Dasypus_novemcinctus Locus ENSDNOG00000019487
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000019487
Dasypus_novemcinctus
ENSDNOG00000019487
GeneScaffold_1812
SNORD42, SNORD42
1521..1588, 3373..3438
4809
CCGCTCCCGGGCACGGAGACCCCCACCCCCAATGGCACTGGCGTTCATCACTCTGATCC
CATTAGAATCTTCCCCTCAAAGACAACTTTTCCTTTTTACAAAGTCCTGCAAGATAGAAG
AAGGGGTAACGGACGATCCATCTCACGGTTTAAGGTTCCTTGAGAGAGGGCGGGGCGGAG
AGGCACAGACCCTCAGAAAGAGCAAACCTGAGCATTACTAAGAATTTGAGGACGGAAAGA
TGATTAGGGGAGGTGAGAGAACAGGGGAGGGGACTTAGTGAAGTTATTCTCAGGAAGGAT
TAACGCAATCCCAGGGAAATCTATGTGCTGGATATTTGAAACATTGGTAGAACTTCTACA
AGAGTAGAATGGGGGAAATGCATGATATCTGACCGTGTCACAAGTAAAGGGGAGCTGATG
TGGCCGCCATTTACCTCCTCTGATACTTTCCTCTCCCACTACGCCTGACGGGACTATTTC
TATCACCAAATCACTGTTATTGATAAACCAGGTCCTCTCTCTGGACTTGAGTTTCCACAG
ATCTGATCTGGAGGGAGCCGCACCAGGCAAATCCTGACCTAACGTTCTTAAACTTTGTTT
CACTCTCTCCGAGTCGACCTAAAACTGTACTCTTTCCGGTTTTCAGTGTTCCAGTCTCCT
GGCACTGAGGTCCTTCGCTGAGCCTGGAAGCTGGTCAAGATAGGAAGGACCGTGGACCAG
ACCAAAGCGGCAGCCTGCCACACCACAGGCCAGAACAAATAAACGCCCTCCCCCAAAAAA
AACTACAACTCCCAAGAAGCCTTAGAACTTTGCTAGGGGCGGGAAAGCGCATGCCTAGTT
CCTCTCGCAAAAAAAAAAAAAATTAACCGTAACTACCATTCCCGGCGGGCACCACGCCAC
AGAGTACCCAATCAGCTTTAAGTACAAAGCATCGCGACTCTTCGGTGAGACTTGGCTGTA
TAAGCCCGTGGGAATCAGGCTCGGCGACCCTTTTCACGAAGATGGCGCCGAAAGCGAAGA
AGGAAGGTGTGTGCTGGGGCTGAGGGTCACATCTGGCTTGTCCGGACTCCCCACAGAACG
AATTCGTTAGGAGGGCTGGTCCGGGGCATTAAGCCCTGGGAAGTCTGTTACGGAGCCACT
GTCTGCTTTTCAGCCACGCTATGGTGTATCTGGGCCGCGCGGTCTCAGCCACATGGGCTG
GGTTCTAGCGAACAGAATTGGGGGAGGGAGGCAAGCCCGCACCACTCGCCGGGGAGAACC
AGATATTCGACTCCTTTCTCTGGGGAACCCCGTGTCTTCAGACCTGTAAGAAATCAGTGC
CCTCAACTTTACTCATTTTCCTTTTTTCTTTTCCTTATAAATGGAACTGTACAGTCCCCC
AGAATGACTGTGCTGCGAATATATATGAAACTCGTAGCATGCTTCCTGGCAAGTACTAAG
CGTTTGGTCAACTCCACTTTTATTTTTCCTTCGTTGTACTCTTCGAGTTACTCCAGGTTG
ACTTCCTCCACCCTCAGTGTCGTGCGTATGATGGAAAAAAACTTAACCTTCTGAGAGTTA
TGATGCCTTCAAAGGAACCACTGATGCACGTGTGTCTAGAGGCGTCCTCCGCCATAGGTC
TCGAGTCCTACGTGATGGATTTCTAAATCCTGCTCCTCCTCTTTGTTTCCTTCTCTCTCA
GCGCCTGCCCCTCCCAAAACAGAAGCCAAAGCAAAAGCTTTGAAAGCCAAGAAGGCAGTA
CTGAAAGGCGTCCACAGCCACAAAAAAAAGAAGATCCGCACGTCACCCACCTTCCGGCGG
CCTAAGACGCTGCGTCTCAGGAGACAGCCCAAATATCCTCGGAAAAGCGCCCCCAGGAGA
AACAAGTCAGTACTACCTCTGTACTCTTGGCGAGATGTTTGGGTTATTTATTTGTAATTT
GGGACTTTTTGTTTCCCCAACCTGGAGAATAGCCTCATCGGCTAATGGAAGCTAGTGGTT
TCCCTAAAGGGAGTGTGAGATTGTTTATTCCATATTTAGAAATGAGTTTTGTAATATTGG
TAGGTATTATGCTTAAATCAACCCAGAGTCACTCAGATTTTCTTCTATTATATGTTAATT
ATTGCTTCCTTTGTTGTCAGGGCTTCATATTTTGTCCACATTCTTGGGAGTATAAAGTAG
TCTTAGTGGGACTTAGATGTTTCTTGGGAGTTTGGGGTTTAGTAAAACAAAATACATAAA
TCTTGGTTGGAGGGAATAACTGGCTTTAAGGACCAGCTATTAAGAGTAGAGCCATGGTAG
AAGTTTCCACCAATGGGTTTCCCACTGCTGTGAACTGCTTCCTAAGGGAAAGGAAGGAAA
GTGATTGTATCCATGAAAGATTTTTTCCTGTGATTAAGCATAATGAGAACTTGAGTCCTC
ACTCCTGGTTTCACTACTAGGAAAGTAGTGTCTGGGTGGGCAGAGTCTGGCCTATTTCCT
ATTTGAATTTCACGGGAAAGCTGTGCTCTAGGTGTAGTCATTCTAGGTTTAACATGAGCT
GCAAGTAAAATGTTGCTGCCAAGAATTGGTGGCCCTCCGTTATAGAGCCAGTTTTTAGTA
ACTAAATGGGAGCAGAAAAGGTTGGTCTAGCTTCACAGAGAAGCACCAACATTCTTGGGT
GCCTGGCTTTCAGAGTCTGTAGTCTAGCCTTGTAAGTTGCTTTGCTTTGCTTTTCAAATC
CTTCCAGTGAGAGTCTACTTTAATCTTCAGGAATGTTGAGGTCAAATAAGGATGTGAAAG
GATTTGGAATTGAAAAGATGATTAATCAGTCTCATCAAGGATCAGAGACTATCAAAGTAT
AGAAGGGCTCTGCCCCTAGGCTAGGGCTCTGGGTCCCTAGGTTTTAGAGTGCAAATGATG
ACACCTGTTCAGCGACCAAAGTCTGACAAAAATGATTCCTATTTTATTGTCTGATGCACC
TGGGCTCTCCTGGCCTTCTATTCCAATACAGGGGCCAAGTTTTCTTCTCCTACTGGGCCC
TGGCCAGGTGACCCCATTTTATCTCTCCCCTAGGCTTGACCACTATGCCATCATCAAGTT
CCCCCTGACCACTGAGTCAGCCATGAAGAAGATTGAAGACAACAACACACTTGTGTTCAT
TGTGGATGTCAAGGCCAACAAGCACCAGATCAAGCAAGCTGTGAAGAAGCTCTATGACAT
TGATGTGGCCAAGGTCAACACCCTGATCAGGTGAGTGGAACCTCATAGGGTGGGGAGGAG
GCTGGGACTGTCAGGAGCCTGGATGGCATGACATTTCTTGATGAGTGAGTGCTAAAATTT
CCTGGGTCCTGTGGCCATTCCCATAAAAAGGAGTTGGCTACATTTGTGTTTTAGGGGCTT
CCCTACTCCCTCTGCGCAAATGATGGAAAAATCACTATTTGGAAAAGAATGACATGAACA
AAGGAACCACTGATGGCGCCAGAGAACTGGGGGAGGAGATTGGGGGAGGGCAGTGGGAGT
AGCAAAAACTAAGGCTCCTTCTCCACCGCAGGCCTGATGGAGAGAAGAAGGCATATGTTC
GACTGGCTCCTGACTATGATGCTTTGGATGTTGCCAACAAAGTAAGCTTCCTTTTCTAAG
CCTCCTCAACACTCTCCGAAATCACTCATTCCTCCTCCTCAGGTGCAAATGCTGCACCGT
TAGTGACCAAAGCCTGACTTTAGATGATTAGTCTTAACTGACTGCACCTTATCTTTAATT
TGCTTTTTAACTATGACTTTCCAGCTTAATTGTGACATGTCAACTCTCAGTAACCTGACT
CCCTTTTGTTTTCAGATTGGGATCATCTAAACTGAGTCCAGCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACT
GTGGTACATAATTTAGATATGGGGCTTACTGTTAAGACTGTCGCAATGCTGAGCCCTGTC
ACCCCACCACACTAATTGTTCCTGAAACTGGTGTTAGTTACCTAGCTGTAGCTCCATCAC
GGGGAGAAGTGAAGCAGGGGTCTTACAAGGACCCCTTCTTTATCCTTAGAAGAGGGTGTG
TGTGAAACCAATAGCTAGAGTTTGGGGGGAGGGGGTTGGGTAATTCCAATTTTCATTAGC
ATCCATTTCAGAGCAGTGTGGGTTGGCTTTCCAGTTGCACCCTGTTTCCACATGCCCATC
TACCATGTCCAACTGGTCTGTCTGCTTCCCTCACCCCTTGCCCAAGAAAGGACAAAGGAC
TTCAGAGGAGTGCATTCATTAGTGTTTTAAATAGTGTGGATGCAGGCTTTCCAAGTGTAG
TAGCTGGCCCAGAGAATGTCCCCAGTTTGGGGCTGAGTCCGTTTCCTGTGTGAGGTTGCT
CTCAGATTTCCTGGGCCCTGAGCCATTTATTCCGTCAAGAATTTGTCTTTGCGTTTCTGG
CTGGGAACACGCTCAGGGCAGAAGTCAGAGCGGAGGAGGCGGGAAAAGTAGATGAGAATC
ATCACGTCCAGCATGAGCAGGATACCCAGCAGAAAGGTGCCTAGGGTCCTCTGGCCCTTG
TAGCGTAGGAAGAAATGGGTGAGGTAGGCCTGAGGAGCTAGGCGGAAGAGAAAGTACATG
ACCAGGTTGACATACTTGTTGACTTGGTAGAGGAGGAGATGCTGGGCGTTGTTGATTTTC
ATCATCATGCGGATGGTGAGGAAGATGTTGCTGACCTCCACAAATAGTGTTAGGACACCC
CCACCAACAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1681..1864, 3033..3209, 3511..3580, 3795..3809
1001..1025, 1681..1864, 3033..3209, 3511..3580, 3795..3806
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved