Dasypus_novemcinctus Locus BMPR1B
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus BMPR1B
Dasypus_novemcinctus
BMPR1B
GeneScaffold_3670
SNORA5
41897..42023
135131
TCAGGGATATATCACTCTATGTTAGTGAAACATTGTCTTACTATTAAAAAGGTAAAAAA
CTAGATTCTTCCAATAACATTAGTGAAATTTATCAAGTATTATTATGTACTGTGCACACT
CCATGTTCTTGACATGAGGTAGGTACTATTATTATCTCCATATTAAGGATAAGAAAATGA
GGCATGAGATGATTAATGTAAGTTACCCAAGGTCAACTAGCTAGCAAATAGTAGAGTCTA
GGTTTCCACTATTTTTAAAATTTAGAAATCTGTCTCTAGAGATCATGTCTGCTTGGTCTC
TTTCATCAAAGATGGCAGGATCATCACACTTTAATAGGTAGACACTTTTGCATGAAAAAA
ACTGATGGGGAAGATATGTCTTTTGAAATATATTTTAATACTAATTAAGTTTTTGTCTTC
CTCCCCAGTTTTGCAGAATAGATATTTTTAGTAATTTCTTTAAAAATATAGGGTGTACTC
AAAGTAGAAGGGTTTCATATTATAGTAGAAAGACTATTTGAGGGCCAAAACAAGAGGGTC
TGTGTTATGGCAGGAAGTAATTTTAGAGTCCAGACAATCTGGGTTCAAATGCTGGCTGCC
TGATATACTAGCTGTGTACAGATCGCTTAAACTTTCTGAGTCTCAATTTTCTCACCTGAA
AAATGAGAGTGATAATTGCCCACAATATTACTGTGTATAGTATGGATAATCTATATAAGC
ATCACATTGAGCTCCTTGCATTCAATTACATACAGCTGTTGTACTTTAATGTTTAAAATA
TATCCAGAAAGAATTATGGGAATTTATTTGTTCTATATGAAACATACTATAAAGAAAGTA
TAATTTTTAGTATCAAAATATCTGTTTTCTGTTTAAATCATTAAGTATCATGAATATTCT
CTCTTGTTTAGTCTCATATTATTCTTTGGATAGAAACTGGCTAGACCATGTCACTGATGC
TTAAAATCTTTCTCTCCTTTTCAGCAACCTTCCTTGATAACATGCTTTTGCGAAGTTCAG
GAAAATTAAATGTGGGCACCAAGAAAGAGGATGGTGAGAGTACAGCTCTCCACCTCTCGT
CCAAAGATCTTGCGTTGTAAATGTCACCATCATTGTCCGGAGGACTCAGTCAACAATATT
TGCAGGTTGGTGATATAAATTATTTAAACTAGCTTTAACAGAAGTCACAAGTATATGGTG
GATAGACTGTGGTCTCGTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCCA
AAATGAGAGCATCTGCGTACAGAGCATAGCCTCATGAGGCTAGAGTGTGTCATGGAGGAA
GTGGGTAAGTTAACCAGACAAGTGTAGATCTTGGCAGCTAAAATATCAGAGAACCAGGAT
TTGCCTCGAGAGAGAGGTCATGGACTCCACCAAGGAGATGGGCCTTTTGGGTCAGAGTCC
AGGAAGTATGTTTGAGCAACCATTTGGTCTTCAATATCCAAGAAAGAACATCAACCTGAG
CTGAATGCTTTTTACTTTCTGAGAGCTTTCCCCCCCCGCCCCCCCCATCCCTATCACTAA
GTCTCTTCTTTTAAAATAAGGGAAGTTACGGGTTTACAAAACAATCATGCTTAAAATACA
GGATTCCCACGTATCACCCTGCCATTAACACCTTGCATTGGTGTGGTGCATTTGTTTAAA
ATGACGAAAGCAAATTTTTATAATTGTGCTATTAACTATAGCCCATGGTTTAAGGGTTTA
CTGTTTATGTTGTACAGTTCCATGGATTTTAAAATTTTAGTATCATATAAAAAAGCTTCC
TATGAAATCTGGTACCAGTTTAGCATTGTCAGTGAATCCTGAGAATCTAATAGATATATA
ACTAGAAATACAAATTAAGTGAAGACAGAGGGAGTGTGTGTGTGTATACTATATGTCATA
TATTCACTAATAGTTATTTAATTTAAAAATAAACATGGAAGGAAATGCTTATTCTGACTT
AAGATATAAGGAGATTGGGGTTCAGAAAGCTCTAGTAACTTTGTTCTTGTAATGTAGAAA
ATGCTTGGGAGACAGGCTCATGCTGAGTAAGTGTGATTCCAAAGCTTGGACAGTTTCTCC
TGGGAAATGCTGCCTCTTTATTGTTAAAAGAGTATCAGAAGAATTTGAAAATTTTCTGAA
GAAAGGAAAATCAGCAGAAGGAAACAAAGTAGGGGATTCAAAAAAATGGCAGTAATTTTA
CTATTTTGTATCAAGCGGTGGTACTCAAGTAAATCCATGGGTGTCATTTGAACTACAGCC
CAGTAGCCCAGTGAATTTTGGGAAACATATTTAAATAGTTCCATTCAGTTTAGACTCAGG
AAACTTCTGAATATAGGTATTTTAAAAATTTGAATCTTTAAACTTCTTTTTTTTAAAGAT
TTATTTTTATTTATTTAATTCCTCTCCCCTCCCCCGGTTGTCTGTTTTCTGTGTCTTTTT
GCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCTTCAGCGGCACGGGAAGTGTGGGTGG
TGCCATTCCTCGGCAAGCTGCTCCCTTCTTCGCGCTGGGCGGCTCTCCTTATGGGTGCAC
TCCTTGCGCGTGGGGCTCCTCTACGCGGGGGACACCCCTGTGTGGCACGGCACTCCTTGC
GCGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGCTTGAAC
CGCGGACCTCCCATGTGGTAGACGGACGCTCTAACCACTGGGCCAAAGTCAGTTTCCCTT
TAAACTTCTAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTT
TCCAGGGTTTGGAGGTAGAGTAAAACATAGTGTGCTTGTGCAAGGGATGTGAAATCATAC
TAGGCTGCTTAAATGAATAATTAGATAAGTCTTCAACTCTGTATCTGGAAAAAGTCACAA
GGGACTAAAGGAAAAGCTTAGGTCCTGTGAGCCTTTTTACAAAATTGGTATACCCTAAGA
CTGCTCAAATTGTTGGTCTGTTTAGCTATCTAGCCATCCAGCTATCCAATAAGTTGTGAG
TTTACAGAAAACCATGCAGAAAATACAAGGTTCCTGTATACTACCCACCCCCCCCCCCAA
CTGCTTAAATTTTAAACCTCCTGCTGACTGTGGTGTTGCAAGTTTTCAGACACATGCTTC
ACAAGGTCTTATAGTATTTAAAAGTGCACATTGTCTTTGTTTATTCATACATCATACATG
CCCACACTCATTATAAGCCTCCAGTTTATTCTACTGTTGCCAAAACCATCTGTACATTAA
GCTCTATGATCCTTTTCTTCTGGTAAAAGTTGAACTCATTGAACTTATGAAAATACTCAT
TAAAACTTGAAATGTGGTTATAAGAGGCTAGGATTTCAAATTCTTTTTTGATGTGTTTTT
ATCAGGAATAATGCTCCTTTTGTGCCTCTCAATTATTTTGGTTAATTATAAATAAGAATG
TTAAATGGGCCCAATTTTTCATTGGACTTAATAGTGAATAGTTTCAAGCTCTTTAAAAAT
TATACATAGGGAGCCATTGATTATTTTTGAGCAGAGAAGGAAAATATAAGATACATCAGA
TGTTGTTTTACTGAATAGGTTTGTGTCAAGAGAGAGGAGATGGGAAGTCCCACTAGAAGG
CCCTGAGAGCAGTGTCAGTGAGAAGTAGTGAGGGAATATGAAGGGTGGTAGGGTGAAAAT
ATACAGATGCCTGATTAATATAAAAATTGAGGCAAGTATAAAAATCTTCTAACTTATAGG
AAAAGGTGAACAAAACAATAAATACTCAGAATAGATTCTGGAGAAGTTTGTGTGATCATT
GCATGCATGCTCCTCATAGAGTAAAAAAGGTCTTTCTCACATTGAACTTTATTAAAGTCA
TAACTTTATCTTCTCTCAATACCATATGACCCCCTCAGATGAAAAGCCAGAGAAGGGAGA
GAAATTTTTTACCTTCTTTTCTTATACCCCAATGAGAATCCTGCCATTTAAAATGATGAG
GGAAACAAAAATAAACAAAAAACAAATGTTAAGATTCTCTTATGCTTTACTTTAATAACT
ACCATAGCTCAACATTCTTTTATTTGCTTTTTCTCCAATCAGTAGAAAACCCTTAACTAG
CTTATGATTTGCAGCTCTACTGCTTGATTTTGACTTTCTCTCCACTATGCTTCTAAGGTT
GGTGACCTTTCTTAGTAGACTATGCGCTCCTTAAAAGCAAAGACAGCCTCATCCTTGCAT
TCTCAGGACCAGACTCTGCCTGACTCATAACCTGCTCTATAAATGTTTGTACAATGAACC
ACTGTTAACAAAGCTATGAGCAACTTTTAGACGTTTTAAATGATTAACATCTACATGATT
TAAAATAGCAACTCAATGTTTTATGTATCTTTGAGTTTACTGGTAGAAAAAAACTTTGAA
AACTTCCTTTTTCCCCTTGAATATTAAATAGATATTTGAGAACCAGAAAGGGCTTGGCTT
TAGAATGGGAATTTTATTAGAGTAAAAACTTTTACTCCCAAGGCTGTGTAAATGTCCAAA
TCAGACATCATCAGAGATGTTTCTCACCAAAATCAGATATCATCAGAGATGTTTCTCACC
AAAGGTTGGCTGCTAGTCAGATTCTGGACTCCCGCCATGGGCGAGGCAAGATGGCGGCTC
GCCATTGGGTTTCTACCTTCTCCCATCTCTTCCTGGGCCCACTGTCTTCAACTTTTTTCT
CAGTCTCTCTTTCAGCTGTAGCTAATCCTGGAAATGTCTTTCACATGGGAGGGTAAAATG
GCAGCTGTTTTTTTCTCTGAGTGTTTCTGCTTCTAGTTTTCAGTTTATATAAGACCCCAG
CAAGAGGGCTGAGACACCCTGGGTCACACCTCACTGACTCAGTCCAAAGACCTAAATAAA
TCTAATTAAAGGTCTCTTAACTAAGTCTAACCAAAAGGCCCTATCTACATTGCCTTCATA
AGCACAGGTTTTGGGTTAGCTTAAGAACACAATTTTCTGGGTTGTACAAAAGACAAACCA
GGGCAGAGAATATTCTCAAGGACCTCTTTACAGATGACCTCAAATCAGCTGACACGTTAA
AAGTGATCCTAACTGAAAAAAAAGAAATATGAAAGAAATTGAAGAATTCTAGTATTTTTC
ACATACTGAAAAAAAAAAAAAGGAATAAGTAATGATCAACAGATTTTAATCCTTGAAGGT
AGATGCAGTTGAGCAGGTAGTCAATTATATAATTTAGTATTTGTCAAGACTAAATTTAAA
ATAATGCTTTAAAATGCCCTATCTTCCTTATTGAGCAGAGCAGATAAACTCTTTTAAACT
ATTTAATAATGTTTAAAATTCAGTGTATTATTAAATTAATCTTTATAATGATCTAGACTA
GTTAATTAAAAAGCTCTACATCCTTTGTAAAATGTGATGGTGACTGAACAACCCTGAAGT
CTTCAATAGAGAAACATAAAGTCATAGTAGAAGAATACTGTTAAAGGGATCAGGTCTTTG
GTAAAATTATAAACACTCTGTTCACTAAAATGAAACAATAAATAGGCCAATTTAAATAAA
GACACTGAGTGCAATTTTAAATATCTAAGAAATGGGTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATGCAGAAAGGACTTTTCTTTGTTAGCTTCTTAGAGTTTTAAGTG
TTTGAGTACCAGATGGGTCTTGAATTAACATATCCCCCACATTCCAGGTAAGCTTGAATT
AAGTTATTGCCCACTTTCTGTCTGGATGTAGCTTTGAATATACATTCAGTCTACATCCTT
TCTGAATATTTAACGCCTAGGGCCTGTATTACCTAACTGGCTTTCTAGAAACTAGGTACA
CTTGGCTACAGAATTAAATAATTTTGAATTCACGCACAAGCTCTATTAGCAGGATGTTCA
AGTAAGCCAATGATGAGACCTAATAGCCCTTGGTGACTGGCAGCAGCCATCTTTTAGTGC
CAGGAACATAGCTCTGATTATATTTGTGCTTGCTTGAGAGTTGAAAGTTCTTAAGTAATT
TTTAAGCTTCTGTAACTGTACTGCTGGCTTCCAGTTGATGTGGCTTACTAGCTAGTAATT
TCAAAGAGAAGTTTATAAATTATCTTTGCTTTGTTGCAGATAATACGCACTTGAAGTGGC
TCTTCCCCCTCTACCCACCCCCTGGCTGGTCCTCCAACCAAATATTTGATTCCTTTCCAA
ATTTATGACTTATGGGATATTGACTCTTTTCTCCCTATCTCCTCCTTATCTTTTTAGCTC
ATTATTCTTTGCATACAGGGAAGTTCATTTTTAAAGCTTGAATTCACTTTCCATGAAGTC
CCTTTATATTTCTCAGGATATTGTAACACTAATTAGCCAACAACTTCACCTGTTTTATCT
ATTCCCTTATTTGTGATTCTTGTAAGTTGCCTTAAAGTACATTTCCGCATACTCAGATTT
TAAAGGTGGAGAACTCATAATTAAGTCTTTTTAGATTTAATATAGTGTACCATCATCTCT
AGTTGCTGTCAATTCCTAATATAAGAAAATTAGAAACACTATTATTTCCAATTCCTGCAT
TTGCCTTTGTTGATAAATATAAATTACACATGTAGTCTAAATGTATAGGAGAAGAATAAA
AAAACACACAAGTATTGTTTGCTCATATTTCAAGCAAATTTCTAAGAAAGACCTATTTTA
TTCATTGCCTTCCGTGTTTATATACTTTGGAGTTTTGTAGCAATTACAGTAAGTTGACTA
AAAAGCCTCAAAGAATTCAGACCATTGGCTATTCATAGTCATTCTTTCTTCCACAACAGT
ATTCATGCTTTTGACCTGAGTCTAACAAAGAGATTTATCATTGGTCCTTCGAAGTCATTC
ATTTTTATACTCGAAATTTGCTATAGTAGTTCTTATAAACAGAGGTATTTTGGATCCCTT
GAGGCTTATAAACTAAGTAAATAATTCTAAGAGTGTTAATGATAACTCAAGGGCTAATGT
ATGGCAGAATGCTACTACCACTAATTTAGAATAGGCAAACCCGAAAATCATGGCCTATAC
CATTCTGAGAGCTTTCTTTCTATAGCCTTTTGGGACTACATTGTCATAACTGCCTTGGAC
TCTGAGCATGAATGTGTATGAGAAAGCAACAGTGATGTAGTTCAGTACTTTATTTCTTTA
TTTCTTAGGACATGGTAGTAGTGGTTTAGGATTTGTATTTGGAGTCTGCTCCCAAATGTT
TAAAGACAGTAATGTCTGTTTATGAATAGTTCTATATATAACAGTACTTGTTTTTCATTT
TTAGTCTCAGGAGGGGATAGCAAAAAATGCATGGGAATGAAGTTAGAGGTCCCTGATTCA
AGGCCTGGTTCATAATTATTTGTTTTGTGATCTTGTATAAGTTTATTAAACTCTCATAGC
TATAATTTGCTCACCCATAAAATAGAGATAATAATGTTATTTCCTTTTCATTGTTATAGA
GGGGATTAAATGAAATAGAATAAGAGAAATTAATATTTAATCTAGGAAACCATACAAAAT
TAAAAATTGTTTCTTTGCTTTCCACGCCTTATTTGATTAAACAGCTTCTTTCTGTTGTCC
ATTCTTACCCACCCCCCAACTCAAACTCAAGTCTACTTACAACAAAAGCTTAATTTCTTC
ATATGATAGGCCAAGTGAGAAGCAGAAGTATCAACTCTCAGAAATTCTTAGTTACCTCAG
TTATGCCCTGCTGACCACAGCCTTCTACCTCTTTCCAAGTTTGTTGCCTTAGTAAGAGAG
AAGTACGGTCTACTAACCACCTCAGAGCAAGAAGAACGAGCATAAATATTCTCCTGCAAT
GGGTTCAAATCCTTGCTCGTCTCTTACTAGCTGTATGGCTTTTCAGAAATTACTTAGTTT
TATTACCTGTATGGCCTTTCTCAGTTACTCTGTGTGTGCCTCTTTCTCACAGAGAATATG
AGAGTATTACCTCCTTACAGAGTTGTTTGTCTGGATTTGTGGAGGTGATTACCATGAAGT
AACGAAAGAGGTGATCAGTATTTGGTACATATTGCCATTAATGGTGATTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAT
TTGCTTCAAATGCCAAATGATCATAGAATGGTTGTGTTGAGTTCTTTGACAACTTCTTGT
GTAGTTATAAGAGGGTCAGCTTTGATGATTGCTCTCAATTGGTTGTTGTCAACTTCCGAT
GGCTGGGCACTATGCTTCTCATCTCCAAGGCTCTTGTATCTTTTACAAAACTTCTTGAAC
CACCACTGCACTGTACATTCCTTAGCAGTTCCTGACCAAATGCATTGTTGATGTTGCCAG
TTGTCTGCTGCTTTATGACCCATTTTGAACTCCAATAAAATCTCTCGAATTTGCTTTTTT
CCAATGTCCATTCCATAGTCTAAAATAAATATAAAATAAACAGCAAGTAATAAGTCATTA
GCAAAAAACATTAAGTGAGAAATGCACATTAACATGATACATAACATCATCACATTTATT
TAAGAATGTATTCCATTATCAAATGGGCAAATTTCAACAATGCAAACTGCAGTTACCTTT
GAACCAACCTAATATTTACAGATATCTCCTTTCAGTTCTGTTTCCCTGGAGAACCCTAAC
TAATACAGCTTGGTACTGGGAGTAGTTCTTGAGAAACAGAATCTTAACAATGGGATTTCT
GAATTGGTTCAGGGATTTTGCATTTGGCTCTATACTGTGATTAAATTCAAGGGCACTCTG
TTTACAATAATCAGGAGGTCAAGAGGTCGTGATAATCCATGGCATAAGTTGGCAGTAGAG
ATACCCAAAATATCACTACTGGATACAGCTACTTCCATGCTCATAAGAGGCAAGGCTCTG
AATGAGAGTGTTTTTAACACCTTAACAGAGTTTTGTGGAATTAAAAGGTACAATGATGTT
GGCTGGCTGTTCCTAAATATTCTGGACACAATTATAAAAGAAAGGGATGAGGTGAAGCCT
TCAAATTTGCAACTTAAGTACAGCATGAATGATGTGAAAGTTTCTACCTGTGCCCCAAAA
GAAAATCTTGTTTTGTGCAAAGGCATACTTGAAATCTCTGAAAACCAGACTCAGAGTCTC
ATTGTACAAGTAGCAGGGTTACAATGGAAACTAAAATCTCAGCCTTGCAGGGTGTCTGCT
GTTAAAGTGAGGGCCTTGATTGGAAAAAAGTGGAATCCTGAGAATTGGGAAGGAGACATG
TGGGTAGATGATGATGGCAGTGGGAGCTTTGAAACCTTAAATTCTTCTGAGACTTTGCCA
AATAAACCTGAGTCTGTCCTGAGCAGACAGCCACCAGACCTCCTCCCTACCCAGAGGAGA
GGACCACTCAACCTCAAGCCTATAGCACCCAAACCTCAGCTTACCCCAAAGAGTCCAGAC
CTCCTCCCTGCCCTGAGGAGTCACTTCCAACCTTCACCTGAAGTGATTAATCCATTCTCA
CCAGATGAAACTTCAAGGGAATGCCCTGAGGTAATTGTCTTACAAGATACTTGTAATGCT
TCTCCTTACCCACCCCACCACCCCTCTTTACTTCCAGATCTATAAGTAGACTAAAGTCAC
AATAGGTCCAAAAGAACTGCATGAGTTTTCTAATTTATATAGACAGAAATCAGGGGAATA
TGTGTGGGAATGGATATTACAGGAATGGGATAATGGTGGAAGGAATATAAAGTTGGATCA
GGGTGAATTTATTGATATGGGTCCACTAAGCAGAGATTCTGAATTCAGTGTTGTAGCTTC
AGGGGTTAGAAAGAGCTCTCTAATGGCTGACTGAAACATGGACCGAAAGTCAAGCCTGAC
TGCTTGAGGTCGAGATGTCAGAATTGCCCTTGTATACTGTAGATGAGGGGATCCAAAGGT
TTAAAGAGATAGAACGTTAGAATGGATTTACCATCTAATGCCTGCCCACCCACACCAGGA
CACAACTTTTGTCAGGATTGTGAGGAATAAATTTGTGAACTAATTCCATCTTCCCTGAGG
AGATTGTGGTTGCTCTTCTTTGTAAGTCAGATATAACTTGGAGAACTGCTGTCACAGAAT
TGGTATCCTTAGACACTATGAGGAGATCCCAGGCCAGCATAAGCCAAGTGGCAGCAGTTA
ATTGCCAAAGACAAGTTGGGCATGGCTACCACAATGAAAAGCAGACTCAGAGCAGCAAAT
AGTCTTAAGTCACATACACCTATGACATTGCCTAATAGATCACGGGATACCTAGAAGTGA
ACTAGATAGGCCGTCTGCTAAATTCCTACTTGATCTGTATAAGCAAAAGAGTTCTAGGTC
TAGTGAACAAAAACCTAACTTGATTATAGAAACGGAGTCACAACCCCTTAATCACTTCCC
AGATGTGGGACAGTTTATAGACCCAGAGCCCCTTGAATGAGGGGAAGGTTGGTTGCCTTA
GGGAAGGAGCCTGACACTGCCAAAAATTTATACTGTTAACCTTCTTCCCAACTTTCCCCA
AAGACACCTATGGCCTTTTATCAGAGTAGCTGTCCATTGGAAAAAAGGAAATAATCAGAC
ATTTTGGGGATTATTAGACAACTGGCTCAGAAGTGACATTAATTCTCGGAGACCCAAAAC
ACCACTGTGGTCCACCAGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTTGCATGAGAGATTGGCAAATAAATCCAACAAAAATATAGGG
ACCTTCCAAATCGGTTACATTTCTAGTTGTTCAGTGGGGTAGGGCATGCTGAGATATCCT
TCTAAAGTGAAGGATAAGCTGTTGCATTTGGCCCCTCCTACAGCCAAAAAAGAGGCACAA
TATTTAGTTGGTCTCTTCAGATTTTGGAGACAACATACTCCTCATTTGGTTGTGGTACTT
TGGCCCATTTACCAAGTGTTCAGAAAAGGTGCTATGTTTGAGTAGGTACAGGAACAAGAG
GAGGTTCTGGAACAGGTCTAGACTGCTGTCAAGCTGGGCTACTTGGACCATAATATCCAG
CAGATCCAATGGGGCTGGAAGTGTCAGTTTCTAATAGAGATGCCATTGGATCCTTTGGCA
GGCTACTATAGGAGAATCACAGTGTATACCCTTAGGATTTTAGAGCAATACATTGCCATC
CTCTGCAGATAACTACTCTCCTTTTGAGAAACAGTGTTTTGCCTGCTTCTGGACGTTAGT
AGAGACTAAATGCTTAACCATGGGCCACCAAGTTACCATGAGACCTGAGTTGCCTGTCAT
GAGCTGGGTATTATCCGACACATTGAACCATAAAGTTGGGCATGCACAACAGTACTCACA
ATACAGTGAAAGTGATATACATGACACAGGGCTTAAGTGAGTCCTGAAGGCACAAGTAAG
TTACATGAGGAAGTAGCCCAAATGCCCATGGTCACCACTCCTGCCACATCACCTTCCTTT
TCCCAGCCCACAGCTGTGGCCTCTTGGGGAGCTCACTGAGGAAGAGAAAACTTGGGCCTG
GTTTGCCAATGATTCTGTACAATAAGCAGGTACCACCCAATAATGGGCAGTCCCTTCTGG
GACATCCCTGAAGGATAGTAGTGAGGGCAAATCCTCCTAATGGGCAGAATTTTGAGTAGT
GCACCTGGCTGTTAATTTTGCTCTGAAGGAAAAATGGCCAGAAGTGTGTTTATGCCTGGA
TTCATGGACTGTTGCGTGTGGTTTGGTTGGAAGGAACATGATTGAAAAACTGATGACAGG
TCTATGGAGGAGGTATGTGAATAGACCTTTTTGAGTGGGCAAAAAACATAAAAATATTTG
TGTCCCATGTGAATGCTTCCCAGAGGGTGACTTCAGTAGAGAAAGATGTTAATAATCAAG
TGGATAAGATGACCCATTCTGTGGATGGCAGTCAACCTCTTTGCCAACCACTCCTGTCAT
TGCCCAATTAGGTTGTGAACAAAGTGGCCCTGGTAATAGGGATAGAGGTTATGCATGGGC
TCAGTAGCACAGACTTCCCCTCACCAAAGCTGACCTGGCTAAAGCCATTGCTGAATGCCT
ACTCTGCCAGTAGCAGAGACCCATCCATATTCAGCCTTCGAAATGGCACTGTTCCTTGAG
GTGATAAGCCTGCTACCTATAGGCAGGTTGATTACAATGGATCATTTTCATCATGGACTG
TCAGTATTTTGTTCTAACTGGAATAAAAACATACTCTTGAATATGGATTTGCCTTCCGTG
CACACAGTGCTTCTTTCAAAACTACCATCCATGTACTTACCAAATGTCTTATCTACCACC
ATGGTATTCCACACAGCATTGCTTCTGATCAAGGAAGTTACTTCACAGCAAATGATGTGT
GGGAATGGGTACATGCTCATGGAATTCACTGGTCTTATCATGTCCCTCATCATTCTAGAG
CAGCTGGACTGATGGAACAGTGGAATGGCCTTTTGAAGAATCAATTACGGTGCCACCTAG
GTGGCAATACCTTGCAAGACTGGGGCAATGTTCTCCAGGAAGCTGTGTATCCTCGAAGTC
AGCGTCCACTCTGTGGTGCTGATTTTTCCATAGGCAAAATTCACGGATCCAGGAATCAAC
AAATGGAAATAGGAGTGGCACCACCCGTAGTGATCCATTAGGACAATTTTTGCATCCTGT
CCCTGCAGCCTTAAGCTCTACAGGTCTTACATCCAGAAGGAAGAAGACTTCTACTGGGGA
ACCCAACAATGATTTCATTGAACTGGAAGTTAAGACTGCCACCTGGTCATTTTAGTCTCC
TCATGCCCCTGAATTGTACCAGGGCTTGTCTCATACCATGCTTCTCCTCTCAGACTCAGC
TGTTCTGCTTTCTTTCCAATTTCAGCTGCAAGCTATCAGGCAAATGGTTCATCTCTCCTC
ACAGTCTCAGCTGCTTGACCTCTCCTTTCTGTCACATGGCAGAATTCTGATTTTTGGTGT
CTCAATTTTTTTTATCAGACCCAACAAGAAAGCAAAGACTCAACTTGTGTCACACCTCAC
CACAGTAGTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
GATTAAGAACCCCTGCTCAGATTAATGATTTGTCAAGAACTGGAGTTAAAACAAAATGGG
AAGCTTTAATAATTTATTCTATAAAAAGATCACATAATAATTCTTTGACTAGAAAGATAT
ACCCATTCATTTAAAATCTGACTCTATTTATGAAAAATTAAACTTCATAATTTTGAAAGA
CATCTTTGTTTAAAATCATTGACACCATATTTTCTACATATGGAAATATTTGAGGAGTCC
CATTCATTTGTATCCATCACAAGATGGCTTTGTGTTTTATGTACGACGGATATAGATTTG
TTTTTCAGACAGATTCATGATATAAAGTGCTCCAGAATCCGCTTGAGAAAAGCCTATAAA
AACTGGTTTGGAATATGGATGAACTTTCAATTTCTATTTCAGAGACAGTGTTTCATTTAC
ATTTGTTTATATTCCGTGGTTTTATCCTATGTCAGGCCTACTTCATTCCAATAGGAAGAA
ATGTGTGCCCTCCCTTGGAACAGGTGCCTAGATGAATGACGGTTCATCCTGGTCAAACTT
GCTTAATTTGAGTTTATCTTATTTTTCTCATCAAAAACAATGTTAAAAATACCTTTCCCA
TCTTGCCTGTGGAGCTGAGCAAATACAGTAGGAAAGAGTTGTTTCTTAATTTTTAAGTGA
GAATATTCTCTGTATTATGGCTGCCTTTACTTTCTATTTAATTTCAGATTTTGTTGATGG
ACCTATACACCACAAGGCCTTACTGATATCTGTGACTGTCTGTAGTTTGCTCTTGGTCCT
TATCATTTTATTCTGTTACTTCAGGTAAGTTTCTAACAGTTGTAGAATTTTAAGTTTGTA
TTATCTTTTTTATATTACTAACCCACCTGCTTTTGCCTGATGTCATTTTCATCACAACTT
TCACAAATTAGATCTTATATTTTACTGAAAAAATCAGTGGCTCTTGGTAAATATTTGTTC
CAGTGAAGTTATAAATATTGCAAACATCAAAACTTCATTGCTAAATTTCATGTTTAGGGA
AATTAGGGACATTAGGAACTCAGGGACTGGTTGCTACTGAGTTTTGATTCTGGAAAGAGT
AATAACAGCCATACTGAACTTAGCATATTTCTGTTAATTCCTTATTTCCTGCACTAAATT
TTTCTTTAGTGTAGAGAGATATTTAAAGATAATTTGTCGGTAAATTATTTAAAGAGCATA
AGTTCAGTTATATTGAAGTTAAATTGTTGCTTACAAATGATTTTTGGTCTACCTACTTAT
TTTCAAGCTTGTGAAATAGCAAGGACCTTTTAAACTCACATATTTTGCCTTTTGTGCAAT
TTAATTCTCACTTGTGAAAATACCCTGTAATAGCATAGACTAGGTGATTCAAATAAGTTC
ATTTTTAATTGAAGATGTAATTGAAAAAAGTTTTTAAAGTTTCACTTTATTTAGTGTATC
TGTTATTTCTTTTTGTACTACTTTAGATGAGAGAGTTAGCTATACTGCTTTCTGTAAATT
AAAAATTTGCATTTTTAATGTATTAAAGACCTTAAAGGAAAAGATGTTAGGGAATTAATG
TTGGAGCTATATAAAAACAAACAGAATGGAATCTGCTTGGGCATATGCAGTTGTATAGAG
TAGAGAAGAAAATCTGTAGCCTGTTGAGACCAATTAACCACCACATCTGGGAACTCACAG
TGCCTTCAACTCCAAGCAGGAGAATCGCATCCATCAACCATGTGGGATCTAAGCCCTTTC
TTGATATAGAGGTGGAGTGGACATCACCAACCCAAGGTCCACAGGATGGAGGAATAAAAT
AATGGATTAGAGTGAACTCACTGGTACTCTACTATAGAACTCTTGTGACTAGTAATGGAA
GAAACTATTGCATTGATGTGGAGAAAGCTACAGTAGTTGCTGAGGGCAGGGAGAGAGGAG
AGGAGATGAGATGTGGGGGCATTTTTGGGACATGGAGTTGTCTTAAAAGATATTGCAGGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTCT
TCTTTCTTAGCTTGGCATGCATGATGAGTAATTGCCTGCCCAAGCTGCTTGCCCAACCTC
TCCTCCACCTCTGCCCCACTTGCTTCCTGAGGTCTGGCATCACTCTGAAGTAATTGTTTC
TTAAATTCAGTATGTTTTCAAAGTCCATGTCTTTCCAAATGAAACCTTTTTATGGAGCTC
TCCTCTGACTTATTCCTGAAGGTCTAGTTCACAATTTACTTACATACCAACTTCCCAGTT
ACTCCAGGCTGAACCAGTCCCTTTGTCTTCTGTCATAACATTTTGCTTATACTACTAAAA
TAGCAGTTTAAAATAATATAATCTGTGCCTTTATTGGACTGTGACCTCTTTAAGGTTGTA
GACTATATTTTACTCACTTTGTATCCCTAGTAGAGTGTTTGATTCATACAAGAGGCTGCT
CAGTAATTTGTTTTAAAAATTTTCAGCTCCAAGTTTTAATATCTGTGAAAATGCTATCTT
GTTTTTGTAACCTAAATACCAAAAAATAGCGTTTGGGTAACCATTATACACATGGTTAAA
AGCACAGATTCTCGAGCCACATTGCGTGGGTTCCAGTCCTGGCCAGGCATTATTCCAAAA
CTTTAGAGATGTGATCTCATTTCATCCCCATAGCATCCCTATGAGGTAGTACTAGAAATG
TATCGCAGTGTTACATTGTTACATATCAGGGAGCATAGGCCCAGACAGGCCAAGTAAATA
GTAGGTGGAGAAACCAGAATTACCTCCAGATCTGTGGGATATGAACCACACACCATTAAA
TAAAACTAAGCAATGCATATGTTAGGGACAGAATGAGAGGGAGGGTTCTCTAAGACCCAG
TTCAGTAAAGGAAAAGTCTTAGTATTTCAGATTTAATATCTGATTTTAAGACTTAGTTTT
TTTTTTATAATTTTATTTTATTCATTTATTTTCCCCCACCCCCTTGCAGCTTGCTTGTTG
TCCGCTGTCTGTGTCCATTCGCTGCGTGTTCTTCTATGTCTGCTTGTCTCCCTTTGTTGT
GTCATTTTGCTGTGCCAGCTCTCCACAGGTGTGGGCCATCAGCTCGCTATGGGCACAGGC
TAGCTTGCCTTGACAAGGAGGCCCTGGGAACCGAACTCATGTGGTAGACGGGAGCCCAAT
TGCTTGAGCCACATCCACTTCCCAACCACTCCATTCTTGACCTTCTCCCACCCCATCTCC
CTGCCAATATAATATGCCTGTTGTCCACAGTGTTAGAAAGTACATTTGTGGCCATCTCCA
CCTGATGGCTTCTGTAGTCTCTGCTGTGAAATGCTGGAGCTGCTGCTTTTTTACTTCCAC
AATTTCCCCCTTTCCCCCTGCACGTGGAGTTTTCTAACTTACTTTGAGACTTAAGCAAAA
TAAGATTGAAACAATCAAAACTGTCAAGGCCTAAGATTTCCCACACTGTGAGATATATTA
TTTCCTGCAATTGAAGAGGTTGTTTTGCGATTCCAGCCCAGAGAGTTTAGGAATAGAATA
ATATTCTTTTTTTTCTCTCTTAATATTTCCTTACCTGTTCTCAGACTGCTTATAACTTCC
AATGGGTTTCTGTAATAAAAGTGCTTCAATATTTTCTTCCTAGTGATAAACAATCAGCCA
CCTATTTATTATGACCGTATACCAAAGCAATGGCTTGTGTTTCTTTGCTGAATTGATATT
ATTGTACAGATGGTTAATTTCCCAAGAGTGGGACCAGTGAAGCCTAGGTTGACCAGATAT
ACCAAATGGACAAAGAGAATTATTGCTCACCTGGCATGATTTCTTAAAAGAGAGAGGGAA
GAGGTATGGAAAAAAAGGATAATGTTACTGAAAAATAAAGTATCCAATCATCTTGAGTAA
ACTGGCATTTAGAAAAATAAACTGAGTAGATTATTCTACTGTTTCTGCTAGACACAGGAT
CTGAATCTATGGGACAGACTGCCCTGAGGCCCCTGAACCTCCCCCTTTGGGATGGTAATA
AGGTGAGAGCTATCCAGCCTATTGATTAGAAAGGAAAGTCTGTTTCCTCAGAGGGTTCTT
AGAATAGAGCACTAAATAAATACATTGATAAATAACAATCCTTTAAAGGGCAGGGGCTGA
CTTTTAGTCAAATATTCTTTCAAATATGTGGCAAACTGCAGGCAAAAACAAGGAGCTCAG
AATTTGTTTTAAAGTGTGTGTGTGAGAGAGAGAAGAAAGGAGGGGAGGGAATGCCTTAGT
TAAGTGTTTTCTCATCCTTGAGGTTACTTCATGTTCTTGGTCCATGTTGCTTCAGTCTTT
GGGGGGAAAAGTATCCCCTTTTTGATGAAAGTGGCTGAGATTTTAGATTTTTGAAATTCT
TTATTACTAGCACTATTATCAGATCTGAAACCGAGTAGAGAAATAGAAATGTCTATTTGA
TTAGGGTTATATCTTCGAAGACAAGGCTGGTTGGAATCAGGACCTCTGTAACACTTCCCA
GGATCATGTAGAGCAGATCATACACACTTCGGTAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAGGTATGAATCTTAATCCTAAAACTCAAGGTTTATAGGTAGGGC
ATCTTTTTATTTTCTTTAAATCAATTGACATCACACTCTAAATGCCTATTCTTCTAAATT
GATTCGGTTTACCATTATTGGGATTTCCTCCCCTATCTCAGTTATAAAAATTTCACTGGT
ACTTAGAGAGTACCCATGTATTGGGAGGCCTCTCCTTGACACCAGTCTGATCCTGGTCAC
ACTTTTAATGCTGGCCGTCCAGTCTCCCTGCCCCCATATTCCTTTCTGGTTCAGGATTCC
CAGGCATGTCAGTGCAGAGGAAGTGGTCCAGGAGCTCAGTATGGGTGTCCAGAAACATCC
CTAGTTCAACATTCTGTCATGCCTTCTGAGGTCGGTCCTCACCACACTGACTTCTCTGCT
TTCCTAGCTAAAGGGCTTACTGGGATTTTTTTTCTTTTCTTATCATTTTGTTGCCCTTTC
TGTCCTTTTCCTTCACCAATCCAGATCCTAATCTTCATTTCCACCAGGAAGTCTTCTCTG
ACTGCTCTGCTTTCCCACTCATTCACATTGTGTCTGTTTTCTTTCCCTTTGTGGTCACTT
GTCCCTGCACTCTATTGTTAGATGCTCAAGGATTGGGGTGGTGCATACCCATTACTATGT
ATTAAATTGTATTGTATCATTTGCAAGTCTTTAAATTGAATTTCTTATTCCTTTTAGCCT
TTTTGTAACAGTGGCCACAGGTCCTTATATTAAATTAGTTATAATAATTATAGCAAGCAT
ATGCACAAGTGGTTAAAAATAAACTCAGTTACAGAAGTATATAAATTGAAAGGTAAAATT
TTCTCTTTCTGTTACCCCAATTTTTCATTCCCCAGATATAGTAAATGTTAACAGTTTTTA
TATATTCTCCTAGAAGTTTGTATGTATATACATACATAAATAGGCAAAAATTATAGGTTC
AGAAAACTGGTCAATAGTTGCCAGGAAATGGGAGTGGGAGGAAGAGTTCATCACAAAAGA
ACATGAGAAGTTTTTTGGGGGGTGGGGTGAGGGGTGATGGCTCATTCTATATCTTAATTT
GCCGGTAATTATACAACTTTATGCATTTGTCAAAATGCACAGTACTGTATGCTATTAAGG
GTGAATTTTACTTACATAAGTTATATCTCAATAAACCCTACTTAAAAAAGAAAATCTCAG
CATGAAATGCTCAACAGTTAAAAAAAGGCAGACTTCAAAACAGCTGATTAACTTCTCACT
TACGTCAAAATGGGGTGACCTTCTGCCAACCTGGACCTGGTAGTGCCTGGAAAGCAGGTA
CTCGGTTACTCTTGGACACACAGTTTATGTGAAGTATGAATAAGTGAATCAGTTGAGCCA
ATATGCCCTTTGCAAAGCATGCATAAATAAATGGGTTATTTATTTAGGATGTTTCCAAGC
CTTGTTCTTCATGAGGTCGCTTCTGACATTCTGACATTAGGGCACTGGTCATTTTGCAAC
GTGCTTCCTGTGTTCCTGCTTTGTTTTGTCTGGAGTTCTAACTGCCTGGATGCCACTGCT
TTCACCAACATTGGAGTCAAGAAATTATTTCAGACTGAGAATTGGAGGCTGCCCTGCATT
TATGCTTTCTATGATGAAGCAAACTAATTTGTATTATTCCTACTGGGCATAACCCAGAGA
AAAGGGGCTTCTTAACTCAGTGATATTCTCATAGACTTAATATACCAAATTATTTTTGAG
AGAAATTATTCATGTCAGGGACATTAAGAGATTTTTGGTTAACTTTTCATTGGATGCAGA
GACCTTAATATACTGTCTCTATTTTGAAAGACTGTAACTTGAAACTAGGCTTGATTTACC
TGTATCCGTTTCCCAATAAACAATCCAGTCAAACATTTACTGAGGATCCATTATATGGAA
ATAACTGCTAAAGGCAGAAGGAGTGACAAATGCAGATACAGAGCCCTTCTGCAGCCCATT
ATAGTTAACTAAATACCTCAGATGGAAGGCAGAGTGTGACGTATTATAAACACAGGCACA
TACATAGTGCTGTGGCAGCAAGTGGGGCTGGGGCTGGGGTGGAATACTGCAACACTCTGG
GAGTGTGCAATTTAAGCCGGGCGCTTGAAGGTAAGATGTGGGATAGCAGACATCCAGGCT
GAGGCCTACTTTGAATAAAAGGCTGCATGAGTGCAAATTTGTCTGTCAGGAATCATCAGC
AGGTATGCTGGAGCCTGAAAGCTATGGGTATATTTAAATTGAGGGGGTGGGGGTGGATTT
CAGTGTCTTCAGCCCTCAGCCTTCTCTACTTCTCCATGAGTTTCTTACACTCTATTCTCT
TACTTGTTATAGTTTTATATATTTAAGTTACCTACCTTGCCCATAAAGGCATTTTAACAG
GGAACTCTGGTTTAAGCAGATTGCTTGCAATCATGTATGGGGTTATGGAAAGTCAAGTGT
GAGGAGAAAACAGGGAAAGGAGAAGGTGGCTTTCTGCAGTGGGGTGTGGATCTGTGATCT
TTAATCCCCTTGGGGAGTGGCAGTATCAAAAAACACTAATAATGAATGCAGGAGGAACCT
TCACACAGTGTTATCATTACTAACACAAAACCAGAAACTACCTAAATGTTCATCAACAGG
GCCTGCTTAAATCAATGATGTTTATACAGTGGCCAGTAAAGAGAAAAAACAGTGTGAAGA
GATGGAAAGATCCCTAGGATATCATTTAAATTATTTTAAAATGAGGGTGCAGGAAGAGTA
TGTATAATGCATATACAGCATATAGCCTTTTCTTTTACAAAGCAAATGAATTTGAGATCC
CTCCACGTTGTTGCATCTATCAATAGTTACCTCTTTTTTTATTACTGAACAGTTTTCCGT
TGTATGGATGTACCACACTTTATCCATTCACCAGTTGAACATTTTGGTTGTTTCCAGTTT
CAGGTCATTTTGAATTAAGCCGCTATGTACATTCACATGCAGATTCTTAAGTGAAAGTGT
GTTTTCATTTCGCTTGTGTAAATACTTGGGAATGGGATTGCCAGGTTGAATGGGCATGCA
TGTTTAATTTTATAAGAAAAAGCTGGACTGTTTCCAAAGTGGCTGTACTATTTTGCATAC
CTGTAATAGTCACTGAGAATTTAAAGGTCTAGGATTAAAGTTACACCTACACCATTTTAT
ACCATTTCAATAGGATTACATGTTTCAGGTCATTTGAAAGATACTTAAAGTTCTGATTAG
ATTGTTTTGACTCTGCTGCAGATACTGGGAAAGGGGGTGTTAGGGGGGCAGTGGAATAGG
AACTGTTTTAGTTTGCTAAGCTGCTGAAAGCAGATACCATAAAATGGTTTGACTTCTAAC
AACAGGAATTTATTAGCTTAGTTTTGAAGCTGAGAATAACGTCCCAATCAAGGCATCATC
AAGGCAATGCTTTCTTTCCAAAGACTGGCTGCAGGCAATCCTTGGGTACTCTGCCTCGTG
GCAAGGCACAGGCCAGCATCTGATGATCTCTCCCTTCTCTTCAGGGTTTTGTTGCTTTTA
GCTTCTTGCTTCCATGGCTTTTTCTCTCTGTATTCATCCTGTTTATAAAGGACTCCAATA
AGAAGATTAAAACCCACCCTGGGCCACACCTTAACTGAAGTAATCTCATGACAAACCTAC
ATAAAATAGGTTTGTAGCTACAGGAATGGATTTGCTTTAAGAACATGATTCTCTGGGGCA
CATACAGTTCCAAACCACCACAGGGATGTAGATCTCCTCTCTTACTTGTATACAGAACAT
TTTTTCCTCCCTGAAAATGATTAAAGTGGGTGTTTGGCTAATCTGCCTGGTATTCAGGGG
AGATTAGAGCAGCTTTGCAGAGAGGCTCTGAAAATCTACTGGACCACTAAGTCATCTCCC
AGGCCCTTCAGGCAGTCACCAGAATTGTGGCATTGATGGCATCTGATAAGGTCCAGCATT
GGAAACCTGAAGAGGGACACATCTTTTAGAGAGTGATAGTTCTAAGTTTAGTTCAAATTC
TCAGTTGCTTAATAACAGATTTCTTTTAGCTTCTCACCCAAACGCTTTCAGATTCTGGCC
ATCAGAGATACTTTGCTTGAAAGGCTTCTTAACATCTAGATTTTATATGGTTGCAAAAAC
AGGATTATGGACTTGGCCTCTACACCTTGCCTTGGAACCTCAGCTGTAATTCAAGAGCTG
TTCTTTCTGGCCATTGCTACAGTCAGCGCCTTTCATACTAAACAGAATTATCAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTATCAGTTCAAAAGCTTTTTGC
ATTAGATCCGTGTCCTCCTTTGTCCTACTGAGATCATGATGTCTGCTTTAGAATCAGCTA
GGTATCAGAAATAGGAAGGAAAAAGAATCAATGATTCCTGGACCTGTGATGTCCTCTTGT
AACCTTCTGAGTTCTATGGTAGCCATATCAGCACCCTGACCTGGAATCTTCATGTAACCT
CCAGAAACCAGTAATGCACAGGGTTTAAATAGGAATTAACTGAATGATCCTGACTAAAGG
CAACTTTCAGCCAAGGGCACTAGAGCAGTGGAGTTTTTGTAATTTTGTTCACAATTCTAC
TTAAATAGAGAGGAGACTACAGTTGAGTCAAATTGCTGCCATGGCAGGGGCTAGCACAGC
TGGCTGCCACAGCGAGCTCTATAGCTCCTGAGCCCCAAGGCCTCTGACCTTGAGGCCTGG
AGATAAGTTTGGCTGTAGATGTTGCACTCCAGGTACAGGTGTCACTGGGGTGGAAAAAGA
GGCAGGCCCTACAGGGATGGGCTTATGTTTAGTGAGCTCAGGCTCAGTGGAAAAAAGGAA
AAAAAATAGAAAGGAGAAGAGAAAACAAATGAAAAATGATTATTTTCTGTCTGAATTTGC
TTCAGGGGAATGCCCATTTAAGATGCCTGCCTATCAGCCACCGGGTAATGAGCAGCCCTT
CCCTTAGCTTGTGGCTCCTCAGAGTTGCAGCGGAAGGGGTTTGCAGCATCATTAAGGAAC
TGCTTGTGCTTCGAGCTGATTTGATGTTCTTATGAAAGTCAGTTTGGACAGTGTGGTAAA
GACAATAAATATGGGAAGCAGACTTGGCCCAGTGGATAGGGCGTCCGTCTACCACATGGG
AGGTCCACGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGGGCTGGTCCACGCGCAGTG
CTGATGCGCACAAGGAGTGCCCTGCCACGCAGGGGTGTCCCCCGCGTAGGGGAGCCCCAC
GCACAAGGAGTGCGCCCCATAAGGAGAGCCGCCCAGCGCAAAAGAAAGTGCAGCCTGCCC
AAGAATGGCGCCGCACACATGGAAAACTGACACACAAGATGATGCAACAAAAAGAAACAG
ATTCCCGTGCCATTGACAACAGAAGCAGACAAGAACACGCACACAGCAAATGGACACAGA
GAGCAGACAAAGGGGGGAGGTTGGGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTT
CGTGACACTTTACTTTTTCATAAAAAAAACCCACAGATGGATTTCCCTTTTATTGTATGG
TGAATTGTTTTCCCAGAATGCCAATGACTACAGTCCAAGGGAAGTGTTCATCTTTGTATA
TTCCACGGGACCTGAACAAGACCCAGTTGGAAGACTACAAGGATATGGAAATATCTTTGG
GGACTCTTTCTTGTTGGACATATGGAGAGTTCACAAAGCTAAGCATTTTACATTTACCAA
GAAAGGGAATTACACTGATAATGAATGTAGGGAATTGAAAATACAGTAATGGAAGACACC
ATCATGCCTAGATTTCTTTCTTAATAAAGGCAAGCTGATATTATTGCATAAGGTCATAAC
ATAATAGGAAACTGTTCATAATTATCACTAATGTGCTTTAAGTATTGTAATTAATATATT
CATACTGGTGCTATCAGTTAAAAACTTCCTTTCCCCTATATGTGTCACAGTTTATGGCTG
AGTAGGTCACAGTAGTACTGGGCACTCCACAGATCTCACTCCCCAGCCAGGGGAAGGTGT
CGAGATGAACTTGTGTCCCAGCTCATGAAGCGTTTGGTCCGATTTTACACTTAGATCTAC
AGTGGACTGGCACTTACATGCTGACAAGACCCGTGGCATCCGGGAGGAGGCTGGTTACTA
AATTGTGGCTCAATTTTCTTTTGTAAAAAACTTCCTTTGCTTTCTGACAGAGGATAATTC
AGAAATTTCCAAATTGCCTTGCTGCTTGAGCCTCTAAATCTGCATTTGAAATTGTTCCCC
TTTAGTTCTATTATTACGGATTTTTTTCTTCCACAGTGAAATTGTATTGGTATTATCAGT
GGGAGTTACCTGCATAAAGAAACCTCTTTCAACTCTCAGAGAGCATTTTTTGAAGAAACC
TCTCACCCTCCCCTTCTACGACTTTGTGAAAATAATAAATGCATAGGTTAAGAAATAAAA
TTGTGTAGAAATGCTTATAAGGAAAAGCATAGTCCCCTCCCAACCCCCAATCCCTGTCCT
TCGGCGGTGGCTCAGGTGGTTCCTTGTTTGATGTTTAAGAATGAGCTTACACTGATACTG
CTCAGTTAAGCATGTCAGTTATCTGTTGACTTGATGCTCTTTGAGCATTTACATTACCCT
TTTCCCTTTCTAAGTTGATAACTACTTTTAATTACTCTAGTGATAATCTTTTTTACCTTC
AAATAATAGATTTTAAAACTCTATTTCCTCTTACATTAACTTATATAGCTCATCTTAACT
CTCCAATCTGTTAGATGAAAATATTAATAATATCTGTAGAAACAGTGCACAGGTTCTCTT
TAAAATTCTCTTATGTTTTCTGAATTATCTGTTTCTCAGGAACCAGGTTTCATGTTTGAT
TAGTTAGCTTTTTTTCTTTGATGCTTTTGTTTATGAGTGGTGAACTTTGGTTATCCATCC
ATGTTTAAGAACAAGGAATGTTGTTTAAAAACTAATTTTAGACTTAGAGAAGTTACAAAA
TAATCGTTTCTGTATATTCCTCATCCAGCTTCCCCTAATATTAATGTCTTAGATAACCAT
CATACAATACCCAGACAGTTTTAAAATTCCTTTATAGAAAAAGAGTCCTCATATATCTTG
CCCACAAGCAAAATACCAGGCTTCCAGCACAGTGCATGGACGTAGCGTGGGATGAGGAGG
AGAATGAGGGGTGCTCACAGGCCTGGTGTACCTGGTGTCCCTTAGACTTCTACTTAACCT
GTTTCCCACCTCCCCTGAGAAACCCCAGTCTCTGCTGTCAGTGAGCTGCGCAAGAAGGTG
GAGCAGAGAGCGGGGGTTGCTGACACATGTCCAGGCAGCTCATCTATGTCCTCCTACTCC
CCTGAAGTTTTCTCCAGCATATTCCTCTGCCTGACCTCCAAAAATTTGTTGAAATCTTTC
TTCTTGTCCTGCTCTTTTGCCCCATCCCTTCTTTGTTATGCCCCTCCCCCTTTTAGTAGT
ATTTTATTAGTCTAGGGACATAAATGCTCATTCTTATTCAGCCATCTTCTACTAGAAAAC
AACATTTATTTATTGAAGAGAACCGATCGTTCATGCCAGCACCTCTACTAAACACTGGCA
TGTTGACAGAGGCCAGCAATCCTATTGAGATTTTTAAAAAAAGCACTTTATGATTCAGAT
CAAAGTTGTTCACTTTACGTATTACTCTACGATTTCACCAGTGTTGATTCTTTATTGTAA
TGTGCTTATTTAAAATTTTTTGAATATTCATTTTCTCTGACCTATCTAAATGAAACTGTT
TATTTTGCTATTTGTTTGGATGTAAGTCCATCCAACTTTAAATATTTTAAAAATCTTCAT
AATATGATTTATCAGCTTTGTAAGCTCAGCCTTGATTTTCTTTTTCTTTTTAAAATCGTA
AACAAAGATCTTTAGAGTGTTTATTCATCTCTGTAATTCACAACACCTAGACCAATGCTG
TGCTAGAGTGGGCACTGACTTTTAAATATATATATACTTAGGTTTTCCAATAAAAATTCT
TTAGCTTTGTGTAACAAATGACATAATTTAGTATAGCGCTTTAGAAATTTCAAATGCTTT
AATTTTTATATTTTATTAACTGTTCACATTTGATGCTACTTAAAAGGTAGGGAGATAGCA
GGCCCTTTTAGTCTCATTTAACAGGTAGAACACTTGGGCTGCATCTGGAAACATTAAAAA
TTTTGCATGAGGTCATACATTCTAAGAGTTTCAGAGCCTGCTTTAGACTTCAGGTCTTCT
GACTCTTAATTCTTTATTCTCTGTTTTGCATCTGTTGCAATACGCTGTACCTATTTGGGG
GGAACTTTTGACAATGAGCATGTTTCTATAAATCCTAGTGTCATTAGGTGTGCTTGCAGT
GGACTCAAACGTGCAGGGCTTATTCTACTAATGACCCAAACTTATCTCTTTCTTTTGTAA
GAAGGTAAGTTTTCCTTGGACAACCAATTCACTGTACTATGTTGTTTGCATGTTCTGTGC
TCAGGAACCAAATAGAGTCATGCACAAGAAAAACTCTCAAGCTCAGGTTCTCTCTCAGCC
AAAGGTATGTTAAGGATCAAAAACCACTCTATATTTTCAGAGCACAACCTCCTCCCTTCA
CCCAAAAATTCATCCATAGATAAGGACATGCTCTAGTATTGACACCAAAACATCAAATTA
AACATAGCACATAATTCACTAGTAGCACACAGAGCTGTAATCCTAATCTGTACCTCCCAA
GATGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAGCACACACTGCTGGCTTAAGTGCCTGACTAATCTTTGCTGCAACTTATACGTTA
TTTCAGAACAGTTTCAGGCCTGGTCTCACATTATCCCGCTTAGTTTGACAGATTTTAAAG
GGTTCAGCCGTCTTCTTCTTTCAGTACATAGGAGCATCAGAGGGGCCTGAGGTTCATAAC
TTTGGGTCACGGCTGGACTTATTGGGACCTGTGGGTCCCCAGAAATGGAAGGCAGAATTA
TGTGAGCCTAAGTGAGTTTTCTTGGGGAGCAGCTTTGTAGATTTCCTCAGATCCTAAAAG
GGACCCATGACCCAAAAATGTTTAAGCAGCATGACTGGTTCTTGGAGGCCTGCCCTTGGA
GCCCCTACTCTTGCCAGCTCCTTCTGTTTCCACTTGAAGCCTAGGCTGGGCCCTGGCATT
CATCTCATGGCCTGTTTCCCATCTGGGCCAGTGTAGCTCTCTCCTGACTCCAATGTGCTG
TCCCTTGGCTGGACCTGATGCCTGCTTGGCTCTTCCTTACTCCTTTCCAGCTCCCCCTGT
CCTGGCCTGGCCTGGTCTGTAAGGTATTCCTGTCTTATTTACTTTCCAAGCACCTTTTCT
TTTGACTGATTTGTTGTAGAGTTTCTTTTCTAATACAGAGTATTGTCAAAAGTTTTCTTC
TACCTTCTGCCTCCTCATCAGTCCATCTGGCCCATCCCAGAGCTACTGTGCTCCGTAAGG
GGTAACCCATGCCCTGAGAAATCCCAGCATCATCTTCCCTCAACACCCCCCAAAATTTCA
GGATCCTCAATTTGCATTCTGTAATATCTCCTACCCAGTCCATTGCAATAAACAAGGAAG
TTTTACTTTACCTGGCTTAACTTTTCTCTCTTAGTCTTATGACAGTGGTGTCCACATTTT
CTGGTTAATTTTTTTAAAAAATTTAGAATCAGAAAACAAAATACACACCACTGGTTAAAT
ATGAAAAATATAAAGGAAGCTGAAACATAGACAGCCAGTGCTTTCTTTTATTTGAGGCTT
TGGTTTGGTTTGGGCCTCTGTTAAGAGAATTCCTCTCATGAAGTGCCCGAGATGCAGGAG
GAGGCCTAGTTGGGAAGTAAGCTGAGACCTCAGCCATATGTGCCTCAGTAGACTGACTCC
AGCACCATAAATCAAAAGTTGGCAACGAGGGTGGATTTGGGGCCCTGTCTACACTGCAGT
TCCATACCAAAGTCAGCTACCCACAAGGTCTGCACTCTGGGCTTGAGGGCACTTCCAATA
GCCTTTGCTGATGATACCTGATGCAGGGTATTCGAGCCCTGATACATGTAGATCCCTCTT
CCAAGTCAGAGTTCTGAGCTGCTCTGCTGCTGTTTCTGATACACAATCCTGTGCTGAGGA
AGTGCTCAGCCTGTGGCACCACAGACTCACAGGAAAGCCTGGCCACAGCCAGCAAGGCAA
GTTCCTGTCCTCAGAGAGGGAGGGAGGCGCCATGACTGCCAGACTGCCCAGTTCATCTCT
ACCCTCCCCTCCCAAAGCAAGTTTCTCAGAAGGGATCGTCTGTCACTTTATTAGCTGAAA
AATAAGCAGCTCTTGTGAAGCCAAAACCAACTCCCTTTGAGGGCGTATGGGGATGCTGGA
GCAGTGTATGTGCCGTCCAGTGATGAGATTTCTTCACACGGTTCTTAATCCCAGTTTTCC
TACTGAAGAGAGAAGATAGATGCTTAATGAAGAGGTGGACAATGGGCAATACAAGAAGGC
TTTTTATTGTAAAGAAGGTTAAACAAGACTTCTCATACTATCTTAGAGCCCATCCCTACC
TGAATTTATTTTTATTCTGTCTAAAGACTTTGTGGGAGGAGAACAAAATATTATTGGTTT
TTAGTTAGCTGTGTGGGTAGGGTGTCAAGAACAAACTAAATCCATGAATTCTGTGGAAGT
CTCCTCTTGTCACATAGCGCATTAGAGTTCTCCTGACTTCTCATTCAATGTCCCCTCACA
CACCGTACTGCCCCCATGCACCACTGTTTCTTCCTACATTTTAAGAAACAAAAACAGCAT
AAAATGTTGAGAACTGACTGCATGCCTATGTCAGGATTAGTTGTATGCCCACAGTTGCCT
CACCCAGTTCAGTCATTTTGCCTCTCAACAAAGGAGTCAGTCACCTTAATGTGGGGCCTT
GTGGGAGAAAAATAAAACCCTTCTTGGTTATCCCCTAGCCACATTAGCAGGGTGATCCAC
ACATTTTAGAACAAGGCATACATACCCCACTTCACCCCTCACTCTCTGGGTGTCTTCTTC
ATGCCAGTCACTCTTTGTACTTCATATCTAATTTACTTAATACTCAGAGCATTTCTGTGA
AGAAGTTGTATTTATCCCACATTGCCGATGAGAACATTGAGGCATAGAGGGTTAATGCCT
ACAAGGTTTCACAGCTAGCCAAGGTTTGCACGCAAGTTTTCTGACTCTAGAGCCCTTGGT
TGTCCCACTACACTGTGCTATTGTGGCACTAGATCCCTGAGCTGCACATTACTAGCATCT
GGGGAATTTTGAAAATAATTTAATTAGAACATCTCCAGGTAGGACCCAGGCCAGCTAGGA
AGAGCTGCAAAGCTAGTCAGCTTCTTCTCCAGCACTGAGTGGACAGCCAGCCTGGCCTTC
ATCCCAGGGCCTAGTTTGGATTCAAGCAGAACCACCAGCTCCCCCTGCTTTTCCTTCTTC
CTCCCTGCCCTCAAGATGGAGCCATTCACTTCAGTTCACCTCAGTTTAGGGCTCAGCTGT
GGTATAGGAATGACTGGAGTAGGAGGTGTTGCAGGGAGAGACAGCAGGGAAGCTGTGTCA
TGAACTGAGCCAGGTTGTGTTGATGGGGATGCAGTGGAACGCAGGAAGGGGGTAAGGGAA
GCTGTGGAGACAGAGGAGAGAGAACCAGTGCTGGCAACAGTGATGAATGAATTAGACATG
AAAGAAGTAAAAATGACTAGGTTTCAAAGTTAGTGTGGGCAGATGGCTTATCATTAACAA
AGATGAGTAAATGAAGAGGAATATTGTTTGAGGAAGGAAAAATGCTGAGTTTATGTTGTA
CATTTTGAGGAGCAATGGGAACCTGAAGTGGAGATATCTCTTGGAAATTGAAAATTTGAG
ATGAGAGATGACAGGACTTTCTCAGCTTCTCCAGTGAATCAAGGTATGACGTGAGTTCTC
TAAAGAAGGCGAGAAGGTTAATAGCTACACAGTGCTGCCCAAAACCTCCAGAGCGTTTAA
ACAATGCTCAGTGGAGAAAAGACTATTGGCCACTTATTTCATTATATACATGTATATATG
TATATTACATACATATATAAAAACATGAATGGACCTTGAAAACATTAAACTAGTGAAATA
AACCAGACACAAAAGGCTGCATAGTATCTGATTTATATAAAATGTCCAGAATAGGAAAAT
CCATATAGAGAGAAAGGCTATTAGTGACTGCCAAGGGCTGGAGGAAGGGAGGAGTGGGGA
GGAACTCCTGATGGGTACTGGGTTTCTTTTGGAGGGATGAAATATTCTAAAATTAATCAT
GGTGATGGTTGCAACATCTGAAACCGTTGAATTATACACTTTATTTTTTTAAAGGTTTAT
TTTATTTATTTTCCCTACTCCCTCATTCTTTACATTTGTTGTATCTGTTCGTTGTGTGCT
GGTCTTCTTTTTTTTTTAGGAGGCACCGGGAACTGAACCCAGGGCAACCCATGTGGGAGG
GAGGCACCTAATCGTTGAGCCACCTCCACTCCCTGAATTATACACTTTAAATGGGTTAAG
TATAAGGTATATGAATTATATCTCAATAAAATATATAAAGAGATATAAATATATCCTGCT
CAAATTGTTATTATGTACTTGATTGAAAATAAAATCCAAACGAATTCCAAACTATACCTA
GCCTTTAACTCTTGAGTTCATGTAGGCACTTTGGATCTTTATCAGGAAAAAAACCACCTC
TTTAATCAGCTCCCCTTCATAGGTTACTTTACCTATCAGTGCAAGATACAAAAACTGTGA
ATTGGAAAATGGGACAATAGTTTAAGAAATAATTGTATTCTCTATTTAAAGAACCACATT
GATTTGCAGAAGAGAAAATGCTCACAATCCTTCATTGCTTTGTTTGTTCCCTGTGAGAAC
CATTCCCTAGCCTTTATTTAATATATTGGTCCTTAATGGATTTGAGAATTGAAAAAGTAG
GACAGAAAAAGAGAGATTGAACTAAAGTCCTTTCTTAGAGGGTTTGCACTGAAATATGAA
TTTGATCTTTCTCAACAGTTTTTAAACCTGAAGAATGTGAAAATGTTTGGGCAGTGGTAC
CAGGTTTCAAGACCATTTGGGTTGTCCTCATACATAACATGTTCAAACTAGGTATTGAAA
AGTATGATGTTGCCTGAACTTAGAACCTTATCAAGTTAACTTAAAAGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGG
GAACTAATTCGTAAAGTTCTCAAACGTCTCATCTGCTACATTGTGCTTGCATGGTTTCCT
CATCAATTTTTCAGAGGTTGTGCTATCCAAGAAGCAGGTTGAGGTCTCAAGATACTCACT
TGCTAGAATATTTGATCTCTGAATGGACCTGGATTTATTCAGTGTCTTGCACGCTTCACT
AAACAGTGTAAAAAGACAATGAAGATAGGGTCCCTGGATTCGGAGACGTTTCCGTTCTTT
GGAGAAGCTTTTCTTTCTCACTGGACAGTGACTACACAGAGAAGCCCTTCCTTGAAGCCG
TCATTTGTCACTGCTGGAGGTTTATCTGTTGCTCTGCAGAGGCACATTCAATGCAAGAAG
ACATGCAGCACGTTATAGATTTTACTGCAGATTCAGCAGAGCATAGAAGAATGCTGAAGT
CATGTGTCCATGCACACCAGGCCAATTCTTTGTGAGACAGAAATCTTGACTGGTAACTTA
CGGTGGATAGTCACACAGAACTGTTACCATCTGCTCTTGATTTTCAGTTTGGAACCACAA
ATAGCATATTTCAAATCTGTAGATGGTCCCAAAACAATTTGACCCTTTTTTTCCAGACAC
TTTCTTCACAAAGCCTTTCAGTAAAGATGCTAACAAGCAGAAAAACCAAACATGTTAATG
TCATCTCTCTGCCTTACCCTAATCCTCCTGACTGGGCAGAAGATGGCTTTTGGATATTCC
TCAAACAAAAGCCGAGTTTGCACACTGGTGGCCCAAAGGCCCACCCAGCCTGTGGATGAT
GTGTTTTATTTGGCCTGTACTGTGTTGGTTTTTTTTTTTAAATATTTGAATGAGATGTCA
GTATTTAAAAATCAGGAGAAGCCTGTGTTTCTGGCTTCTCAAAAAAATCTGGTCTGGTCA
CTGTGGGCCCACATTCTCAAGTGATGATGTGATAAGGCTAAGGGGAGGCTCTTCCTTCCA
GTGCTGGGTCTGGGCCACCCAGAGCCCCGCCCACCCACTCACACACTTCTCTTACCTTCT
GCTTGTTGAGACCTCCAACAAGAGAAGGAGCCCAAAGAGGAAATATTTTGCTTTCCTTAC
AGATGTCCATGGTGACACAGTCCCTTCCAGTATGAAATTTGACCTACTCATATACAAGAT
ACACAAGTACACAAGTACACATACCCTTCTCATTCATTTCTATTAAGGAATAAAAACTAC
CTTGTTCAAACGAAGTTAGAAACATGTAAGGGAAAGCATACTTAAATGAAAGACAGATAG
CCTGAGTTTCTGATGTACCTCACTCCTATGATGATACCTGTTCCTTACCTGCATGATGGA
AGTATTAGTAACATCACCTGTCATCTCATTCAGAATTCATTTATTTAACAAAGTTCATAG
AAAGTAGATGACATTAAAGACTTAGAGTCTTACAAACTTGGATCTGTATCTAGAGCCTCA
TTTTCCTCATCTATAAAATAAGGGTCATAATAGTAGACTTTAGTGTCTGGTTTCCCCTAA
TAGTAATTGTGAGGTTTTATTGAGTACCAACTGTTTGCCAAATTTTGTGGTAGGCCTTTG
GTGGGGAGGAATGCGATCCATGCCCTAAAAGAGCTTCAATCTAGTTGAGGAAAAAAATTC
TGGGCCAGGAAGTAGAGTCAGTAACATAAAGAAAAGCTCCTCAGAGTGGCTGTACTGCTG
ACCTGTAAACATACTGGCAAGGCCATGGCCTGTTAAAACGTCATATCATATTAAGGAAAG
TTTCATGTGCAATACCTCCCTTTAGGAATATGTATGCACATACATATCTAAATATGAAGG
TGATAACAGAAGTCTTCAGTGAGATTGTATTAGAGAAGTTCCACATCAAGCTTCTAAATC
AGAGGTTTTGACATTTGAGGGTCATCCTCTTTATAGGTGAGTCAGAGCCATGACCCAATC
CCCAGAAAAATGCACGCACACAATGGTTTACATAACATTCCAGGGCATGGGGAGCCCTCA
GAGCCCAGCCATAGGGCCTGCTCCACTTAGGTCCTCACTAGGTTGGTCACGCAGGCTGTG
GAGGCAGTTGTTCCAGAAGAGGCAGTCGTTTGCTAAGCAGAGGCCACACGTAGAAACAGT
CGGGCCAGTTCTGTGTGAGGGCAAGGGGCTGAGTTGCTCAGAGGTGAATTGGGCAAGGAG
GAGAAATTTTAATGAAGAAAATGACACTTTTTTCCAGATAAAGAAGATATTCCTATAACA
ACTAATGTAGTTAGAGCTAGTACCTTATATATCTGACATGTGCATAATATTGTGATACTC
TGACACATTATATTATGGAATGGTCATCTCTCCTATGATCCTTTCACCTTTCCCTAAATC
ACTGTCTGCAGTTCTGGACATGAAAACAAACCTCAATATTTATCAAACCAGGCCATTGCC
CATGCATAGGGTTGATTTGGCTTAACGCTCCTTCACCTGTTCTCTGGTCTTTTCCTAGTC
TTTAGCCCACAGTTCCCAATATGCACAGAACTGGTTATACCTGGACCTTACTGTCTGTTA
GTAACCAGATGGGGCTGGTTACTCTGGGCAGCCTCTATCCTTGACCATCTCTGACCTTGA
GATCAGAGGCAACACTTTTTCCCATATCCCAGAAACAAATTCAACTGCAGAATTATTGGG
AAATAATGTAAGTTTGACTGAAGGTTTGGGAGGCCACAGTGACAAGAAAGCTCCCACATN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCAAGTAAATTAGTCTAGGAAAACAGGAGTGCAGGCGCATTC
CCAGGTAGGATGTGTGAGCTGCCAGCCAGAGGAGCGCCGAGTGTCAGTGGAGGATGTGCT
TTCCCTGCTGCTGACGGTGGAGGCAAAGATCCCGGGGGTGGGGGGGGGCTGTGGGGGACT
GAGGAGTCAGATGCCATCTGCATCGAAAGTGCATGTTGGAGAATGGTCTCCTCAAGGAGC
CTGGGACATTTAGAAGGAAGCCAGAGCAGGCTGAGTTGGGGGGGGACACTGAGCTAATCA
GCCAACCCAGGTGCTGAGTGTGCAGAAAGCAGGTAAAGGATGAGAGGAGGCCTAGAACAT
GCTGACAGATGGGAAGGAGGCTCAGCTTTGTGGAAATGATGAAGGGACCGAGTACCCCAG
CTGAGGGTCAGGTGACTCTGCAAGGAAGCCAATTTGGCTGAAAGAAGAGGAGTAGAACTG
GAAACCAAGCAGAAGAGGAGCTGAGAGAAACTCAACCTATCCTGGATTTGGAATCAGGGT
GACTCCTTGGTTCAGGGCTGGCAAACCAGACTGAGTCATCGGAAATTTTGTCCTCAAACT
CCACTGAGTTGTGGATAATTTTTCCTCCCAGGTATCTGCCACAACCAGGCATGTCCTGTA
AAGGACATGATGTCAGGAATGTCATGAGCATTAAAAAAAAAAAGTTAAGAACATGTGCCT
CAGTCCCATGAATATAGAAGGAGAAATAGCCCCCATTGTCATTCCTTGGATGATGGTAGA
GGACATTTACCCAAGGGAAAAAAACACTGGAAGCCTGATTGAAGGGACTTGTTTGGGAGA
GTTTCTGGGGAGCCACAAAAGAGAGACAGAGACAGCAGGCAGCTACAAAGGGAGTAAAAA
AAACGTAAGGAGGCATGAAACATTAAGACAGGAGTACTGGGAATGTGATGTGGCAATGGG
AGGAAATGGGGTACATTTTCTAGTTAGAGAAGATTGATCTGTTCAAGAGGCTTTCAATTC
CCTCCATTCCTTTCAAGTGCATCTACACGAAAGTTTGTGTTTTGAGTCATCATGAGTTTT
AGCCAATGTAGATGTTCTGATTTTCAGCTTCACCCACATAGATCCTGATCCATTATTTAA
AAGCCTGCTGTCCTTCATGTAAGTCTGTTAACAGATCTGCTTTTGGCTATACCTGGGGAG
AGCTGCTTTTTTCATCCCACATGTGCCATCCCTCCACATTTGCCAATGAGCTTTCCCTGG
GTGTCTGGGCTTAATGCATTGGGCAGAATGTGAACTGATGAGGAAAGATGAATCCCAAAT
GGTGTGTTTGTTTGACCAGAAATATTACATAAATTTAAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTATTTTCTTATTGCTAAGGC
AAATACCAATACAATGGGTTGACTTAAACAATGGGAATTTATTGGCTCACAGTTCGAAGG
ATAGGAGAAGCCCAAATGCAAGCATTGTCCAGGCGATGCGTTCCTTCTGAAGACAGGTGT
TCTGGAGCTGGTTGCTGGTGGTCATTGGGTCTTGGCTACTCTGTCACATAGCAATGCACA
TGGCTCCCAATCTTGACCTCTCCCTTCTTTTCCCGGTTCTGATGACCTTCAGCTTCTTAC
TTCTGTCCCTGTATCTCTAGTAACAGGATTAAGATCCATCCTGATTGAGTCAGGCCACAC
CTTCACCAAAGTAACCTCATCAAAAGGTCCTACCTACAATGGGTCCACATCCACAGGAAT
GGATTAAGTTTAGTAACATGTATTTCTGAGGTACATAGGTGCAAACCACCACACATCACT
ATTAAAAAGGCAATAGAAAAGGAGGAAAGACATGAATAGACAAATCAGAAAGATAAAATA
CTACGGTCAAGAAACATATAAGATTTTAGCCTTTATTTAAATAACCATATATTTATTTAA
TATTTATTCATTTAAATGTTTATGTAAAGAAACTGTAATAATAAGATACTAGTCTTAATC
TGTTAATTTGAAGAGATGTTTTAAATTGATAAAAGCCAGTTTTAGTGAAGTAGGTAGTTT
CACTGACTGCCAGCAGAAGTAAAAATCTGACAAAAAAAAAAACAAAAAACATTTAGGGGA
CTGTTAGTGGATAGAGGATTGGAAGGCAGTATTCTAGTACAGCCTTTCCAACCGTTTTGC
TGTTTGAACCTGAACAGGAAGTATAAGCTCGCGGCATCTTTCATTTCTTCATCAGTAAAC
AAGGAGGCTTGGTTTAAAAATATAGTAAATGTAGGAAAGACAATAGAAGTTCCAAGAATG
AGGTAAAGATGGACCATTTAGGGACCAGAAAAGAAGAATTTTAGAAAAGATACCTATTAA
AATCTCAGATATATTCATTATAACAGGATAGATGCTCCAGAAACAATCGCCAAAATAAAT
GGAAACTTGGCATAAGGTAGACCGGCATTTTAAAAAGTGGGAAAAAGCAGGATTATTCAG
TATATGATTTAGCTCTCCCTATGCAAAGTAAAAAGTAGATTAATGCCTCACCCTGTATAG
ATGGATAATTTTAGATGGATTAAGGACTTGAGTGTGAAAAATAAAACTTTAAAGTTATTA
AAAGGAAATGCAAGAGAATATCTATGACTTTGGAGAAGAGATTATTTCTCAGTCAGGATA
CAAAAAAAAGACAATTCATAAAGGAAAAGATTACTTTAAGAAGTCACCATAAAGCCTCTA
TAAATAAAGTAATAAACCCTGGACTGGAAATAAATATTTGCAACACATGAAATAGAAAAT
ATTTTGGTTTCCAGAATATATAGAGAATCCTTGCAAATCACTATGAAAGACAAATGACAG
CCTATGAAAATGGATAGCAGAGGATACCTTCAGACAGTACACAGTGAAGAAGATTAAAAG
GAGGAATAAATATAAGAGATGCTGAACCTCACTAACAATTAGGGGAAATATTAAAACAAA
AAGGGTACCATTCCTCACCCATAAGATTGGTAAAAACAAAGAAAAGGTGGCTATCCAAAT
GTTGGCCAAGATGAGTGGAGAGGAGAATTTTCCCAGCTCTCTGAGTGTGCAGTCTTCTAT
ACCACTTTGGAAAGTAATTTGGCAATACCTAGTAAAGGTGAAAATGTAGTCTGTGACCAG
GCAATTTCACCCCTGGAAATATTGCTGAGAGAAGCATTTGCAACAGACGCCCTGTATAAG
GGTCTTCCCCAAAGCATTCTTTGTCATGAGAAAAATCTAGTATGTTAATGGAGAAAAGAT
AAAACAAATTATAGTATATTCATATTTTCTTCTTTGTCGTTGTGTCTGCAGCCACCAGAA
GAGTTCCTGAAATGTCATTGATACATATAAATATGAGTTGAATGAATGAATACAGTGGAA
CATGTACAGCCATTAAACATGAATAAAATAAACCAAATCCTTATTATTAATGTTGATAGA
TTTCAAAAACAGTATTGAGTGAACAAAATGATCTTGGACTATGTATGCTATTATACAATT
TTAATACACCTAAGCAATACTATAGATATTGTTCAAAATGTTGTACATATTTTACTATAT
ATGTACTAAAAAAATTAAAAACATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGATTCAGGCCTGGTTCATAATTATTTGTTTTGTGATCTTGTATAAGTTTAT
TAAACTCTCATAGCTATAATTTGCTCACCCATAAAATAGAGATAATAATGTTATTTCCTT
TTCATTGTTATAGAGGGGATTAAATGAAATAGAATAAGAGAAATTAATATTTAATCTAGG
AAACCATACAAAATTAAAAATTGTTTCTTTGCTTTCCACGCCTTATTTGATTAAACAGCT
TCTTTCTGTTGTCCATTCTTACCCACCCCCCAACTCAAACTCAAGTCTACTTACAACAAA
AGCTTAATTTCTTCATATGATAGGCCAAGTGAGAAGCAGAAGTATCAACTCTCAGAAATT
CTTAGTTACCTCAGTTATGCCCTGCTGACCACAGCCTTCTACCTCTTTCCAAGTTTGTTG
CCTTAGTAAGAGAGAAGTACGGTCTACTAACCACCTCAGAGCAAGAAGAACGAGCATAAA
TATTCTCCTGCAATGGGTTCAAATCCTTGCTCGTCTCTTACTAGCTGTATGGCTTTTCAG
AAATTACTTAGTTTTATTACCTGTATGGCCTTTCTCAGTTACTCTGTGTGTGCCTCTTTC
TCACAGAGAATATGAGAGTATTACCTCCTTACAGAGTTGTTTGTCTGGATTTGTGGAGGT
GATTACCATGAAGTAACGAAAGAGGTGATCAGTATTTGGTACATATTGCCATTAATGGTG
ATTAATGATAAATAGCATATGGAAATTTTGAGTCCTTATTTCTAGCAAATTTTAGAACAG
GGGGAATAATAACTCATGACTTTATGATAATTAAAATCACTTATATAAAAGAGAATTTTT
ATCTTCTTAAGAAACTGCTTCCTGTAATGGTCATTGACTTTCTCCTTGTTTGTAATGAAA
CAAATGATAGTCACTATTCCTTTCCTTTTCTTCTAGACACACACACAAATATATACACTT
ACTTTGCTTGTTTGGTCTTTAGCACAGACGGATACTGTTTCACAATGATAGAAGAAGATG
ATTCTGGGACACCTGTGGTCACTTCCGGATGTCTAGGACTAGAAGGCTCAGATTTTCAGT
GTCGGGTAAGGAAGATAACTTGTTACCTTTCATTTCCTGTACTTCAGACAGTCAACTTAG
GAGCATAATATAACAGTTGTCTCTCTTGACCAGCCTGGTTTTAGTAATCTGAAAATAATT
TGAAAATTCTCGTTGGGTCAATCTTTTCTTCATTTTAAAATCAAATATCCTTCTTATTTT
TATTGTTAATTTCTTGGTGAGCTATACATTAGATCATCTTTCTCAAATTCCAATTTAGTT
AATTTCATTAAGCCAAGTCTTCCTCTATTTACACCATATGCACTAGTTATTAACAAACAG
AATGGTAATTTTGTCCAAAAGCTAAGGTTAAGATAATTCACAATAATTTGAAATAAATTA
CCTTAATAGACAACAACAATTTCAAGGTATGAGTATAAAATTATTATGTTTTAAGTGGAT
TTTCTAAATAGTGCTAATTTTTTCAGTTTTAGATTATGGAAATTTGAAATTTAAAGGAAA
CCCACTTATAGCTGTTTGGGTTCCATTGTAGGACACACCCATTCCTCATCAAAGAAGATC
AATTGAATGCTGCACAGAACGGAACGAATGTAATAAAGACCTGCACCCTACACTGCCTCC
ACTGAAAAACAGAGGTAAGGGAGGAAGGACTCCAGGCTGAAGAAACTACAGGCATAATGA
AAATAACTGGAATCAGTCTCTCCATTCCAAATTATCTGCCTGTACCAGGTTCCACTGCTG
GAGCAAAGAACTAAGGCAAGGTGACATAATGCAGTGGTCATTCAGAGATGTGTATAAGGA
GTACTTGGGAAAATAGTTGTACATGGCTTCACTATTGGGACTGTTATTACTGTAAGTTCT
CCCCTGTTTCCCTTTAGAATTGCAAGTACTAGAGCTTGCGGTGGGTAGCAGGTAGAGGTA
AGAAACAATATTTTAGACTTCAGAAATTGTATTTCACTTAAAAACTACCACTCATCTACA
TTCATTTTAAAAATAAAGACTTTATAAGGGACTAAATTAAAGATTATTTGCTGTATGGCA
TTTCCTTTTATCTTTGCTACAGTAAATAATTTTCTGTCAAGTCATATATCAAGGTACTGA
TAAAATTGGGGACTTGTCCAAACATTTTCATTTAAAAAATTATGTATTTAAGTGTTACTC
ATTTAAAAAGATAATTATCACATACCCAAAGACTTGTAATTAAAACAGCTCTGACATTTC
TTTTTCTCCTCCTTTTTCTCATCACAAAAATAAATGATTTGTAATTATTGTAAAGTCCAA
GTCCTACACAAGCAATTTAAAATGATCCTTCATCATTGATTTTATTTCTTAATATAGAGA
AAATATTTCCTACAAAATATAATGCTGTTTCATTGTTTTTAAAGAGAGCATTTTACATTT
GTTCCTGCTATATCTTGTTATACCCTAGGAAAGCTATATAAGATCGAGTTGTCATAATTC
AAATGAAAAAAAAATTTCACATTTTACAATTTTACCAGGCAATGTGTTAGGGTTAGTGAT
ATAAAAATGAATGAAGAAAATTCTTGCTCTCAAAACATATACACTAGGATGTGAAAGAGA
AGCATATAAATAACTAAATTATATTTGGTCAGGAATAGCTCAGTATTAAATTGATAATAA
AGTACATTAAAGATACAAAAGAGTGAGTGGCCAGCTCTGTCCGGGTTGGGAGGATATATA
TAAGAAAGCTTCATAGAAGGGACACTTAAATCGATACATTAGGATTTATAGAAGTTTTGC
TAAGTAAATAAGGCAGGAATAAAAATAAAACGTAAAAATAGCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTCTCTGT
AGGAAAGGACCTATTTGTAGTTGAAACATTTGACTAGTATACATAGCCAGCTCCACTGGT
ATCTCACCATGCAAATTCAGCAACATCTTGTTCAAAGAGAAGTCCAAGGATAAAAAATTA
CTGCAAAAGCTCTAAATGTTTACTCTCATTTTCTGTAATTATTTCCTTGTGAGCCAGTTA
CAAAAAGCAGCAGCCCATGGATAACAATTTGAATAGTATTGATGTTATGTGTTAGGAGTT
GGGTGGGGAGGGAAGAACTAGAGGAGTGACTTGAAAGAAGGAGGTAAGTGCCAGATTTTA
GAACTCTCTTCAGGAGGAGGTTTTTCACATGCTAGTGGAAGTGCTGTGTCTTAGAAGTAG
CAGTAAGGCTTAGGAAAACTGTGACTCTCTTAAGTGCTGCCATACAAGTACTGTCCTCTA
GATGAAGACAGATTCTAATTAGGACCAGGAAGGTGAGGGAGTTTACCCTGAGGTCCAGAA
TGTGGGTCTTCTTGAATAGTGAAAAGCCTTTGAAAAGGACAGCGATGGGAAGGCAAGGTC
TTGTTTCAAAGCAGTATGGTAATGAGGATGCAAAAGTAGCTGCTAGATTCTACATAGGAT
TAAACAACTTGATAGGCTTGGGTGGTATTAAGTGGCATTAGGGCTTATTTCTTTGAACCT
TGAGGATTCTCTGTAGTGCCTAGAAAAGGTCTCTTCAGATTCCACCTTACACTTTGGGGC
TAGTAAAAGTCACTGTAAGACTTGTAGTCTTGAGAGCACTGTTTTTTTTTTACATAGCCA
TACCATAGAACTGTGTGTGTTTGCCTTTACTGTACTCCTGTACAGGGTTCTTAGTTAAAG
TATATTATGTGTGTCTAGTGAATATCAGTCATGCCTTGGGCAGAAACATTTGATTTGCAG
CCATATTCAATATATGCGAATATGTATAGTGCCAAAAATAAAGAAACAGGGATGGTATCA
GAAAGACATGAAACCCTGTGCTTTTACATTTTTAATTGTAGTGGATTTTTTCATACACAG
GCCAAACCATAATTTTTGTGGGGTTGGGGCAATATATAAATGGAGATCCACATGCTATTT
GCCTAAGTAATTTAAGACTCACAAACCAGTATAGCAGATTGGTAAATAAAATGCATTCTA
TCAACCTATCTTAACAGATGTACTTTCAAAATGAGAAGGAATATCAGTTTGGCCTTTGGG
ATGCTTGAACTCCTTGGACTTGTTCACTCTGACATGGAGACATGAGTGATAGGGAGAGAC
CCATCCCTGGGTTTCCCTGGCACAAAGAGAAGCTTCTCATGCATGAATGGGGACACCTTA
GCACTCAGGCTCACACTGTGCCCATACCCCTTGCCATGGCTTTCCCTTTGCCATCTTTTG
GTCATCTCTCAGATCTCAGGGTACATACACCAACTGCGTGGTCTACTTTGGGAGACAGGT
GGTGAGAAGAGGGTCTCACTGGCCCTGGCCAAGGATATGGGGCCATTTTGGAGGCAATGG
AGTTTTGTTTAAATGGGGAGTGGGGTGGGGCAGGCACTGGTCAGACACATCCCCTTGGCC
CTGTGTACCTCTTGCTCAATAGGAAGGAACAGAGTGGGGCACAGTAAAAGCTCAGGGCCC
AGGTCAAAGGTTCCTATTTTCTGTCTAAAGGAAATGGGAATCCTCATAATAGTGATATTT
GCTAGTGCAAATTGAGAGCTTACTATGGTTCTTTTCTAGGTACTTTACATATAAAAATTC
ATTTAATCTTCACAACATTCCTGTGAGGAATGTGCTGTTGTCATCCCCATTTTACAGACA
TGAAAGCTGAGAAATAGTGTGGTTAAGTACCTTGCCGAGGTTTTACGGCCAGAGCAAGTG
ATAGAACTAGGAAATGGGCCAATGACGTCATCTCATTCAGTCTTCTATAGAAAGCTCTGA
TTGATATCCCCCCAAAATGCTTTTCCTATTTATAATCACAAAACTCTATGGACAGTGGTT
AACCATTTCGCATAATAATCAATAAACAATTAGTATGTTTATTTCAAAACCTTTTATTGC
TATATTTCCCTTACACAGAATTTTCTGAGACAGGCAGTAGTTTCTAGTCTCAGAATATAG
TGTTAGTGGATTTGTTTCTTCCTCCCTCCTTCTGTTTTTATTTCTTTCCTCCTCTGTTTC
CTTTTTTTCCCTAAGAGGTATTTGTATACATTCCAGTTTATTTTGGTGTATATCCAAATG
AATGAGATTACAGTTATCTCAAAGTACACATAAATTATTTAGATTTTCTCATGCATGAAA
CACTGATAAAATACCTAACATTATTTAAGGACTTCAGTATAATCTAAGCCAATATATATT
TGACATTTGGGTTACATGTTCATATAAAAACAAATCCATTTGTCAAAGTCAGCAAAAGGT
ACAACAGCTTTCTGGATATAATTAAATTTTTAGAGGCAAAGTGGTCCAAATGGGAGCAAA
AGCTGACTTACTTATGAAGTACACTAGATAAACACAAAAATTAAGAATAATCAAAGATAC
TGAAGATACAAATGTGCACTATAGGTGTGTGTGAATTCAAAATGCTTCCAATTAAAGATT
GTAAACTCTTATGACCAAGGAAAATATAGTTTAATAAAATGCCCTGGGGTAAAGAGGGGT
GGTATAGGTGAATAGGGGACATTTGTCCATCAAGCTATCCCTATCAACTTACTGAAAGGT
AGATTATTAAAAGTTTCAATGGGCTCAGATTTTGACTTGGCCTTATAGTGATATGTATTT
CATTATTTATTAAAATCATAACTAAGCATATAGAATGCTAGCTGTCACTAGATTAGTACC
TTAAAGCTAAACTCTGGAAAGAAATTACTGTTACAGACACATAAAACATTATTTTTTGTG
GTTCTACTGTTGTTCTTTTCCATTATTTTTGTAATTGGGGCAAAATANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAATACTGATTTCCATTACAATTATTTCAGATGA
GAAATAGTCAATTAAAAAAAGCGTTTTTTTCCTTGAGTTATGAAACATTAACACACTGAT
TGAAAAATCTAAAACACCACTGTAAAGATGTTAATCGTTGTTGGCCCTCAGCAATGAATG
GATGCAGCTTTACTGTGACTTCTCCAAAACTGCTTTGCAAAAGCACCTAACACACTGCAG
GTACACAGTCTCAAAGTCCGGGCCATTCCCTTAGTAGGGATCTTCAATAATAAGTTGTTT
TTGTGGATCAGAGCTGCCAAGTAATTCATTTTTAGCTTTGCAGTTTTTAACATGATTACC
TTTGTTACTCAGATCTCTCAGATTGTTTTCATCTATACATAGTGTATAATTAAATGTGGC
AAACTCTTCTGTGGTAACCTGCTGGGCAGTGTGATTCATGGGAACATCATGCGTCTTCAT
GCAGATTTGCCCTCGGTAATCGGGGGGCTTTCTTATCTCCTGTGGATGTTGCAGCACTGT
CCATCCTCCAATTATCTGAAGTATTTTGATTAGTTACAAGTTTTCTGAAACTTCTTCTGC
ACTGGGTGATTGCCAGATGTTACCCAGACACACAAACAGCGCTGACTTGGATGCTTGCTC
TGCCATTGTCTCAGGTTCAAGGAATGGCATAGAGTGCCCTTGTTTCCTTTAATGTAACAT
TTGTTATGTCCCAGTTGTATCTCTAGCCAGTGGTTCTCGAACTTCAGGAGCATCAGAATC
TACTGGAGGGCTTTTTAAACCATGAATTGGTGGGCTCCACCTGCAATTTCTAATTTAATA
GATCTGAGTGGGCACCAACAATTTATATCCCTAAGACGTTGCAAGATGATGCTGATGCTG
CTCTTCCAGAGACCACACTTCACTGAGAACCGCAGAACTAGGCAAGGTCTTAAATGTCAA
GTTATTATAAATCAGAGACCGTGTCATTAAGAAACTTGGGAGGCTGAAGAATGAAGAATC
CAGCTTACTGTTTTGTTTTTGTTCCTAAATAATTGCTCAGAGCCAGCAAAGTCAAATGAT
TAACCTTATCAGGAATCCTATATGTTACTAGGGACCCAGTAATAACAGGCTTCATGATAT
TCTAAGGGTAAATTCCTAAAAGTAAAGAGTTCTTATTTAAATCAAATAAACAAACAAGAA
CATTTTTTTATCCCCCCCCCCCAATCTGGAGTGTTCTAAGAGAGAAGACTCTTTTTTCCC
TCTTTTTTCTTTTAAACTTAAATGCATTTAGTAGGAAATTAGATGTAGACAATCTCATTC
AACACATATTTATCAGTGTATATTTATGTCCTTGAAATTTTATTTGCCTACAAAACCAAA
ATAGTTTCAGAAAAGAAGATGTAAAGTGACCAGAATACAGCTTACAATTTTTATGAATAT
TAGTTTTCCACTTGTTTTGCTTATTCCATTGTAGCACCAGTAAACCAGAATACCCTGGAG
AAAAGGTTCATTCTTCTTCTTAAGGAGGAAATGTGAAAAATAATTAGATTAGATGCAACA
CCTTCATCATAAACAATAAAATACCATTCTGGGAAGCCCAGTAACACTTCAGCAGGTGCA
AAGAGTAGGAAGAGAGATGTTTGTTTCGATGTAGGGGCTTCTAGAGAGAAGTTGTGGTTC
CATGGTGTCTGGCTCCCGGCTAGTGCAAGGCGCAAGTGATGTGCTGAGAGCATCTCAGCA
TCAGACCAAGAGAATGTGAGTAAAACGTCCTCTTGCAATGTGGGATAGGCAGGATTATTT
CATGATAATTCAGGAGGTGTTTTATTTTTTTTTTCAAAATTACTTATTATAATACTTATC
TGTGTTTTTTGAGTACATAGAGAAATAATAAAATACAGGAAAGTGTGAAGAAAGAGAATA
AAAATTGGAGTACTATACCAGCAACAACATATCCCTGAGAAATGTGCTCAGTTGAGTTTG
TGTTCAAGTGTGAGATGTTTTGACCTTATCACTCCAGTACATAAAGAAGATTTAAGTCCA
AAAAGCAAGAAATAATAGACTGAAATTAAAATGAAATCAGCAGAAAACCTGGGTTAATAT
TACACTTCACAAAATAAGCTAAAATTTATCTAACTTTTTGAGGTAGTTGTAAGTTTAAAT
GTTTGAACATGGCATTTGCTCCTATGTCTTACATTTCCTTCTTAGTATAATAAATGTATC
AGAAATAGCTTTATGTTTTGAAATATGATAATATTTATATAGTTTAAGACAAATTATAAT
ACAAGAATTTTAATGTAAAAGTTTGTCTTATTATTTTTTAACTTGACTTCTATATATATA
TATGTTTTCTGAGCAGCTTACAAACTTTTTGAAAAGTTTAAATATTGTCAGTTGGAAATT
AAACTCTGCAAGTAACAGGTATTTAACCAATGAAACCTTCTCCCATATTCTCTACAACAC
AGACATATTGACTATGTGATATCTAGCAGAGAAAGATTAATGCCAGCATTTTCTTTCTAA
TACATACATTTTGCTGAAAGTTATATAAGTTAATACATGCACCTGAGCTAGATACTTGTC
AGTGAGTAGGTCTAACATTTCCTGAAATAGTCACCTCTTAATTATTTTGGAATTTCAGAT
TAAACTTGTGTTTGGGAGAGATGAAAGGAATTTAGAGACCAGCCCTCTTTTTTCTTATTA
GATACAATGATCTGAATATAAGAATTTCTTAACCTTTGTTATCAGGAAATATAATCTTAA
ATATTTTTTATGCAGGGAAATATCTAGAATGTTATGTCTGTTCTTATAGAGAATTTATTT
CTAAAGTTCATTCTGAGAATCACCTATATGTGATAAAAATAAATTTATAAGTATAATAAT
GTTTGTTGATTAAAAACTTCTGACAAGAATATGCTTTTTAGTTACTTTGTGCTCTATTAA
TAGAAAAATATCTCTAAGTTATCCATGATTATCAAGACCTATATATGAGGAGGTCTTTGG
TCAAGTGGTTATTTCCAAGATTCTTGGCTAGCTGTCTGATTTTTTTCTTCTATTCTTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGATGCTTATTTTGTTATGA
ATGCACTCTGATTCTTCTCAGTTCTTGCCTCTCAGAGTGAACCAGACTTCCAGGAGAGAT
CTCAGTTTTCTCTCTTTAAGCAGTTGGAGTGACAGCACAGGTAGAAATCTACTGCCCGGA
GAGAATGGCTGGGTCTGCTGTTTTCCTGATAGGCATCTGGAAGTGTTCCCTTTCCAAGGC
TCGGGCAGTGACTTGAATGTTTACATTGTTAATGCTCTGAGCAGAGGTAATGGCAGATTA
AAACATAACCAGTGTGACCAACAGATACAAAAGGCTTATTGATATGGGTCACCTATTCAT
GACAAAGACAAGGAGGCCGTGGATGAGGCTGCAAGGAATAGGGTTATTGGGGCAAAGAAA
AGGTAAATAAGAAAGTAACACTAGCCTTTAAAAAAGTGTTTGGTATGTAAGGAAGAATTC
CTGGTCTCACTGATCTCATAAATCAAAAATATAATAAGATGAATAATAAATGTGCAGTTC
AGGGTGTATTTACATGGAAAGTGAAATACAATGAGGTTGAGAATTTTAGAAAATTTTATC
ACTGGAATGAAAAAGTATGCTATATTCACCTACCAACGATAGGGTGTGATCCTGTGGTTA
GTTCTGGTTTTAGCTGAGTATGCAGACTTTTCTTTGGATTTATGTGTAAAGTCAGGCTTT
TGGCTTTTGTCAGCTCTAAATTGGAAATGCAGTTGAAGCTAATGTTTTCAGCAACAATGT
TTGCATGTATATGTCTAATGCTATATTTACACCTATAAATGTATAAAAATATTGTGAATT
TTGTTTTCACTAGCTGAAGTATTGTGCCTACCTTGGGTTTATTGTAAACCTTGCATATAC
CTAAGGAAGGGTAGCGGGTGGGGCAGCGCAGGAAGAAGTTTACTAAGACAATTCATTGTG
TAAATGTTAGCCTGCTTAATTTGAAGAACCTAGACATTATTTTCAAATTTTACTAAACAA
CCTTTCAGACAAAGCATGTGCTAATTATATGTGATTCCTGTCTGTGTTAAAACCTTAACA
GCTTTTTGGACACATTACTGTAGTGTTTCAGGTTTCTGAACTCCTTTTTCCCTGACCATT
AGCAATGTCTCTGTGTTAATATTATTAATAGAAAATTGTTTGTTTTTAATGTTCTCTCAG
TTTTTTCCAGATGTAGCTATTCTCATTAATTTTTGGCAAGTAGTGTAGATCATGGCTAGC
TGTTTAAATATATCTGTTTTAGAATGGTGAGTAAATCACAACATTGACCGTCATGAGGTT
TGAACAAAAAATTAGTATAAAGCTCTGTGGATATAAGTTAATAGTAAATAATCCAAATAT
TTCAAAGTGAGATTTACTTTCAATTTTTACGTTCATGTTAATTTCCTGATTTTGATAATT
ATATTATCATTTTGTAATAAAATATCTTTGTTCTTAAGAAATGCATTCCAAAATGAATAC
AGGTATGAACATTATGTCTGCAACTTCAAAAGGTCTAAAAATATTGCGTGTGAACATGAA
TGCATTCAAACATGTAATAAATAAATAGGCACAGACTGAGACAGTAAGAGACTTCTAAAG
CAAATGTGAAAAAATGTTAACAATTGGAAATCTGCGTGAAGGGTCAAACACTGGAGTTCT
TTATCCTTATAGTTTTTCTGCAAGGCTAAAATTATTTCAAAATAAATAATTAAAACATAT
ATTCACAGTGATGGAGAAAATAAAAACTGTTACAATATTTTAAAAGGATATTTTGACAGT
ATGTATGAAAAGCCTTAAAATAAATGTTCTTTGAACTAATAGTGCTACTTCTAAGAATGT
CGACTAAGGCAATAATTCTCGATTATGTAGAGATGTATGTATACGAGTGGTCATTACAGC
ATTATTTATTATAGCAAAATTATGGGAGTCTCCTAAATATAGAGCAATAGAAGTTTGGCC
CTGGAATTAGGATATATTCATATATAATGCCATGAAGTCTTTAAAAATGATACTGCAGAA
AAAAATATTGTTTTGGAAAACTGTTTGCAATATTATGTGAAAACAATTTAGTTGAAAAGC
AATATATAGTATAAGGCCTTTTTGTAAAATATTTTGCTCATTGACATTTTTGCCGCAAAG
GCATTGTGATGCTTAGGCTAATGTGTCAACTCAGCCAGGTAATGATATCCAATTGTTTGG
TCAAGCAAGCACTGGGCTAATTGTAATACAAGGGCATTTCATGGACTTTAATCATCAGTG
AGTTGATTGCTTATGTGGCTGATTACATCTATGATCAACTGAGGTTCTTGCCCTCAGCAA
TGAGTGACATCTCATACAATCAGTTGAAGGCCTTAACAGGAAAAGTGATTTCAGCATTCA
GAGAGAGAATTCCCATCTGTACTTCAGACATCCAGCGTCTCCTGGGGAACTTCATCTGAT
CCCAGGCTTGCAGCCTGCCCTACACAATTATGGACTTGTGCATTGTCATTGTTACGTGAG
ATAGTTTTTAAAATCTTAATAGTATTAGGTTGGTGCAAAAGGAATTGCAGTTTTGGACCA
TGATTATTAAATCATTATAACTAGGTTCAAACACTTCGATGTTTTTTTGGCATGAGTTTG
GCTTTGGGAAGTGCTTTGAAGCTTGTTCTTGATCCATCCACTGAGCTGGTTGTCACCGGT
TATCATATAAAATCCACTTTTGCATGCTCAGGATATTTGAATCTCTGGACTATCTATGTG
CCAGCTGGGCCCTGAGCCCCAGCAGAGCTGCAACGCCTACTCTCTGGTTTGTTGGAATTA
TCCAGGTCAGCTAAAGGGAGGTGAGGATGGTCAAGCAGCACACCAGGGAACTGAGAGAGT
TGACAACTACAAACAAGAGAATCACATCCATCAGCTATGTGGGATCTAAGCCCCCTCTTG
ATTTAGAAGTGGAGAGGATATTGCCATCCCACTGTCCTCAGGATAGAGGAATAAAATATG
GATTAGAGTGGACTTACTGGTATTCTACTATAGAATTATTGCGACTCTAGCAATGGAAGA
AATCATATCATTGATGTGGAGACAGTGGCCATGGGAGTTGCTGAGGGCAGGGAGAGAGAA
ATAGAGGTGTGATATTGGGGCATTTTTGGGACTTGGAGTTGTCCTAAATGATATTACAGG
CACAGATGCAGGATATTATATATCCTGCCATAACCCACTGAATGGACTGGGAGAGAGTGT
AAACTACACTGTAAACGATAATCCATGCTGTGTAGCAGTGCTCCAAAAGGTATTCACCAA
ATGCAATGACTGTACCACCCAAATGAAAGAAGTTGTCGATGTGGGAGAAGTGGGGGACGT
GGGGAGTGGGGTATACGGGAATCTCTTATATTTTTTAATGTAAAATTTTGGGTCATCTAT
GTATCTTTAAGAAAAAGATTTTAAAAAATGAAAAAAAAAATCCAATTTTGGTTGCAAGTA
ACAATCCTATCAAGAAATGGTTTGTTGTTGTTGCATAGAATAAGAGAAGATGGCACTTCT
AAATAACGATTTTTTAAATTTTTGGTCAGCTCATGGGCCACCCACTTACTGAGCTTTTTC
ACCTTTCCAATTTGCTTCAAATGCCGAATGACCATAGAATGGTTGACATTGAGTTCTTCA
GCAACTTCTCGTGTAGTTTGAGGATCAGCTTTGATGATTGCTCTCAACTGGTCATTGTCA
ACTCCTGATGGACAGCCACTATACTCCTCTCCTCATTTTCAAGGCTCATGTCTTCTTTGC
AAAACTTCTTACACCACCGCAGCACTGTACATTTATTCCACAATGCATTCCTGGGTCAAA
AGCATTGTTGATGTTAAGAGTTGTCTCTGCTGCTTTTTGACCCATTTTGAATTCGAATAA
TAAAATAGCTCAAATTTGATTTTGCCTAACGTCATTTTCATAGGCATAAAATAAATGTAA
AATAAACAGCAAGTAATAAATCATTAGCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCACGGGATACCTAGAAGTGAACTAGATAGGCGTCTGCTAAATCCTACTTGATCTG
TATAAGCAAAAGAGTTCTAGGTCTAGTGAACAAAAACCTAACTTGATTATAGAAACGGAG
TCACAACCCTTAATCACTTCCCAGATGTGGGACAGTTTATAGACCCAGAGCCCCTTGAAT
GAGGGGAAGGTTGGTTGCCTTAGGGAAGGAGCCTGACACTGCCAAAAATTTATACTGTTA
ACCTTCTTCCCAACTTTCCCCAAAGACACCTATGGCCTTTTATCAGAGTAGCTGTCCATT
GGAAAAAAGGAAATAATCAGACATTTTGGGGATTATTAGACAACTGGCTCAGAAGTGACA
TTAATTCTCGGAGACCCAAAACACCACTGTGGTCCACCAGTCAGAGAAGGGGCTTATGGA
GGTCAGATGATCAATGGAGTTTTAACTCAGGTCCATGTCACTGTGGGTCCAGTGGGTCCC
CTGACCCATTCTATGGTTATTTTCCCAGTTCCAGAATGCATAATTGGAATGCTCCAGCAA
GTGGCAGTTTCCCTACATTGGTTCCCTGACTTATGTAATAAGGGCTATTATGGTAGGAAA
GGCCAAGTGGAAGCCACTAGACCTGCCCGTACCTAACAAAATAGTGAATCAAATTCAATA
CCAGATTCCTGGAGAGATTGCAGATATCAGTGCCACCACCAAGGACTTGAAAGATGCAGC
ATCTGGTGATTCCCACCACATCCCCGTTCATCTCTCCTACTTGGCTTGTGCAGAAAACAG
GGTGACAGTGGATTATCATGAACTTAACCAGGTAGTTACTCTAATTGCTGCTGCTGTTCC
AGGTGTAGTATCATTGCTTGAGCAAATCAGCACATCCCCTGGTATCTAGTATGCAGCTAT
TGATCTGGCAAATGCTTTTCTCTCAATTACCATTGTTAAGGACCACGAGAAACAGTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCATATTTATGTGCTGTGGTTACTGTTCTATCTGCAATGTTTTATCCCTGTCGTTACAT
TCCAGTGTCCAAAATTATATTCCTTTATCCATCCTTAGGTATAAAAGACAAGAAACCAGA
CCTCGGTATAGCATTGGGTTAGAACAGGACGAGACTTACATTCCTCCTGGAGAATCCTTG
AGAGATTTAATTGAACAGTCTCAAAGCTCAGGAAGTGGATCAGGCCTCCCTCTGCTGGTA
TGAGAAGAACATATTTCTATTTCAAAAGAATATCCTTGGAAAGGAAAAGTCAAGACAGGG
TGTCTTTTTACTGAAAGAGGGCACTGGACAGGGAAAAAGTTCTATGCAAACAGCTGGAAG
TCAGTTCTCAGATTCAGGGCATCCTGATAACATTTTGGCATATGGATGGTTTAATTTTTT
TTTTTTTTCAACTGTAAGTGTATAGTTACAATCCAGACCCTCAGACGTTCTGATAAGGAG
CAGATTAGAAAACATTAAACATGGAATCATCTTCCTTCTGTTTTCTGTAAGGATTGCATG
ACTGCACTTTGGCCTGGCTTTTGAAGGGAAAAGTGTTACAAGAAGGATCTGAATACTTCT
ACAAAGGGAGAAGGTTATGTTATAGCTGCAGGGTTTGTGTTTCAGGAAAGTCTGGGCTTT
TGCATTCAGGAAAGGTTCAATGTTCTGAGGGTCAACACTGCCAACCTTGAAAAGACACAC
ATACACACACACACACACACATATATATATATACACACTGAATCTAAGGCACTTGCTTTA
GTGAGAAAAGCATTTGGTACCTTTATGGACCATGCAAAAAGATTGTTGGAATTTAGGATG
AAAACAGTATTTTTAATGAGAAATAAGCATTTTCCTTAATAAACTCTTAAGCTTGATTTT
CCTATTTGTCTGTTTTTGACTTTGGATATCTTATTTACACTATTCCTTTGATGACCTTTT
ATTTAGCGCTAAAAATAGCATTTTTAAGACCAGGCAGAAAACAATTTATGAATGAGTCAT
TATGACCAAACTGTTACTACTTTAGTTTTTCAAAAAATTGAATTAATTGGCAAAAATTAT
TTTAAAATTTTCTTGATATTTTATTCTTAGGCTTCATTAATATGTAGCAATTATAGTTCT
TGTATTCAAAAATTTTCCTTTTTTTGTTCTGTTTATTTTTTTAAAGAAATGTTCCAATAG
TAAAACCCTCTGGTGTTAGTGAATGTGCTCCTGGAATTGAAACAATTTCAGTTCTTCCAG
TGGTTCCCCACTTCCAGCTCATCTTTCTCATAGCTACAGAGTTATCGCTCTGAAAATGTT
GGTTTGTACCTAGGGCTCTTCTTTCTAGCTTGGCATGCATGATGAGTATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
CAGGGACATATTAGAGGGTATAGGAGTTCTTTTCATAGCAATAAAAATCACGATTATGTG
TTTTCCAGTGACCATATCTGCCCATGACCTTTTTTTTTTTTTTTAAAGATTTCTTGTTTG
TTTATTTCTCTCCCTCCCCCCCCAGTTGTCTGCTCTCTGTGTCCATTCACTTGTGTGTTC
TTCTGTGACCTCTTCTATCCTTGTCAGCGGAACCGGGAATCTCTCTCCCTTGTTGCGTCA
GCTCTCTGTGTGTGCAGCACCATTCTTGGGCAGGCTGCACTTTTCTTTTGCGCTGGGCAA
CTCTCCTTATGTGGCACACTCCTTGCACATGGGGCTCCCCTCTGCGGGAGACACCCCTGT
GTGGCAGGGTACTTCTTGCACGCATCAGCGCTGCACATGGGCCAGCTGCACATGGTCCAG
CTCCACATGGGTCAAGGAGGCCCAGGGTTTGAACCACGGACCTCCCATGTGGTAGGTAGA
CACCCTATCCATTGGGCCAAGTCCGCTTTCCTGTCCACGAACTTAAATGTGAGAGACAAT
AAGCTGACATTTCTAAGATAGAGACAAGTCATTTTAAGTCCTGAAACATTGTTGTACACA
GTTTACAAAAATAATTCTTCTCATTTTGAAGTCGTAATTATAGCACTTTATCTTACAGGC
ATTTTATTTATATAATTAAATTTTCAAAAATTGATATCTAACAATGTAATATAGAATGAA
AGTACCTACCAAATGATGAGAAACACTTGCTAAATCTAATAAAAACCCACATAAATCAGT
TTATCGTGATTATAAACAATATAATTAACTCTAAAATTATAATTAATTACATTAATATAT
TAATAATAGTTAATATAATTTTCATGATTTGTTATAGTAGATCTCAAAACAAATGTATTC
AACTGTATTTTAAATTTCTGAGTATAATTTAGTAACCCTCTATCATTTAGCTATGTGGTT
ACTGTTCTATTGAACATTACCAATTCTATCAGTAGTTTCATTAAATTAAAAGAAATATAA
AGCAGAAGAATCATATCCATCAACCATGTGGGATCTAAGTCTCCTTTCAATTTAGAGGTG
GAATGGACATCACCAGCCCAGGGTCCACAGGATGGAGGAATAAAATATGGATTAGAGCAG
ATTTACTGGTATTCTACTGTAGAACTATTGTGACTAGTAATGGGAGAAATTGTAGCATTG
ATGTGGGGAAAGTGGCCATGGTAGTTGCTGAGGGTAGGGAGAGGGAAGAAGAGATGTGAT
GTCGGGGCATTTTCGGGACTTGGAGTTGTCTTAAATGATATTGCAGGGACAGATGCTGGA
CATTGTATATCCTACCATAACCCATTGAATATACTGGGGGAGAGTGTAAACTACAATGTA
AATTATAATCCATGCAGTGCAGCAGTGCTCCAAAATGTATTCATTAAATGCAATGAACAT
GCCACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACGTCATTAGATGGGTCTTGCTTATTCATATCTCAGCAGGAT
CTCAGAGACAGCCAAACTAGATACAACCCCAGGTAGGAGTGCTCCTGAAGACTATGGAGA
CACCCAGGTCCTTCAGTCATGACAGATGGCTCTGGAGTTCAGTGCCTTGCCAGTGGCCTT
AGTTTGGAATTTGTGCTTCTGAGTGTGATGGAGTTGGACTCAGATTTTATCTCTCTATAT
CTGCCATTTCTGTCACTTTTACTGAATATGTGGTTGGCACTGGGGTTCATGTATGCTCAG
GAGACTTGATTCTCTGGACTGTCTATGTGCCAGGTGGGTCCTGAGCCTCAGCAGAGTTGC
AACTACTATTCTCTGGTTCATTGGACCTACCCAGGTCATTTAACAGGGAGGTGAAGATGG
TCAACCACCAGACCAGGGAACCAAGAGATTCTACAGTTGCAAGCAAGAAAACTCCATCCA
TTAGCCATGTGCAATCTAAAGCTAAGTTCCCTCCCAATTTAGAGTTGGAGTGGATATCAC
CATCCCAGGGTCCTCAGAACAAAGGAATAAAATAAGGATTAGAGTGGATTTACTGGTATT
CTACTACAGCCTTATTGTGACTCTAGCAATGGAAGAAATTATATCATTGATATGGAGACA
GTGGCCACTGGAGTTGCTGGAGTCAGGGAGAGGAAATAAGCGGTATGATATTACAGAATT
TTCAGAACTTGGAATTGTCCTCAAAGATATTGCAAGGACAGATGTAGAACATTATATATC
CTACCATAACCCATTGAATGAACTGGAAGAGAGTGTAAACTACAATGTAAATTATAATCC
ATGCAGTGCAGCAGTGCTCCAAAATGTATTCATTAAATGCAATGAACATGCCACAATGAA
AAAAAAAAACAAAGCCAGAAGGGTGGTTATGTATAAAGAGGAGAACAAAATTAGTATTAT
TAAAATTTCTAGTAAATTCTTTTAAAAAAAGAATATATATTATCATTAGAGAAAAAGTAG
ATACAAAACTGTTTATATCAGGAAACATTTTATAGAAGTACATGACCAATGCTTTGCAAT
AGCTGTACATTAAACGTATTTATTTAATAAATGTGGGATGTTTCCTCTTATCAGTAGGTT
AACTACTTCCTTCCTTCTCTCCCTCTCTCTGTCCTCCCTCACTTTCTCACTCTCACAAAG
GTTTCCTTTATTTTCTTATGAGCCCTACAATGAATTACAATTTTGTTTTGTTATACCTAT
TATTTTTTATCCATGGTCAAGTTGTATGGTGGTAGGAATTCATTCAGAATATCTAGTATT
CCACCTAGTGGGGAAACGAGAAAGTATACTGTTTATACCAATTACTGTGAACCCATTCAA
ATTTTTTCCCTATGAAATGATAATAAAATGAAATATTTAATCATTTGAAACAATCTTTTT
GGGCATTAAAAAATCCAGAATCAATCTAAAATCTATTTAAAAGACTACAACATAAATGAA
CAAATAAATTGTCCATCTAAATAAAAACTACTGCCTAAATATACTCTACTTGCAGTAATT
GTTTCTTCTTTGGAGAGAAAAAAGAGATTAAACAAATCTGTAGTGCTGTGAATACACTAA
CAGTGTGTTTTGGGATTTAACAGGTCCAAAGAACTATAGCTAAGCAGATTCAGATGGTGA
AACAGATTGGAAAAGGTCGCTATGGGGAAGTTTGGATGGGAAAGTGGCGTGGCGAAAAGG
TAGCTGTGAAAGTGTTCTTCACTACAGAGGAAGCCAGCTGGTTCAGAGAAACAGAAATAT
ATCAGACAGTGTTGATGAGGCATGAAAATATTTTGGGTGAGTAAAAATCTGTATAGCAAT
GTTCAGTGTTTCCTAGCTTTTTCTTCTTTTTTTCAGTTAACATCTGCACATTGAATCATC
TGTCTAGATCTGTTATGAAATATATAGAAATTTTCTTCTTGGCTTGCACCCCAGAACATT
ATAAGCTTCTAATGGGAGACCTCACAGAAGGAATGACTAAGGAAGGTTGGGCTGGGAGTG
GGATATTCTAAAATATATTCTCTCCAGAGATAGGAAATGCAAATATAAAAAATTTTAATT
TCCTAGGGTTTCTTAGGGATTGATTTGAAGGAATATATTTTTAGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCAACATGTTGTCTTTAAGGTTCA
TCCATGCTGTCACAAGTATCAGAACTTTATTCCTTTCTTTTTTTTTTTAAAAGATTTATT
TATTTATTTATTTCTCTCCCCTTCCTCCCCATCCCGGTTGTCTGTTCTCTGTGTCTATTT
GCTGCGTCGTCTTTGTCCGCTTCTGTTGTTGTCAGTGGCACGGGAATCTGTGTTTCTTTT
TGTTGTGTCAACTTCTTGTGTCAGCTCTCTGTGTGTGCAGCACCATTCCTGGGCAGGCTG
CACTTGCTTTCACTTACGGGGCTCTCCTTACGGGGCGCACTCCTTGCGCATGGGGCTCCC
CTACGCGGGGGATACCCCTGCGGGGTAGGGCACTCCTTGCGCACATTAGCACTGCACATG
GACCAGCTCCACATGAGTCAAGGAGGCCCGGGGTTTGAACCACGGACCTCCCATGTAGTA
GACGGAAGCCCTAACCACTGGGCCAAGTCCGCCACCTTTATTCCTTTTTAATGCTGACTA
ATATTCCATTATTATACACCTTATATTTTTAATCCATTCAGCAACTGATGGAAACTTGGG
TTGCTTCCACCTTTTGGCTATCCATAATATCCCCACTTGTACTAAGCCAGTTTGGGCCCC
CTGCACCATTCTAGATTATCATTATGTGGCACATTGCACTTACTTCCTCTTTGTCTTCCC
TCTCTCCAGACTTTCCTACATGCCACTGTAAGATTTATTTTTCTTCAGAGAATTTGGACA
CCATAATAACTTCATAAATTTTCTTATGGGCTATGGATTAAAATTTAGGGCCCTTTCCTT
TTTCGGGCCCTGGGCTATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTCTTCTGTGACTGCTTTCTATCCTTATCAGTGACACCGGGA
ATCTGTGTTTCTTTTTGTTGCGTCATCTTGTTGTGTCAGCTCTCCCTGTGTGCAGTGCCA
TTCTTGGGCAGGCTGCACTTTCTTTCGCGCTGGGCGGCTCTCCTTATGTGGCACACTCCT
TGCGCATGTGGCTCCCCTACGCGGGGGACACCCCTGCATGGCAGGGCACTCCTTGCACAC
ATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGAAGGCCCAGGGTTTGAACTGCG
GACTTCCCATGTGGTAGGTGGAAGCCCTATCCACTGGGCCAAGTCCGCTTCCCACCATTT
ACTATTATCCTGAGCACTTCATTTTCTCTCTCACCTTCAAATGTTTAAATGTTCCTTTTA
TCTTTACCTGAATCTCTGGCATCTCCACTTCTCTTTTGATAACTACTATTGATATTCATA
GTTTCTTTTAAAGAGCCTTCATAATTATACCCTTAGGAGTCTGATTTTTGTTAGTCTGTC
TTCCTTTATCCTCCATGTGAACCTGCCCATACTGCTGTCACTATTGTATGGTAGTTATTG
TCTTTCCCAGTGGACAATAAGCTCCTTGAAAGCAGATACCACGTAGTTTTCAGTATTGCA
TTCTTTGTGCCTTTTCCCGGTACCCATTGCTTAAGTGTTTCTTAAACATTTTGTATAAGG
GATGAATTAATGATTCCATATTGACTATGGGAGGAAAGGAAATATAGCTCCAGGGATCTA
TCCTTATGGTTTTATATCTCACAAAATATCCTACTTGAATGCTTTCTTTTGCAACACTGA
ATCAGTTGCATATTCTCCATATCCTACCCTATGCTTGCGCCGCCTTGCTTTTGATTGCAT
AGTCCCTCAGCTTGAAATACCCTTACTTCTCCATGGGCTCAATTTAATCATGGAGTTATC
TTTAAGTTATTTTGGTCTTCCTTCGGATAGGAATAATGACACTATCTTCTGTTTTCCTGT
AATAATTTCCTGGCCCTTGTGTACCTTGTATTATGATTATTTTGGTACATGCCTCATCTT
TCCTACTGGACATTGGGCATCTTGAGAGCAGTATCCATGCCAAATTAATAAATGTATTTC
CTGTTTAACATGACATAGTGGGTTACCCATTGTAGGTATTCCAGTATTGCATTGAATCAA
TAAATGTAGGCAATATCAAAGTAATTGAGAACAAATCTTCTTTATGGACTCTAGAATCAG
GAAGTGTCCCTTACATTTTCTCAAACTTAGTTCTGCTTATGTAAGGTGAATGAACTTAAT
AATCTCTGAAATTTCATGTAAAACCTGACACGAGAAAGTGAAACAGAATACTTTTTAACG
GATAATTCAGATTTTTAATGTATTTATAGACTAGTTTATCAAGAGATCAAGGGATGAGAT
TTGTAACTGTAATGGCTGTTGACTACACAGAACCTTCAATGTCTAGAAACTGGGTGTGGG
ACCATTTGTCATTTACCATTTACCATTTACCATTCTGGGCCTCAGTTTCCTTTCTCATTA
AAAAAAGGTTGCATGGAAAGCGGACTTGGCCCAGTGGTTAGGGCGTCCATCTACTACATG
GGAGGTCGGCCGTTCAAATCCTGGGTCACCCTGACCGGTGTGGAGCTGGCCCAGGCACAG
TGCTGATGTGCGCAAGGAGTGCTGTGCCACGCAGGGGTGTCTCCTGCATAGGGGAGCTCC
ACGCGCAGGGAGTGCACCCATAAGGAGAGCCGCCCAGTGTGAAGGAAGGCGCAACCTGCC
CAGGAATGGTGCTGCCACATGGAGAGCTGACACATAAAAGATGACGCAACAAAAAGAAAT
ACGGATTCCCATGCCGCCAACAACAACAGAAGCGGACAAAGAAGAAGACGCAGCAAAAAG
ACACAGAGAACAGACAACTGGGGCGAAAGGGGGAGGGGGCAAGGGGAGAGAAATAAATAA
ATAAATCTTTAAGAAAAAAAAAAGAGGTTGTATTTCATGATTTCAAAGGACTTTATTGTA
TTTTATTTTCTGTTACAGAGCTTCAGTTTTAAAGACTAAATTTTTTTTTTTTTTTTTTTT
TTGAGGTACCAGGTCTAGGGATTGAACCTGGGACCTCACATTTGGGAAGCTGGCACTTAT
CCACTGAGCCACATCAGCTCCCCTGTGTTATAATTTTGTTTGTTTGTTTGTTTTGCTTGT
GGTTTGTTTTTGTTTTTTCTAGGAGGCACCAGGAGCTACTGAATCCAGGACCTCCCATGT
GGGAAACGGGCTCAACTGCTTTAGTCACATCTGCTCCCAGGGAGACTCAATTATAATTCT
TGCTTTAATAAGCTTATTTAGCTTCTATTCTCTTCCCAAATATTTTGTATTTGGGGGTGG
GGGTAGTGTGCATATGCACACACAGGTATTTATTACAAGTGGGCCCATAGTTAACCCTGG
GGGCCCATAGCTAACTCAGGCTTCATATATGAGCTTCCTGCTAAAACTTAATCTACTAGG
GTTTCTGCATGGAAAGTGTTCTCTCAGGCTTTTCAGTCGTTACCGGGAGAGTCTCAAGGA
AGTTCAGGGCCCCAAAGAGAGCAGATGGTGCCTTAGAAATTTCCTGCTTATATTAATTTT
TTTATCCTGTGTTGTTTTTTTCTCTTGAAAATGATGTAAATGCTTATAAATTTCCTGCCC
AGCAGAAATTTAATCCAGGTGATGCCATAGCAAGACATTACCATTACTCCATATCTGTCT
TAGGAAGAGAAAACAGTGATGCATGAAATCCCTTGAAGAATCAAGCAACCGCTCTGGTAC
TTCAGTGTCAGAATCTTATATTTTCCGAGGGGGGAACTAACATCTCACTTAGGGCTCCTC
AGGTATTAAATTTTAAATAGAAAACCTACCACGAAGACTGGGCTGCAACACTGATCTGCA
AATGGTGATTGTCATCATCTAAGCACACAAGAGATGGGGTGCAAGCCAAGAGTATACTGA
ATTTCCTCCAAGTCTTTCTGATTTCGTATTTTTAGAAAGGCTTCTTGATTTGGGTGCATA
TTGGTTTTTAAGCAAGTGGCATGTCTAAATGACTTGCTGAAGTCCTAGTACTAAGCTAAT
TTGTGGCAGATTCAGCCCTCCCAGTCCAGTCAAGGTTTCTGCAGCCATATCCACCTTCTG
TTGAAGAGTCTTTAGTTCTGAAGTTCTGTTTCTAAGAAACTGTGAGATTTTTTCTGGACT
GAATCATAGCAGCAGTAACTCCTGGTGAAAAGCCCTGCAGAAAACTCCCCTTCCTGGTTA
ACACTCGACTGGTCAGAGTTCAATTCAGCAAATCAATTCCACAGATGTTTACAAGGTGCA
ATAGGAAACACAAAGCAATGTGGGCAGCTCCTTCTTTTTAAGGTTCCATGAGAATCTCTT
TCCCTTTGGGGAGTATTTTTCATCTTTCTGAGAGGTGTTCTAAGATTTTCCAGTATATTC
AGTGTAGTTAATTTTCTGCATCAGTGATAAGCTGCAAGCAAAGGATCAGCCTTCCTCGTG
TGCCTTCTCCATCTTCTTCCCTCTCCACACTGTCTTTCAGGTTCAGTTCATAATTTTTCA
AAAAGCTTTTTAGATGATTAAAGGTGTGCGATGTTTGCCGCGTCTCTCTTTCGCTGTCTG
TTGCCTTTTTATGTCCCTTCTCTCTCCCCTTTCCCTCCATCTTAGGAATCAGCAACATCC
AGGCAGGAGGACCCCTCACGAGCTCCCAAAGGCTCATGAGCTAGAAGCACCTTGTCGGAG
CTGAGCCCTCGGTGTCCTGCCTGACGCTCAGTGCCGCAGTGGGCTCTGCTGGTGACTTTT
ATGAGACTCTCACTTCGGTTTATGGTACAGTGGGGAGTGTGCACACTGCTGAATGAAGCA
GCGGGCTTTTCCTTTACATGACAGTACTTGCAAGAATTCTTGGTATGGATTTATAATTAG
GATGTTTAGTTAATATAACATTTTTAATACAAAATAAGGCTGAGAGGTTATATATTTATA
TACATATCGCTGCTGTGTTCTTTGCTATCAGAATAAAAATCTTTTCCCTGTCCTTCATCC
AGTGCATGATGGGTGAGAGTATCAGGAGTGCCCTGATGCAGAAGTCCTAGGAGTGTGGCT
CATGTTGCCTTCAGCAGCCCACTCAGGATCCTAACTGGCCCCACTTGCAGCCTCTCTGGT
GCCCAGAGGCAGCTCTCAGATTTCCCTTCCACAGTTACTCTCACACCTGCAGTGTGTACT
CACCAGACCTGGAGACAGTATCGTAGCAAGGGGGATGGTGGGAGCAGTCTGCCCCTGGCA
TAGGTAATAGGGGGGCATCTTGCCTGTAGAAAATTTCAAAATAATAAGAAAAGCGATTAT
CACCCTGTGCCTGCAATGCTAAGTAATGTCAGTGATAAAATTTTGCCTCCCAGCAGGGTG
TATTCTTTCCACCATCCCCTCCTTGGTGTACCTTAGTTTTATAGTTTTTCTTTTTTCTCT
CTCTCCGTGTCTTTCTACACATCAAAGTCTTCAAAGCCTTCTCTTTTCCTCCTTCTAAAG
CACTTGCCTTGAGGACTCTCACTTACTTTGCACCTATACCGGGAAGGGAGCCACTAGAAG
TGTCCATACAGTTAGGAAACCTTTCTTCATCAGTGTAGACTTCTCACTCCACCACTTTGC
CATTTTCTTTATTGTGCCACTGTCATCCCAGTGGCTTTGCCCAGAAATATGAACTTGGTT
TGCATGCTTCTTTTTGTAACCGCAGCTGAGGGCATCTCATAGTTTAAGATTCAGATAAAA
TTAGCCTTTAGCATCCCATTCCTCCAGTAAAGTAGGGAACTCAGCATCATTCCCAGTATA
TCTGGGAATTCAAAGGAGCTTGTTTTCCTCTTTAGCCTACCAGCTGTATACCTCCCATCT
CTGTGGTTCCTTTCCCACATAATATAGCTGCTGGTTTTTTACCTCCCGAACACCACCAGC
CCAAGGTGGCAGATATCTTTACTAAGGATTTTTATTGGAGAGTCTTCATTTAAATTTAAT
CCTAAAATCCGTGCCACAAGGACATATTCTTGATTTTTTTTCCTTCAAGGGCTTAACATC
ATGCCATGACCTTAAGCCTTCTATCTTCTCCCTAAATGAATTGTCTGCTAGCCCCAGCCT
CCCAAATTAATGATCATTTCTTATTCAGAAAACTTTAAGTATTTAAGTATTTTAAATTTA
TCAAGTTCTAATCCCACAGTCCTTCATCTTCATAAAGAGAAATATCTATTAAAGTGTGAT
TCTCAGGCCAAATAAAAGGTTTTTTTCCTTGAATCATTTATCTGACATCCCTTAATTTAT
TTTCTTATCTTCCAATTTTATTTACTTGCTTCCAATTCTACTTAAGTCTCTTCTGCACTG
GTATTCACATTAACAGGGACAAAAGCTGTATTGAGTCCAGATGTATTAATTGTATTACTT
GTAAATGTATAAAAGGGTGAAATAGACTTCTGCCTGTATTCAGTGAACTTTTTTAAGTGT
GACCATTTTATTTAAATATCTGTAGTTCTTCTCCATGGAAGGGAGAAGAGGGATCAATGT
GTTACCCTCAGAGTGAAAGCATGTTTTTGACAGAACATTTTAAAGTCTCCGTAGGAGAAA
CTCACCTGCTCTATAGTTTTGTCCAGTTTATTTAGATCACTTTTGGTCATCAGGCCTTAG
TCTATGACCTATCCTTTAATCCCTGAAATGTAACTTTTTCTATTTCCTGTTACTGCTGGG
CTCTTTTTATTTTTAACGTATTTAAGTATATTTTAAATACCCAGAAAAGTATAAAAATAT
GGAACATCTGTGTGATAATTTAACATTAACAATTGGCCAAATTTTTGTTTGCTCTTTCTT
TTTAAAAGAAATAAAACATCTCAAATACTCCTGTTGCTTACTCTTTCCTATTTTATTCCC
CTCTATCATTTCCAAAGTAACCAGTATCCTTAGGTTGGGATTTATCATTGGACTACATAT
GTGTGTAGCCACTATGGTATATAGGATTATTTGTGGGTTTGGAGTTGTTTTCTCTAAACG
CCCTCTTTACCTGGCAACCTTGTTTCCCAACCCTGCCAAGCATTCCATGGAAAAGAGGCC
AGGGCAAGCTGAAGGCTCCCTGATGTTTCCTCTTTTCTTCTTCCTCCTCGACCCTTGCCT
TCTGTTACTCTATACCCATTCTTGCATGCACAGTGCCGTCTGACTCTACTTCCCCTCTCT
TTTTCTTCCTTCATTCTTGGTGCCCAGAATTAGGTCACTTTAATGTCCATTTCTGGCCTT
GAGTATCAATACAAACTCAGTTTTCCTCCACCCTTATTTGGGAACAGGGAAGATAATGTT
ATTAAAAACCTGAGGGGAAATGCAGTTTCAACTCTAGAAACACTACTGAGGGGAAAGGGG
GCAGAATTCTGTGTCCTGGAGAGTCAGATAATTTAACAAACAGATGGGAGCACATTTATT
GTTAGTTGTAGTGCTGAGAGCATTTGCCATCAAATAAATAGTAATTTTCTTTTACAAAAT
TAATTTGGTTAACAAAATTCTATTTATCCTATCTCACCTTAGGGTCTCTCTATAACAGAG
ATTTTTACATTTCCCTTTAAATTATCTATTATGAAGTTTACTATAAACAGGCCTTTCCCT
TCTTTCATTTATGTTATATTATTTGCCTTCCATGCGTAAACCATACTGTGAATGGAGATG
GATTGGGGCCATACTTTAGGGGTATACCAAATGATTACAGTAGATATTCAGGGCTCAATG
GAGTCCACAGTCTGGTTGGAAGACATATTTTTTTCAAATACTGGTAGTAAGGATATTTAT
TGAAAGCACCCAGGGTAGTGAGAGACAGTGGAAGATGCATGGTTCTGCTGAGCATCGCCT
CTGTAGGAATTCATTTTGTGGTATTTGAGGGAAAAGCAAAATCTTTAAATACATGTGCTT
GCAGTATTTTGAGGGATATATAGCTTAGAGATGAGTCTAGCCATCACAAGTCTTAATCCC
ATCATAAGGTAACAATTACTTTTCAGTTCTCCAAGTCACATATTCCATTATCCCTTTTTG
ACCACCCAGATCCAGATACACTTTTATGGGGCTGAGAGTAAGAATGGCGTGGAGTTGCCT
AACATCTTTATCAGCTGTGGTCAGAGTGTGTCTTTGGCCTTTCTAAATGCATCCCTGTGT
GGCCAATGCTGAGACTGTTCTTGGTTTCCTTTCCCAGGACATGTTTGGGAATTTAGGCCC
TTAATCTTATTTCCATCTGAAAACCTGAAAACTCCCACATTTGTTTTCTCTGCACAGAAC
ACAGAATTCCCTACCAGAACCCAACACTGTCTTCCTTTATTGATTCAATTAAATTATAAA
ACTACAAATAGCACATTAATGAAATACCCACTGTGTGCTCACTAGAGAAGTATTGGCGAA
TAGAGTAGGAGGAAAAATGACTTTATAGCTAGAAGTGAAGTTTTTGCAGGATCTTTAAAA
TCTGATAATTTTCCAGCTTACCATTAAGCCTCTTCTTGGCACATTTTTCTCCCTTACCGT
TTTCACTATTTAGATATGCAAACAACATCTTTCTATTATATCGTGATGGTAAATGCTTAG
AGATAACTTTTTTTTTTTTAAAGATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGT
TGTCTGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTTGTCCACTTCTGTTGTCGTCA
GCGGCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCACTTTCTTTCGCGCTGG
GCGGCTCTCCTCACGGGCGCACTCCTTGCGCGTGGGGCTCCCCCACGCGGGGGACACCCT
TGCGTGGCAGGGCACTCCTTGCGCGCATCAGCGCTGCGCATGGCCAGCTCCACACGGGTC
AAGGAGGCCCGGGGCTTGAACCACGGACCTCCCATATGGTAGACGGACGCCCTAACCACT
GGGCCAAAGTCCGTTTCCCTAGAGATAACTTTTAAACTTCTTTTACTATTCTGAGAAAAG
AGCCCAAACAGTAACACTTACATTCACAAATGCTAAAGAAGACCTATTCTTTAGTCCTTT
CTTTTTTCTTTTTTTAAAAAAGTTTACACTTTTACTTTTATATTAGGAAATGAAGTCCTT
CAGAGTTGTTGTTCCTAAACGACCATGAGAGACCTGATGAGTATACTGATGAAATGTCTG
TAGAAATAGCTTTAGAGTGAAAGTTTTATCTGGAAGTAAATTTTAAAAGTCTCTAAGTCC
GAAGCTTAATGTTTATACGTTTTGATAACCATAAACAGTGTTGAGATATACATAGTGATG
ACTGCCACCCCTTAAATTTTCCCAAATGATGTTTAATACTTTATGTTTTAGAAGATAGAG
ATTGATTGAATAAGTTCCATCCAGAGGTTTTCTTTTATTACCAAAAGCTACCAGAGTTTG
GTTAATTTGGTATTATTTGTCTATAACACAAGTTTTATAAATGTGTGGTGTTAGATATAT
GTACCTATTTTTTATGTTGAGGAGAAATAACATGTAAATGGTTGAGAGTCAATGGAGAGA
GATGGAAAGAAAAGAAAAAAGATTCTCGGTAGTCAGGAGCTAGAAGATTTCTCCTAGATT
TGCCACAAACTTTAGTCTGGTTCTAAGTTTTTGTGCGTTTTTCTGTTTTATTGTACTTCC
ATCTCTGTATAATGGCTCTTTTTAGTACCGTTATTTTCTGTTAAGGTAGTACTTATTATG
CATCTAATATGTGCCTTGTATCGTGCTAGCAGGGACATTACATGTCTCATCTCATTCAGT
CATCCATCCCCCTAGTAGGCAATAGTAATTCAGCCACTTCAAAATATGGACACACAACTC
TTCTCCAGCTCACTGTGCTGAGGCAGTGATTTCTAGTGCCTCAGCAGACTGGTGACTGTC
CATCACAAATTTTCTCACAGCCTACAGGAAATGAGAATAAATGGGACATGTTGTGAAATT
TCTCTCTCCCTCCTTTTTAAAAAATGTCATTCAGCTTATGAAATATTAGTGGCAGTAGAA
AGCTTTTGTATGTGTCCCTGCTTGTCAAAACAATACATTTGCATATTTTTGTTAGTCCTC
TCCTTCCCTCTTTGTTAGCCTTTTTTACATGTTTGTAGATGTAGAAGCCTCACAATACCT
GACTTAAAATACACTGTCTCAACCAAACCCTGTAAATGTGTACATGTCAATTTTAAGAGC
AAAGCTGGTAAAATATAAAGGGAAGGAAAGCATTCTTTAGATATTTAATAGATATTAAGC
ACTTGTTTAGAATTTAAATGTAATCTAATGCTAGTGCAGTTTTTTTTTTTAATTTAAAGA
TTTTTTTTAAATTTACTTCTTCTCCCCATCCTGTTCTCTGTGTTCATTCGCTGTGTGTTC
TTCTTTGTCCGCTTGTATTCTCACCTGGTGGCACTGGAGATCTGTGTCTCTTTCTGTCAC
ATCATCTTCCTGTGTTGGCTCTCCATGTGTGTGGCACCACTCTTGGGCAGGCTGCGGTTT
TGCGCAGGGTGGCTCTCCTTGCTCAGGGGCCACTCTTTGCACAGGGGCCACCCTTACACG
GGCATTCCTGCGTGGGCCGGCACTCCTTGTGCGCAGCAGCACTGTGAGTGGGCCAGGTCA
CCACACGAGCCAGGAGGCCCTGGGTATCAAACCCTTGGACCTCCTATATGGTAGGCGGAC
CCTCTATCTATTGAGCCACATCCGCTTTCCTAATGCTAGTGCAGTTTTATGTGTTGCAGC
TTCACTCTGGTTTGAGTCTCATCTTCATTGGGTTTTTACCCAATGTGAGTACGTAAGGTA
ATTTTTTGGCAGGAAATAATTTTCAAGGAATGTTCTTACTCTTTGCAATTTCTCATTCCC
CATCTTTTCCTAAAACCCTTATTCAAGAATAACCTTGATTTTTCAATTTTTGGTTTTCTT
TAACACTGATAGTGTTCTACTTTACTTTTCCCGTAGTGATACCAATGAAGTTGATATACC
ACCCAACACTCGAGTGGGCACAAAACGCTATATGCCTCCTGAAGTATTGGATGAAAGCTT
GAATCGCAATCACTTTCAGTCTTACATCATGGCGGACATGTACAGTTTTGGACTCATCCT
CTGGGAGGTTGCTAGGAGATGTGTATCAGGAGGTAAGTAAATTATATCTTTGAAAAGCCA
CAGTGAAAGCTATCACAAATCCTTTATCTTTGATCAGAAATCAAGGTTATCATATTGTCT
ACAAAATCAGATTTTCTTTTCTTTTCCCTTTGGTTTCTATTGTTGTCTAGTTACAGTCCT
CCTAGGAAATGATATTTCATAACTTAGAACCATCTTTGATTGACCCCTTCACTGACTACT
GGTGATTCTCTTCAGATCCACTGTCAGTTTCCTCTGCCTTTTCAAGAATCACCCTCTTCT
ACTATGTGCATTGTCTGGTTTCTTTCTTGGGCTCTTCCTCTAGCAGTTGCTCTTCAAATC
ATACCTTCCAGCCTCTCCTCACCACCTTGCTGGGTGCCACCTCAAACTCCAGTGCCCAGT
GGCCTGTGGCTTCCTCTGCACAGGCGACAGTAGAGACATAAAAAATGTGGGATGGGACAC
ACATTCTTTTGTTCCTGTATTTCTTTACTTTCTATAAGTCTACCTTGTACAGCCATTTGA
ACACATCCATTTTCATTAGAAGGAAATTAAAGCAAAGAATACTATTATCTTCCATGATAA
TTTTTTTTTCTAAAAACAAAAGAATTCCCTAGTGAGACCAATTATAGCAAATTAGAAGAC
ATCCTTCAATATCCAGAGGTATTATGATTTCTTGTACTGTTTTGATTACTGCCGCATAAT
ACAATTCAAATAGATTCTAATACCTTGCAGGTAAGGAGCTGACTCTTAGGCGCTTCTCTA
GCAAATACCCTTGATGTTTGCTTGAGCACATGATCATTCTCAGTGAGAAAGCTTGATACT
GCTGCCATTCTTCATAAAGGCCAGTTTGAGCTCACCTTCATGAACAAATGGACTTGACCA
GGATTCTGAAAGTGCATTGTACACTAAAGTGTGCTGGGACTTGTTCCTGGACCTGCCACT
TACTATCTGTGTGAGAGTTTGGACATTATTAGAATTTCCTTGATTTCAGTTTTCTCATAT
TTAGAACAAGGTTAATTATAGTATCTACCTCAGATGGTTGCTGTGAGGCATCAATGAGCG
TAAAGAGAATTAAATCTACCTGGCACATGGATAGCACTCAAAACATGTTAGCAATTTTTT
TTCCACTTTGGTTAGTAGAGCCTTTAACTTATATTTAGAGCCATATTTCAATACAAAGAA
GATACAGGTCTTAGCAGACTACAGCTTTGTAGAAATATCATTTTCAGTGCTGCCGTTTTT
TTCATTATCCTGGGAAATCAGAGCCTCTTGTAAGCAATTTAAAATAGAGCACATTCCGTC
TAAAGTAAGAGTAGTCTTTTGTACAAAAGGAAGGTAAATCTAGGAAATTTTGCCTAATCA
GATATTGAATAAATCTCTCACTAAAAGTATGAAAAAGGAAAAGAGTTACCAAAGTTGCCT
GTCCTAGATCTCATGCTTTTTAAAGAGTATGTGGGCCTACCTTTGAATAATATGCTTACC
CTTATATACTTAAGACAGGTTTACAGAAGAAGGAGTAGAGTACAAGTTTGCTTTTCTGAT
TTATATTTTCTTTTTTTTTAAAGATTTATTTATTTATTTCTCTCCCTTCCCCCGCCCTGC
CCCAGTTGTCTGTTCTCTGTGTCTATTTGCTGCGTCTTCTTTGTCTGCTTCTGTTGTTGT
CAGCAGCACTGGAATCTGTGTCTTTTTTTGTTGCATCATCTTGTTGTGTCAGCTCTCCAT
GTGTGCGGTGCCATTCCTGGGCAGGCTGAACTTTTCACACTGGGTGGCTCTCCTTATGGG
GTTTACTCCTTGCGCATGGAGCTCCCCTATGCGGGGACATCCCTGCATGGCAGGGCACTC
CTTGCACGCATCAGCACTGCACGTGGGCCAGCTCCATGTGGGTCAAGGAGGCCCAGGGTT
TGAACTGTGGACCTCCCATGTGGTAGGAGGACGCCCTAACCACTGGGCCAAGTCCACTTC
CCTATATTTTCTTAAGCATCTAAAAAAATTGGGCTATGAAAGCCGGTATTTAAAAGTCTT
TGGGCCTGGATATAGGAAAAAGGATTTTTATGTAAACATCAAGCTATTAATCTCATTGCT
AGGGCTGTCCTTGCCTATGGAGATTGGGGAGTACCAGAATGTTTCCTTATTCCTGTGTGA
AGTTAACATTCATGAATTGAGTCCCAGTTCAACTCCATATGAACCTTTGGCCAGTGATTC
TTAAGCCTCAGAGCCATGTTCCTCCATTTTGTAGAGTGTGGATATTAATGCCCTCTTATA
AAAGTGTTTGTGAGAGTTTAATAAATTAGAGCATCCCTATCTCCATACCTGGAGATCATC
AACTCTCAACAAATTAGTTTCTTTTCTCTTTCCAGAGAGGCAAGGCGTACAAATTTCTAT
CCCTGATACTTTCCTTTATGAACATACTGAAAGTTTCTGGGCTTGTCTCAAGCTTAGATA
CTTTGGGTGGAGCAGACACATCCAGATACAGGTCATTCAAACATTGGAAGGAAAAAAGAA
AGAAAAATTTTGAGGTTTTCAGGCACAATATTAAATGTCCATGAAAATGGAAAATGTTGA
TAACTTGGTTGAATGATGAGAAAGGAGGAAGGTCTATAGTTCAAAGCCAAACTTTAATTA
ATTCATTCATAATTAGATATTACCCCAGTCTGTGTTTCTTATAGTATCTACATCTATCCC
ACCATCCATTCATCAATCCATCCAGGTAATGGCACCAACATTAGACACTAAGGATAAAAA
TGACATGAATTAGATAAACATGGTTATTGTTCCCAAGATGGTTCCAGAGTGATTGGCTTG
AGAATTAGTAAGGAAGAAGGAACTGAAATGAAGTGAGCATTCCCTGTGTACCAGGCTCCA
ATACTTATGTTTATCTTGTATAGAGATGAAACACAGACAAAGGAAATATTAGCATAGATA
ATACACATAATAATGCTCTAGGGACTCAGTGAGCGCTAAAATTAGTGGTGAGTTAAAATG
ATATGAGGCAGTTTGGCATCTCCTGAAAACTTTTTGATTCTATGTAGGTTTGAGTTTACC
AGAAAGGGTAAAATTCAGACACTGGATTTTGTCAGAGTAAACCTCCAGTGAATTTCATGA
TGCACTGTATAATGTGCCAATCTGGAGAATTCATCTTGGTCAGGGAAAAAGCCATGGCAT
TTCTATAAAAGATGATTTACCCTTTCTTTAAACAATTTATTTATTTTTCCTAATAGTAAT
GTATTTTTTTTGTAGAAAATTTGAATAATTATAGAAGCCTTTAAGAAGAAAATAATATTA
GCACCTAAAAACCATTGTTAATATTTTGGAGTGTATGTATTTTCCAAATTTTGAATGTAC
AAAAAAATATTCTTATGATTTAAGCAGAAAAATGTAAATCTGACATTTTGTTGAAGTAGG
ATACACTGCCAAATTTATTATGAGAGCCATAATCTCCTATTACAGTAATAGAAACAGTTA
CATATTTTGCAGTCTATGTTTGGATGTGCCTGCCAAATTTGCACTGAGATTTAATACAGA
TTTTTTTTAAAATTTGGCATATAAGAGACTTTATAAAATTGATAATTAAGTTGAGATGTT
TGCTTTACCTAGCTATCAGAAATTAGAAAAAAGCCTGAAGACCTCCTATTATTTCCCATT
AGGCTTTCTATTCACTTTTTATTTCTTTTTATTTTTCTATCCACTTTTTAAATATAAGAT
TAAGTGCTACTTGGGCAAACTTTTTTCAAAATGTGTTTTGCTTTTTCCAGACTGAACTGG
TCTTTAATACTGTTAGCACCCTTCTTGGAAACTAGTTTGCATGCGTTTCAGACTTTTATT
TCCATTTGATAAGAAATACTAATAATAGTAATAATGACAACATGTTTTCAGGTATAGTAG
AGGAATACCAGCTCCCCTATCATGACCTGGTGCCCAGTGATCCTTCCTACGAGGACATGA
GAGAGATTGTGTGCATCAAGAAGCTGCGTCCCTCATTCCCCAACCGGTGGAGTAGTGATG
AGGTGAGGCTTGAGGTCACTGTGTGACAGCGACTGTCTTCTAAACATTTCTTCTTTTGCC
AAATTACAAAGATTCATTACAGGAATTCTTTTTCCCTGTGTTTTGATGGTGATGACAATT
ATTGCAATAATTTATATGGAGTGTGTTAAATTATCTGCTCCTTTTTTTTTCAAATTTAAT
TTTTAATAGACTTTATTTTAGAGCAATTGTGGGTTTACATTGTACAATGTAAATTATAAT
CCATGCAGTGCAGCAGTGCTCCAAAAGTATTCACCAAATGCAATGAATGTGCCACAAGGA
TGAAAGAGGTTGTTGATGTAGGTGGAGTGGGTGGAGTGTGGTGTGGGGTATATGGGAACC
TCTTATATTTTTAATGTAACATGTTTTGTGGTCTATGTATCTTCAAAAAAAATACAATAA
AAAGTTAAAAAAAAAAGAGTTAATGGATAAAAATGTGGGGGGGAAGGAATGAGATGTATA
GGAATCCCCCTATATTTTTAATGTATCATTTATGTCATCTAAAGCTTCTTTAAAATAAAA
TAAAATAATCTTGTTAATTATAAAAAAAAATTGTGGATTTATACAAAAATTGCAGAGTTC
CTATATACTCTTTCTCTGGCCTCCCCGCCCCACACAGTTCCCTATTACTCATACTTTGCT
AAATTAATATGGTATATTTGTTACAATGAACGAAGCAAATTTGATACATTATTATTAACT
AAAGTTCGTAGTTTACATCAGGGTTCACTCTCTGTGTTGTCTTTTCAATGTATTTTGCTT
CTTCTAAACTATATACATGCCCATATACAACATCCTGTCATTTTAATGAGAGAAAAGATA
GGCATCTGAAGAATTAAAATTTCTATATACAGAAATGCTACAATTCAGCTGAGTTGGGAT
GCCTGCCTCTGCGTTATCTTTAAGTAAGGGTGATGAGATGCAATTTGAACAAATGACTAT
TCTGCTTGGCCATAAGGATGTGGTAGTGAAACTAAGGTCTGTAAAGGAGCTGCTGCTTTT
TTGACCTGGCCTCCTCCCACCCTGTATTTCTCCCCATCCACCTTCTTAGCCTTCCAATTC
ACCCCAGTCCTGGAGTGGACTGGCAGACTAGAACATTCAGAGATGGGTTTGAGGCACACC
CAGAAAAAAAAAAGATTCCTATCAAATCTTATCAAACATATGCAAAGCCAATGCAAACAA
ATGAACAGAGGACTATTTGTAAACTAATTCTTCAGTGTAAAATACAGTTAAAATACAACC
TTTGATTCCTTAGTGTTGGGAAAGTTACTGAAATGCTAATACATATATTTTCCAAAGAGC
TGGGCTGAAATCTTTGCGAGATGTTGCAGTTATATTATTTTGAAGGTGGTTTGGGGCATT
GGTATTACTTGAAATTTCTTCACTGAGCAATTCTAATGAGGTGAATTAGCACTATTCAAC
AGAAAGAGTAATAATTGATGTGCCACATGAGAAAGTTTTAGCATTGCTATGCACAGGTCA
TTAATCTTGTTAAATGGTATAGTATGATGCTGTTATTGTAGCAGACAGTTGTGATTTAGG
AATAACCATATTTATACATATAAGTCCTTATGGAATTGGATAAAAGATTTAAACTTATCA
AGTGTTGTAAACAAACGGGAGTGTGGAATGGAATACTGCTTCCCTCGGTGTTTTTGTGTT
TGTTTAATACTGACTTACAAAGAATCCTTCTGTAATCAGCAGAACCACCTGCTTGCTCCT
TTCTCAAGGAGGACATGAAAATCTGTCATATATAATTTTGCATGAAAAAGGAGTTTTTAT
GAAATTTATGTCGCATGGTTTTTAAGGTTATCTGTTAAAAACGATGTTCAAACTTAAAAA
ACCAAATTAAAAGCCAAATATCGTATCAGCCTTGCAGCGAATACATTTCTCTAATGTTGT
TCCAATTTCCTTTTCTCTTCCCATAGTGTCTAAGGCAGATGGGGAAACTCATGACAGAAT
GCTGGGCTCATAATCCTGCTTCGAGGCTGACAGCCCTCCGTGTTAAGAAAACACTTGCAA
AGATGTCAGAGTCCCAGGACATTAAACTCTGACTTGAGGGGAAAAGTAAACATTTCCTTA
CAAAAGCCAATAGCTATTTTTCTGTTGGTGGGCAGAGCAAAAGATGTTAAAGAAGCATCC
ATAGTGCAAGCCTTGAACATCGTCCTGCTTCCCAGTGGGTTCAGACCTCAGCTCTCAGGG
AGAGCCCTGGACAGAGCGCATTCCCCGAAACCCAGATCCACCCACGTCTGCTTATAGGAG
GGAGAAACCGCTTGGGTAACTTGTTCAAGATATGATGCATGTTGCTTTCTAAGAAAGCCT
TGTATTTTAGGATTGCCTTTTCGTTTTTTAATTTTAAGATGCTTTAAAATTTGCCAAAAT
AAAACAAATAATTTAGATGTTTTAAGGTTTATACTGTTATAGTTAAATAATAACAAAAAA
AGTTCTTCCCAGAAACCCTGCTGGACGGTAAATTATGAAAATATGGGTTTTTTCTATTGG
TAAAATATCATTGCACTCTTCAAACCAAAAGACAGTCTGTGAAGGTGGAGAACAGGATGG
AACTCATCTTAACAGTCCCTTGGCTGCCTCCTCAGACCACGGAATCCAGCCTGCGTTGGG
GGCGGCCGCTGCAATGTGAATGTACCTGGGTACAAATGCCACCTGTCTGAGGCCGTATTT
TGGAATTCCTGCCGGTGGCCTTTTGCAGCTTCAGCCACTGTGGAACAAATGAAGGTTTTG
TGTGACTCTGATAGAAGTAAATGTTGATGCTGTTCTTTACAGAAGCATTTTGTGTTTCTA
ATTTTCTGTTAGGCATTTCTTTCATGGTGAAATCCCTTCCTTTTCATTAAACGCAAACAA
AGCTATGTTTATGTGCTTAAAGCACTGACGTGCATATTTTTGGTCTCTCAAATGAAAGGA
TCAATTTTACATAAAATTGCCATCAGTTGTGTTTAAGACAAGATGCTTTAAAATAGAGAT
AATTTGCTCTTGTGTTATAGGAAGGACATGCCTACAAGGTAGGGGGTGAGGGAGGGGTGC
AGAGAGCATGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1069..1144, 83842..83944, 84451..84553, 96839..96935, 104258..104396, 113183..113375, 113785..114082, 127896..128071, 131931..132061, 134006..134131
1001..1067, 1069..1144, 83842..83944, 84451..84553, 96839..96935, 104258..104396, 113183..113375, 113785..114082, 127896..128071, 131931..132061, 134006..134128
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved