Dasypus_novemcinctus Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus GTF2A1
Dasypus_novemcinctus
GTF2A1
GeneScaffold_5496
SNORA79
8302..8445
50463
GGGTCCAAATGAGATTTAATTCTCTTTGGAAACACACAAATAGGCGAGCGAAAGGTCCA
ACCTCGACGAGAACCGTGAACGCCGAACCCAGCACTTGAAACTCTGCCCGGGGACCCAGC
GCGCCACGGGCCAGAAGTTGGGCCACGTGACCCGGCCTCCTCTGCGGCCATTCCTAGCGA
GGCAGCTGCCACCTCCTGGTCCACATTCCCTAGCTCCTCCAGGGCGGGAAAGCACGTAGA
CGTCTACCGGGAGGCGGTCCCTCAAGTGTCACCAGAGCTCGGGCTTTTTCCCAGCACTGT
CTTTTGCAGCTTCTCGTCCAAAGAAGCTGTCGAGACTTCCGCCTAGGTGCCAATCACGTG
AACACGCGACATTTGCGATGGCGGCACTTCATTACTCCAGTTCCCGGGCTCCACCCGCCC
AGCACTCCACACGTCGCGTGACAACGCGGCCCGCAGCGACCTCCGCCCCGGCGCGCCTGC
GCAGGCGGCTCTCGCGGTGTCTCGAGCTCAGCCCCGCCCACCTCCGCCCCCGCCCTTTCC
GCCCCTCCCTCCCCCTCCGCCCTGTCTCTCGGCGGCAGCGGCGGTGGCGGCGGCTCGCGC
AGCTTGTTGGCTCGCTATATATAGGGGAGAAGCGGGCGGACGGACGGCTGGAGCTGCAGC
CGGTGGCGGCAGCGGCGGTGCGGGGAGCGGCAGCCGGTGGTGGTTTCCCTCCTTCGCGCG
GGGTGGGGAGCGGGCAACGCCCCCAGACCCCTGAAGGGTCGTGGCTTTTTCTTTTTTTTA
AAGGCGATTCTCGAGGTTTTTAGCTCCGGGAAGAGTGCCCCCTCCTCCTCCTCCTCCTCT
CACCGCTCCCCTGTCTACTCTTTCAGGATTCGATTTTGTTTAAAATTTTTCCATCATCTT
GCGGTGCCTTGGGTCACCCACCGGGTGTTTTTTTTTTTTTTGGTTTTGTTTTGATTTTGT
TTTCTCAGGGTTCCCCCCTCTTGTTTGTGTTGTGTGTGGAAATGGCGAACTCGGCAAATA
CAAACACCGTGGTAAGGACGTGGTTCGGTGGCCGGCGGGGGCTTCGTTCCGGCGGCACCA
ACGGCCGGAGCGGGCGGGGGCGGGGACGGCGGCGACACCGGCCTCGATACGCTCCTCAGC
CGCCCGCGCGGCCGCCGCCGCCGCTTCCCGCCTTGGGCGGACCGGGCCGGGCGGCGGGAG
GGGGGCTCCGAGGGCTCGCGGCGGCGGCGGGGCGGGCGGCGGCGGCGGCGGGGCCTGGGC
TGCCGCGGGGAGGGCCGGGCCGCGGAGGCGGTTGGGCCGGGGCGGAGGGAGGGAGCGGAG
CCTCCGCTTCCCCCCGAAGCGGGCCGGGCCGCTCTGGTTCGAGAGTGGCTCCCTGAGCAG
CCTCCAAACAAAAACCTTGTCTGGGGAATTGGGCGAATCCCCAAGACCCACTGTGACCCG
CTTGAATGCGGTGGGAAGGTTAATGGCTACTTTGGGGGTGGGTTGGGGGGGTTACTATCG
GGTGTTCCTGGCCTCTGTGCTTAGAGAAACCTGCACTGCGACCATTTTGTACTTTTAAAA
CAATTTTTTATTTTTTTATTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTATCCTTTCAACTGAAGGTGTAGAGGCAA
CAATTTAGCTATTATTTAAAATTAAATCTCACTTTATTGTGATTAAATATGTCTTAGAAT
GTTTAGGTATCGGGGCTGTTTTTCTAGAGTTTGGAATAATCTGCCCTTGTGAAGGAAAGA
ACAATATGTAGTTTAAGTGAGACAAGGAAAGGTTTATTTTGAGTGAAATATAAGGGTTAC
TAAAAGTGAAGAATAGGTATTCTAAAAACACAAGTGAAAGAATGCTAACTCTCAGGTATA
AATTGGGGAGAATAGCAATATAAATTGCTCAAACAGCATAATGTAACTTATAGATATGAG
TAACAAGAGAACAAACTTAATATGATTCCTTAGTGTTATGTGGAATGAATATTTTTGCAA
TTTATGATAAATCTTATGCTTTTCCTTGTAGTTTTGTCAACTTATTTAGGAGATTCAATA
TGTTTAGGTGTAGAAAATAAGGCCCAGAGTAATTTGCCTTGGGTCAAACCATAGTCAACC
CATGTTGTTGATTATGTACTCTGCTTTTCACAGGGGAAGTCTGGAGAATTCTTGTCTTTC
TTACTGGCCCCAGCAGAAACAAGGCATTCTCTCCAAAGAGAATGAACTATCTTTAAGACC
AAATAGCTCTACCCACTATTTTTGTTTTATTAGACTTTTTAGAATTTACATATGTATTTT
GTGGTTGTGGCAGTGATTTTTAGTCTAAAGGTTAGTTTTGTAGGGATAAAAACAGTACCT
TATTCAGCTTTGAATCTTTGGCTTCTACCACAATATGTGACGGGGTTGGCATTCAGTAAA
TATTTAATTGAACTGGTTAATAACGTGTGTTTCCACAATCTAACTGAGCAAGATTGTTGA
ACTTCTTTTTGTTTGTTTCTTTAATAGGTCATAATCTTCTATCCTGGGTTATAACTGGAG
TTAAAAATAAAACTGTGAGACTAAAATCAATTTCTTTTAATTCTCTGTACTACATTTTTT
CAGAATATCATTAGCATTTCTAGAACATGCCCTAGTTTTTACAGTTGGACAACTAGCACT
GTTCTTGAACTTTCTGGGATGATGGAACTATTCTGTATCCGTGTTGTCCAGTTTTATAGC
CACATGAGGGGCTATTAAACACTTGAAAGTAGCTAGATGAACCGTAGAACTGAATTTCCA
ATTTTATTTAATTTCAATTAATTTAAATCTCCACATGTGGCTACCAGCTACTATATAGGG
ACCATAAGGTATAGCCGTTCTTGGTAATCAAAGCTCACATTAATTTTACCTTTTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTAAAAGCAAGAAATAAAAAAAAA
GCAAGATATAAAACATTAACTCTGTTTTCAATAAAGAAAAGAAGGTGAAAAGAGTGTTCT
CAATTGGAAATAAATCTGAAATTCAGTAATCTGCTTGTAGATTGATTTTCTCAACCACTG
CACTATTGACATTTTTGACCAGATAATCCTTTGTTGTGGGGACTGTTCTGTTCATAGTAG
CTTATTAGGAGCATCCCTGGCCTCTACCCACTAGATAACAGTAGCAGCCCTCAGTGGTAA
CTACTAAAAATGTCTCCAAATGTTGCCACATATCCCCTGGACAGCATACTTATCCCCAAT
TGAGAACCACTGCTCTACATAGTCTAGATATTTGGATTATAAAGAATAGTCTGAGATACA
GATGTGAGACATGTATTCAGGAAAGTACAGTGTTTGGTACTGCTAGAAAATAGGGTACAA
GTTATAGTGGCAATAGGTAAGGTAATATGCCATACATATTAAGGAGCTTTGTCTTTAGGT
ATGGTGCCAGTTAATGGGTTAACGATCCACTAACCTGCAGTTTGCATTGAAAAGCATTAG
TTTAGACTTTAGAGCAGGTGTTCTCAAACTTTAGCATGTTTTAGAATGACCTGTATAGCT
TGTTAACACAAATTGTTTGGCTCCATTCCCAGAGTTGCTGATTCAGTAAATCTGGGGTGG
GGGCCTGAGAGTTTCCAGATGCTGATAGTTCTGGGACCCTCATGTTGAGGACCACTATTT
ATAGAGGATAGATTGGAAGGATAAGTTTCCACTGGAATTTAGACTCTATGAAGATAAGGG
ATTTTTGTTGGTTCACTGTCTGTTCTCAGTGTCTCTTAAGAGCCTCTGGCATATAGAAGA
CATCCAATAATTTGTAGAAAGTATGGGGGTTGTTGAGGGAGATCAATTACTACACTTTGC
AGGACTGATTGGAGGAAAGGAGTTAATTTAGGGCCATAATACTAGGGATAGATTGGAAAA
ATGCTTTGACAAGGAAATTGACAATGATGGTGGGGTATTGGGATGGATTCTCCTAAGGTC
ATTGATTAGGAAGCTAAATTTTGTTATGTTTTGTTTTGGAAGGGGGAAAGAGATATAGAA
TATTAGGGTGATAGTAGAGTGTTTAATATCAGCTAGAAGTGAATTTAGAGGTACTCTAAT
TCAGTTTAGCATTTTAAGATGAGGAAAATGCTTAAGAAAGATAAGTAATTTGGCCAACCT
CAAAGCTATTTAGTGGCCAAAACCAGAATAAATGTTTTCCTAACTTCTGGTAAAATGCTT
TATTTATTTATTTATCTTTTTAAAGATTTACTTTTTAATTATTTCCCTCCCTTTTCCCGT
GCCCCCCCCCTCAATATCATCTGCTCTCTGTGTCCATTCGCTGTGTGTTCTTCTGTGTCT
ACTTGCATTCTTGTCAGGAGGCACCAGGAATCTGTGTCGTTTTTTGTTGTGTCATCTTGC
TGCATCAGCTCTCTGTGTGTGCGGCACCACTCCTGGGTGAGCTATGCTTATTTTTGCGCG
GGGCTGCTCTCCTTGCAGAGTGTACTCCTTGCGTGTGGGGCACCCCTACACGGGGGGCAT
CCCTGCATGGCATGGCACTCCTTAGGTGCAGCAGCACTGCACATGGGCCAGCTCATCACA
CAGGCCAGGAGGCCCTGAGTACCGAGCCCTGGACCTCCTGTATGGTAGGCGGACACTCTT
GTGAGTTGAGCCACATCCGCTTCCCAAAATGCTTTATTACACAATTAAAACCACCGCCAC
CAATAATAATAACTAACCTTTATTGAGCACTTTATGCTCATCTTCTGTGATAAATGTTTT
ACATGATTATTTATTCAATCCTTATAGCAACCCCATGAGATATTGTTTGGAAGCTTTATA
TATTGGGCTTGCCAGGAGGATGGTTCCCCTGGGAAATTCACCTTTAGTTTACTTTTTCAG
TAAGCTGTCAGACATGTGCTGGACTTATTACTTGCATGTAAATACAATGCTAGTGTTTCT
AGACTGGTTGGAGGGATAAAAAAAAGGTAAAAATCCATATAAATATGACAAAGGGAGCTT
CCTGAAGGAGCTGATAGAAACTTCAGGTGAATTAGGCATTATCCCAAGAGCAGATCCTGG
AGAAGAAATAAAAAGCCTGAGTGTGTGTGTGCTGTGTGCTCTTAATGGTGGTGTATTTGT
ATACAAAATTACTAATTTAAGTTTCATTTGTATTCTCAAGGAATACTTTGTGACTTTCTT
GGGCAGATTCTTATTTGGTTGAGGCTCTAGATCAAACACCCAACCTGGTAAAGAGGAAAT
GGATTAAGGAGGGTGGAATATTTGTAGATATTTTCTTTTCATTGCTGGCTTTTTTCTATC
ATAGAACCTATCCTAGGGTGAGATGAGAAAAATGGAACTGGTTAAGCAGAAAAGGGGTAT
TGTTAGCTCTTGTCACACTGAAAGAAGGAAAGAAATAACAAGAAATGTAGAAAGCTGGGA
GAACCTCTGAGACCATCAGACATTGCTGTTTTTCTTTACGTAGGCTTGAACAGATGAAAT
GTTGGGCTTATGTAACATGGGGGATTGCCTTTATAATGTTTCTCATTGTTCTCATCAAGA
AAGGATGAATTTATGTTCTGTTTATTTAAATAACATAAAATTCTGTGTTAAGGAAAAATT
TCCATAAAACCTTTAATAAAAGGTTTTGATATTCAAAAGGATATTCTTTGATTACTAAAT
ATTTGCCTATGTGAAAATCTTTGGTAAATTCATGTTCACTATTGTTAACACTTGGGTAAG
AATTAGAGATTAGCTGATTTTTGTAGCTGTATCAGTTTTGAAAAATGAAAGAATTTTATA
AACAGAAATACTGATAATAAGCAAAATATGTTTTACCCATATCCCCAGAGTCATTGTCAC
TTAGGCATCTTTAATGTTCTTTACCTTAGTTATGGGAGAATAAGCTAATGCAGTCTAGGG
CAGTAGATGGATTTAATTCAGAAGAGCAGCAGCTTTTATTGCAAGTCCAGCAGCAGCATC
AACCCCAGCAGCAGCAGCATCACCATCACCACCACCATCAGCAAGCTCAACCACAGCAAA
CAGTACCGCAGCAAGCTCAGACCCAGCAGGTACTTATTCCTGCATCCCAGCAAGGTGAGA
CAGGATTTGTTTTCCTACTTACAACTTAGAAATGGAATCTGTCCTTTTGAAAGAAAAGAA
ATACTGATGTTGGCAGTCTGAAAATTCAATCCTGTAGTTTGTTTTTTAAAAAAAAATTTT
TTATAGTGGCAGATGTATAATTATCATTTATTTCATATCTAACAGTAAAATTTTAATTCT
GAATTCAGATGTTACTATAAAGATTATAATTGTTTTATGGTTAATTTACAATATCAACAA
ATAATTGTAAGAAAAAACAACTTACTGAATAAAGAACATTTAATGATGATATGGTTCTAG
GGAGGAAAGAATCTTTAACAGGCTTTAGCTGTATTAAAGTGCTTTCTTGGGAGGGAGCTG
ATGTGGTTCATTGGTTGAGTGCAGGCTTCCTACGTACTAGATCCCAGGTTCAATCCCTGA
CCCTAGTACCACACACACACAAAACAAATTTCTCTTGGGACTATTTAAAGGTTTTTACAA
TTTTGCTTAAGCACAGTCATTACAAAGGTAAAGCAGAGGATATATTTTCCTTATTAAAGC
ATAATTTTGAATATCTAAACAAGTCATAAGTTCCATACCATAGTCATAAGTTCCATTACT
TTCAAAAGCCTGCACATATTCATTGTTAGTTGTTGAAAAGCAGTAAATCTTGAATTTATC
ACAGAAAAGAAAGTGGTAGCAAGATACGGTACTTAATAAAATGCTCTAACCTGTAGTCTA
GATGATAAATGCTTGTAACTCTGTTGATTTTTCTGAAACAACTGAGTAATGCCCTTATTA
GCAAATGAAGCCCATTGGAGTCCTGTATCTGGAAGAGAAGACCTTGCAACCTTTTCTTTA
ATTTCCCCTTCTGCTTCGTTATGACTTGCATACCCTGACCACATTTAGCTGTGGGCTGTG
TTTTAATATTATCTGAAGGATGATGCAATCTTGAGTCCTTCAGGGCTGGTGTGGTAGTTT
CACACCCCCTGTAGTAGACACATGCTACCTGCTACAGAGCCTCAGAGTGCCCCCCGCACC
ACCCACTTGACTCCAATCCCACGGTAATTTATCTAAGTCTAAAGTGGACCAAATTAGGTT
TCTTTAAGTAAAGAGTGGATATGTAACATATCTTAATTTATATAACATGGTTTACAGGTA
AGAAAAAAATTGTATCCATTTTACATTGTGCTCCTCAGGACATATTATAGATAGTATTTC
ATTCAAGCCTTATAATCTGTTTTGATGACTCTTCCTCCTATTGCCTTCAGGCCTGGCAGT
AGGATTTTAGGTCATCATAAATTAAAATTTGATTTTCTTCACTCAGAGAATATTAGGATA
ATGGGATTATCTATCTGTTCTCTGAAATTTGCGGAATCAAACACATAGCTCCTTTTGCCT
TTAGCAGAATTATCATAATTTCTGTTTTTTTTCCTCTGTCAGTTGAGAAAAAGATTATGT
AGATAAAAACCAAAAAACTAGTTATAACTTTTTGAGCTAACTCTCAACTCATTCTAGCAG
TGGTATCATCAAAACAGTTAATGCTGAGTTACTGGATAAGATTAACTTGTTTGAAATTTT
CCAGTGTATTTAAGATTGTATAGAAATATATATGTCTAGGTGTTAAAGTCCTGCAGTGTG
TAACGAGTGAACTTAATGTGTTTCAGAGTTCACTTGTATACTTAGATATTGTCACTCAAA
TCTTTATTCATTGATGTTTTCAAGTACAAGTTTGGGTATATTACAGCTGTTATTTGCCAT
AGGAACTTAAAATGTTCTAAGATCAAAGTTTTGGGTGCATTTCATTGCAGAAAGTGTAGA
AACATGAAAAAAGTTTTCAGTATTGTATACTGTTCTTGTGATTATGGAAGAGCTTCATGG
TTCATTATTTGTGTGTGTATTTGTGTTTTTTTGTAGCTGCAGCACCACAAGTTATTGTTC
CTGATTCTAAGCTGCTACAACATATGAATGCATCAAATATGGTAAGACTCAGAGGTTAAC
ACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTATTTAGTT
TACCGAACATTATATATAACAGCAAATGTAAGGTTCAGTTTAGCATGATACTCATACATT
GTGGTTCATAAAGTTATGCAATTTTCTGTTGAAAATACCCAAAAGAATTTGATGCTGTGT
GGGAGCCAATTCATCTTCTCCTGTTTTGAGAAGGGGTATGGTATAGAGTGGCAAGTATAG
TTCTGTTTTAAAAGATCCATTTTAAGAGGTTTTGAAAATAAAAACGAACTGTTTGGATAG
ATTAAGATAGCTATTTTTAAGATTCAATTTTTTAAAAATTTTGGTCTTCTTTAACCATTG
TGTAGCAAAAAGTTTTATTACAATATGTAAATTGGTACCTTAAAATGCATTTTAACCAGT
TGAGTTTATTATAAATTTGACTTCTGGTATTTCTGAGGGCTAAAGTAAAACTGTAAATTG
AAATAATCCCTTCAGGTCATTAGAAAATATTTATCTATTTGGCTGAATTTTTAAATAAAA
CATTAAAACAAAGACTGGAGTATTTAAAGGTAAAAATCATTATTTTTAAAAAGGTCTCAG
CATACTCGCAATGAACTTTCTTATTTTTCAGGTCCAGTTTTGTTGTTTTTGTTTTTTGTT
TTTTGTTTTTTTTTTACCTAAAGGCAGTGTTTTAAAAAATCACTTCAGCTGCGTGAGTGA
CAAGTAGTGAACCATAAGCTCATTTGCAATTTTTAAGCCAGACAGGAAGTAAGGCTCACT
TGTAGATAGATGACTTCCTTCTATACCTATCAGCCTCACAAATTCATACCTTGGAACAAT
TGCAAATTTCTACATGAGCTTTGCATTAACTAGACAATTAGTAGAAATTGCAATTTTAAA
ATTCACAAATATCAAGGATTTCTATTTGTACCTCTAGTTCAAGCGATTGGAATAATTTCT
TTTGCATGTCAAATCACAAATTCCAAGCTTATTTCTCATTTTTTATTATTTAAAAAATTT
CCCTTTAAGTCTAAGGCCTAAAATTTCATTTTAACACCTGCCTTTTTTTAAAAAAGTATC
ACCTTAAGATCCATATTGTAGTTTTGTTTATTAAGATAGTTTCCCAGGGAATAATTTGCA
TTATTTTAAAACAGGAATTTTGTTAAACTCTTACGCAGTAGGCCCATCTATTTTTCAAAG
AATTTTAAATGTTGTAAAAAACAGTTCTAAATTAAAATTGTTTTGAGACTGGGGCACAAT
CAGTGGCCCATTGCTTACTGATTGGTTAGATCTCATTGGTTCTAAATAGCATGTGTATTT
AAACAGATCAGAAGTCAGAAGCTTCATTTAATTAACGTTTTAACATTTATAAATATTTTT
AACATTTTACTTTGATGTTTTCAGTCAGGGTTTCCTTTATGCATTTTACATTTTTTGAAA
CATAACCAAGATAGGCTTTTTTTTAAGATTTTTTATTTATTTTTCCCCCCCCCCCCCCCC
AAATTGTCTGCTCTGTGTGTGTTCTTCTTTGTCCGCTTATGTTCTTGCTGGCAGCACTGG
GAATCTGTGTCTCTTTTTTGATGCGTCATCTTGCTGCGTCAGTTCTCCATGTGTGCAGCC
CCACTCCTGGGCAGGCTGCACTTGTCCCCTCCTTCCCCCCACAGGGTGGCTCTCCTTACA
GGATGCACTCCTTGCACATGGGGCTCCCCTACACGGGGGACACCCCTGCGTGCACAGCAC
TCCTTGCGTGCATCAGCACTGCGCCTAGGCCAGCTTACCACACAGGTCAGGAGGCCCTGG
GTTTGAATCCTGAACCTCCTATGTGGTAGGCACATGCTCTTATCAGTTGAGTCAAATCCA
CTTCCCCCAAGATAGGCTTTTTATCAATAAAAGCTTTTTGGGTTTTTGTTTGTGTTATTC
TGGATTCAAAGACAACCGTTAAAATAGGTTTGATTTTTCTGATGGCTCTGTATGCTTTGG
AGATGAACATATTGAAAAATCATATAATCTTATGAAAATGTGAGGTAGTAATAATATAGT
ATTAGGTAGAAGGCTATTTCAGGGAACTTATAGAATAGGACATTATATCAGACCGGGTTT
TCAGTTTCTCCTTATGAAATGATTGGTGTAATACATTATTCATGACTCAGTTATTTCAAA
AATTACTAGAAAAAAGTTTTCAGTAGTTATTAAATAAGGGATGGTCTGGGTAATGGTATT
TCACTCATCAAATATTTATGGAGCAACCTGAATGTGTGGAAGATATGCAGGTGGTTATTG
CACCATGAATGCCATATAAAAACTATGTCAGTTTACCAGTAGAGGGAGATCTATTATCTT
ATAAAATATGAATTATATTTTATATTCCTAAATAATATTTCTCAGAAGTAACTGATTATT
GTGTTCCTTAAATTTAGATTACCTTTCATTTGCCTAGGGAGACAAGATTTATTTTAAATT
AGACAGTTGGATACACAACTTAAAGATGGATGAATCTGGTGGACTCTAGCTGGATTCTGG
GGGAAAAAGTGGGAATTTCAAGGTCAAGATGTAGAAATTACTTAGACCGATCAAATGGCA
ACATGAAGCATATCTTCTTAAAAAGCTATACTTAGAGTTCAGAGTAAATAGTAATTATAT
CATTAATCTACTTTAGTATTCCAGGTTTCATTGACTTCCTTGGCATTAGCATCTTCAAAG
CAGTTATAGTTCCCTAATCTTACCCAGACGTGAACATTTCTAAATATTTACCTGTTTGAC
TGAATATGTGAAAGCTTGATACCTAAAGAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTAAAGTATTTTCATTATTACCTTAATAATAATAATAATAAACAGAGG
AACAGGCAAACAAGAAAATTCCTCACCTCTCAATTCCTCTATGCTTCCCCCGCTGTACAT
AGCTGCTGTTTCTTGCTATTATAGCCAAAGTGTATAATCAATGCACACTGCCACTTTTAA
TTTATTATTCACTGACATTGGCATAGGCATAATATAATTTATTTTTTCTATCTAATAGGA
GTTATATCAATTGCCTATTTGATAAAATAGAAAGAGGATCCCTTCGCAATTTTTCACCAC
TACAAAATCATCCTACATTTTTCTAGTTTTATGAAAACTAGAAATACAATTTTAAATACA
ATTATAATGCTTAACAGAAATGTTTTGATTATTGAGAATCTCATCTGAAATGACTGCTCT
TGCCAAATTCAATAACTGTTATTTGTAACATACACAGAAAACTCAGAAATCTATTACTCC
AAATAATTTAATAAATACCTTTGAATGATGTACTTACAAGGATAATTATATTTAAATTGG
GGCAAAGTCCTGGTTTTACATCTCAATTTGGTATACTCTAGAGTTTCTCTTCTTCCAAAT
GAAGTTTAACATGTTATATAATTAACAATTTTTTAAAAACTCAAGATGCAATACAATTCA
ATTCAAACCTTTCACATTCTCTTGGCCTGGCAGCTTCTTACCTCTAGGACAGGTGCAAAG
AGGCAGTAAATAGTAATATAACCTTGACAAGTCACTACTTAACCTTTATTCAGACAAAAG
AGATAATAATACTTACAGGACTGTTATAGACTCTAAAGGAAATAATGTGCGATTAAAGGG
TTTTAAAAGCCAAACACTGCTATATAAGTCCATTATTACTATTACTTCTCAATTAAGCAA
GAAACACTAAATGGCAGATTTCTCACTCTTTTACTTTTTTTTAAATCTCATTTTCCTGTT
TAAATAGTCATTCTTTTTTGCCTACTGGCTATCTCACTACTTCTTTGAAGTACTATCCTA
CAGCATTATTACAGAGCCTTGGCTCTCAAGAAAGTATTTGAACTGCACCCTTTGATTTTC
TCAGTTACCCTTGTACAAGTAAAGTTGGCTGGTTACAAGAGCTTTATTGCAGTGTTTGTA
GTAGTGAAAGCATACCTAGCGCCTTCTGAGAGCAGGAGGGGACTGATGTTCAGTTGCCAG
AGTGAACACGATGAATAACTGATGTCCTTGAGCTGATGGTGAGCAACAGGCAGCTGGTAG
TCCTGCTACGGTGTTCAGTAGTTATGATGTCTGTTTTCCTTGCAGAGCCACTCTGCTGCT
TCTCAGGTTTCAATGGTATGGCTCTGGATATTTGCGAGGGTATTTGCTTTAACAATCTCA
AGAGGGGTGTTAGAGGAGTGGGCAGGGATATGATAGACAGTTACCTGCTGCTGTTGTCAG
ATGATGTCAGACAATATTCTATAGATTATCTCCTCCTGCAGCAGGAGTGATTACATCGAC
AGCATCATTAGTTGCTTCGTCGTTCTTTTTTTGTAGTCTGCCAATCCACCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTACATTACACCTAGAATATAATACCAGTATTGTCATTTTTTATT
CTTTCTGATATGGAATCTTGAAGAATTTCCAGTTATATTCCCAAATTCTGTCTTTTAATA
CAAGGTTTCTAAAAAGGCCGTTTGGTTATAGTATGTATTTTAAAATTAAAGAGTCCAAAA
TGAAGGTATTTACACTTTTGCCTGGGTAAAAAGAGTGGAAGTAATGGAGTAGTTAATTCC
CATGTTGTACAGCATTATTGTTAGTGGGTAAGATTTCCTTAAAGCACATTCTCCAGGGAA
CAAAATCCAATTATATTGTTCTAATGGATTAATTGAAGTAAATTAGATCATTTAGGCTTG
GCAGTCTTTATTATTATTTTATAAAATAATATTTATATTATTATTATTATTTTATAAAAT
AGGATTTAGTTTTATTGTTGTAACTTTTCATTTTAGTATATACTAAAATGATAAACTTTG
AATACTTTTGCTAGAGATAAACTGAGGTGCTATTATGCATATATGTGGTTTTGATTCTTC
TGTTTTTTGTTTTCAGAGTGCTGCTGCTACAGCTGCTACCTTGGCACTCCCTGCAGGTGT
GACTCCTGTTCAACAGATACTAACAAATTCAGGTAATTAGGAATAATAGGACCATTATTT
ATATAAGTCAGAAAATTGCACCAGCTAGCCTTTATGTTTTGTCTTCATTGAAAGACAGAA
AATCTTAATAATTTTTCTTTTACCATTCCCTTTAGGTTATTAAAGTAATATTATTTAAGG
CCAAAAAAAACCCACCTTAAACTGTAATCATCATTGAGGATGCAGGCAGATAAGAATTTC
ACCTGAGCTTTTGGTTCCTGAATTAGAACAGTATTTTGAATGAAGTGTGACTATATAGAA
ATGCTTATTTATTAAGTTTATGTTTTCATTTCTTTAAAGCTTTAAAACTGAAGAGCCCCT
GAAACATCTGTTCTTACTTAACTGTTCTCATGACTCCTTTATATATTAACAAAGATAATT
TTTGCTTTTAAGGAAATCTTATAATCTGTTGTTAAAAAATCTTACTGGAAACAGTTAAAT
AAGGATGATAAAGAGGTAAAATAAAAGATATTAGACTCTGTATTTGAACATGGAAGGAAG
TCAGGGAATGTAAGGATTATGGTTTGCTGATAATGGATGATAACCCTTTAGTAAAATTGT
TAAGACTTCCTTCTTGATAATTTCTAGTCCTTCTGGTGATTTGATGTGGTCATTGCTAAC
ATGGTAACTTGGAATACATACTTTTACTTTAGGCCAACTTCTTCAGGTGGTCAGAGCAGC
CAATGGTGCCCAGTATATCTTTCAACCTCAGCAGTCAGTGGTTCTACAACAGCAGGTTAT
ACCACAAATGCAGCCTGGTGGAGTACAAGCTCCTGTAATACAACAGGTAAAAGAATATCA
AGATTACCATGGGGTTTTTGTTTCTTCCTTTTGTATGATTTCCCTGGGTGGTTTCCCCTC
CCCTTTTCCACAGCTTTAGCTAATTATATACATTCTTAGATTCTTCTCTAGAGCTATAAA
TTCTTGCATTCTGATACTCTGTATACCTCATAGTTTGACCATATTAAAACTAACTTGTTT
TTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTTCTCGGTTTCACCTGATGT
TATTCTTTTTAGAATGCTACCTTTGTGCCTTGTTTCTAGCAACCCTCTCTACTCCTCCCA
AACAAAAAAGCAAACTAAACAAAAATGTCTGACTGATCTCTTGAAAGCACAAACCTCAAG
TATTACCTGCTTAGGAAGGCTTCTCTGACTATGGCTTGTCTCCTAAGCTGAATTTGGTAC
TCTTCTCCTGTGTTTTTATTATATCTCATGTCTTTTCAAGTTGTACTTGTTTTATATCTA
TTACATCCTTAATCAGTAAGCTTTTTAAGGAAAATATTATGTCTAAATATTTTTGTATTT
CTTAAACCTAATGGCACGTAATAGGCATTCAGAGCTTCTTATTTATTAATAATTAGAATG
GTAAACGATTAATTACATTTCCTGTAATATTTGTTAATACATTAATGTGCGATAGTGTGG
ATAGAATTCTTTTTGAATTGTGGTTTACTTTGTAATTCTAGGGTGCAGAAACTGAAAGGA
ACTTTAGAAATCATTTGATCTTGTGGTTTTCAACTGCAGTTGCATGATAGATTCATCTGG
GGAGCATTAATTACAATGAGTATGTTCTCACAAGTTAAATCAGAATATAAACTTCCAGTT
AGTTTTAATTTGCATCCAGGATTGATCTACGCTAATGATGAAGTGACTAAAGCCCAGAAG
GCAAGCCAGACTTGCTTCTATGATCTATATCTGTAATCTTAGACCTACAGATCCAGGTCT
TCAAATCTCCAGCCCAGCATTCTTCATTTGGAGGCAGTCTGGCATAATTGTAATAGCATG
GGCTCTGGAGCCAACAAGCTTTGGTTCACATTTTGTCTCTTAGTGACCATGAAAGTTTTG
CAAGTTACTAAATCTCTCCAAAGCTCAAGCAAATAGACTAATAACTTGTGTAACTCTTGA
CTTGCTATCTGCACATTTGTAGCAACTACTCAGTAAATGTTAGCAATTATCTTTAGGAAA
TCTTTTTCCTTCAGAAATTTAAATGTAAAGTTAGTGGGCCAGTTATTATTTTGGTAATTT
TGAATATGTATGAGAAGTGGCCATTCCTGGTGAGTCTTTAGCAGTTGGGCCTATTTCTGT
TTACCAAGCAGTGAAACTGAACTACTCAATCCCCTCTTTCCTAATTTGTGGTTTTGTTTT
GTTTTTGCCTTAGGTACTAGCTCCTCTTCCTGGAGGGATTTCACCACAAGCAGGTGTCAT
CATCCAGCCTCAGCAAATCTTATTTACAGGAAATAAGACTCAAGTTATACCTACAACAGT
GGCGGCACCTACACCAGCACAAGCACAGATAACTGCAACTGGCCAACAGCAGCCACAGGC
CCAGCCTGCTCAGTCACAAGCTCCTTTGGTATTACAAGTTGATGGAACTGGGGATACATC
ATCTGAAGATGATGAAGATGAAGAAGAAGATTATGATGATGAGGAGGAGGAAGACAAAGA
GAAAGATGGAGCTGAAGATGGGCAGGTGGAGGAAGTAAGTTTCTAGTAAAAGACTTGAAA
TGAGAATCTACTCAGTCATTTCCTATTTTACTTGGTGCCATACTGATAAATCATATCCTA
TTCTTTCAAAGACTGTTGAGAAGCTGTTTATAATTTTTAAAGATAAAGTAATTATTAGAT
TGTTCTGGCTATATATATTTTCATAAACCATTAATTATAGTTTCTTCATGTACCTGATAA
TAAAGAAATGAATGTATTCCAATTTAAATTGTATTTATAAAGGTGGTAGAGACAATGCAA
GAAATTTTAATTCTTTGCTTATGCCTTCGCGATGTGCCTTAATGATAAGACGTCGGTTGA
ATAGATGAATGTGGGTAATCTTTTGCTTCAATAATTAGGTATGGCAACATTTAGGAAGAG
AGGAGACTCCAGATAAAAAGCTAAATGTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAGCCACAGCCACTTCACCCTAATTATTACTTTTTAAAAGTCCACTGG
GTGCCCTATCTCCAGTCCCCTCCCCTCCTCTTCCCTTCACTGTTAGTAAATCATACTTAT
GAATTTTGCATTTGTCATAAACTTGCTTTGCTATGTATTTTACCATATGACAGGGATGTA
TATGTGTATATGTATATTTAAATGTTAACAAGTTTATTATAAGAACTGACTCACATGATA
ATGGAGATGGGCAAATCCAAAATCTTGTAGGCCACACATGGTGAACTCTGATGGTTTCCA
TGAATGCCCCAGGAGAAGCTGACTGGCTGAAGTAGAAATAGAAACTCTTCTTTCTGACTG
CTGAAATAATCAGTTCTTTCTTTAAGGCCTTTAGCTGATTGGATGAGACTTCTCTTATTG
TTGAAGACAAACTCCTTTGCTGATTTGTTAATTGCATAGTCACAGTCAGCAGTCCAATGA
TTTGAATCAGTGAAATACCCTCACAGTAACAGGCAAGCCAGTGGTTCTGGGACCAAACAA
CTGAACACCATAACTTAAACCAAGTTGTGTCATATACTTAACCACCACAATTAAATAGCA
TGTTGTTTAATTTTGCATGTCCATTTATAACATGAATGGAAACGTCTGTATTATTTTTCT
GCAAGTCGATTTTTTTCCCCTGAGATTCATCCAAGGTACATTAGGGCTGTAATTATTTTC
ACTACTGGATATACCATAATTTATTTATCCATTATTCTGATATGATAGACTTTAGAGTTT
TTCTTGTTTGCTGTTACAAACAGTTATAGAATATTCTACTATGTGTTTTTTGGTGCTAAC
TCTGATATTCTTTGTTACATTTTCCAGTTGTTGGTAGTATGAAAAAAAAGTACTTGTAAT
ATTTATCTTTTGAGTCAGCCATCTTCCTAAATTCTCTTAATTCTTATAATGTATCTTTAG
GCTCTTTTTTGTTTTCTATATGCATAATCAAATATGAAAGGCAGTTTCTCATGTCTTGCT
GGCTAAGCCCTCCAGAATAGCGTTGATTAGAAATGGTGAGAGCATTAAGTGCCCTTGACT
TATACTTAATTTAAAAAGGAATCCTTTCTTTGCACCATTAAGCATAATGTTTACTGGACA
TTTTTTCTATGGATACCCTTTATCAGGTTAAGGAAGTTACTTTCTATTTACAGTGAACCA
AGAGTTTTGCTTTGTCTTTTTTAAGTTATAAATGGACATGACTTTAAAAATATATATATA
TATATTTTAAGATACTTAGATTATATAATTGTTACATAAAAAATCGAGAGAATTCCCATA
TGCTGCACTCCCTACACCTCCACATTTTCCCCCTTTAACAATATCCTTCATTAGTGTGGT
ACATTGGTTACAATTGATGAACACATTTTGGATGATTGCCACTAGGCATGGATTATAGTT
TACATTGTAGGTTACACTCTCTCTGGCACATTTTTGTAGGTTACCACAAGATATATCATA
ATAGCCTGTATCTGATGTTGCAATGTACATTGACTTTCATGAAACACTTTACAATTATTC
GGTAATCGTGATTTCTTATCCCTGTTATTTATGATGAATTGCATTAATTGATTTTCTGAT
TGTAAGCCAAAATCTTGTATTCCTGGAATCATTTGGTCATTATGTATTAATCTTTTAATG
AATTGCTGAAATCACTTTGTTCAGGATTATTACATATATATATATTCATGAATGGTATTG
TCTGTGATTTTTTGATCATACTCTTACTAGGTTTTGTTATCAAGGAACTTGTGGTTCCTC
AAAAAGTTAAGCCTAGAATTATCATGTAACCTAGCAATCCACTCCTAGGTCTATACCCAA
AAGAAATGAAAGTCAGGTGTTCAAATAAAATCTTGCCTACAAATGTTTCTAGCAGCATTT
TTCATAGGAGCCAAGATGTGGACAGAACTCAAATATTTATCAANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATACTCCTGTATTCTCCAGTTTTCACCA
CTGCCTTCCATTTTTATACTATTTCTGGTTTCTGGTGCCAATTTCTTAAATAAACCATTC
TATTTTCTTCCATTTTTACACTATTTCTGGTTTCTGGTGCCATTTTCTCACTAAGCTATC
ATATTTTCTTAGGGTCACTTGTAGAGAACTGTCTTCTTGTGCTATTCTTAAAGATGAAGG
AAAAAGGTTGAACATCTTCAGATTTACAAGTTTTTTATACTTTAATCATTTTAGTTGTAT
TTAATTTATGCTTGGGATCTCAGTAACATTGCTTAACTCTTAATATAGCTGGTTAACAAT
ATGGTTATGGTACATATATGCATTTGATATTTGGTTCTCAAAGAATATCAAGGTCATTGT
GTATCTTTTCATAGAATATTAGTAATGCAATGGGGTAAAGTGAATAAGCTCTCATTTTTT
TTTTTTGTAGGAGCCGCTCAATAGCGAAGATGATGTGAGTGATGAGGAAGGACAAGAACT
CTTTGACACAGAAAATGTTGTCGTATGCCAATATGATAAGGTAAGGATTCATCATCAGAT
AAATTACTGACTTTATTTCTGTGGTATTTCTTCCCTAAACCATCCTTCCTGCCTTGTTCA
AACATTTGATTACCTCAAAGACTTCAACTAATCTCTAGAACTCTTGTATTATTATTATTA
TTTAAGGTGAAGCCTAGGGTAATAGGACTGATAACTAACAAATGTTTGTACTAAAAATAA
CTTTAAAATTATTGAGCTTTGCTGTATTTTGGTAGTATTTAGGGATTTTTAAAAGTTTCT
GAAATTAGCTCCTGACTCCTTTTTTTCTTAATTCTTAAACAGGGTATTTCTTTCCAAGTA
TTTTTTGTTATTATTGGTGTTGAGATTTCTGTTTATTGAAACATTCACACTGGAATTAAA
TTTATATTAAATCTAATTACTACATGTAAGTTATAATTTAATTCAGCAGAGATCTTTATC
AAATGCTGAAAACTCTTAAAACCTTCTGTGGGTTTTTTTTTTTGCTTTTTGTTTTTGAGG
TACCAGGGATTGAACCCCAGAGTGGAAGCCATCAGTGCTCAACCACTGAGCCACATTGGT
GCCCCTGAGTTGTTTTTTTGTTTGTTTGTTTGTTTGCTGTTGTTTTTTTTTTTGTTTTCA
GAAGGCACAGAATCCGATCCCAGGATCTCCCCATGTGGGAAGCAGGTGCTCAACTGCTTG
AGCTATATCTGCCCACCCCCGTTGTTATTTTTTTCTTTTTTTAAAAATTTTTATTTTTTT
AAAGATCTTAGATTACATAAAAGTTACATAGAAACTATAGGGGATTCCCACATGCCCCAC
TCCCTACCCATTGGGTTTTTGTAGTGAATATTTTTTGACTGCCTAATGTGCCATTCACTG
GAAGTTATGAACATGGAAAATTCCTGCCCTGCATTAATTTTTTTTTAATTGATGAAGAAA
ATCTTAAAGTCCTGTTGCTTTTATAGAAATGAATGTGATAAGTAGCTGTACTTATTGCAA
AAAAGCACTACTACTGGTTGAGTGTACTGAATATGTTATACCAGGCATGTTATATGAAAT
GTTATTTCTTATACATGTAGACCCAAGAGTATTGAGGTCTTCAGGAGATACCAGTAAACC
TTGTTAGGCAGTCTTAAGGGAACCTTTTGCAATCAAATTAGCTAGAACATGATTTTGTAA
GATGTCAGATTTATCAGGCAAGAGAGAGCCTTTACATTGCCTGACTAAAGAATATGCAAC
TAAATATTTTCCTGTTAAGGAGAGAGAGAGGAAAATGGTTTTGTTCTCTTTGGCACAAAC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACACTCTCCCACGTTCC
ACCCAGTAGGCCATGAGAAGGACATACAATGTCCAGTAACTGTCCCTGCAGCATCACCCA
GGACAACTCAAGTCCTGAAAACACCTCCACATCTCATCTCTTCCTCCCATTCCCAACCCC
CAGCAGCCACCATGGCCACTTTCTCCACACCAATGCCACATTTTCTTTGATTACTAATCA
CAATAGTTCATGAATAGAATATCAGTAAGTCCACTCTAATCCATACTCTATTCCTCCATC
CTGTGGACCTTGGAATGGTTGTGTCCACTCCACATTTATATCAAGAGGGGGCTTAGATTC
CACATGGATGCTGAATGTAATCCTGCTTTCAATTGTAGGCACTCACCATTTATTATTAAA
TATAACTTCAATGCTGCGGATATTGACTATTATTTAACCCATGAAACTTTCTGCATTTAT
TTTCTTGCAAGTTGCCTTGCAGTGGAATCTAATCAGTTTCTTTACTGATCAGTGGAATTC
CTATTTCCTGGCTCTTCATTGCTTTCATTTATATCTTTGTATAATCCTACTTTCTCCTAG
GTTGTAGTCACTCAGTTCATGCTAGAAATAAATTTGTATATACATTTTTAGGGTGTAATT
ATTGCTTTCTCTCCTTGTGGTCAGAGAAAAAGAGGAGACCGAGGTCTTCTCATTCCAGAA
ATATTTATTGAGTGTCCATGATCTTCAGGACACTATTCTTGGAGTTTCGAGATGTATCCG
TGAACAAAACAAAACAATCCCTGCCATTGGAAAGCTTATTCTAGTGCGGGGGGCAGAGGA
GGAGGCAGATGTTAAAACCCTAATAAATTATTTAATTTGTATATTAGAAGCTGATAATTG
GTACGGAAAAATACAGAGCATGGAAAGGGACCACATTGCAGTTTTAAATAGGGTAGTCAT
ATATCTTGAGTAGAAGACATTTGAGCAAAGACTTTAGGAGAGTTAGCTCTGCCATTATTT
GGGGGCATACGAGCAGCAAGGAGGCCAGTGTGGCTGGATTGAAATGAGGGAGGAAGAGAG
TGCAGTAGTAGATTAAGTCGGAGAGTAAGAGGGAATAGCTGTTGTGAGGCTTTGTAAGGC
TCTTGTTCTGAGTGAGATGGGAAGTTAATTACTGAATGATTTTGAAGAGACAGTGGCATG
ATATACATTTTACTTTGCCTTCTTTGTAGAGAACAAAGTATGAGGAGGACACAGGGTGAG
AAGCAAGGAGACAAGGGGGAGATATTGTAGTGATCCAGGTGAGAGATAATGGTGACTCAG
ACTGGGGCATATTATTGGAGTTAGTGAAAAGTTGTTGGATCTTTTATACATTTTGAAAGA
AAAGTCATCTGGATATCTTGACTCTCTTGGATGTGTGGTAGAAAAGAAAACAGAATGAAG
AATGGCTCCAACGTTTTTTCATGAGACTGAGGAATGATAATACTATTAACTCAGAAAAGG
AAAGGTATAGGGGAACAGGTTTGGGAGAGGCAAGATCAGTTCAATTTTGGACATGTTAAG
TATGGTATATTTATATACATTCAAGTCTAATGACTTCCATGGATGTACATAGTTTTGAAA
TCTGTAAGTAACTGAATGTTAGCATTCCTTCAGCAGTATTTGTTAAATGCTTGCCATGCA
TAAGGTTACATAATTAGGAGATCACTGTGGAACTTTATTTTGGTAAATCCGTTCGTAATT
GTATATACCTACAAATTAATGTCATAGGGATTTTAGCATTGGGAAAGAGTAATGTTTTCA
GATCATCCTAAATACAATTAAATTGGAATAGAGATAAAATAGAGATGAGAAATGCTAATA
TTAATAATACTCTTACTGTGAGGTGGCTGCATTATTAAAAGGGTCATCAATACAGACGTT
GTTATGCTGACAATTACATACAGGGAAAAAGAAAAGAATGGTTGTAAATGTGACTCCAAT
ATTGAGGAAAGGTAGTGGGTGTCTTGGTGGTCAGTAGATAAGAGAAACAAAGAAAGACAT
ACCAGGAGTTATTGCAAAAAAAAAAAGGCAAAATAGTGATCTTTAAAGTACTTAGAGCGA
CAAAATATTGCTAATTACAGATAAATTCGTTTTTTTAAGAGTGAATGAGATACAGTCTTC
TGATTGTATCTAATTTTTTTCTTTTTGTTTCTTTAGATACACAGAAGTAAAAATAAATGG
AAATTTCACCTCAAGGATGGCATCATGAATCTTAATGGAAGAGATTATATATTTTCCAAA
GCCATTGGAGATGCAGAATGGTGAAGAGTTGCTTCTTTTCTTTTATAAGTAAAACAAAAC
AAACTAAAAAAAAAAAATTAAAGTGGACAGTTTGAAACTTGGGACATACACCAACCAAAA
CTTAACTTTCTGCATGTCAAAAAAGTGCAGTAGAAGCAAAGCTACTGCAACAAAGATAGA
CCTTGACACATAGACACTACTTCTAACTGGCAAGCCATGGCAACTGTAGCACCTGGGGCT
GTTGAGGGGGGGAGGGCTGGGGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGGTAAAA
AGTTGCGGGTGTGCTTTTACAAAAAGGGGTAAAGAATCAGGGTGTTGATTTTAAATCACC
TTGTATAAGGAACAATTTAAAATCTCATAATACGTCTTAAATATTTTTACTTGCTATTCT
TCCTCAGTAACATATACCTCTTCCTTACATGCTTCATGAAACATCTAAAGAGTAAAAGGT
GATCACATTTAGTTTGGAGGCAAAACTTGATCCAGAAATGAATATTTCTTTTAATTAGGG
TTTCATACATAGTAAATGTAATTTAAAGACTTGGGTCTTATCTGACTTGAGTGGAATTAA
AATGACAAGTTTAATGTTCTTACTGTATTTGTTTCTTTTAGTCTCATACCTTAAAAAGAA
ATCCCAGTTGGCTCCTCAGGAATACGGTTTATTTCACAAAGGTAGCATCTAGCTGAAATT
GTATACAAATAAGTAGATACAGATTTTTTCTTGTTGGGCTGAAGTGTGCTTATATATGTG
GTTAGTCTTTAAGCTAAACGTACATTCAGATAGCATTCTGAAACATTGATTGAAGCATAG
GGCAGGCAGTGAGGACCTGAATTTTTATTAAACAATTTTAGTAATTATAAAAGTTTCTTG
TGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1684..1785, 6869..7073, 8976..9040, 36556..36631, 37292..37425, 39973..40293, 45250..45339, 49356..49463
1001..1030, 1684..1785, 6869..7073, 8976..9040, 36556..36631, 37292..37425, 39973..40293, 45250..45339, 49356..49460
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved