTCTAAAATCTTTCTCTTTTTCTTTAGGTGGCTCTGGTAGACGGGGAGGAAGG
TTTTCTGCTCAAGGAATGGGGTACGTTTCATTAAACAAGAGTCTTTTTTTTCCTACCCTA
AGAATCACCATTATCTTAAAGTGGTTAATATCCTGGAATCCTGAAGATAATAGACAGCTT
TTAACAAAATGCAATTAGCGGGCTTTCTAGGCTATTTAGTCAGAAAGTTGTGAGGACTTA
GGGATAAGTATTTACCACTTGGATCATTACTCTCCATCTTGATAGCTTTGTTTGAATGTG
TATTTGCAGAAAATCTCCATGGGAATTTTATTATGATTTTAGGTGTCATAACTCAAAATG
GGTAGTTAGATTTAAGTTGAGATAATATTACAAAGTTTTGGGTAGGCTAGGCTGATAAGT
AAGGGAAAGTAGACAGCATATAGTTTCTAGGATGGGGTTGTGATTGATCTGCGAATAGGA
GATAGTCAGGGTTCTGGCTGCCTTCTTTGTGTTAATATTCGGTGATGTTGCTTAGAGTCA
GAGACCCTTCTAAGTTCTTTTTTTCCCATCCCCCCCTCAGAACTTTTAATCCAGCTGATT
ATGCAGAGCCAGCCAATGCTGATGATAATTACGGCAATAGTAGCGGCAACACATGGAACA
ACACTGGCCACTTTGAACCAGATGATGGGACGAGTGAGTGAACATTTATTACTCATTTCT
TGTCTCTCTGGGATTCTAAGGAAATACTTTTTAAGGTTATAGTTAGATCAAAAAGCAGAG
GAATAGTGTTTGGATGCAGAAATAGGGTGAGGAAGTGATGGAAGTTGAAATAGCACTATA
CATGCTATTTCACTTGATCCTCATCACTCTTTTATGAAATAGATATTTATCGTCACTTTA
CAAATGAGGAAATTGAAAGAGAGGTTTCAAAATTTGCTAGTATTTGATTCTAAAAGCCTG
TGTTCTTTCTGTTACACCCACTTGGCTGCTATTAGCTCCAAGTATATTTCATAGTGTTTC
TATAAAGAGTAGCTTTGCTTTTTGAAAAGATATACAGGAAATTAAGCCACTATTTGTGGA
GATGAACTGGTCCCGTAATCAAAGCCCAACAGTCCGTATTTTTTCTGTTGCCAAGATAGG
AATATTCGTTTTTAGGAAATCTTACCTCAACAAGGAGATAATTTCTAGTCTTTCTAACTC
CTTGTTGGTTTGTGCCTCTGAAAGAGGTGGAGCATTATGGAATTTGAACCAGATTGCTTA
CCTGACTTTTGGGTATGGTATAAATGTTTAAGGATGTGTTGGGCTTGTGTGATACACCAA
GATATGTTGAGGGGTAAAGGATACAGGTGGTGCTTTAAATAAAAGCAGCCTCTGGGCTAT
AGAGTGCTGACTTTTTTGTGAGGTCATCTACTTCTTCCTGGATGAGCCAGCCCATGGAAA
GGCTGAGGCTTTTTCTTCTTGTCAAGGGGGAATGATTTAATAGTAGGGCCTGAAATGGCC
TGTGGCCCCTTATCCATTTAAATTTGCTTTGCCCCCTTTCAAAGATCAGTGAGCTGCTTC
TCTGGGTCTTCAGGGAGGGTCTGTGACACAAACTACTTTTCGTCTACAACTTACAAGGTG
TTATACCTCAAGTCCTGAATGTTGCTCACTTTTTGTTTACCAAGCTGATAGCTCATAAAG
TCATTTTTCATGGGTCGTGGCTGGAATTGAGTTACTGACAAGATAGATATCTTGTAGAAT
TCCCCTCACTATTTGGCTGTGAAACGTACTGTTTCTGTTTTAACTTACCAAAATTTGGAG
GCCTTAAAACTAATCTTCATTTATTCCTTGGTGGCTCTGTAGAGGCAATAGTAGCATTAT
AAATAACAAAAGTTACTGTTTTTGAGCTGTGGTTTGTTCTTGGGCATTGGCTTTTTATCT
TGGGCAGAAAAGATGATGGAAGTTAAGTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCAGAAAAGATGATGA
AGTAAGTGATTTGTTTTAGTGGGTGATAGAAAATCATGCAAGATCCTAGTCTAGATTATA
AGCCTCAACTTTCTTCAATAAGGACCTGGTTGGAAAAACAGCGAAGGGTGAAGTATGCGT
TTATTTCCACCGAGTAGAGAAGAGAACAGATTTGGTAGGCCAGAATCAGAAATCTGATTT
GTCGTGGCTAAGTCAATTATACGTAATGCTGCTGTCATTTTGTTAGTGTGAAAGTGTTAG
GTATAGCTTCATGCATTCCCATCATTGTTAATTTCATGATATAAACATTCCTTCATGCAT
GATCTTATTTTTGTGTCTTCATGATAGCAAACTTCAAATTTCCTTTTTAATTTAAAAAGA
AATTCAGCCCTACCTTTAAAATATCCACAGGTACAGTGGGAGTTGAGTAGTGGGGGCAAA
CGTTCTCATTCACAAGCAAAATTTCACTGGTTGTCTTTTCTTTTCTTTTCTTTTTTGTTT
CAGGACTTGATTTCATTGGGGTTGAGGGGTCAGATTATCCCCGAAAATTTGAGACTGCTC
CTGGTATGATACATCCAGGCGCCCAACTGCCCCGGATATTTTTATAGACTTTTATGAACT
GAAATATCTGTGGATATGTTATTTTTTTCTTTCTGCTTTTTCTCTGCTTTTTCTCATTTT
CTGTGTCCATTTTTCTTTTTTAAAAATTTGTTCATTTAATGACCGAGACTTGCATTGACT
TCACTTTCTGCTGATAGAATGGAAACCCTAAACTGTTATTCAGAGCATATCCATTCTTAC
TGTTCCTTAGAACTTCCTCAACATAGCTCTGTCTTCGCCTCTTCCTCACCCATAATCATA
TCTCCTAAATAGGAAAGTACTAAACATGTACCTACATTCTTCCTTTCTATCCCAATCACA
GTCACCAGAATGCAAGAAAAAAATTGCTTTGAGAGCCTAGATTATGTGGCTTTTCAGATC
ACTTCCAACTCTAGATACCCAGATTTTGGGTTCCCTTTAGCCAGAGTGGGATGGATGTCA
GTTGGGAGGTATCGTGTATCACCAGAGAGAGAGAGAAGAATGTGGTTTTTAACTTGTCTT
AAGTTGAGATTCGACTTCAATTGGCTTTGAAAACATTGTCATTAAATGGTTTGGTATTTC
CTCTGGTACAGTTCTAATATGATCCTGGGAATTCACTACAATGAACATGTTTTCTTTTAG
GAAATAAAGCTTTTTTCATTATTAAATGTTATGAATTTCAGATGGATTTTGTAGGTGTTA
GAATATCCCCTTTAGTGACAATGAAATATCTGAATCCTAGATTCTTCAAGAACCTTTCTC
CATTTGGAGAGAAGTCTTCAAGAGTTATTAAATATATATTGTGTTCTAGAGAAGAAAAGG
CCTTCCACAGGCAGGTCCTTATTTCTTACTGTAGTCCCTTTGGTTGAAGGAAAGAATCCT
GGGTCCATTGGAAACCCAGGATTCATTAAGAATAGTTTCCCTTTCTGATGATATATAAAC
ACATGAAGCTGAAAAAGCTGAATGTGGTTTTACTGCTTATGAACCTCTCCTGTAGAGACT
ATCCCATCTGTGGTATTAAACCAGTGTGATGAGAGTATACATCTCTTTTGTCTCTGCTCT
GATCTTGGCAGAACAAAGTTCACACTCTGTATGATGATTATTAAAATGATAGCTATCATT
TACATTTGATTGTTCAGCCTTGTATAGTGTCTTCCAAAGAAAACATATCCGTATGGGGGT
TTTCCTTACAGTTATCTAATTAAACCAGTAAGATTTATAAACTTGACTGTTGCTGAATTT
GCATTTTTTATTCAGTTCCAGTAGCAGATCTCATTGCCCTTGGTCTGGATTTCAAGCCTG
TTCTTCACTGCCCTTGCACTAACCATCATGTAGCATACATTTGTGTTCATCTTTCACCGC
TGCCATCTCTCTTCAGACTGCTGCAGTTTTGTCTTATACCAAATAAATAGGTGTAGATTG
CATGTTCTGGTTTAAATTGGCTGCTTCCATTTCATTGAATTGACACTAAGTCAGAGGGCT
TGAGAGCCTTAAAGAGATTGCCTGGAGCACTGGTGTGTGGTTTTTGTTTGTTTGTTTTGT
TCCTGTTGCAGCTACGTAACAAAATCTGAAGGTATCTGAAGTCAAAATCCTGGTGCTCTG
AGGTATCCTTTTCTAAAGGGTCTTTTCCTCTCTCTGACACCCAAGAATTCCTTCTGATTA
CTAAATTCTGGTCGTACTTTTGGCTGCCAAAAATGTTAATACATTAATGTTTTACGTACC
TGCTTTATAATGGCATATAAAATTATTTCACTGTTTTTCTTTTATTCCCAGGTGCATGGA
GGACTGCAACAGAGGAGTGGGGGACTGAAGATTGGAATGAAGATGTAGGTATTAAAAAGG
AAAAAAAAAAAAAAAGATGTAGGTATTCCCAGGTCATTCCTCATTAATGCCTTCTATCTT
TAACCGGTGTTTAGAGTTTAGGGATAGTAAATGGTTCACCCTTGAGGTTCTGAGCCAGAA
TATTTCAAGTATGTTATATGAAGGAGACGGCATGAGTGAGACTCTGTGGAACCACATTAT
GGAAAGGGCAAGTTGTATTGTGTAAGTCCAGTATCTGATTGTTGGATTTATTTCAGGAAT
AGATGGTGGTTGGGTAGGACACCAGAAATGGAGTTAGGCAGGTAGTGCATTGAGTGGTGG
CACATATATAGAGAATGACTCTACTTGGAACTTTTCCATTATTTGCTTGGCATTTAAGTA
TTTGGTGTTTAGTTTTGTAATTTGCTTGGAGGTGGATAACAGAGTGAGAGTACAAAATCT
TCACGCTTACAGTTTGTTTGGTTCTGGAATCCTTTTATTTATTCAAAGCCCAACTTTGTA
ATTGTAATTGACATCAGTAGGTATAGAATTTGCTTCTTTGACAGCTTGCAGCAACTTCTG
AAACCATGTAGATGAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGGGGGGC
GGGGGAGGGGCGGCAGAGTCCCTCTTTTTATGTAGGAGAGGATTTTAATCAAAAAAGAAC
CAAAACAAAACCCAAGTTTACTTGAATAGTTATTCCCTACCATTGCTTATCTAATTCTTG
TGTCTTGCAGTGGAGAAACTAGGTGTGATAAAGTCAATAATTAAGACAAAAATTATATAT
AGTTAAAATTATCCCTGAAAAGACATTAACTCACCAGCACTGGGTCTTTACTGCTCAAAG
TCAAGCATTAAATTCTTTCTGTCTTTATTTTGTCTGGTTTGTCTTCCCTTTGGGGGGAAT
AGAAGATAAAGTGAAGTTTGGTTAGAGGTTGGGGCTGGGGCCTGTAATGGGAAAGAATAC
CAAGGTGTTTTTCCTCTCTTTTTTTCATTCTTTAACATATATGTTGACTTTTCTTTTAAG
TTCAGTGTGCATATGGTGTGGCCTCCATATATATATATATGTTTTAAAATACAGTTTTAT
TGACACACTGTACAGTGTAGACTGTATAATCGGTGGATTTCACTATAATCACAGAGTTGT
GCATTCATCATAAGTCATTTTGAGAACATTTACATTGCTCCAAAAAGAAAATTCCCATAC
CCCTTACATCCCCCTATTATTGACATGTATCATTGGTATGGTACCTATGATAAAAGAATA
TTACTGTTAACTGTAGTTCGTAATTTGCATTAGTCGTATCATTCCTATATTTTATTGGGT
TTCTAGGTTCTAACTCCTCTTTGGGTAAAATCATTGCACATAAGTAGAAGGGGGCTTTAG
AAGGTCAGCCCATTCAGGATTCCTCAGGGTAGATAGCTTTCTAAAGGGTTTCTGTTTCTT
GATGTTGAATTTCCCTTGCCTATGCCAGATTTCTGACTGTAGTTTTCCTGATACACCAGG
AGTGATTAATTCTGTCTTCCAGCTTTCTGAGACCAAGATTTTCACTGCCTCTAACGTGTC
TTCAGTACCTCTGCCTGCAGAGAATGTGACAATTACTGCCGGTCAGAGGTAAGTGTATGT
AAAATGCAGTATCTTATTCCCAGACGGATCAGCTGAGATAGCTGTAAGGAAGAATGGCAC
TGGGCTTTTACAAACTCCCATGGTCTTGGTAATAATAATAATCAAATCACATTAGATTAT
GATAAGTTTATAAGAATTGGTACTACTTAATCTAGTGAATGTCCGTATGTTAAAATTTTG
AGCTGCTTTTCTGCAAAATAGGTTTTTAATTATATAGATCAACCCTTCAGTCTCTGTGGC
ATTGATTAAAACTTAGTACAGTATAATTTGTCTTGTAGTAAGTCAGGCAAAGAAGAGCTG
AAGTGGATGTCTTTTCATTTATTTCTGCATTGTGCAGAACTATTCAATAGCTTCTTTTCC
TTTATATTAATGATCTTTGCCTACTGAGTTCACTGAGTTTAGTGATTATTTTTTTTCCTG
GGATCATTAGGATCCAGTTTAATGAACTGTTTAGAACTTGAATCTAGGTGTTGAAGTCAG
TGGGTGGGGAGACACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAG
ACACTCTTCAGAGCCTATTTTTATTCGTCAGGAGCGCCTTTGATCACTTTAGAGCTAGGC
ATATGATAGTTCTTGATTCAGAAGGACAGAAGTGGAAGTATGATATAGGATGTTGGGGGT
ATCGTGACCAGAAATATCTTTAGATATTCTATGAAAGTTGAAAACACATACACAAAATCC
TACTTGTTCTAAAGCCACTTGAAGATTCCAGCATTCTGGTATACGGTTTTAGGTCTTAGA
TACTGGTAAAGATGGGTATTCTGTATTAAAATAGTGAGCAAAAATTTCTGAATTTTGCCC
TAATTGTTGTTGCCATATTAAAACTAACATTTGATAATTCATTGAACTAATATTTTCATT
AACATAATTTAAATCGTTATTGTTGGGAACAGTGGAATTTAGATACTATAATGGCGCTTA
TGCATAATTTTTTTTTTTTGGTAAATTAAGCATTTTAAGGCTTTGTGTTTCTGGAGTCAG
CTTAGAAGAAGCAACAGTAAGTGACTTCATTTTGATCTAACCATAGACATAGGTGTTGGG
GAATACCAGAATGTTCGATCTACTCATCACGCTTTCTTTCCCTCCCTACTAGAATTGACC
TTGCTGTTCTGTTGGGGAAGACACCATCTTCGATGGAGAATGATTCATCTAATCTGGATC
CATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTGTTCAGTAACTCGAAGCAGAGTGCCA
TATCACAGCCTGCTTCAGGGAACACATTTTCTCATCATAGTATGGTAAGTAGGAAACTTG
GTTTATCTTGATAAGGCCTTCCCTTTCCCCCCAACACACACACACACACACATACACTCT
TAATTGAATTCCTTCCAAGAACAGTTGGAGATTTGGAGCAGAGGAGAAATAATCCTCTTT
TGTCATCTTTTTAGAAGCCTTGGGTATAGAGATGTTGAGTTGAGTAGTAGGGGATATCTC
TAGGGGAAAACTGCTTTGGACAGATGGAAACATCTTACACAAATAATTTAATGTCATTTC
TTGAATATCTATTATTATGACACTTTTTTTTTTTAACAAATCAATTTTATTGATACGTAT
TAATAAAGCATATAATTCTTAAAGGGCAAATGGCAACAATGTGTCAACAAATTTTTTAAT
CTTTTTGCAATCCTAATTAAACTTTAGGGGGGTTGTAGCAACTCTTCATTTCAAGATGGA
GCAGAAATTGACACACATATTTACTTGAACCAACATTGCTAGACTAGGCTTCCAAACACC
TGAAGTCTTCCTGAATCTGCCACTTACACAGCCATGTCTTTGTTATTGAGAATGGGGATA
AGAATGTTTGCTCACCTATCTACAGGGCTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGATTGAGCTCTACTTAGGAGCAAAGCAATAAAAAGGGGTGTCACCTG
CAGAAATGAGATTAAGACCTATCCTTTGAACCTGATGATATGAGGTCCTGACTCTTGAGG
GCGTGTAGCTCATGCTTCTAGAGCAGGACAAATAGCATTTCATCAGCACTTCTGGCCTCA
CACATTTGGTTCCCTCTTGCAGATTTGAAGAACCCAAATGATTCAGCAGCACACAGCCCT
TTTACAAAGCGCCAGGCCTTTACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAG
AAACCAACTGCAGTGGCTACATCTACAGCTGCACCTCCACCCCCCTCTTCTCCTTTGCCA
AGCAAATCCACCTCGGCTCCACAGATGTCTCCTGGATCTTCAGATAACCAGTCCTCCAGC
CCACAGCCAGCTCAGCAAAAACTGAAACAGCAGAAGAAAAAAGCTTCCTTGACTTCAAAG
GTACTTGAGTTTTAGATAGATCGTATCTTAAAGCAAAGGATGTAGGATTTTGGGAATTGA
GAATTTGTGAGGGTATCATTTGGAAATTTGAAGGAAAAGTGTTTCATTAGTCTACAGTAA
GGGTAAATTCATTTTCTCTCTTGCTTCACCTTTCTCCTTACAGATTCCTGCTTTGGCTGT
GGAGATGCCTGGCTCAGCAGATATCTCAGGGCTAAACCTGCAGTTTGGGGCATTGCAGTT
TGGGTCAGAGCCTGTCCTTTCTGATTATGAGTCTACCCCCACCACGAGCGCCTCTTCAAG
CCAGGCTCCAAGTAGCCTGTATACCAGCACGGCCAGGTAATGGAAACATCAGCTTTAAGA
TCTCTTTTATTAATTTTTTCTGAGTTTTGCTGATTCCTAGAACCCTGGAGCAGTCAAGCC
TCTGACTGGATGAGGGAAAAGTAGCCAATTGTGGTATTATGTTGAGCACTTTAAATGGTG
TTAGGATTAGCTCTAACTCTAAACAGATAGAAATATACCCCTCAGGTACCTCTAGAATGA
CCAAGCACAGTTTTGAAAGATGTGTAGAGCATCTCTAACAGAGAGTTACTTGGTACATAC
TAGAGCTAAAAATGCGGTTGGTTTTTCTTTTAGACCTCTGATGTGAGACTCATCCCTGAG
AAGGGAATAACTTTGAACTCCTAGGAAGGAGATGTAGCAATTTACCAATAAAAAGGAACT
TTACCAGTAGGATTTTTTTTAACTGGTAGCTATCAAGAAAGACCATCTTAAGCAACAAAG
TCCTGGAGGTATTTCAGAGGATTAGGCTATTTTTCTCAGTCCTTAGAATCCAAAAATAAC
ACATGTCTAGTTTCTAGCCTAGACCTGTTGAATTAAAATGCCACTAAGGCATGTGAATTT
TTTTTTCCTTTGTAGGAGGTACTAGGGATTGAACCTGCGACCTCATAATGCAGGAGGCTG
GCAGTCAACCACTGAGCCACATCAGCTCCATTGAATTGGTTTTTTCCTTTGTGTGCTTGT
TTTGTTTTTCTCTAGAAGGCATCAGGAATGGAACCCAGGATGTCCCATGTTGGAGGCAGG
TGCTCAACTGCTTGAGCCAAAGCCACTCCTTGAATTTTTTTAAAGTTCCTCTGGGAGAGT
TAACCAGTAATCTTAAATCATAGTAGTCTTCTCTGTTGACCTTGGAGCTCAGAATTCTTA
AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAGCTAAAAATGCGGTTGGTTTTTCTTTTAGACCTCT
GATGTGAGCCAATGCCCTGAGAAGGGAATAACTTTGAACTCCTAGGAAGGAGATGTAGCA
ATTTACCAATAAAAAGGAACTTTACCAGTAGGATTTTTTTTAACTGGTAGCTATCAAGAA
AGACCATCTTAAGCAACAAAGTCCTGGAGGTATTTCAGAGGATTAGGCTATTTTTCTCAG
TCCTTAGAATCCAAAAATAACACATGTCTAGTTTCTAGCCTAGACCTGTTGAATTAAAAT
GCCACTAAGGCATGTGAATTTTTTTTTCCTTTGTAGGAGGTACTAGGGATTGAACCTGCG
ACCTCATAATGCAGGAGGCTGGCAGTCAACCACTGAGCCACATCAGCTCCATTGAATTGG
TTTTTTCCTTTGTGTGCTTGTTTTGTTTTTCTCTAGAAGGCATCAGGAATGGAACCCAGG
ATGTCCCATGTTGGAGGCAGGTGCTCAACTGCTTGAGCCAAAGCCACTCCTTGAATTTTT
TTAAAGTTCCTCTGGGAGAGTTAACCAGTAATCTTAAATCTAGTAGTCTTCTCTGTTGAC
CTTGGAGCTCAGAATTCTTTAAAAATAGTATGAGCAAAAGATGACTCTCATGCTTTAGAG
TTCATGTTATGATGTATAGTAGGGACCTAGAGTAATGTATCCTTTCGACTGAACTTTACT
TTAGCCTTTATTTCCTTGTAATAGCAGAATATAGGGGAACTAAAGGTTTTTCTCTTTGAG
GGTTGATAGTGTTTTTAAACTCTGTTCTTGATTCAGGAGAAAACTGCAGCAGTTTCTTTC
ATTCATTGCTAGAGAAGTTCTTTCTGATTGTAAGCAACTTTTTTCTGGTAGAAGACCTCC
AGGGTTTCCTGAGCATTGGTGGATCTGCTTTATTTTGTTTCTCTAAGATGTTTCCTTTCT
TTATTCTCCACAGTGAATCTTCATCCACAATTTCATCTAACCAGAGTCAGGAGTCCGGTT
ATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAATAGTGCTCAGGGCCCAC
TGTACGAACAGAGATCCACACAGACTCGGCGATACCCCAGCTCCATCTCTTCGTCACCCC
AAAAGGACCTGACTCAGGCAAAGGTAGTGGCTTTACAAGCCCCTGGGCATTGGTTAGGAG
AATAGTGGGGCAAAGTCCCTAAATATTAGTATTTTATTTCTCAGCAAAAGCTGCTAAGAA
ACCTCAGGAGTGCTGACTGAGAAGCTGCAAAAAAGTACATTTCTGTGGTTGGTGAAATAA
TTATTTTCAGCAAGCCTGGAAGCTCAGAGGCAGAAAAACATTCTGTTTGCACTAAAGATT
CATTGTTTCTAATATAACCAGGCTGAAGTACCTGTCTTCTCTTCTTGGAAGATCTGATTG
CTAGACTTCTGGGTGCATATCAGTAAACCTCAAACTGCTATGTCTTGGCTTGGTGCGGGG
GACAGCATATGCCAGAGGAGATGTGGAGTGACTGCCAGATGCAGCCAGCAGAATAGGTGG
TTTGGCTGAACTGTCTCACTCCCATAGCCTTCCTCAAGGATCACTGGATTTGGACTTTGG
GCCTTTTCTGCATCTATTGTGGGTTTGGGATGTCTTCACCAGTTTGGGGGGGTATTGCCT
TCTGTGGCCTTGAGTCATGCAGGGTTGTTCTGTCTTGATTTTTGTTGTCATCGTTGTTTT
TAAGTTTTATGATAATTTCTGTTCCTTTGGAGAGTCTGCAACGTATTAATCATTTGGTTA
ACTTATGGAATTTCTCTCTGAAAGGTTTGTTGACCAAAATTAAGCCAAGCCATTGCTAAC
CTGCCCCATTCACTTGAGTTTGTCTGTTTCTTGCTCTTCTGTTTCTTGTACTAGAATGGC
TTCAGTTCTGTGCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ACCAATCAGCACTCATCCTCCTTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACT
ACCACCACACAACATAGCAGGTGATTAGGGGTGAAGGAGGTTGGGGTTGGTGGTGAGTAG
CTATAACGGAGTTTTCTGGTTCTATCTTATTCTTTCTACCTGACAGACCACATTAGCCCT
GCTTTTTATGGTAAGTAGATGACCCGAAAGCTGTGGGAAGTGAATGCAGAGGAGGCTTAT
TTTCCTTTTTCAGTATCCATTCTTGCTTTTACTGCTCACTGTGACTGGCTGGCCATATGT
TACCATATGATCTCAAGCCTCCTTGGTCCTATAGTCTGCCTTTTTTCCTTGCCTGTGTTT
TTCTCTGGTGCTGCAGGTAGATAGCATAGCACTATGACTAATGGCAAACTCTTTCTTTAC
AGCACGTTATCTACTCAGCAGAATACCCTTTCATCATCAACATCTTCTGGGCGCACTTCA
ACATCCACTCTTTTGGTAAGAGTGATGCTGTAAAAGAGGAAATGTGGTTTACTTACACTT
GGTAACTATCCAACCATAAGATTCTCTCAAGGTTATATTTAAGAGGGTTCTTGAAAATTT
CTTCATGAGGTGGCAAAATAATAATTGATCTGAGGTCATAGAAAGGGAACAAAAAGGAAA
CCAGGAGAAGCCAAAAAATTCAGAAACATTGTAGAGTTCTGGGCCAATCCTAAAACCCCT
GGAAGTGACTTTCCTGACTCTTTATCTGATACATTTTTTCACTGAAGATGGGTGGGCCTT
TGTATGCTATGCTGAAATCTATAAGTATATATTTTTAACTGGTACAGCCTTTCCTCATTC
CTTGTTTGGGGGTATGTGAAACATGAGTCCTGAGAATAACCAGTGCCTGAGCATCTTTAT
GACAGTAGAGGCCAGGTGACAGCTTTCAGTTGAAAAAATTAATTTTATTGTTGTGATTGA
TAACTATTTGTGACCTTATGCTGAGGTTATAAAGGAAGGCAAATAACTTCAAGAGGACCC
ACTTTGGACAACTATGTCAGGTTTGCCAGGAGCCTGGGGGAGTAGGGCAGGGGAGAAGAT
AGGAGGGCTAAGGCTTGCTTTTGCTAGGGACCTTTCTTTCCTTAAACACACTATCTCAGG
TTTAAAGTCGTTAGGATTTGTGTTTTTTCCTAGCCCATGAGCTGGTTTCCTGGGCTAAGC
TAGTAAAGAAAAAAACGTGAAAAAAAGGTCATGTTTTATTGTTCAGGTCTCAGCTATTAC
TGTCCCCTTACTGACCATTTTACTCTAAAAGAGCTTGTTTGTCCTTCCTCCTCTGCTGTC
TTTCAGAACAGAGTGATGACAATGTAAAGGGTGGGTCTCTTATTAACTTTGCCAGATGAA
TCTTGAGGAATGTGTAGCTGGAGAATATTATGCCTTCTAACTACTTTGGCAGAGGATATC
TAGTACCTTGCCTTAGCTTTTTAATTGGGAAGTTACCACAATGAGAAATTAACCAGTGGA
AGGTGTAGTTCATCTTTCGTGACCTGTAATGGTAATCACTTTTTCCTTCTCCCCTCTCCC
ATTCCTTCCCCCTTTATGAAGCACACAAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCC
TCCAGCACTTTCTCCACCTCATCTAGCACAGTCTCTGCACCTCCCCCAGTGGTCAGTGTC
TCCTCCAGTCTCAATAGTGGCAGTAGCCTGGGACTCAGCCTAGGTAGCAACTCTACCGTC
ACAGCCTCCACTCGCAGCTCAGTTGCTACGACTTCAGGTAACCCTGCATAAAAAGTGGAT
AGTATTCTTCTGGGGTGGAGGACAGAAATTATATGCTGGAGATAACAATGTAATTTCCCT
TCTAGGAAAAGCTCCTCCCAACCTCCCTCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTA
TATTATGGCTCCAGGGCTGTTACATGCCTACCCGGTAAGTGGGACTGCAGGATATTCTCC
AAAAGATAAGGATTTTATGGCTACTGTCTTTGTAGCTCTGACCACGGTTTGAAGACTGTA
ATTAAAATATGGAAGTGAGTGTGAATGATTACCCCACCCCCCCGTAACCCGTAATCTATT
TTTTTTTTCTATAAACTTGGATGTTTTAGGCATTTCAATTAAGTGGACTCATACAGTATT
TGTCCTTTAGTATTTGGCTTGCTTCAGTCAACATGATGGCTTCAAGATTCGTCCATGTTG
TAGAACGTAACAGAATTTGATTAATTTTTATGACTGAATAATCTGTTGTTTGAATATACC
ACATTTTGTTTATCCATTCATCATTTTGATGGACACTTGAGTTCTTCCACCTTTTTGGCT
ATTTTGAATAATGCTGCTGTCAAAATTGGTGTTCATATATTTATTTGAGTCCCTGAGCAA
ACAGGTTTTTAATATGTGTGGTTTGGGGGAAAATAACACTTTTTAGAGGGGAAGAACTAA
ACTGAGGCAAGGACCTCTACTGTGTCTCTGCTCTGTATGAAAATTCTGGGCCTCAAATGC
CAAGAGCCAAAGAGTTTGCCTAGAATCCCTTTCAGCATTTTAGAGAATTGTTTTCTCTAA
TTGGATTGATTCCTTAACTCTGAGAGTCTTTACTGGCTCTGACTTAGCCACAGCAGAGTT
CCCTGACTTAATCAGAATGACTGGTCTGAGAATAGGTGGCTGACAGTAGTGCATCTGTAT
ATCTTCTATTAACTTGATATATTAAGTGCCTATTAAGATGAAGGATATTTTTTTAAAATT
TTAAAGGTACCTGTTCTTGCCCTAATACAATCTAGATGAGCATCATACAGAAGAAATAAC
TCAAATACCACTTTTACACATATTAACAGCAATGAATTACCATAGTACCCATAATGTTGG
AGAAAGCAAGAATAAAATATAAATCTTTTCTTGGGGAGATAAATTTTAAGCCAAAATTTG
AAGTCTGTAAGAGACAGAGACTGGTAGAATAGCAAATAAAGCAGGCTATTTGCATGTAAC
CTGTGCTGCTGCCCAGAGGCCACCCTACTTGAATCAGAAGTCAGAAATTTAAGGAAAGCA
TCCAGATTGTTCATGAATTATTTCATCTCTTTGTATTTCACTGCTTCCCTCTTAAAGAAA
TAAGAGGAATTTTATTCCTTAATTTTCTTTCTTCTTAAAGAAAACTGGAGGAAATAATGT
ATGTTCTGTTCTTACCAAGAAGTATGAGTAAAAAAAAAAAAAAAAAAAAAAAGAAGTATG
AGTGGTCTGTTGATTTATCTTGCCTCTTAATCCTTGACTTGGCCATCATCACAGCCAGTC
CCCATTAATATTTTTTTTTCTTTTTATTCTTTTTCCAGGGAATTCCCATTAATATTGTTA
CATATCTGTATCTTTCAGCCACAAGTATATGGTTATGATGACTTGCAGATGCTTCAGACA
AGATTTCCTTTGGTAAGTATATGGGGTAGAGCTTTGGAAAAGAAAGAGATCTGAAAATTA
GAGTTGGGGATTAAATCAGATGAGCAATTGATGACAAGTCACAGACTTAGCTTTTTTTCC
CAAGCCATCTCTCCATACACATGCTTTGGCATAAAATATAGGGGTTTGAGAGAGTAGTTC
TATTAGAAGGTAACTTAAAAATATCACAGTTGTGAAATCTTTGATTTAAACAAAATTTAA
TCTAATTTCTTTGTAGGCCAGTAGAATAATGCCCTGGAACTCTTCAGATGTTTCCTCTAT
GTCTCAAGAACTGTGAATTCCAGAAAGATACATCTATTTCAGTAGAATAAGCTTGACATA
GTAGGGATGTGTTCTGGAAGATTTAGGATATTTTTGGTTCTGATGGGCCTTGATGTGTTC
TCCATTTAGCATACAAGTAGACCTTGCCTGGCTTTGTTTATAGCCATGCAAGGGGGACAA
TGTATGCAACAGTAATTTGGAAGTTTGTGCCAGCTCTAGCCAGCTTAATTAATGGCTGGA
TAAATTGCAGTATTCCAACATTCTCCTACCTCTCAACCTGTGGAATTAATCATGGTGAGG
AATGAGTAGCATTGAATGTCTTCTCTTTCATTTTTCTCTTCTAGGATTACTACAGCATCC
CATTCCCCACACCTACCACTCCACTGACTGGGAGGGATGGTAGCCTGGCCAGCAACCCTT
ATTCTGGTAGGACTGGGTTGGGGCTCAACAAAGGGAGTTTGTGTTGGGATTGGTGGCCGA
AACTTGATTAGTAGAAGCAAGGGGCCCACTTTTCACTTTAAAGATCTTTAGCAGAAGTAT
AGAATGAATGTGATCAATCAGGGTGGGTAGATTCAGAATCCTGTTAAAGATGAGCATGTG
GTTGCAGCTTTTTCCTTCTCATCCACTTTCTATTGTCTGCCAGATGACCGATGACATCTG
GACTTGGTTTTCTCAGCCATTTTCCCAGTTTTATCAGGAAGTGCAATGGTTGTTCTGGCC
TTCTTAATGTATCTCTGCCCCTGTACTCTACCCACAGTGGCAGTCTCATTGCCTTGCTGC
ATCTTTGGTCTTCTTTTTCCTGCCTGACCTACCACTGTTCTCATTAATCTTTCATTTTCT
CTGACCTGTGATGGTCCTTCAAATCTTTCCTTGGTTACATTTCTGACATCTATATGGTTA
TTTCCCTTGTAATAGCAAGTATCAGTATTTTATCTAATGCTTTAGAGTTTACAGATTGCT
TTCACATCGCTCGTCTCATTTGGAAAAGGGGGAAGTTTAGGTGCCACCCTGTTTCTTTTT
TCATTCATAGAAATTCAGGAGACAGCTGTGCTGCAGGGTTGGCAGGCCTAGTGTTGTATT
GTCTTATAATTTCCCAAGCTCGTTACAGGTATTCCCATCCCAGGGTGGGGGAAGAGGGGA
ACAGAGACTCTGGAAGGAGATGAAAGAACTGTTCAGGAGCTTTGTTCTGGGTGCCTGTCT
CTGTTATAGGAGTACATGGTTATTCAGTATTAGTCCTTGATTAGTACTATGCTAATTGTG
TGCTGAGTAATGCTAAATGTAGCAGCAAAGTGTAATTGTAGGAATTAAATTTTAACAGTC
TTTGAACGAGATCTCCTGTAAACATGTGAAAACAGAAGAGGTAATTTTACATTGGTGTGG
GGGGTAAAAGTGGCAGGTACATTTAGCCTTTCCTGTCACAGGTGACCTCACAAAGTTCGG
CCGTGGGGATGCCTCCTCCCCAGCCCCGGCCACAACCTTGGCCCAACCCCAACAGAACCA
GACGCAGACTCACCACACCACGCAGCAGACATTCCTGAACCCGGCGCTGCCTCCTGGCTA
CAGTTACACCAGCCTGCCATACTACACAGGGGTCCCGGGCCTCCCTAGCACCTTCCAGTA
TGGGCCTGCTGTGTTCCCTGTGAGTACCTGGTCTTGATCTCTCCTTGAAGGGGAGAATTC
TAGCCTTCAACATTATCCTAGCTGCTTGCAAAAAGCTAGATAACTTTTTACTAATGAATG
AGGAGGAAGAATGATTTCCCACCTCTGGCCAATTTCTAGCCTTGGAGAGGGTGTGGGGCT
GGGATTGGTAGGATTAGGATGGGGTAACCTGTTCTTAGAGTTAGCTGAATGGGGAATGTG
ATACCATATAAGTTAGCTTCTCTCAGTCATTCATTCCCTGCCTACCACTGCCCCTTTCCC
TTCCTCCCAAACTACCTTTTTTTCCCCCTTCACTGGCAGATTCTAGAATTCTCAATAAGG
AATCCATTTCACTAAATAGTCTTTAGGTATCCTACATCAGAATAGGTATCCATCTGAATG
CTCATTCCCTGGAGTAGGATGGGTAGGGCAGATGGTACCCTGATGCCATTTGACTGCACT
TTTGGCTTTGCTCTTCAGGTGGCTCCTACCTCTTCCAAGCAGCATGGTGTGAATGTCAGT
GTGAATGCATCGGCCACCCCTTTCCAACAGCCAAGTGGATATGGGTCTCATGGATACAAC
ACTGGTAAGCTTACCTTGGCTCTGGTTGTCAGTGGTGTCTGTGGGGTGTTAGATGAGTTT
CAGGGAGGAAAACTTGGTGCTGGAGAAATGGGGTTGGTAAGGATGTACTATTCCATGTAC
GATCGGTAATGCTTGATTGACTTGGGTGTCTGAGCAGCACCAACAGAGGAGCCTGATGAC
AAGGCATATGACCACTACTCATGGGGAATATCCAGGGACACATCTTGGCTATTAGAATAG
TTTTGAGTGGGAAACAAGTTAAGGACCCCCAAAATTTTGCTGAGATTTTAATGTAGGCAA
GTGTTAATATGTATGGCACTGATAGTTAAAAAGGGATATAGTCACTGAAAAAAAGAAAGC
TTAAGTGTGTTATTAGGATAGCAGGCTATAATAGGTTTGGCTTCAGTCTCTTTGTAGTAG
TACTTTTCTTATGTGGCTCCCTTTTTATTCCCTAGCTAGAAGACCTAAGATGTGGAGTAA
GCATGACCGTTGAAGAGAATGAAAATTGGGGTGGGATAGTTGTACCTTTAGTCTCCTTCA
TTTATTTAGCTGGGGTTTTTTGCGAAGCCCATTTATACCTTTCATGGCAGGGAGAAAAGT
AGGAATCCTCTGAATGGGTACGGAAGTAAAAGTTACTTTGCCTATCTTTCGCTCCCATAC
CTGACATCTATCCTCCATTTTTGAAGGATTGGGAGTGAGAAAGGGGTCTTTGAATTTTAA
AAAATTCATTTACATCTTCTAGTGACTTGTGAGTGAATATGAGGGGGAGGTTGTTGCATT
TTCCCAGGGTTGGGAGGTATAAGGGGGTTGAGAATTGCCCTTCAAAGCGCTCAGCTCAAA
TATAGTTACTTGGTGATTTGGATGGAGCAGCATCTGTGGTTCTCACCCTTGTGGTAGTCT
CCAGGTGGGTAAATTGCCCAAGGTTTTCAGTAATTGGGAAGCTGCTTGAACTGAGCACAG
AAGGCAATAGGTACTTTAGGAACTAATAGGTGGAGACTTGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 2635..2712, 3220..3330, 20352..20520, 20921..21016, 24514..24559, 25060..25172, 29931..29978, 30013..30017, 31762..31848, 31852..31853, 33052..33223, 33913..34111, 34402..34679, 34843..35015, 51613..51802, 52554..52608, 52945..53119, 53462..53534, 54621..54816, 54905..54993, 56418..56471, 57104..57185, 58181..58398, 58878..58982
1001..1090, 2635..2712, 3220..3330, 20352..20520, 20921..21016, 24514..24559, 25060..25172, 29931..29978, 30013..30017, 31762..31848, 31852..31853, 33052..33223, 33913..34111, 34402..34679, 34843..35015, 51613..51802, 52554..52608, 52945..53119, 53462..53534, 54621..54816, 54905..54993, 56418..56471, 57104..57185, 58181..58398, 58878..58982
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved