Dasypus_novemcinctus Locus SLC44A1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SLC44A1
Dasypus_novemcinctus
SLC44A1
GeneScaffold_579
SNORA63
103424..103541
132483
GGTACCTTCAGAGGCTGCATCTTCCCAAAGTTGATGGGAAACAGCATTCTTCCTTGAGT
TCTTTTATGTTCTTGGTTAACTCTAGGGAGAGATTGTGGTGGACCTGCTGGGTTTGGTAT
AAACTGCCAATCCTAGTTCCCATGGCGGTGATAATGCTTAGGACAGCTAGGAGAGGTGTG
AAGAGAGATACTGCCCTAGACATAAACTCACAAGGACAGTATAGGCAACAAGACAGGCAT
CTGGCAAGCAAAATGTAGTACTTAAGAGAGCCATTCCTTTATCTTATAGGCGCATTTGTT
AACTACTTAGAAAATGAGTTAAATTTACCAGGATTTTTAACACGTTCAATATTCCTCTGC
ATATAATCTAGAATAGAAAAGATATCATCATAATCATCAGGCATATAGTTAACAATAGTG
AAATACTAATCAATGCACATGTTCAAGAGGAATTCGTTTTAGTGGGTTTCCTTCCTAGAA
GAGAACATATAGGAAGCATTCCTAAAATTTTAAGTCGAGCAACTGGACACACAAAGAAAA
AGCTACAACTAAGATCGAAGTTGAAAGAGTTTGTTCATTTATTTATTTGTTTTAAATAGC
ATTTACTGAGTATGTATCATGAACCCTTAGACATCATGTTATTTAGTGGGAAATGAGACA
TGCTCCTTCCCTTGAGAAGCTCAAGAGCTGCTGGGGGACACTGCTTAGCAAATCATAGTA
ACTATGCAGAATGCTAAACATTTTAATTAGGGTACCAAGAAAGTAGTGAAATCAGCATGT
TGCCTGGCCCAGAAGAGGGGAGGTGGGGTAAGGGGGTGGTCAGTGGAGTGTTGGCTGAGG
GAGGGAGGGTAACCTGCACGGATAAGGTGCCTTTGAGTTGGGCCTTGAAGGTTCAATAGC
AGCTTATCTGGGAAAGAAGGCATCTAGGCATACGTGTGTTTATGCCTTCCCAATTTTAAC
TGAACCTAACCTCTACCACCCTCTCTTGTATTTTCAACTAGAGCTCCAAGCGAGAATGGA
AGCCTCTGGAGGACCGTAGTTGCACAGACATCCCGTGGCTGCTCTTTTTCCTGCTCTTCT
GCATTGGGATGGTAAGGAAGCCGCACAGGTGCTGAGACCGGGCTCATGGCCCAAGGGAAT
GGGGGCGGCGCTGGTTTCGAGAGGGAGCTGGTTCTGTCCTTACGGTGGTTACATAAGAGA
ATGCCCTTGTTCTTAGGAAATGCACTTGGAAATTGTATGTGTTCAAGGAGCATGATGACT
ACAACCTATGCTCAACTGTTTAGAAGGTAGCCAGCTACTAGCTAGAGTGATAACAGTAAA
TGTGACAAAATGTTAAGATTGGATTTGGGTATCTGGGGGAGGGTATGTCGGAGTTCTCTG
TATGAATTTTGTATTATTTTTGCAACTGTCCTGTAAGCTTGAAAGTATTTTAAAATAAAA
AGTTGAAAAAAAAAAAAGAGAGCTTTTCATATTTTTTAACTCCTCATGTATTGCTCATAA
CTGGAGGGCTTTGCACACCATCGAGGCAGATTATTTTGCCCCAGGCAAGCCACATATATT
TGGTATCCCTTTCGTTTTGTTTTCCTACCTGAAATCTGAGACCGAAGTTCAAGAGCAACT
GGAATCTGTCATTTAGTAGATCATTTCAGAAATCCAGATTGACACATGGTTCTATGAACT
GTGACCTGGTGAGGCGGGGAGCAAGCCCTGGCCGGGACTAGTCACATTTCTCCTTGTGTT
CCTGTGCAGAAGAGTAGGAGGTTCTGCTAGATGATTTCCACTGTAGCTTCCGATTCTGGA
GGATTTTAGTTCTTCCCAGGTAGGCGGCTGTGCCTGTTGCTTCATCCTTCCTCTGCCCCC
GGGGCACCTGCTGCTTTCTCAGCCGACTGCAGTGAGTGCCAGCCCACGGTTGAGATCAAG
GGACCCGATGCACCTTAGACCAATGATTTTCTGGGGTGCAAGGCTTTTGGGGTGTGCTTA
CTCAAACTGTACAATTGCTCTGCCCTACAGGAGTCAGACAAACCTCAGGGGCCTTAGAGC
CACTGCTGGTTTGCTGGGCTGGATAAAAGGTAGAAAATGTCTATTTTAGACTCAAGCTCA
AGGATGTTCATACCTAGAAAGGACCTTGGAAATCTTATCTGGTCCACTACCCTCATTTTA
CAGATGAGACATCAGACCCAGGAGTGAAGGCCATCCCAAGGCCACACACACTGCTAGTTA
AAGGCAGAGCCGGGCCTGCTCTTGACTTCCAGAATCTTTCCTTCTGCCTCATATCTTCCG
GCAGAGTCGGGACAGGTACCTTATTGTTTTCTCTCTCTCAGTCCTCTACAACTCAAAAGG
CAATTATGCTTCTCAGGCAGCCTTTTTTTTCACTCAGGTGAGTATTTTAACCTCCTTCTT
CCTGTAACTTTTACAGATGAGTCTTCACATCTCAGGCAACTGCCCACTTTCCAAGTTCCA
TTTGCAAATCACAGAATAACCCTAATCGTGACTCTCAGGCATAATTGTAAGGCCAGTTCC
TCTGAACTAAGGAAAGGAGAGCAGCAAGTTTTTAACAGTAAGATATAATAAATCCAGTGA
AATAGTGGGTGTCAGTTTTAAAGATAAAAGCTCAGTTTTACCAAATTTGGGATATTTAGA
AAAACATCAAAAGACCATTTCCTAGATCTGAGGACTTAGGAGAGATTGTTCAAGAGTCCC
CCTGATTTAATGGACAGGCAGTGGCAATGCAGCGTGCACAAATATGCATGCAGAATGGGG
AATAGGCTTTTTGCCAACAGTCCATAACCTTTTTCTCTCCTGAATTTAACCCTGCGACAA
ATAGGAACTGACCTTTCAGAATTCTGTTTATAAAGAACATGCACCCTGTCCTCCAAGATG
CTTTTGATTTTCTGTGCTAAAATAGCTCAGGCAAGGACAGTCATTATTGTTAATAGGCTG
ATTGGGACTGACTTGAGAGCAAGTGATTTGTTTACTGAAACGTTTTAATGCAGTGGTAAT
TAATAAGATGTTGATTTCAGTGGATTGTAATTAAGACCCACTGTGTGTGCTTTTAAGTAC
AGGCATAGTGTTTTTTGTTTTGGAATGATTCTTTTACCTTTCTTCAAGGGTGTGAGCTAT
TGTCAAATTTTGCCACGTCTAAATGGAAGAAATCTCCCAAGTTCTGATGTCCAACCTTTG
TGCACCTCAACAGTAGTTTTTGTTATCTGAGTATATGTTTTGTCTGTTTAAAGAAGTGTT
TCCCCTTTGGATTTCATTCTTTAGTACTTTTAAGAGAAACATCCAACTAACATTTGTTGA
GCAGCAGTCTGTGCTTGAGGCTTTCATATGTGTATTTATTCATATATGTATTTATCTCAT
TCAGTTCTGCCAATTACCGTACCCTGCAAGACAGGTTTTAGCCCCAGCTCACAAAGGAGG
CATAGCGGAGTTAAATATTAGCTTGTGGGGGAATATACTGTTGTTTGTAAGAGGCAAATA
TAGAATAGGAAGTGGAACTTTCTGGCCACATTTTTTTTTTCAACTTGTGGCCACAGCTGC
CTGTTGCTTTTACATCTTGTTTCTCAATTGTCTTGCAGCCTAATATTCAAACCATAACTT
TATTCTTCTCTCCTCCCTTGCAGTTCTTTGCTGGCTTTTGTTATCTGTGCTCTAGTTCTT
AAGTATTTTAAGTTCTTGGATCTTCCACTCATCTTCACCACTAAATCTTTTTATTTACAC
ATGCTCATCTCTTCATAAATATTTGTACTGCATATATATATATATATATATATANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCATCACAGATTTGTGC
AGTCATCGCCTCAGTAAATTTTTTTTAAAGATTTTATTTATTTATTTATTTCTCTCCCCT
TCCCTTCCCCCCCCCCCCCACCCCGGTTGTCTGTTCTCTATGTCTCTTTGATGAATCTTC
TTCGTCCGCCTCTGTTGTTGTCAGCGGCACAGGAATCTGTGTCTCTTTTTGTTGCGTCAT
CTTGTTGTGTCAGCTCTCCGTGTGTGCAGCTCCATTCCTGGGCAGGCTGCACTTTCTTTC
GCACTGGGCGGCTCTCCTTACGGGGCGCGCTCCTTGCGTGTGGGGCTCCCCTACATGCCA
CACCCCTGCGTGGCAGGGTACTCCTTGCGCGCATCAGCACTGCACATGGGCCAGCTCCAC
ACGGGTCAAGGAGGCCGGGGGTTTGAACCGCAGACTTCCCATGTGGTAGACGGACGCCCT
AACCACTGGGCCAAGTCTGCTGCCGTCAGTAAATTTTTTAATGTTTTCATTAGTCAAAGA
AAAAACCCCATACCTTCCTTTTATTGACCCTTAGTATTGATAGTATATTTCTCTTTTTAT
TTCTTCCCTCAGTCTCAAGGTTTCTCCATGCTTGAATTGTCTAGGACTAGGGTATTTTAA
AAAATAAACTGCTACCGGTCTTTTTGAGAACGCCATCTTCCACATTTGAACTTTCATTAC
TATTTTGAATTTACTGAACATCTGCCTACCCTGTTCAAAAACAAAAAAATCACATATAAC
ATTGCACTTCTAAATTTCTATTTTCTATGATAGTAGAAAAGCCATCATAGAAACTTTAAA
CTCTAGGTGCTTATTAAATGCATCTGAGATCTTTTATAAAATACCAGTGCTTGGGCCCTA
CCTTAGAGATTTCTGATTTCAACTCTGTGACTCTTAATGTTCAGTTGGGTTGAGAATCTC
TGTTGTAGAACTGATAAAGAAGAGGTTTTTTTTTTTTTTTGTTTTTTTAGGTATTAGGTA
CCAGGGGACAAGAATTGAACCGGGGACCTCATGTGTGGGAAGCCAGTACTCAACCACTGA
GCCACATCGGCTTCCCTGAGTTGGTTTTTTCATTCGTTTTGCTTGTTTGTTTTTGTTTTT
TCGGGTGGCACTGGGAACTGAACCCAGGGCCTCCCATGTTGGAGGCAGGCTCTCAACTGC
TTGAGCCACAGCCACTCCCCTTAAGAAGAGTTTTGAGCAGGGATAGATATGACTGGATTT
AGAAAGATGCCCTGGCAGCCAGTGTTAAAAGATGGTATGGAAGGAGGGGGGCAAGATTTC
AGGCAGAGAGACCGCTGTGGAGGCTCCTATACTAGTCCAGAGGAGAGGTGAAAAACTTGA
GATACGGTAGTGATAGAGGAGAGGAGAAGAGAGATCGCAGAGTAGGATCAGTAACATTTG
GCATCACTGATGTCGAGGAAGTGGGAGACAGATCAAGGATGGCAAAGATGTGTTCGGGGT
TGAGGGTCGGGTTTTCCAGCTCACATCCTTCCCAGCTCCTTGCAGAGGCCTATATGCAGC
TTCTGTACACACGGGAACTGTAGTAGGGCAGCTAGCAGAGCACTGCTTCACTTGCAGCCA
GGCAGGCACTTGATAGCCCCACTAAAGCACATGTGGGTGAAAATGAGTTGTGGAAGGAAG
CTTGGGCCAAGGGGGCTAAGGTCCATTCCTACCACATGTAGGATGATGTGACAAGTCTTT
TGCCTCAGGGCGAGGAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTAGGAGAGGAGCA
GAAAGCTGGGAGAGCAAGGGAAGCAATGGAGAGAAGGAACGAGCAGAGCTACCTGGGTCA
AATCAGCTTCTCATAAAACGGCAGGAAGGAGAGGAGGCCGGGTGGCGCTGCAGGTGTGCC
TCAGTGTGGGAGGTGGGCGGTGGAAGCTGATACAGAGCCACCCCCTTGCCCAGCCCCCCT
CCATAGTTATTGCTGCTCACCGGGTACCAGGCGCTGCTCTCAGCTCTTGACACACACAAG
CTCATTTATTCTACAACTACTCGGTGAACTAGATGCCACTATCATCACCGTCCCCATTTT
ACAGATAAGGAAACAGCGGCACAGATAACTTGTCCAAGATTACACAGTGACATATTTGGA
CCCAGGAGCAAAGAGGCAGACCTGACCTTTTATGTTTGTGCCCTGCAATTGAGAAGCAAC
AGAACAAGCCCTGCTGGGGAATGTGGACCTGTAAATATGGCCACCTTATCTGCAAGGAAA
ATATGGGCTAATCAGTGTCTCAGTCTGCTGGAAAGGATTCTCATGATCTCTTCCTCTAAT
GAGAAGACAGAGCAGGGGTAAAAACCTGGGGGGAAGGGCCGGAAGAGCCCCCTCCCTCCA
GAGTTTATCTGGTTGGTCAGAGGACCGGGGTGCTTATGGGGTAAGGTATATGTAGGGAAG
GGAAATGGGTTGGGGAACTGTGACATGAGAAAACTTTTGGATATGTAGAACTTGTGGGTA
GAGATAGGCACTTGGAAGTGCAGGGTTGGAATTCTGGTGAACGATCTGAACTAGAGCTGG
ACTTAGGAAACATCGCTGTGTAGGTCGTCTCTTCAGACTGCTTTCAAGGACCTTTTTATT
TCATTAGCATTAGTCTGGTTCCTGGGGCATGGTGTTTCTACCTCATTAACTGTTGTTAAG
CCTGCAGCACAGAGCGAGGGATTCGCTGCAGTCTTTTGTTACCTGTTTGATGGTCTGTTT
TTGGCCAGGATCATAGAATAGGAAGAACAGCATGCTAAAAATTGCCTTACAGTTTCTGTG
AAATCCATACTCTTGCTTTCCTTTTCTGTCACTGTAAAATGAGTTTACACTTTGCCTTAC
CAGTATCCTCTTAAGACTTTTAAACTTGTACTCCCTTTCCCTTTAAAGTATACAATTTTG
GAAGAGGAAAAGACTTTGTAGAGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGTAGGACTGGGGCTACCGATGTATGTAGCAAATTACCACAAG
CGTATCCCATGAAAACAGTACAGTTCTGTGGAGCAGCAGTCTGGGCCCACCAGGCTGAAA
GCAAGGTGTTGGCCTTTCTTTCTGGAGGCTCTGGGGAATGAGTCTGCGTCCAGGCTCATT
TGGGATGTTGGCATTTTCAGTCCTGTGCAGCTGTCCGACTGGGTCTCTGTTTCCTTGCTG
GCTGTCACCAGGGCTTGTTCTCAGCTTCTAGAGGCATCTTCAAAGATGGAGGATGAATCC
TTCTCACACTTGACTCTCTCTGACCTCCCTCTTCGGGGGCAGCATCTTGGTTCCAGATCA
TCCATGTAGGTTGAAGCAGTTCCTCAGGCAATGACTGGGGGTTCAGGGACAGGATGTGTT
TTCATAGGGTTTAGAGCTCCAGTTAGGTGGTTTGGCGGTTGGGGGCAAGGCTTGCATTCT
CTCACGGGAAAAATAAAATACAGTAGGTCTCTGGAAGGAAAGCATGCATGTTGGTGATTG
GGGGGAAGCTGCTTAATGGATGGTTTGGTGAGTTCTTGGACGCAGAGGTGGTTCTAAGAG
CCTATCTTCTAGTGAGGATGGGATTCCAATTGAATGCCAAGCTTGGTTCTTGTTGGCTGA
GGAACTGGGTGAGCTGAGTTTACCATTTGGAGTTCTGTAAGCCAGGCTAAGTAAGGCTGG
GCACACAAGGGAAGGAGCTCCTGACTCCGCCTTGTGGAGTTGTAGAGGCTTAGAAGAAGA
GAGGTGTAGACCATTTATCTAGTGTCGATGCTTCAGTTTACAGAATGTCCTACTCACCTA
ATATTGAGGTTTTCCTAAGAGCAGCCCAACAGATCACCTGCTCATTGCCACACTTTAGGG
ATATGTTTGAACAACATAAGCTCTATGATTTTGGTTTTGCAGTGAGGGAAAAGCACTCTC
CTTTCTCCTCCTTTCAAATGCTTTGATTTTCAACATTAACCTACCATCTCTGCTAGTTTA
GATCAACAAGTAAAAGAGCAGACTGGGGAGATACCTCACTTGAATTTGGATTTGTGAACT
CTTCTCCCCACAAGTTTATAAGTTTAAAAGCAATAACATTTATAAAATGTTCTAAAAAGA
AACCAATTATTGTACTATTTAAACTTTTTAAAAAATTATCTTTTCTCATGGAAAGTATTA
GAATGTAAAAATGACAGTTAAATATTTAGAAGTCTAAATTTGTGGAGACATCTTGGGGAA
ATATTTTTTGTTATATTTCATGACCACAACCACTCTTTAGCTGGTTTTACAAAGGTACTG
TCTCATCTTACTAGTGTAGTTCTACCTCCAGGATAATATTTGCTAGGAAATTTGAAAGAA
GAGTCCCACAGCATTGATTTAGAAAAATATAAGAGTTGAAAGTTAAAACATTGTGTTGCA
AATTCGAAATAGACAGCTCACCGCCTGCTGAACAGAATTAGATAACATTAAGCACCTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCTTAAGACTTTTAAACTTG
TACTCCCTTTCCCTTAAAGTTATACAATTTTGGAAGAGGAAAAGACTTTGTAGAGATTAA
TTTCATGACAGGTAAGGAAGCAGAGGCTCAAAGAATTTAAAGCAACCTGCCTCGAACATA
TGAAGTATTAGTGGCTGAGTTGAGATCAGTTCTCAGGATTCCTCATCTGTGCTCTCTGCA
TTGCCTGAGCTACCCATGAAAATAAACCTCTCTGATCTTTGCTTCTTATTTTCTTCTCTC
CTGAGAACCTTTTTTTTTTTTTTAGGATAAACCTTGTGTATTGTAACTCTTCATACCTTG
CATTTGGATATGCTTAATAAATGCTTACTGAGTGATGTTGCTTCCCCATTCCACTCCCCT
GCCTTCCTCTTAGAGCAGTGCATCCATTAAACATTAAAAGAATCCAGAAATCTTTGGCAG
ATAGTGGCAAAAGTTTTATATATGTTGGTTTGTCTTTTCTAGTTTGTTTGCCTCTAACAC
CACTTCGGGCCTTTTACTCCCACCCGATCTGCTGAGTCCTAAAAGCTTACCTTATCTCAA
GATAATCAGAAGAGAAGGAGCAGAAGCTAAATGTTACTCCAAGAGTTTGCCAGTTATTTA
TTACAAGATTGACTCCCAGCATGGTCTGGATATGGTCCTGTTAATCCCTGAGAAAGGACT
GTACACGTAGCTCTTTTAGTCCCCATCTTGTTTTGAAACATTTTGCCATATTCATGTCTC
CTTGCCCCCCCCTCCCAGCATGTTTTGTTGACTTTTTTCCATCACCACCCCCAAAAAAAC
AAAAAAAGCAAACCACAAAAACCTAAACTACGGCCTTCTGCCTTGTTCAGGTGTTTCGTC
AAGGCTCCAGGTGTGAAACCCAAACATCTTGTGAAATAAAAGTATGTCTTTTTTTTTACT
AAAAGTGAATGGAACCGAGCAGAAGCTCTTATTTTGGTAGAACTAACCCTTACAGAGGAA
AGGAAGAATAAGCACCCTTCGTTGCTTAGCACATTGTTTCTCCCCTACTTAGGCTATGGG
TCCTTCTTAGTTGCCAGGTCTTGCTTTAGACCCCTCCATCCTTGTATGCCTTTATCTGAT
TCAAGTCACCTCCTGTTTGTGATTAATTTGTCTGCCCCTCCCCACTTAAAATAACAATTC
TAAAAGCACTTCAATAGCTCAATCATTTTAAGATTTTAGCCATCATTCTCTTCCTTAGTA
ATAGGCTTGCTTTCTCTCTAGTGATTGCTTCCTATGATATGCTTATAAAAGCTTTCCTCA
TCCCCCTTATCACGTGATTTCCTTCTGTCAAATACCTTTTTTCCTTTTTCTGTGGAACCA
TTAAACTATTAAATGTACTCTGTAAAGTTCTCCTCACCCTATTTCAATTTCAGGTATCAT
ATTTTTTTCTCATAGGAAACTATTGCTGCCCTTTTTTGGTTTTCAGAATTTTTCTTTTTA
AGGAGATTATAGTTTTAATTATATTTGGCCTAGTTCCCCATTGTCAGTGCTTTACCATGT
GGGGCATCTCTGGGATAACAGTTAGTTTCTTCCTATCTTATTAGCTTACTATTCTCCTTT
GGTCCCTCCCTGGAGCTTTTCATCCTCTCTACTCTGATGCTTCTGGAAGCTACTAAGAAG
TTTAAATGGCCTGTGTGAAAATATGTCACTGTCCTATTTTAGCATATATATGTAACATTT
ATAATTTATATCATGCCTCCATCCTAGAGGGATATGAGGTGGCTTATGATAAAAAAACCA
CATGTCCAACTATACTGTTAAAAACGGTCAGAAGGGGAAATCAGAAACTGTTTTGAGGAA
CAACATAAAGTACTTATCAGACACAAGAAGAAAATTCCTGTAAAAAGTTAAAAAAAGAAC
ATAACCTTTTAACCACAAAAGGGCTTTGCTAGTAGTTTTTAGATTAGTAGTAAAAGAAGA
TTGTAATTGTGGTCTGAAAATGTTTTTGTGTAATAGCAGAATTACTGATATATTTCTGTT
TTTACTCCCGAGAAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCATTTGACAGGAGAAGGCGCCTAAGTCAAGAACAAGATTTTCCAGAAGTGGTGGG
ATCTCCTAGAGCCTTGGGTGGCTCCTATCCCACCTCCCCCGGCTTGGCATGGAGCCAGCC
CACGCTCCCATTGCAGACCCCTGGTCGCAGCTCTGGAGGGAATAGAATAACCCTCTTGCC
TATACTGGGAGCAGATATGCCTGGCCCAATCTATTAGGTGGTAGTGTGAAGGATCCACTC
TTCCAGAGCTTGTCTTGTGGGTAGAAAGCAGCTTACCAAGCTCTCCTACAGAATGCTGTG
GGACAGCAGCCAGGTGCCTGCTTGGGGCAAGGGATTGTTGGCTGTAGGTCATATAGTACA
GTGCCAGGGACCAAGAGGAAGGGGAAGAGGGGACATTCCCATCTGTGTAAGTGAGGGAAA
TCGTAGGGCCACACACACATGCCCAAGACAAGATGCATGGGCAGAAAGAACCAGGGTGGC
CCTATGCTTTGGCCTGGCCCTATCCTCCAAACTCATTATATGGATAAGCCCTAATGGAGA
GTACTAGCACAGGTCAATCTGCAAAGACCAGGAAAGGTATTTTCTTTATTTCCTTCTCTT
TTTTGTGTGTGTTAATTCCCTGGCACTTAAAGAAAGCTCTGTCATAACACTGGCTGGATG
CAAGCTTTAAGGGAACACAGTCTCAGAGTCTACGTTCCAGTGAGAGCATCAAAATGTCCA
CGTTTCAACCAAAGATTACAAACATACAAAGAAACAGGAATCAATTGGCCCAGGCAAGGG
AGAAGATTAAAGCATTAGAAACCATCAGTGAAGAAGATCAGACCTGGGACATTCCAGACA
AAGGCTTGTAAAAAATGGTCCTAAAGATGCCCAAGAGGCTAAAGCAAAATATGAACAAAG
AACCAAAGCAAACCAGAAAAATAATAGATGAACACAGAGAGAATATCAATAGAGAAATAG
AAGCTATGAAAAGGACAAAACAGCTGAAGACCACTGTAACAGAAATTAAAAATTCCCTAG
AGGAGTTCAACAGCAGATTGGAGCTGGCAGAAGAGATAAGGCAATTGAAAGTATCCTGTC
TGAGGAGCAGAAAGCAGAAAGAATGAGCAGAGCATGAGGAACCTGTGGGGTACAGTTAAG
TGTACCAATACCTGCTTTGTGGGAGTCCCAGAGGAGAAGAGAGAGGGGGGCGGAGAGAAT
ATTAAACAACTAATGGCTGAAAAACCCCCAAATTTAACAAATTTACAAAAATACACAGCC
AAGATGCCCAGTGAGTTCCAAATAGGATAAACCCAAATAGCCCCATGCCGTGCCATGTTA
TAATAAACTCAAACGCCAAAGATAAAGAAAGAATTTTGTAAGCTGCAGGAGAGAAGCAGC
ATGTTACCTGCAGGGGAGCCTCTATAAGATGATAAGTGGCAGTTTCTCACTGGAAGCTTT
GGAGACAACAAAGCAGTGGGAAGACAGATTTAAAGTGCTGAAAGCAAAAGCATAAACAAC
AACAAAAAAATGCCAACCAAGAATTCTGTAGCTGGCAAAACTGTCTTTCAAAAATGAGGG
AGGAATTAAGACATTTCCGGATAAACAGAAGCTGAAGGGATTTGTCATCACTAGCCGGAC
TTAAAAGAAAAGCTAAAAGGGAGTTGTGCAAGTTGAAAGGAAAGAACACCAGATAGTTGA
CTGAAGCCACGTGAGAAATAAAAGATCTCCAGGAAAGATAATGGCATGGGTAAATATAAA
GACCAGGTCTGTTGTATATTTGATTTGTAACTCCACTTTTTACCTCCTACAGGATCTAAA
AAGGCAAATGCATGAAATATAATGGATAAATCAATGGTTTTAGAGTCATAATGTATAAAT
ATGTAATTCATAACAACAACTCCATAAAGTTGGGGGACACAGGAGTATAGGAACATAGTT
TATGTGTGCTATTGAAATTGTTAAGTTGGTGTCAAAGCAAACAAGATTGTTATAGATTTG
GGATGTTAAATTTATGTCTCATGGTAATGACAAAGGAAGTATCAGACATTATGAAAACTC
ATAGAGACAAAAATTAGAGTAGAGGTTACCAGGGGTAGGGGTGGAGGACGGCAGAGAAAA
TGGGGACTTACTGCAAAATAAGTGTAGGGTTTCTGTTGAAGTATAGAGAGGTGAAGTAAC
TTGGTCAAGATTAGAGAACTAGACAGTAGCAAATCAGGAGTCTTCTTTACTCTGAGTCCA
CCCTGTTAGAGTGTAGTTTTAAGAAATTTATACCAGCTAGTATTATACTCTTTACTCTTT
CCCCTTATCTCCTCTACCTGCACAATAAAAATAGGAGGAAGGGTTATTTAGAAAATAGTG
TTTGTTTGCTTTTTTAGGTAAGTTTATTTGAGGGAAAAATACTTGTCTCTAAGAAATTGC
ATATGGTATAGTATTTATCCTGTGGACCTGAGATCTATTAATAGCAGGGCTACTTACACA
ATAGCAGTCATGATACTTGGCTGTAATGAATTAAACAGTGATAATTGCCGCCTTCATTAG
ACACTTTAATAAAATTAACAAACACTCAGCCTTTTAATGACCAGGTTTCAAGGCTTTTCT
TAACCCATCTTTTCCCCCAAGTACAATCAATTTATCAGTAGTGATTGGCCCTATTTCCTA
GTCTCAAGCTTGCAGTTGAGTATCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGGAGTATAG
GAACATAGTTTATGTGTGCTATTGAAATTGTTAAGTTGGTGTCAAAGCAAACAAGATTGT
TATAGATTTGGGATGTTAAATTTATGTCTCATGGTAATGACAAAGGAAGTATCAGACATT
ATGAAAACTCATAGAGACAAAAATTAGAGTAGAGGTTACCAGGGGTAGGGGTGGAGGACG
GCAGAGAAAATGGGGACTTACTGCAAAATAAGTGTAGGGTTTCTGTTGAAGTATAGAGAG
GTGAAGTAACTTGGTCAAGATTAGAGAACTAGACAGTAGCAAATCAGGAGTCTTCTTTAC
TCTGAGTCCACCCTGTTAGAGTGTAGTTTTAAGAAATTTATACCAGCTAGTATTATACTC
TTTACTCTTTCCCCTTATCTCCTCTACCTGCACAATAAAAATAGGAGGAAGGGTTATTTA
GAAAATAGTGTTTGTTTGCTTTTTTAGGTAAGTTTATTTGAGGGAAAAATACTTGTCTCT
AAGAAATTGCATATGGTATAGTATTTATCCTGTGGACCTGAGATCTATTAATAGCAGGGC
TACTTACACAATAGCAGTCATGATACTTGGCTGTAATGAATTAAACAGTGATAATTGCCG
CCTTCATTAGACACTTTAATAAAATTAACAAACACTCAGCCTTTTAATGACCAGGTTTCA
AGGCTTTTCTTAACCCATCTTTTCCCCCAAGTACAATCAATTTATCAGTAGTGATTTGCC
CTATTTCCTAGTCTCAAGCTTGCAGTTGAGTATCGGCTTGCATTGTTTTGTTATGGTCAG
TGAATACTGGACTTAGCAAGCACGATATGATTCCAGAGCATCTATGGTTTGTCTTTGACA
CTGGGATGAAGCATGTTCCCATGAAATGAAGTGACCTTTGGGGTATACAGAGCCAGCACC
TCGCTCTCATTGAGTTTCCAATTTTCAGAGCATGGCGGTACTTCATGGTGTAATTATTTA
GTTTGTATCCAGCTTTACTGCAGGAGGGAAACAGAAGTGTTGTGTGCACTGAAATGTGAT
AATTATTAAAAACCTACCTCATACTCAATTATTCTTTGAGTTTTTTCCTTTCCATCCTTT
GCTTGTTCTTCATTTAAATAGAACCCCTTTACAACCAGATAAAGAGTGAAGAGAGCTGGG
TTGTTGCCATGCTCGGCTTTTTACTAGTTTCTGTGGTCTTGGGCAACTCTTTAACCCCTC
TAGGCCTCAGTTTCCTCCTCATGGGGAATGGAGATAATGTATGGTACATGCAGAGTACAG
AGCCTGGCCCAGAGCAGGTGTTCAGTACAGAGATGCTACAATAATTATTATGTGCTAAGA
TGGTCTTATGATGTAAAAGCTTGGGATTTGTTTTGTTATGGTAGTAAATAGTGTTTCCCT
GTGGACTGCTTTGTGCTGCTCATGTGAAACCCAAGGAAAACAGTGCAATAGTGTTTGCAG
AAGGAAAGATAGCTCATTGTTGCCTTGAACAGACAAAAGAAGCTCATTATTGTACCAAGT
AGTGACTGTTGCTATTTAAATGGTTTATTTGTGTGTCTTTTTCTGTTTCTTTCCTAGGGA
TTTATTTGTGGCTTTTCAGTAGCAACAGGTGCAGCAGCAAGACTAGTGTCAGGCTACGAC
AGCTATGGAAATATCTGTGGGCAGAAAAATGCAAAGTTGGAAGCAATACCAAACAGTGGC
ATGGACCATACCCAACGGAAGTGAGTACTCTGTGAGCACTAATGGACATTTTGAAGAGGG
TGGAGAAAGTCCTGCTTTTCTGACTGTTAGAAAGAATATTCTTTTTCTATGACTCCGGTT
AGTGTTTGTGAATTTTTAAAAATTGTACACTTGAATCACTCCTGTTTTCAGTCTACAAAT
ACATGCTCCAGGAAACAAAATGAGCTGCCATGTTAAAATGTGAAAGATTAAGTTTTTAAT
GGGGTAAAGGCTTGATTTGAGATGAATATTCTTGTACTCTATTTTGTCATTAGATTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCAAATAAAGAATTATATACTTTAGTAGAGAGAGAATAAATAAT
GAGAAGAAATATAATCTATTCCTAGATGAGCAGTCTTCACATAATAAAGATGACAATGTT
AATAAAGTTAATTTATAGATTTAATACAGTACCAGTTAAGATACCAAAAGGATATTGAAT
AGAACTTGATTGATGGAGTAAATCACAGAGTAAAGGAGCAGGCAAGAATTTCAAGGGGAA
AGAGGTTTTTAAAAATTAGTCTGGTTCCCAAAATAATTGGAGAGGACTAGAATTAGATGC
ATGTATTATAAGACAATTACAGGAATAAAAGATCAGGCGCCACACAATGGAAGTTGAGAA
GAGATTAGATCAGAAATCTAGGCTAAGTGTAGTTGCTGAAGTTGAACACCAAATGAGCTG
TGAACTTTCTGACTTTGAAGGCAGAAAAGGAAACTCAGTGGATCACCGGAGGTTGCAAAT
TCAAAAGCTTCTAGAAAGACATTATGCAGCACTGAAGTGGGCCGAGAATAAGACAATCGA
GAATGGTGGACACTTTGAATGAATGTGTGTGTGGCCTATATAAAGGAGATAGCTGCTACT
TGGTTCTATTATATGTGTGTGTATGTTTCAGGGGGAAGCATACATAATCTAACTTCTACT
TTTTAAATGTTGGCAATTAATGGTACTGGCCATGCAAAATGTGTGTGTGGGTGACTACTC
ATGCTCTGAGTAAGGATTATGTATCTGTAGCTGTCATTGTCTAATTAATGACTGGCTTAA
GAGGGGAGCCAAAGGAGTTTTGCCACTCAAGATCAAAATTCATTCCAAAATACATTAGTA
ATAATACCTGAACATAGGTTAACAACAGTGAAGGGAACAAAAATAGAAATAAACTGATAG
TGATTTGATATACGAGAACACAAGTAAAATTAAAACTGTCAAAGAAATCAGTATTTGACA
AAAACCATTGGGTTGAATGACAATATGAAAAAAAAACCATACATTTAGGTCTATCTTAAT
CTCTTTATTTTACCAGGCAAAATAAATTCTAATTTTAAAATGGAATATTATACATAACTT
TGTTGTGGAGAGGAGGAGATAATTTACAGATTAAAGCAATAAAGAAGTGAAGTAGTACCA
TGTGGTGAGCATATTTAATGATCAAAAAATGTGATTTTCTGATGTTCAGGTAAAAGCAAG
ACAGTAGGAACAGTGTTTGTAGTTATTATGTGGAGGATAAGATGCTTTGTATAGTTGAGG
CTATCTCTATGAGGGTAGATCCGATAGATAACCAAAGGACTGTTTATACCAGGGAAAATA
CTAATAATATGTTTGACTTGAAGACCTTCGTTCGTAAAATGAGGATAAAAGTAGTACCTA
TGTCATAGGGTGTTTTGGAGGAATAGATTTGATAAATCATGTATACTTCTTAGCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAGTTAACCCATAACTGCTTCCCGGTCATTGATTCTTGACACACTGTTTCTCAATGT
AAGTGCTGGATTAACTTGATTTTGAGAATGCTCCTTCTCACCATATGGTATTGATAACAA
ACTTGGATTTGGAGTTTTATTCCCACTGGTTGGATTAAATAGAAAACTTTTTTTTTTGGT
AGCTTTTAAAAGTGTTTAAAAGCAAAATTTACTTTCTTGCTTTCATTTAATATAAGGAAC
ACAATTTGATGTCAGTGATTCTTGGCTACCATCTGGCAATTATTTCTCACTGTAGTAAAC
ATATAAGAAAGAGGCAGACACTGTAGCTAAGTAGAAGAACCATTTTTTTCTCTCATGCGT
TTCCTGTTCTGTGCCTTTGTTTTCGCAATGTTAATGTCTCTTTGGCTCTATTTTTCTTAC
TTCTTGCCCTTTTTTTAAAATTTCTTTGCGGGCCTTTGATGATCCGTCAGAAACTATGAA
GCATGAAATCTTTTTTTTAAAAAAATGCACATGAAACTTGTTTATGATTTCTGGCTGTCA
TAGATCTCACCCAGGTTAAGAATCTCAACTGTCCGCACTCACATCGGTGATTTCATACAC
TTCTTGGGGTGGGGTTATCATCTATATGCTAATAATTCCAAAATCTCTGTCCCCACCCAG
AATACTCTGCTAGAACGCTCAAGCCAAAGCCTAGATCCACTTGGATGCCCCATGGCCCTG
CAGCCATAACATCTAACATCTTTATCCTTCTGTATTCTACTCTTCTTTCTAAGTGCCCTA
TCTTATTAAATGGAATAGGATTCCAAGTCTGAATGCTAAGCAACATCCTCAGTTTCTTCC
TTTCCCATCACACCTAGTCTGTGTTCCTTCATTGTACCTTCCTGCTTTTGAAATCTCCTT
TTCATTCCCATTCTCATTTCCATCCTCATCCAAGTCATCATTTCTTGGTAGAAATTCAGT
AGCCTCCTGACCAGTCTCCTTATTTTCTCTCCTGCTTCCCTCTGATTCATTCTCTACCTT
ACAACCAGTGGTCTGAAAACTCCTAGCAGCTTACTTTCTAAGATCTTTCATAATCACTTG
TAAGGCCCTTTGTGGTCTAGCTCCAGTTTGTCCAGCCAGCTCTTTTCCATGATACTTCAC
CTCAACCATACTGACATTTGTCATTTTCTGAACGTATGGCTTGCACTGTCTGTTCCCTCC
CTGCTCCCACCTCTTTGCCCCTACGTTTGGTTAACTCCTATTCATTCTTTAGGTGCTGGC
TTTAGATATCGTTTCTCTCTGGGCACCTACCCTGTCTCCATTTAGGGGGCCCATCTGATG
TATCCTCTGGTATCCTCTTTTCCCTGCTATAACACTTGCACTGTTTCATAATTACCTCCA
TACCCTCTGTACTGGAAATGTTAGGAAGGGAGACATTTATTTGTGTTGGTTATATTCATC
GCTGCATCTCCAGTGCTTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGGAGATTCCACTGTGGT
TTTCTGTAGCCTGTATTTAGCATAGCACAGGCATCTGCTAGGCCATTGTGTTTTTCCTTT
GATGTAATTCACTGATGGCAGTGCCCTTGTTGGAAAGGGGCTATAAATTGTAAATTGATA
TGAGGTAATAATTGGAAGAAATGATCAGACTCCATTTTTATTCCTCTCTGGGGGAAAACA
CATGCCAGGAGTCACTAAAACCAGAAGGCAACTGAGAGATTTTTCATCCAGCTTTCCAGC
TCTAGTTCCATGGTGTTTCCATGCTGATTGGAGAGAAGACAAGACAAATTCGTCAGGAAG
TGGCCAGCAGCCCTCGTATCTGCTTGCCACCATTTGCTCCTAGAAGCCTTGCTGCAGAGA
GTTGCCATGGCAGCAGGAGGCAATTTAATGGTAAATGCTCATCTCTGGAACAGTGCTGCT
GGTGCCCCTGTCCTTCTCCTCTCTGGCACTCTCCCTAAGGGACTAGTTACACCAGGGCAG
CACTGGGCTGTGACCATTTAGAGCACGCAGCCTAATGGAGCAGGGCTTTAGGAGCCTCCA
GAGCCTAAGGAGAGCTCCCGCTTTATCCCCTGCTTCCCCTTGGGGCACAGCCCTTTGATT
CACCACCCCACAGTCCCCCATGTCACGTTACTGGCAGTTCCTTAAGTATGTTCTCTCATG
CCTCTGAGCTTGTACACGTGTAGTTTCCTCTGCCTAGAATGGCCTTCTCCTTCTGTGTGG
AAAATTCCAACTCACTTTCAAGCTGTAGGCTTAAATATTACTCCTTCCTCCTCCAAGTTT
CCCCTGACCCCTTACCTTCTGTGCAGATTCCACCATCTCCACTGCCATCTCCACTTTGGC
ATGTATCACATGGTTTCGAAATGACTATTTTTGCCTCTTCTTCTCTAGGCAGCAAGTAAC
TTGCATTCGAGAACTAGTGTTATGGGAGCAGATGTAGCTCAAGTGGTTGAGCGCTAGCTT
CCCCCATACAAGGTCCTGGGTTTAACCCCCATTCCCAGTACCTCAAAACAACAACAACTA
CTGTGTTTTATGCATTTTGTAGCACAAGGACCTAGCCCAGGTGTGGGCACAAAGCACACA
CTTAGTAGGGGCAAGTGTTTTCCTATCAGCCTGTGTCATCCTCGTGTGCCTGTCAAATAC
CACGCAATGTTGAATACCATTGTCTGCTCGAGGTTCCCAGAGGATTGGCGGTTCCCAGAG
GATTGGCCCGTGTAAAACCACTGACTTGGCCGGGCTATGACTCCCTCTCCATTACATTTA
TTCTCACTCTCCAGTTTGAAGTGAAGTAGCAATGGTGGAAAGAGCAGGATGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGGAACCCGAGTTCCTTTACCTTGCCCTGTCTTTGATGAAGAAG
ATGAAAGCAAGAAAGAAGTTTAAACCTAGCTTTGAACCTTCTCTGACATCTCTTTCTGCA
TCAAGTCATTCAGCGTTCATGTCACAGCTTTAAAAAGCACCCCTTTGTGGGCTTTTGTCC
CTCTTCCAGAACTTCCAATCCCCTTGAGCTTTGGTGCCTCTTCTTTGCCTCTTTGCTTGT
CTTCATCTTTGGTGCTTTTGGTCCCCTCAAGAGTTCACTGTGTAGACAGAACATTTTATT
TAAATCTCTCTACTTTTCTTGCCTCTTTGGTATAATTTGTTGTATTTCAAGATTTCAGTT
TAAAATGAATTTATTTTTTCCTCTGTACCATTCAAATAATTCCCAGAAACCAAGTCTTCT
GTAAAACGTTGGCTTTACAGTTTTGTCTGAGCATTTTTCTCCATTCCCATCTAACTTTTA
AGTTCAAAGCTCGTATAGGCTGTTTTGCAATTCCCTTGGGAAATGTGTTCTTCTCAGTAT
CATGTGAGCATGCTGTGTGCATATCATATATTGCCAATGCCTGCAGCTGCGAGAGCCGCT
GAAGTTGTATTTTTGTCTCTTATTTCTCTTCCTTCATTCGCACTTACGGTATTCATTCCA
GTTCCTCTAAAGGATGCAAAACTTAAACGAAGCTGTTGTTAAGTTATTAATAGGTCTTGT
AAAAGAGCCACTAAGAATAGCAGTGCAAAACTTCTTTAAACTTAGGCTTACAGATTGTGA
CAGTGGTTCTCGACTGTGGAGGCATGAGGGCTATGGGCAAAATGTGCAGTGAGAATTGCC
AGGAGCTTTTTGAAATCCTATTGCTCAATCCCCCCCACAGCCATTTGCCTTAAGGCCGAG
AGAAGGTAGGCTGAGTATTTTAAGAGGCCTCTCTAGAATGTATTGTAACTCCTTGTGCCT
TGCCCTCTCAGTTGAAAACAACTCACCTGTAGATTTCAATAAATTACAATAATCTGGACG
GCCAATGCTATGCTTATTTCAGATTTGGTTTTGTTTCACTGCCAAAAATTTAAATTGCCA
CATAAAGTTCATTTTGTTCAAAAGTGTTTTATTCAAGCACCATTCTTACTCTATAAATAC
TCAGTTAAATATCAATTGGTTAAAATATAGTTATTGGGAAGCAGATGTGGCTCAAGTGAT
TGGGCTCCTGCCGAACCCAAGAGGCCTGTGGTTCGGTGACCATTGTCTCCTAAAGAAGAC
AGTGAGCTGGCACGATGGGTGGGGGCACCAAACTGACACAGAGACACAGATGAAAAACAT
AATGAGACACACACAAGTAGGGAACAGAGGTGGCTTAAACATTAGGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTGAAATTCAGAATCAGAAGGACTGGTTGAACTAATGCTCTGGCACTACTAGCTC
CTTGCACCTGACAATTAGTCCTTTAGGGCTCAGTTTTATTATCTGTGGGATGGTAATGAC
TCCCTACCTCAGAGCTGTTGTAGAGATCAAGTAAGGTCATGAAATGTGACAGTGCCTACC
CACCAAATTCCAGGAAACATTAACAGAAGTAGAACCTAATGCCTCTAAACTATTTTTAGC
ATTGTGTATATGTATTAGTCAGTGAAGGGGTACTGATGAAAAATACCAGAAATTGATTGT
TTTTTATGAAGGGTATTTATTTGGGGTAGAAGCTTACAGTTACCAGGCCATAAAGCATAA
GTTACTTCTCTCACCAGAGTCTATTGCCATGTGTTGAGGCAAGATGGCTGCTGGCATCTG
CCAAGAGTTCAGGCTTCTTGGGTTCCTTTCTTCCCAGGGCTCTGTTTCTCTCCGGGCTCA
GCTGCTGTGTGCTCTTCACAAGGCCTGCTGTAGACTTATCAGGCAAATGGCTCTTTGTCT
ATCCCCAGGTTTCTGCCATGTCTAAGGAGCTGTCTCTTTTCCTCTCTGTTCTTCTCCTAT
GTGTTCACTTCCTGGGCTCCAACTCAAAACTTTCTACTCTGTCCTTCTGCCATTTCTTTT
TTCTGAGAGTCCCACCCACCAAGGGGGCGGAGACTGAACGTCCTACTGATATGGCCCATC
AAAGCCTTAATCGTTATTTAATCAAGTAAAAGTAAAACCTCTGAATCCAATACACTCTAA
TATGCCCAGAGGAAATATGCCCAGTTTACAGACATAATCTAATATTTCTTTTTGGAATTC
ATGAACCATATCAAACTGCTCCAGTGTGTGTGCATGTGTATTTGAATTTGTGTAATGAAG
AGAGAATTAAATGGAATATGTTCTTTGATTGTGGAGGTAGGTGACTGGAGTGTGATGATA
TATATGCATGTGGGTATGTATTTCCTGATAATACCACTGAAAATTGTTTTTTAGATTTTA
TTATACATTTTCCAAACCATATATACAGGCTAAAAAATGTGCAGTGTTAGTCCTACAGAG
CTTCAGTCATAGAATTCTTCTCACCCCCTGTTCTTCTTTTCTTGGTGCTAGACCTGTTCC
AGAGGCCTACTTAGTTCTTATCAAGGCTTGTGACCTAGCAGTCTTAAATATCCCTACACA
GATTTTTCTTCTGAATGAAAGCTAAATATTAGCATTGTAATCCTGTTTTATGCACCTATT
AGAAAGTGTTAGGTTTAGAGCCTTACTGTCAAATATAAGCTTTGTGAAAGACAAATACAT
TTCCATAATGATGATGAACAGTGTGTTACTGGGTATATTCCATATGTTAGGTGCTTCATA
TATATCATGGATAACCTTACAATAACTATAAAGTAGATGGTATGCGGTTTTACAGATAAG
GAAATTGACTCAGAGGATATAGCTCCTCCCAGGGTCCGAGAACCACTAGGAGAGAGAACC
AGAATGCAAGCTCTGGTTGGTCTGACTAAAGCGTGGTATGAGGCTGCTGCCCCATCACAG
TATAAATCAAAGGGGTGTATTTTGAGGTAGAAAAGAGAGTAAGTAAACAATATGCTGGGG
GCTCTGGGCCTTGGAGGAGGCAGACGCCTGCAGGACAGTCAGACAATACATCTCTTCTCA
GTGGGCTCAGGTGAGGCCCTGGAAGCTTGGCTTTTTCGCTTTTTTTTCCAAAGCCTGTTT
TTCTACTGTGATTGGATTGTGTGACATCTCTAGATATTTCCGAAGGCCTTTGTCATCGCT
TAGAACCGTCCACTCAACTGCTCTCTACCCACCCACCTTCACTCCCCCAGCACACACACA
CGTGCACACAGCATACAACAGGATTGTTTTGAGGATTAGAGGAGTTAATATATGTAAAGG
GTTTCATACAGGACAGTGCCTAGTACATTGTAAGTGCTCAGTAATGTGGACTACCATTAG
TATTTGAATTTTCATTGTTAACAGTATTACTGGTTGGGGGAGGGGGCGGTAGGAGAGGTA
GGAAACCATTCTGAGGTCCTCTGACACCTTCCTCAAGGGCCTGCCTGTGCCCTGTGGGGG
CTGGCTTTGTGCAGTTCTTTGCACGGGGTCCCAAGTGTTGGCATGCTCAGTCAGGGTACA
CAGAACAGGCAGAGGGACACTAAGTAAGGGACACTGCTTAGTTCTACCCAAAGGTTGCCA
GAAACACTTCTCTCTAAGCTCCAGCTCCTTGACATTAACATAGAGCAGTTTATGAATCCC
ACTTTCAAACCACATCATTTTAGAATCCACAAATTATGCCTGGCTTCTTTTCTTTCCTTT
TATCTGAGTATAAAATCAATGGTTTTGGAGTCACTAAGAGAATGACATTTCTTGTTTTTC
AGTTTAGTAGTTTGTAGCTTTATACCTGACCTTCATGTTGTGTTCTTGGTCACCTTAATC
TACTGAAGTATGTGATGTAGATCCTGGCAAAGGCCTTTTTGGGATTTCTTTAGATTGTCC
ATCCCAGCACGTGTTGAGTTTACATCTTTGCTCTTCAGTTTTTCCTTTAATTCTTATATT
TGGTTATATTTTCTGTTCCAAACTTGAATCATACTCTGCATGTGGAAAAGGCTGTTGACA
GATATATGATTTTATAAAACTTACCATGGACCCAATTAGAATTGACCCCGAGGCTGGAGG
TTCTTTAACTCTTATTTTACTTGAAAGCATTCCGACTTGTGCTTCTCCCTCCCTTGACCC
AAAATATTATACTTGGCTTATCTTGGGTAGTAGTGGTTGGCCCTTACTTTCTCTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAATTTGTCATAGCCTTAAATAAACTGTCAAGGAACTTTAAGAAGA
AAAAAGAGAATTGAAAGTAATTTTGGACTTCTGTGATAAAAAAATCATAGTCACTGAGGG
AGCTTGTTAAAACTCCAGATTCCTGGGCCCCACCAAGGGAGTTTCCGGTTGAGTAGGTCT
TTGGGCTCTGGAAATTTGTCGTTTTTACAGATGCCTCAGATGATTTTGATGTAGCCTACT
GAGTGTTTTGGAATGACTAGACCACTTACGTAAAATTTGTTTTGTTCCCCCCCATGTGGA
TTACAGGTATTTAACTTATTATTTTATTTTTATCCCTATTTAACATGTATGCTAAATATA
TCATAGAAATTTGAAAAGTTCAGACAAAACATAAAGAAGTAGAAACAAGACTTCCACACC
AGTTCTTTTTCAGTGTATTAATGTATATATATTTTTTTCTGTTCTGCTTTTTAAAAATTT
ACCATTATGTTGTAACCATTTTTTCCTAAGAAGAAAGTTTGAGGTTAATCTATGAGAAGG
AGATGAGAAAACCAACATGGTTAGTTTCCTGAAATCCAGCTCTGTTCTCTTGAAAATTTT
AATCTCAGGTCCCATCCTCAGTTCTGCATGACTCTCCTCAGTTCTCTTCAGAGAACAGTT
TTATTAAAACCACTCTTGGGGGAGGTAGGTGAAGCCACATACTGATGGCCCCACAAGCGC
ATGATTTTGTACATACATGAGGTTTCATGTTTGTATTTTTCATAGGGACTCCTCAGAGCT
CCAGTCCTGCCCAAATCACAGACTAGTTCTATCCTTGGCACAACAGCTAACTCCACGTGC
GATGACTTCTAGCTGGGTGGAGAAAGTGTCTGGGATTGTAGCTACATACATACCAGTAGA
GCTCAGATCTGTCAGATGGTGTGCTAGCCTTCCCACTGCTCCCTGCCAGCATCATAAGTT
AACAGAAAGAGTTTGGGACTGAGTGGGATCTGGATTCCAATTTGGGTTCTGTCACTGACT
AGCTCTTTGACCAGGGGCTAGTGATACAGCCTCTCAGTGCCTAGATTTCTTCATGTGGAT
AAAAATAATATTCCCCTCATAGGTTGTTGTGAGGATTAAATGTGATGTAGGAAAAATACT
GGGTACTTGTGTGGGTGGTGAATAAAGAGGTGCCAACTGCTCTGTAAGGTCTTGTTTCCT
GTTCCCACATGATATCTTCACATGTGTTGGCCTTCTGAGCCTTACATCAGAACTATAATC
CCAGTTATTATCAGGTCTCTTAGGGAGGGGTCTCTTAAGGGTTTTTCCCAAATCTTCTTA
GTGTGAGTACAAATAATGACCTGTCATAGGTAGTGTACATAAATAAATTTATTTATAGGA
ATAAATATGAATACATTCTATTTCAACAGTGGTTAAGAGTCTAGGATCTGGAGTAAGATT
ATCTGGGGTCAAAGGTTGATCCCACCATTTACTAGCTGTGAGATTAAGGGCAAGCTACTT
GCCCTTTCCATGCCTCAGTTTTCCCATCTTTGAAATAGGGATAATAACTGTACCTAAACT
ACCCAGTACATTGTTATGAGGAGTAAATACATGCAATACTTAGAACACAGTCTGGCATAT
TCTAAATTGCTCAATAAAAGTGTTGGCTATTGAAGTTATTATCATTGACATTACTGTTCC
ACCAATGGAATGATAGTCTTCCTGCTTCTAGTTTCTCTCTACTTCTAGCTTACATACTGC
AGCCATATTAATATTTATTCCTAGCACTTTAGCCACATTAATCCCTTGCTCAGAAATCAC
GGGTAGTGAAAAAACAAAAGTCTATTTGTCTGTCAGATGGGGTGCTAGCCATCCCACTGC
TCTCTGAGCTCTACTGGTATAGCTATTTGACATTCAAACCTCTGATCAAGCCTTGGATCT
GGTAAGATCTAACCTTCCAAACTGATTTACTACTCCTAAATTGCTGCCCTGGCCTCTAGG
GGACTAAAATTATTTGTTGTTCCTTGTGTGTGATGCTACTAACTCTTGGTGATGCTCTAA
ACAGTCTTCTTCATTCCAAGTACTTCTCTGACCTTCCCACTTGTCTAAATCTTGCCCATT
CTCTAGGTGCCATTTTCCAAATCTATGCAGTGCATTATGGTAGACATTAGCCACATGTAG
CTATTTAAGTTCAAATGAAATACAATTATAAATTTAACTCTTCACTCCCATTAGCTGCAT
TTTAAGTGCTCATTAGCTATGTGTGTGGCTAGTGGCCACCATGTTGGACAGTTCAAATAT
AAAACAGCTCCGTCACTGCAGAAAGTTCTATTGAACGAGTGTTCCAAAGACTACCTACTC
CTCTAAAAGCTTTGAGTACTTGGTTGAGTATCTTCAACTTCCATGGTACTTTGCTCTTTA
TCACTTTCCAGCTTAAATCCTAATAGTACAGATACCCTACCTCTCCTCCTTAAGGGCAGA
CAGGTTGTCCTTTTCAGCTTTTATGGGTAAAGGGTCAATGGACTCCTTTCTCCTTCTTTA
AGGACACATTTGATCTTGTTTATTTTCTAACTCTATCCCCACACCCCCCCCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAATAATTCATTTTATTCATTCGTTTAT
CTCTCTCATACATACTTTCAAGTGGTTATTCATGCCTTTTCTTCTCGTGAGCCCTCTTGT
TCTTCCTCTTTCCTAACCTTATGCCCTACAGAGAAAATTGGAACCGTCTGGTGAAAGCTT
CCATCTGAGTTCTTATTTTCAGCGGGGCATGCATTTCATCTTGACTCTCGCTTTCCTTCC
TTCAGCTTCTGATGAACAAGCTTCTTTCTTCCTTTATCATTATTTTTGAAAACTCAAATA
ATGCATACATTTTGGGGGAAAATATCCCCCTCCTTCTGAAGCTAACTGGTTTTATATGGG
ATTTTCATTTCACCCCAGCCAGACCATGACAGGTGGTAAAGGGAAAGGAAAGATATTGTC
TGGATAGCCAGTTCTTTCTTCCCTGCTTCCCCCTCTAATTTCAGTCCTTACCACTATCTC
TGGCCACTTCACTGCCCCCATTATAGACATGTTCAGCAGGGGTGTCTGAGTCTGAGCAGT
TAAATCAGACTTAAGCCCTGGGGTTTTTTGGTTTTTTTTTTTAAGGTTTTATTTATTTAT
CACATTGTTTGTGCTCACTGTCTGCTCACTGTGTCTGCTCGTCTTCTCTTTAGAAGGTGC
CGGGAACCGAACCAGGGACCTCTCATGTGGTAGGTGGGAGCTCAGTCACTTGAGCCACCT
CCACTCCCTGCTTTGTATCTCATTGCGTCAGCTCACTGCACCAGCCCATCACACCAGCCT
GTTGCGCCAGCTTGCTGTCTTGCTCTTCTTCTCTAGGAGGCACCAGGAACCAAACCTGGG
ACCTCCCCTGTGGTAGGCAGGAGCTCAAAGGTTTAAGCCACATTTGCTTCCCTGGGTTTT
GTTTTAACATACCATTTATTGGGGCTACTGTGTGCCCTGTGCTGTGCCAGACACTGTGCA
TTTCATTTCATTCTTTTCACTTGCAGTATAAATTCTAAACAGCAGATTTAGAAGTGGGTA
TAGCCTATGAGGAAGTTAGGGGCTGACTGCATGTTCTCAGTTCTTGTTAATGTTTTACAT
GGGATGCTTACTACCTCTTGCATTACTCTTACCAAACTATTTTATAATACAGAGTTGACT
TTCCTAACATAGCAGTAAACTCTAACAGAAATCTATTTTTATTGTTTATGTACCATTTAT
AGCATGTGAAAAAGCACTCCCATTTAAGTGTGCTTCTTCAATGTACAGTATTTTGTATAA
ATTCAAGCTTTGAGATTTGCCATTGGGAACATATTCACAGTTTGAGTACAGCCATGCATC
TGTGGTGCTTTCTCAGTGATCACTGTTTTGCCATTTAAGATTATGAAAGATATGTGATAC
ACTCAGATAACATTTGCTATTTGTGAATACTAGTAAGCCATTTGATTATCATTATCTAGT
TGTTAGGAGGTGCCCTTGGTTTAAGAGGTAATATCAATAGATGATCAGGCAGAATGGGTG
TAGCTCAGTGGTTTAGCACCTGCTTCATATGTTTGAGGTCCTGGGTTCAATTCCTGGTAC
CTCCTTAAAAAAAAAAGGTCATTAGACCACTGCACTCTTTCTTAGCAACCAGTAACAATA
TAACTTGAATCACATAGTATGGATTTTTTTTGCAAAGTGAATCAAAATCTTTTATGCATG
AATGAAATGATCAGCACTAGCAACTGATTTAATTGCCTCCAAGTCTGGGATCAACAAAGG
TAGTGTGATTGTTAAAAATGGGAAAAAAAACAAAACACAGAAATCCTTACATTTGATAAT
GCAATTTAAACTAATTCCTTCTCTTAACAAATAATTAGCCCCACTACGTATACAAAATAC
AGTTCCCTGCATTTAAGTAGCTTACCATCTAGGAAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAAAA
TTTTAAAGCAAGAAAAAATTAAGTATATCAACTGTTTTTTATATTAATTTTTTTTAAAGT
TTAAGGAGAATGCAGAGCAGAGATGCTACTAAATTTCCTACAGTACACAGGACAGCCTCT
GACTACAAAGAATTATCCAGCCCCAAATGTTAATGGTTTCAAAGTTTAGAAACCCTGTTG
TAATTAGTATGCTTTGTAGTGAATGGTGAAAAACATTTGAACAGTATAACATGTAACACC
AAACTATGAGAGATTAAAAACAGGTATTAAAAACAGGATGTACATTTTTATTCAACAGAT
GGCTTTTGGGTACCATGTATGAGCGAGGAGATATGAGTTCCAGATATTTGAAGGCATAAG
ATCCTGGTTCTGAAAGTGTTCAGATTCTAAAAACAGAGATAATAAACAAAAAGTTGCAAA
ATTATATGCTAAGTTTTATAATAAGCCTCAGCAGTAAATAGCTTTGCTTGAGTTGGTCAG
AGAAGCTTGACAGAGGAGGTAAAAGCATGAGTAGGTTACAGAAATTCTGCTCAAATTTGA
ATCCTCTGATGTTAGTCAAGAAAGGTCAGCCCAAGCAGAGGGAACAGCATGTGCAAAAGT
TTTTTTTTTTAGCCTCTTTTTTTTTTTGTCTTTGTTTTTTTAATGTTACATTAAAAAAAT
ATGAGGTCCCCAAATAACCCCCACCCCCCTCACCCCACTTCTCCCATAACAACCACCTCC
ACCATCATCATGAGACATCATGGGACATTCATTGCAATGTGCAAAGGTTTTGAAGCTTGT
TGAACAGCAAGAATTTAACCAGGAAATTCTTGATTAGAAAATATACAGGAGAAGGCTCAG
CAGAGCTGGAGAGTGGGTGGTAGAAATGATTTTTTTCAAATGAGATGTTTTTGAAGTATC
TGTAGAATGTTTTTTTGTCCCCCAGGGGACTTACTGACTAGTTGTTTATGATTATGATTA
TTAGGAGTGCCCCTAAAGAAGCATTGTGGTCTAGGAGAAAAGAAATTCTTTACTCTGGAA
GTATTACTCTTTTTCATCTATAATGTTCAGAGAGTGGTGATGGAAACACCTCGTAGGGGA
GTTGTCATATCTGATATTGAACTAAAGAATAAATAATTGTATATTATAAAGCATTTGAAA
AACTGTAGTAGTTAAATGTTCTGGAAGGTGATAGCATTCTTTTACCAAGATAAATGTTAT
ATGACCAAGTTAGGTTCCTGAGTTCACTTATTTTGATGGCCTTTGAATAGCATTGACCAG
TTTTATGGCTTGCCTCTGGAGTGACTTTAGATAAGCTTTTGGTGTTTGTTTTAGACTTTC
CATTACTCAAGTATGGTTTTCATATGTTCTCTGAATTTGAAGAAACAACTTTGTTTCGCT
GTTTATGCCAAAACCTCTCATGCCAAGTATTGTTTATACTTTTGCTGTAAAAATTTAAAA
TTAGGATTCTACCTTAAAAATGTTCCCTGAAAATGTGTTCAATAACAAATATGAAAAGAA
AAACAGCAAAACAATGTTTGCTGTGATTGTGTTGTTTTAATGTTCTCCACTGAGGCTTCC
CTGCCCATCAACCCTTTGAGCAGGAAGCAGTATCAGGCTGCTTGTGACTGTTACTACTGA
CACATTGTAAAGATCTTTTTCCTTTAATCTGTTTAGGGCAGGATCTATTTAGTACTGGCC
TCTATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGATATATCTATGTGAACCATATATCCTGGAAATAGTTGTGGTCTGCCTGTTC
AATCCAGGGTTGACTTTAAACTGTTTTAAACGCTCTGAAAACTGGCGGTCGTTTTCAATT
CTTTATTCCTTTGTACAGTTTATTTAGGATATATTATCTGAAGGGATATAATATCTACTG
CATATATTATGCTATATGCAGTAGTGTGAAGTATTTAGTAGTGGAAAGTATAGGAAGGCA
GCAGCCTGGGTGGTTTGAGCATGGACTTTGTGGATCAAGAAATCCTGCTTGAATCCTAGC
CCTACTACTACTTACTAGCTAGCTGTGTCATCTTGGGCAAGTTACTTACATTTTATCTTA
GCCTCTGTTTCCTACTCTGTAAAATGGGCTTGATATCTGCCTTACAGAGTTGTAGTCAAG
GATATAACATATATATATGTATGTCATCTTGTATAGGGCCTGACATATGGCAGACATTCA
ATGAAGGTAGTTCTGGTACTTTTTGTTGTAATTACCCTTAATATTATTAATTACAATTTG
TAACAAAACTAGAGAACAGCCAGGTTTAAATGATTAAGGAAAGATAATACAGACTGATTC
AGAGTCTTACTAATCTGGAATGTTTAAAAGTCTTACGTCCTTTTAATATTAACATATAGA
ACAGAATTAAAGTAATCACAAAGAGACTGTTCAGCCTTGCTTCTGCCAGCTCATATGTAC
TTTTCTTTCCACAGGCTCAGCACTATGTAACTACAACCTAAAGCCTTCTGAATATACAAC
ATCTTCAAAAGCTTCTGCTCTTTGCCCCAAACTACCAGTTCCAGCGAGGTAAATTTTTTT
GCAATGTTAACTTGTGATTTTTTCCCCCCGAAGGTAAATTTTAAATGGTGAATGTTATTC
TGAGAAAGTAGTCACTTGATGATACCTGTTGCCCAGGTCTAATACTTTTACAACAAAGCT
TAAAAACTAGCAATGGAAATAACAACATGTAAATTCATATCTTTTAAAAATATGTATATA
TAGACATGGGCATAAAACTTGTGTCATTCTCAGATATCATAAATCTTTTTTTGGGGGAGG
CTCACATTTTATTTTTTCATGTCATAATTTTAAGTACATGAAACTGCTGCTTCATTATAA
AATCTGCAACAAATTTAGAAGCCAAGTGCCATAGTCTCCAAAGGTTCTTTAAGGTTGATC
TTACTAATACTGGGATTATTTTTTAATTTACTTTGTAAATGTGAAAACTACAGCAGTGAT
TATTCTTCATAAGTTCATTTCAGGTTATATCCTTTAGGTAATTCTCTGTATACTGTTTGT
CACATTTTATCTAAAGTCTTATTCAACAAACATTTATGCTTAGCCTCCAACTATGTGTTA
CAGATATAAAGATAAACCAAGAAATGTTCTTTTTTTTGGGGGAAGGATGTCACAGTAGTT
TATAAGAAAGCAAATTTAAAAATTAAAAATAGAATTTTAAAAGTAAATAAAATTTCAGTT
ATTTATATCTCCTCAGAATTAGTTGTATAGGATTTAGAGCATATCTGTTCTTGAGAAATA
TAGTGTATATGGGTAACTTGAAGTCATTTTGATTTTATTTCAATACATTCTAGTGAGCTA
TTGGGTAAAAATTTCTTAGAGACTTGTAATCTTTGGATTGCTCATGGATATAACTTACGC
TTTATTTACTTGAATCTAATATTTTCTGTTAAGTAGAAGAAGGATATATCAATTAAATTG
ACTTCTAGTCTTGTCAAGTTGCTATTGAAAATTGAACTATAAAGCCTATACACTTAAAAA
TAAAGGAACTATTTTAAAAGACACTAAGTAAAAGGATCCTACAAATTAGAAACTTAGACC
AACAAGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTTTAGTTG
AAATCAGGGGTGGGGAGTGAGGGATACTAATCTGACAGGGACAGCGCCTAGACAGCATCA
GGAAAGAAACAGTTGTAGGCCCCAACCAAATTGTCAGGTTTTGTCCCAAAGCTGCTCCGT
TGATTTAGGAACTCAGGGTTAACCCTTTTTGATTCCTGTAATATTTTCAACCAAATCTAC
TTTTCACTTATAAGTAGTATATAATCTAGTATCTTTTTTCCATCATTAGTCAAACAACTT
TGGGTCAAAAATGATGACTTGAGTACATGTAATTCAGACATTACTCAGAATGCTCTGGCT
TTCTGCAGTTTCCAATAGAGTATCAAATCTTTTGGCATTAACTTGCAATTACATCATTGT
GGAGGTATACACATATACCCAGTGATACACAGAGGTGAATGTTTTAAAGGCATATTCATA
TTGCTGTTGCATCATCACTTTTGGATGCATTTTACCAAAACATAATGAAGATAAGGCTAG
ATCTTTAAAATTATGCAGTGAACGGACACAGAGAGCAAACAACTGGGGGAAGGGGGAGGA
AAATATATAAAAAATAAATCTTTACCAAAAAAATTTGTTATTTTATTGTTCTGTGAGGGA
TAGCAGTGTGGAAGATGTTGCTTTTTCTTATTCCCAGTGGTGCTCATTTAACATGTACAG
AAACAGTTAATCCAATAGGTAGTTCACATGTATTCTTATTTGAAAAGAAATACTATTTTT
TGAGGAAGGAAACAAAGATAGTGTTTTGTTGCAGGTCACACAGATATTCCTTGCTGAAAT
GAGAAACCTTGAAACTTCATCTTCAGCCATGTGGTCTTATTCACTAATTTGACCAAAATG
CAGTGCCAACCCAAAATAGGAAGACATTTGTATCATTCCAGTCAAAATGTTATTTTAGTC
TGACAGTCCTATATACAATTCTGAAAATGTGGGTTTCTTGTTGGTAATGGCTAAAATTGC
ACTGGATGCACATGAGTATGGTGAGTTCATGTATGGTTAGAATCCAAACATATCACAACT
GAAAGCATATTCACAGTCCTTGGTTTAAAAGCTCCCATAGATTCAGTGTATATCTATGAG
ATATCTATGTTTATGAGAACCCAGTTTTAACAAACCAGATTTAGAACACAGTTCACACAG
TTTTGTCCCTCCACAGGTTAAATCTACAATCAGTAAAAGCCTCATATAACTGATAAAGTA
ATTGATAGTTTACCTTTTTTTGTGACATAAATAATCTTGCGATATTGGTAACATATAAAA
AGAAAATAGCCCAGAGCCCCCATGACCCTTACAAATCAGATAGTTTTCATTTTTTAATAT
TTTTTCTATTGTCATTCATATGTTTACATCTTTTTTACAGAAATGTAACGCATTTCTAGA
TAGAGATGCATTCTCTCTCTTGAACTATTACATCATAAGATTCCCATATTGTTATATTAG
TATTCATGGTTATTGTTTTAAATAGCTACATATTACACTGTATGTTGATGTCTCAGCATG
ACTAATTTACATGAGCAGTATTAAGGGCATTCCCTAAACATCTTTATTAATCTAAGGTTT
CTTGTGCTCTTCTGATATAGGAAACATACCATTACTGGTGTCACATTTCAAGCAAAAGCA
TGTTTTTTTTTAAATTTTTAAATCGCTTATGGCAAAAATTCTTTTTCAGTTTAATGAACT
ATATGTGTGTAAATTTCATTACCTGCCCCTTGATTGACAGATGTGTAGGCAAGGAGTTTA
AGTGTTTGGTCTTGCTTTTGGTGGCATTGTGTGTGTGTGTATGTGTGTGTGTGTTTCTCT
TCAGAAGGGGAGGGTAATGTCTTCCATTGGAATATGCACTCCACCCTCTGATAAGGCTTG
TGGTAAGATGCGCATCATTACCCATTACAGTCATCATCATAGCATTAAGCTCACAGCTCT
TAGCGCCCATAATGGTGTGTGGAGGGTGGAGTGTACTGCAGCCATACTCACCTTTCATTT
GTGTGTTTGATGTGGCATTTATATTAAGTAGGAGTAATTTTTTTTCTGATTTTTTTTTCT
TGTGTCACCAGTGCACCTATTCCATTCTTCCATCGCTGTGCTCCTGTGAACATTTCCTGC
TATGCCAAGTTTGCAGAGGCCCTGATCACCTTTGTCAGTGACAATAGTGTCTACACAGGC
TGATTAGTGGAGTATGACCAGCAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAA
GCTTTTATTGCCTTTGCAAATGCCCAAAGAAACTTGACAATGAGCTAACTTTCTATAAAA
ATTATTTGGTTTTTGAAATAGTTGAATACTTTTACCAAGAAAAGAAAACCCAAACCTTAA
AATTAGTGATGATAATGTTTTTGGGCCACTGATATTACAGTTTTTTATTAGAATGGTTCT
ATTTTGAGGCTGAAGATGTAATATAAGCCCCAACTTTGCTCATTTGTTTTTGAAATGGGC
AATTATGGAACACATAATTTCAGAAAAGTATGTTTCCATGCAAGGGATTAATCTTCTCCC
TTTTTTTTTTTTCTTTGGGCTCTTTATTAAAGATTTTAGCACATTGGGATTTAGCTTGGG
AAGGGTAGAAGAGTTGACGGTGTAACTCAAACCAAGCTTTGTTTCTTTGGAGGAAAAACT
TCTCAGTCAGGAGCCTTGCCCCCTGTTGAGAAATGAGGTCAGAGAAATTTGGGCCTCATT
GGGTTTTAGGATGTTAGCCTGTAGTGTCAGACCATCCCCCAGAGTTCTAGAGGAGAAACA
ACCAGAAAAAGCTAAAAGTCAGTCTTGACTGACTTGTCAGAGACATTGCTCCTGAAATTC
ATAGATTACTCAAGGAAGTGTAGCACCTAATTTACCTATCTCTGTCTTCTTGTGGTGTTT
TTCTTGTCACCAACATGACATGTCATTATCTATACTCTGTGTGTTGTCATGTATGTTTGC
ATGCGAGTTCTGGAGTCCTCCATTGGTGAATCCACAACAGTCCTGTGCTGTTTCTGAGTC
ACCATGTACATTTGCATGTATTCTTTTCTATTGTTTATAAACCCATGCCATTAGGTGCTT
TTGATTTTGAGTGATTTGAGTGTTGCACAAGTAGCAAAGTCAAAATGCAGAATCAACCAT
CTTCCTTTTTTACGTAAATTGTGGTCACGAACTAGTTGATAACAACAAATAATTTCCCTG
GGAAAAAACAACATTTGAAAGAGTGTCTCTTATTTTCCTGTGTTTTCAAGTAAAATTCTG
TGTGTTCTCTATTTCCCTGCAGTTCTATCCATGATATTGATGGTGATAATCAGGTATATA
TCAAGAATACTTGTGTGGATCTTAACAATTCTGGTCATACTGGGTTCACTTGGTAAGCTG
CTTATTTCTTTGTTTCTTAGTAATTAAAATGGAGAGTTAAACTTTGCTTTCAGCACCACC
TCCATTCAGAACTACTTTGGTTATTTTAAATAATTTCCCTCTTGTAAGCCTTGCGAATTA
ATTTAAAAACTGTAAAAAGACTCTAAGTGGATGATATTGGAGTTAGTTCACTGGGAGATC
ACTAAAATAAAATAAAATGGTAAGGTCATTGGCATTTGGGGGTGAAAAGCCCAAGAGAAA
AGAAAGCAGTTGAGCTGTTTTGCTTCTTGTTCTTTAATTTTCACTTGATTCTTCCACCAG
CCTGGCACGTGAATGGATTCTTTTATTGTGTACTTTTTAAAGGCCTGGACCAGCCATTCT
GAGGTGTTGAAGTTCCTTCTGGTTGAAAAGTGTTCCATTTTAATTACTATTCTATCGACA
TTCTATTTTATTTCCTGTTTTTGCTTTCCTGTTTATAATGAACCTGTTAGGGTTTTCTGT
TTATTGTTTTGTTTGTTTAAATAATTTCCTCTCGCATTTATAAATGTTTATTGCTTTGTT
CTGCTTTAAATAATTTCCTCTCGCATTTATAAATGTGATACCCTACTCATGGTAGCAAAC
AAATATAAACGAAGCAAATAAAAATTTTTTTTCACGTATTTATCTTCTCTTTAAGAAATT
TGTTTACTTTCGTCCTTAGAAAGTTTCATAAATATATTTACTACCCTTCCCTTATTTCAC
CAGCTAGAATTTAAAATCTAGACTTTTTTCTTTGCATATGTATATGTACATGTACAGATA
TATATATATGTATATAATATAGTTAATTTTTTCCCTATTCTTTAGTAGCGAAATTCATCC
TATTTACATTTAGAATCATAACTGGTATGGTGGTCTTACTGATGACATCTGCTTTATGTT
TTGCTTCAATTTATGCTTTCTTACTTTGTTTTCCCTGTATTTGCTATATGCACTATATTG
TCTTTGGTTTAGCTTTACCTTGCTTTGAATGTTTTAGATTATATTTTTTATTTCTATAGT
TGGAAACCTATATGTTATCAGAAAACATTTTTTTTAGTCTGCAATTCTGTGATATTAAAG
GCTGAAATTAAATGGCATATATTGAGTTTTCCCCTACCTCTCCTAAATTTTGCATGAACT
TTTCTTCACTTATTCTCCTATGCCCTTCTGCTCACTACACTTTTAACCTTTATTAGATAA
TTTGAGCTTCCCCCCAGGTTATTGTTAAAGTTAAAATACTATTTTTACATATTATATATT
CTTTTAAAAGAATTTTGTCCCCCTGCTAAAAATAAAGTTGTTTCTTATTTATGCCTGCCT
GCTGAACTCTTGTAGCAACCAAGGACACTTGGTTTCATACACATTGATTGGGGGGTAAAA
AAGAATTTCATTTATCTTTGCCTAAATATGTTGCATAATTATCTTTACACTTAAATTATT
TAAGTTTTCCTGTAACTGGTTTTGGTGGGAACTACTGATCCTTTTTTCATGAAACTCCAT
TCTTAAATTCTTAATTTCATGTCCTCTTTATATGGACTGGAATGTGAATTCAAGTAAACT
TATTCATGAAGGATTTATGGGTGGTTTATTTTCTCAACTCTTGCTTATCTAAAACTGTCT
TTGCCTTTACATGAGAATATTGAATTCGCTGGGTATAAAAATCTTGAGGCACAATATGCT
CCCTGTGCTTATGCTTTATTTTAGAGAATCAGAGATCAGTCTAAACTCGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCCTTTGGTGGGAACTACTCTTTGATCTTCATTTATTCATTCA
ATGAATATTTTATTCAACTGCCCGACTTAGTATCAGTCCTAGGCACTGGTACTGGCTAAT
ATAACAGGAAAGATCCTGCCTTCCTCGAGCTTCATGGCTGATTTCTGTGACCCTTACTCA
GTGCCTACAGCCTCCCCAGCTTAAACAGACACTGAGGTGCTTTCTTTCTGGCCAGTGCCT
CTCAGGAGTCTGGAAACAGTACTGTTTTTGCAGAATCTCCCTTGGGTCCAGAGTCCTCCA
TAAGTAGAGTTGAAGGAAGTTGCTTTGCTTCACTGAAGGATTTATAAGTGCCTAAAATGG
AAGGTGAGAATGGAGTAATCAGCGCTCCCCTTAATGATGGCAAAGAACTCCCAGCCAAGT
CCCTTACAAAGGGATGGTTGCTGCATAAGACCCATGACGATGTGTAGGAAAGGCCCAGTA
AATTGAGGATTTGCATTACACACTCTCCTATACTAATTATTGCAAAATCACTTGTTTTTG
TCTTTAGGTGGCACAGGTGTACTGTGGTGGCTGTACGCAAAGCAAAGAAAATCTCCCAAA
GAAACAGTTATTCCTGAACAGCTTCAGATAGCTGAAGACAATCTCCGAGCCCTCCTCATC
TATGCCATTTCAGCCACAGTGTTCACAGTGAGTGGAGGCCAGGCTGTGTCTTTCGGTTTT
GTGTTTTTATTTTCAGGAGACCACTGATGGAACAGAAACTTTTAGTTTTTGCCTTCTTAA
CCCTGATCATCATTTTTTAAAAATCCGTGCCATAGTATATAAAGCATTAAGAAGTTTTCA
GAAGGCTTCCGTAATTGAAGAGTGCTATTTGATACAACATATTGTTCTACTCTGTCTGCT
TTTTGTGAGAGGATTTTTCACTTACAATATTTGCTTACAGTCTATGACCATTTGCTTATA
AGAACACATATCCTCTTATCATAACAAAATGCAAGTCCTTTTACAAAAAACAACCCCTTT
TACTGTAGAAAAGTATGTTGAGAAAAACAGGCTACTTTCTTCCATTTACTTGTTCACTAA
TTGATTATTTGCCCATTATTTCCCTTCAACTTTTCTTTCAACAGTGTGTATTATTTTAAA
AATATAGATGACATTCACTGTTTACCCACTACACAGTAAAATTACTAATTAACATTGGCT
AAATAATTTAGACTCTGTATCTCTGGTTCATCATCTTCTCTGAAAAAGGAAAGAAAAATT
GTGGTCTACTTCTAGGAGTACTCCTAAGCTTTTTATGGAGGTTAGAAAGAAAAAATAAAC
CCAGTTACCTAAAACCACTGATGCCAAAGATATTAGCTATTATGATGCAAACATATAGTA
AGCACCTTTTATGTACAACTCACTGTGCCTGGGGGCTGGGAGGAGGTAACAAAGGGTGAA
TGGGGCATGGACCCCACTTGTAAGGAGCTCTTGCTCCTATAGAGATGAGGCACAAATAAA
TACTTTGAATGCTTCTGTGGTGATGGCATGGGTCCTTTCCCGTATTTTTCTGAGTGACAG
CTTTTATCTATTCAGATAAAGCAAGGGTATAATCCTGATTGGCCTTTCCTCACTCAGAGC
ATATTTTCATTCCTAAAGAATGTAGAAGGGAAAGGTAGAATTATTCCAGCATTTATTAAT
AAATTGAGAAATCCTTTCATGTTTAATTTTAAAGGCACTTGGTAACCATAATTTACAGCT
GAAAATAAGAGCTATAGGAGAGTTACTGATAAAGTGTTATTGAGATTTGGTGAATGATAC
TTCCAGGTTTGGGAATGAAGAGTTGTTAAAAAATTTCAATCATTGGCAGAGGGAATGTAG
CTCAGTGATTGAGTACCTGCCTCCCATGTACGAGGATCCTGGGTTCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGTGGTAGGTGATTTCTTTGGCCAATCACTACACGGTCATCACCTTT
AATATAATATTAACTTCTGTGCTTTGCCCTAATTATCAAGATTTATAATTACTGGACAAG
TACTAGCCCTGAAAAAAAAAACTGAAGTGTTTGAAAAGTCATACCTAAACTAAATAAGTG
ACAATAAGGTAGGAACTGTATTCAAATAGAACAACTTTTAAAAGCTTGTTATGAGGGGAG
CGGGTGTGGCTCAGTGGTTCAATGCTTGCTTCCCATGTACTAGGTCCTGGGTTCAATCTT
CAGTACAGACTTTAAATGATACCCATAAGGAAATCAAAATGATTTAATTTCACAGCTTTT
TCAGGTGATAATTATTTTTGTTTTGCTCCTTAATAAATAACACTATAATTTTAAAGTTTG
GAGTGGGGAGGAGGGTGGTCTGTTACTGGAAATTAGATTAACCTTTTAGATTTGATAGCT
CATTTCTTGGTTTATACTTTATGTGCTGCTTCCTTCTTTCCCTGTTTTCCTAGGCAGCGC
TGTTCAGAATGACCAAGGCTTTGTGGAGTTCAGAGTTTCTGGACCTTTGCAGTACATGTG
GTGGTATCATTTGGTAGGCCTAATCTGGATCAGTGAATTCATTCTAGCATGTCAGCAGAT
GACTGTGGCGGGAGCCGTGGTAACATACTATTTTACTAGGTGAGAATTTGTACTTGTCAG
AAAACTCAGGTTCACCCAAGTGATTATACTTGGAGAGTGGAGGGAAAGGGAATGGGACTA
TGTTTGGCAAGAGCTTCATTTCATTAAAAAAAAAAAATTGGGGAAACGGACTTGGCCCAG
TGGTTAGGGCGTCCGTCTACCACATGGGAGGTCCATGGTTCAAACCCCGGGCCTCCTTGA
CCCGTGTGGAGCTGGCCCACACGCAGTGCTGATGCGCGCAAGGAGTGCCCTGCCACACAG
GGGTGTCCCCTGCGTAGGGGAGCCCCACGCGCAAGGAGTGCGCCCCGTAAGGAGAGCCGC
CCAGCGCGAAAGAAAGTGCAGCCTGCCCAAGAATGGCGCCGCACATACTTCCCGTGCCGC
TGACGACAACAGAAGCAGACAAAGAAACGAGACTCAGCAAATAGACACAGAGAACAGACA
ACCGGGGGAGGGGGGGATTTAAATAAATAAATAAAAATCTTAAAAAAAAAAAAAAAATAG
ACCATGAATATGATAAAGTGCTAATAGTTGCTAATTCTAGGTGATTGTTATTTTGCTCTT
TACACATTTCTGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCATAGGTATGATTTTCTAAATTCTTGTTTTTTTAAAC
ATGTGAAGTACTATATGACAGTTTGATTTTTTTTTTTTTTAATTCTGATTTTTCTCCCTT
TTTAGGAAAATGCTTGTGCTCGATGTGTGCTGAAATCTTGCATTTGTTGCCTTTGGTGTC
TTGAAAAGTGCCTAAATTACTTAAATCAGGTAAAATATTATAAAAATATATCTAATGTTC
AGCTTCAAAGATAGGTTCATTGCTTGAAAGATGCTGTTTTTCTTGTGGTGCTGTTCATTA
TGCCATGATGGAATCTATTTCTATCACAATCTTTTTAAAAAAACTAACATATGTTCTTAC
CAAGGCTCTTTATTATATTAATCTTAATTTTAATATATGAATAAAAAATCATTAGTGTTC
CTCTTTCAGGAAAGACATTTTTCCTTTATCCCTTATTTCGCCTTCTTTCATCTGTGAACG
AATCTATCTGCTCCAGCCATTGTTCCTTCTTTTAAATGTTGTTTGAAAAGCTATTGTGAC
ATTTATTTCTTCTTTGCCACTATTTACCATTGTTCAGAGCTACCTTGCTCTTTATGCTTT
TTTTTTTCTCATCCACCTGCTAAAATCTATATTTGCCTGGGAAATATTACCAAAAGAAAT
GCTATTTCTAAAGTCAAATGAAGAAATCAAGACTTACTGAGATAACAGTTCTCAGGGGAG
TAGGCAAGCCTCTGCTTTTCTCTTTGCGTGTGTAGGACTTGCTCTGCAGCCCCCATTTCT
TGAAAATAATTCTAATGTATAAGGTACTGTCATTTAGTAGACCAAAAACCAAAACTGACT
TTCTCCCCTTTTACCTCTAGCTGATTGAAAATTAGAGTTACACTTTCCATTTCCTCCAGG
AGAGTCCAGGGATGACAGTCATCCTGTGGCCATGGGCTTGAACATACCTGGAGTTTGCTT
TGTTGAAGCCTCTGGTTAATAGGAAGTAGATATGACATTTCATTAACAAATCTTGCAGGT
CATATTTCTGTGGGTGTTCAAGTGTTTAGAAGGTCATTGTTTAAAAAAAAACTGACTTCC
TCCCACCACCTAAACTCCTAGCCTTAATGATTTTGTCTGAGCATCACCTCCTCCAAGAAT
CCTTCCTTCATCACCACAGCCTGTGAAGCTTCCACAGCACCAGTTTCTACCACTGTCAAA
ACACTAAGCTCATTGTTAAAATGGTCTGTTTACTTGATGTCCTCACTTTTAGACTTTAAC
TCCTTAAAGACAGAGATCTTATTTTTCTTAGTCTTCCCAGAAATTAGCACAGTGCCCAGT
ACACAAATAGGTAGTCTTCAAATATTTCCTGAGCATCTTATTAATTAATCAGTGAACATT
TGGACTCAAAAAGACTGACGGTGGAATAAAACTGTTAAGTAAAAATCTCAAAAAGGAGAT
GTGCAGTTATACTGAAGGAAGGGAACAAAGCATAGGATGTCAAGATGGTCAGTCATCTGG
GGGGAAAAAAATCCAAGGTTTCTAGGGTATCCCAAGCTAAACAGCAGTCAGCAGTTTAGC
TCTGCGGTTCTGGGATATATATACAATCTGCGACTTGTTCTTTGTTGCACAGGTTTTGTC
CAGTTTGTATCTTCATTATGCATAGGTGGTGGTTGAGGATTCCAGGGAAGCATTAAAGTC
TATTCAAAATAATAAATTGAACATGTAGAAGAGGTTTAAGGAAATGTTATTCCTTAAGCC
AAGGACTGAACTGATACTTACAAGTTGTTTGAGAACATGAAGTGCTACTAAGTGAAGACT
GATAACCAGTGGGCTTCCTGGCTTCTGTGCTCTCAGGGAATGGCTTTCTGTGAGATGAGG
GCAAACATATTGAAGATATTAGAAAACTTCCTGTCATGAGAGGTTGAGCATTAGGCTCAG
TTGCCAGTGGAATTTTTTAAACCTGCTTCATGTGAGCCTCTTCAGAGCTGGGTGGGGCCC
CATCTGTTGGCAGTATTTATGATGATGGCATCAGGTAATGTTGAGCAGAGACCTCCACAG
CCCTTTTTCTAAAATTCCAAAGATAGAGTCAGGCATAAGAACAGGAACTGCTGGTACAGG
AAGGGGCATTCTTCCCGGGGCTGCCACACACGGTTGGCAGTTCTGAGTGCTCTGCACTGC
AGGACATCCTGCCACAGCTGGCACCATTTTGTCTCCATTATTAACCCTTACTTTCTATAA
ATGAAAGTTTCCTTTTTCCAGTCACACAGGATTGTGCCCATGCCTTATGGCCTTGCTGGA
GAGAGTTCAGTGGGTAACTGGGGGGATGTAGAATGGAGAGGACCTTGTCGCTAAAGCCAC
ACCTGTGTTTCACTCCCAGTGTGTACCTCTTTGGCAAGTTCAGTGAAACCTCTGAGTCTT
AAGCAAGTGGAAAAAAATATACCTATCCTCATAAGCTTTAGTAAGGATGAAATATTAGAA
AAGTTAAATTAACTCTTAGAGTGCCTGGCTCTCAGCAGACACCAAGTAAATGTTACCATT
CTCACCTTCCCCATTCTTTTTGGTGCAAACTCCCAATTTTTTTACCCTAAGACAAGAGAA
CTGTGGCAAAGATAATCTAAAAAAATCACTCTAAAGATTTATGTTTTCTCTAAAAACAAA
AGTAATAAAAAATATTGAAGAAAGAAGAGTTTCCAAGCATCACCCATAATCTCATCATCT
TATTGCAACAGTGTCTATCATTCTCATAGTTACTGGCTTTGGAAAAAAAGGTTAGTAATA
CTTCATTTCAATGCAGTAATGTCTGATCATCTATACACTTCATCTGTAAAATGGGGGTAA
TAATGGTGTTTATCTTAAGAGCACAGTGAGGATGAATAGATACTGTCACAGGGCTCTGAG
CATGTGCTTGGAGCACAGCCAGTTCTCCGTGATTTGGTGAGTGGCAGCTCTTACTCAATC
ACATCAACAATTGGTTTCTTTTTAATCCTTCTTAACATGCAGCAGTTTTTATCTTTTTCT
TGTTAGGTCTTTCAGTCTTTCTTTTACGGTTACTTACTTGGCTTTTGTGCTTAGAAAGGT
CTTCCCCATCACAAGAAATTATTCTTTTATATTTTCTTATAGTCCTTTAGAGGTTTATTT
TTCAAATACTTAAACTCTTATTTGTCTGGAATTTGGTCATTTATCCCAGGAAAACTATGA
ACAATCCCATCCTTTTCTCCTGTTGAAATGCCAACTTAATCATGTTATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCTACAAGATTTATGGTATTATATATCTTA
AATATCTTATGATGCGTAAGGCATGCAAGTCCTGCCCATTCTTATTTTCAAAGATTTCTT
GTGTACATCACCTAGTTTGTTCTTCCAAATTAGCTTTAGAATATTCTGTAGAGCATATAA
CACTAAATAATGGCAGCTAACATTTATTGAACTCAAGTACCTTACACTTTACATGCATTA
TCCTCCATTAAGAGTTCTATTTTATCTAGTACTCTTTGGAAGATGGTTAAAAATGAATTA
GTACTTATCACTTTGGACTTGTTTTCCTCCTGTCTTTTCTTTTGCTGCTGCTCCTACTAT
CAGCATGCAATTTGAAGTCCAAAGCCTTGAAATCAAACTTAAGTACTTGCAAGGCCAACT
GTGTCATGTAAATGAGTGAAGCAGGCAGGGTCAAAGGCAACAGGGAGTGGTGGGGACTGT
GGTAACCTGAAGCTATCCTGTTTCATCCAAAGAGGCCATTTAGTAGTTAGCTCTGACAGA
ATATTGTCATATGAGAATTTATAGACATTTATTCTAGCTTTTCCAGTTTTCTAAGAAAAG
TCAGAATGCTGGTTATTTACATTTTATCTCCTGCTATTAAACGTTTGGCAACTCATTTAA
AAAAAATAACTCCCAGTGAGCCAGAGCAAATACAGGGTGGGCCTCACCAACATCCAAGGT
CCATGGGCAACCAGTTTGTTGCTTTCCTGCTTTTAAAGAATTTAGAGGACAATAGGAATA
AAGAGGAGTGTAGATAGGGAGGTAGAGTAGGCCAAAGTCATTCTGCAGCACAATATGAAA
TGCCATAATCCTAAACCATGCTCCAGTGAATAAACTGTGGAAAATAAAGCTGGCTTCATA
ATAGAACTTTAGATTTTAAAAGCAAGCCACTCAGTATATATAGGGTAAGTGCCAGAGTCT
TGCAAACAGAGTGACCTGTGAACTATGTTTGTTTCTGCAGGTGCTTACCTTAATATGTGC
TCAAGTGATTATATATCTAACAGGATTCACTTTAGATAGAGAGATTGTTACAACCAGAAT
CTGTTTTCTGTTGGGCATTGGATTACTCAGGTTTGTTTTACTTTGACATCAGTTGGAGAT
AGTACATTTAAGACTGGAGGGTGTCTGCTCTCTAGTTTTAAAGTATTAAGATAATAAAGC
TTTTCTCTACATGGTATGAATGGGGGTTGTAGAGAACATTTTTTTAAGTTCCTATAATAC
ACCTGCTACTACACTAAGGACTGTATAAACATCCTCATTTTCTCTCCACAGTTCTGAAAG
AAGGCATTATTTCTCGTTTTTGAGAACATTGTGACTGTTATTTATGGCAGGTCACGTGAC
CTGGAGGAAAGAAGGTTTTGAATCTGTTCACCTACCCCTTTCCACCATTATCGCCTGCCA
TATAAGTATATACACATCTGGTGGAGCATAAAGAAAGCAGAATTATTATCTACTCTAGAA
ACTAGGCAAACATCTCAAACTCATGTTTTGTGCAATTAACTAAGATGTGATGGCTTTAAA
GAAAAATCTATTTAAATAAAGGTTTGCAATATACTTTTAATTCTTATGACCCTTAAGAAG
TCTAAGAATTTAGAACCAAACTGGGTGAAACTGTTAAGGGGTTTATGCCCCTTCCCTCTG
CTTCTTTCCTCTTAATCTATAATGATCCATACATAGATACTAATATATATCCCATTCCCC
TTTCCTGCATTGCTGTCCATTGTTTGCTCTGTTAAATGAGCCATTATATAAAGATTCTTA
AACTATAAGAAAATGTTTGTGTCCTTAAGTGAAGAAAGGAAAGAAAGCTGAAAACGTGGA
ACCTGTGCTCTGGAACAGATGCCCAAGCAGGCCTAGGTCACCTGCAAGGTGGCTGCTGAC
AGTCTTCACAAGCTTTCGTCACAGGACCAGTAACTTTTTTTCTCTCTAGCTTATCATACA
GAAATGCCCCCAGGGATCATCTGTGCTTACAGTAAGCATCCTTTTGGAAAGATTCCTTGA
TGGTGACTTGCGGTGGGGAGTTCCCTCTCAAGCTTGTGTCCCCCTCAAGCAGATACTGGT
CACGGACCAGATATTCATCAGTGATACCTTACTGAGGGTAGTTTAGCTCAAGATAAGGAA
GGCAATTTGAGGAGGGGCAGGGAGGGGAATGCTAAAAATCTCAACTAAGTAGTTTACCTT
AAGAAAGCTCTGGGAACAGTTATCAGAGAAAGCCACAGAGGGCCTAGAACTCCTTGAGAA
CCTTGATGGGAATCCTTTCAGACTAAGAGGTCTAGAAGCAGAGGGAAAGTCCACTGACCT
GCTGTGATCTTTAGCTCATTTTCCTTCCTGAACTGGTCTTCCTGACCTTCTTTGCATATC
GCATGCAGCTCATCCTCCTACAACAGAGGCAGATGAAAGAGCTTACAAAATATTTACGTA
CTGGTTTTTTGCTCCCCAGTTAGGTAGAATACAAAAGAGTTGCATAGATCTATAGGAATA
TTGCCCAGAAGGCTTAATTTTCAGGAGGGCATCCTACCCTAAAACCAAAAACTGGAGAGA
AGGAACCATTGCTGCTTCCCAACTTGTCTACAAATAAATAGGCATCTGCTCTAAAAGCAG
ATGGAATGGGGCAGTGTGGGAGGGGAAGAAAGAGGAAACAGGGGAGGAATAATCAATGGG
GCTTCTGAAAATGAATGAGGGTCATATAGAGCTTTTCAAGTTCAGTTCGGAAGGGTCGGG
TCCTCTTCTGGTCTGATGATGATGGAGAGAGCATGGAGGATGTGGAGCCCCTCCTGCTTC
TGTCTCTTCTTTCAAGGAAACTCATCCTCAAACTGGAAAGGGTAGAGCTACACATTTAAG
AGTGAGTTGTTCTTCCTCATAAATAAAGAATATAAAACCAGCACCTGGTTGATTTTAAGT
GCATTATCCAGTTTCCTCGATTTTATTTATTTATTTTTTACATCAGAGTGCATCTCATGA
TCAACATGTATTTTTAATATTGTAGGGTGTTTTCCTCTGAAAACCTGTTACTTAAAACTG
ACTCATTACTCTCTTGATCATTTCTAAAATAGGGGAAATATGGTAATTCTCTTCACGGGA
CTTATATCTCTCAGATTATCGAAGCCAATTGTCAATTAAATTGTTGAACTGAAGAACTGT
GTGAATGATGCTAAAGGACTGAAGTTGTAGAGAAAGGTAATGAGACTTAAAATGAGCAAT
TGTAGTTTTAGTTTCCAAAAAGGATAAGGAGGTGGATTCTATAGAACGTAAACCAATGAG
GTTGATATTGAGCCTTGGTAATACTCTACACAGGGGTCAGCAGATTTTTTTTTTTCTGTA
AAGGATCATATACTTTATATTTGGCTTTGTGGGCTATACAGTCTGTCAGAACTACTCAAC
ACTGCCAATGTAGTGGGAAAGCAGCTGCCCACAATATGTAAATAAATGTGTGGCTATGTT
CCAATAAAACTTTATTTGCAACCATGGGTTGGAGGCCAGGTTTACCTTAATTTCACAATC
CCTGCTCTTGTATAAATTGTTAAATGGGTGCTTAGTACCAGTTGGCTTCTCTGAGAATAG
GTCCTGTTCCATCCTTTTCAGTAGGCTTCTCTCTCTCCCAGGCAAGATCAGAAGTACTCA
TTAAGACCTGGCACAGTATTTCAAAAGAAGCTTTTATAGAAGGTGAAGAAATGTATATCA
GAGCAGTAAGGTCATTAACTCTTCAGTGTCTGCTGTCTTAACTGATAAGAAGTACTGGCA
GATGAACAATGTAAGAGAACAAGCAGCAAATGAATGCTAACAGAAAAAAATAGCATGGTT
TCTTTAAAAATATCTTATTTATTAACTTTTGAGATGAAGAGAGCTACAAATACACCATAG
CAAAAAAATTTCTGATAGTAAATTACACCAATTTTAAGATGGAATGCCAGGTTTCAAAAT
CGTATTGTGTTTTTCAAAGAACACCATAATTTCCTGCTGCTCCACTACTGGAAAACGCTT
ACAAATCACAGCCAGTAACCTACCCAGTACGGTTTCATTGTTTCAGGTGTTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTGTCTC
CCTTTGTTGCATCATCTTGCTGTGCCAGCCGTGGGAGGGACCGGCTGTCAGCTCTCTGCT
GGCTCGGGCCATTTTGTCTTCACAAGGAAGCCTGGGACTCAAACCCAGAGCCTCCCATAT
GGTAGACGGGAGCTCAATTGATTGAGCCACGGCTGCTTCCCCAGATTAATTTTTTATGGC
TCAAACCTTATCCTCATACCAGTTTCCTAATACCTAACAGCATACAAACGGAACATTCCT
AAGTTAAAGACTGCCTCTCCTGGGTTCAGTGTTTAAAGCTTTACAGGCAGTACAAACTAA
CTAACCCCTTACATGTCCAGCAATTTTCCAGCAATTTCAACATTTTGGACCCACCAAGTC
CATATTCTTTCCCTTCCTAAGACCCCAAACATATTTGATGTGATAGTATTTTTTTTTTTT
TTACATTTCCCAGAAAACATCAATGCTATTCCAGCATGTACTATAAAAAAGAATAAAAAA
CTAGCAGAGCTGTGACTCGTGGGTCAAAGAAGAACAAGGGCACAGGGCAGCAGACACAGA
CTCAGGCATCAAGCGCCTCTGCTGGGACTTACTGTTACAAGGGCCTGAGAGGAAGGGAGG
GAAAGAGGAAGTGGGAGAATGTCCGTGAATAAGAAGATATTAGCAATTTATTAGCTACTA
AAACCAAAAACTCCAGAACTCTGACAGGTTCGTAGGGATGCAAACATCATCACCACATTC
AAGTACCTGGTTTCTCTCTGCTCTCACTTCCGCCGTGCTGGCCTCACCCTCAGTTTGACA
CCACGGCCTCCGGCAGCGCAAGGCTCTTCCCACTGTGTTAGCAAAAACGCTTGAGCAATT
CATACACACACTGGGCTGCCCACAGAAATGAGAGAGCTGCTCCTTCCGGAGAGCCTGTGG
AAGAAAAAAGAAACTTCTTTTTCCCAGAAGCCCCAGCACCCATCTCCTTACTTTTCATTG
GCCCTGATTAGCTTATGGGTCAATCGCTGAACCAATCACTATGGCCAGCTGGGTAGGGTA
TGCCGATTGGCTTACTGTCCATCAGGTCCCTCCCCTAGAGCTAGAAGTAGTATCCACCCC
ACTGGAACCACCGGTCGGAGAACGCGGAAGCGGTGTTTTCCCAGAGGAGATCTGGTGTCC
TTCTCCCATGAAGGAAGAGTAATAAAATGCTGGGCAACAAACAGCTGACTGTTGCAAGAG
TTGGGAGAAATGACAGCAAAAAGAGAGCCTCTACACAGGAAGACCGTTGAGGTTCCATTT
CAAACAGCACAGCCATCTGATGCCGTGTATTATCAGAGCAGCATCCCTTACGTGTCTGTG
CAGCTTTTAAAGCATCGGTGAGCTGGCTATAATGCATCACTGATATTCATAGTGAGGAAC
GTGAGGCCTCTCCAAAAGGTTGACTTACGTTGGATTTACTAAAACAAGGAAAGACGTTAT
CGGATATTAGAGTTTTGTGTATTTCAATAATTACCGGTATTTTTAAAGGACCCAGACTGA
ACCAGCTTGGAAAGTTCTTTTTATCATATCAGTTATTATTTTTAAAATGTCTTAATATTT
CCTCATGCTTAGTGTCAATCTGCACATCATCAAAGCCATAAGTTTAACTGTGAGGTAGTT
TTAAAAGCGATGCTTCAACTATGCTTGGTTTATATCTTGACAAAGGAAGATGATGTTGGT
TGATGAAAATCCTCTTTTTGCTTCTGTCCAGAATGCGTACACAGCCACAGCTATCAACAG
CACCAACTTCTGCACCTCGGCCAAGGATGCCTTTGTCATTCTGGTGGAGAATGCTTTGCG
AGTGGCTGCCATTAACACAGTGGGGGATTTTATGTTATTCCTAGGCAAGGTAAGGCCAAG
TTTGAGATGTGGTAATTTTTTGCATGCGTGCATGTTTGTTCTTTAATAAAATAAAATTTA
AAAAGCAAAAACAATCCCCCCCACAAACTGAAAGTAACTTAATTAAGCTCTTATTATGTT
TCAGGCACCGTTCTAGGTACTTTATATAGTATTATGCTTATTTAAGCCTCAACAAAATTG
TAGGGTAAGTTCTGTTATTGGCTTCATTTTACAAATGGTGAAACTGAATGTCTTAGTCAG
CCAAAGGGGTGCTGATGCAAAGTACCAGAACTCTGTTGGCCTTTTTAAAGGGTATTTATT
TACAGTTACCAGACCCTAAAGACTCCAACTCAAGGTACCATGACAGGTACTTTTTCACTC
AAAATCTGTTGCCACGTGTTGACACAAGATGGCAGGCGGAGTCTGCGAGGGTTCAGCCTT
CCTCTTTCCTTTCAAAGTTCTGTGGGCCCAGTTTCTTCTGATCTCAGCTGTAGGCTGGCA
TAAGGCTTGTCTCTCCTCCCAGGACTCATCTCTTTGGACTCAGCTCCTCTGCTCTCCACA
AGGCCAGCTGTAAACTATCAGGCGAACATCTCAGCTCTCCCCAGGGCTCCAGTGTTCTCC
TTCTCTCTATTTTCTTCTGTGTAAGAGTCTGTTTTATCCCCACCAAGGGTGTGGGGACTT
AACCCTGCATGCCCTAATAACATGGTCCAATAAAATCCCTAGTCTTGATTTAATCAAGTA
AAAGTGAAACCTCTGAATCTAATATAATCAAATACACCCAAAGGAACAGACCAGTTTATA
AACACAACCTAGTATTTACTTTCGGAATTCATAAACAATATCAAATTTCTGCACTGAGGC
ACAGAGAGGTTATGTAATTTGCCCAAGGTGATACAGCCACTTTTTCATGTTTCTCCTTAT
TCATTTTGAACTGTGAAGAATTATGAAACAGTCATATTGTGTTTAGGGGTTCTGCTTCTG
GAGTCTGACTGCTGGGCTTAAATCTTGGCTCTGTCACTTACTAGATGTGTGACCTGGGGC
AGAATACATAAACATATCTGTCCCCCAGTTTGCTCATCTGTAAAATTGGGTTAATATANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGGGGATTAGACCTGTTAT
ACTTGTAGAGTGCTTAGAACAAGTGGCTGACATATTGTAACTCTCAATGATGTATCTGTC
ATCGTCGTTTTTATATATAACCCGGTCATCGTCATTTTTATATATAAACCCCTTATAATA
TAGTTGTTGGGAAGTGGGACTAATACTTTCCTTAGCAATATCTCAGAAAAGGTGACTGAT
TCTACACTTTGCAAAATAATAAATAGAATTATACTTGGATTTCACTGTATTTGTATTTCA
AGTCATAAAGTACTCTGGAATTATGGATAAGTGAGAAGAAAGACTTGTAACCCCACCCTA
TAGCCTAGTAACTTCTTGTTTTTATATAGTCCCTCCCCGTGTTTTCTCATAGGCTTATAT
TTCCACAACATAACAATCATAGCAAACATACCTGGTGGTCCTGCCCTTTTCACTTCACAT
TGTATCTTATACATTTTCCACATTACTTTGATAATCTTCATACATACTGATTATCGTGAT
GGCCAGTATTCCATTATGTGCTGTACTTAGACGTTCTGTTATTACTGAATACTTAGGTTG
CTCCATCCAGTATGCTTTAAAAATGTTTTTGAAAAGAAAAAAAAAAATTGGTGTAAAGAA
CATGGTAGCACTGTATGGTTCTCAGTTGTTTACTAATATATAATAAGCTGCAGTGGAATC
TTTGTATACAATCCTTGCCCACATCAATACTTACTTCCTGAGGCCGGAATCCTAGAGTTA
GAATTAATGAGTCAAAGAGTGTCGAATAGGTTTTTTTGGTATGCATTGCCAAATTGCCTT
CCAGAAAGATCTATTTGTGAGTAGTGCAATATTTGTAGTATTAAATATTAAATGACTTTT
AAAAACCATGAAAAAGAAACCTTTTTTTATTAGTTGAGAAATCCACAAAGGAGAAAGATG
AGGGAAACATTTTCTGAGTTTCTAACATACTAAGACAAACACTCTTGAAGTTTCCTTTTT
CAAAAACGTGGTTCTGATAATAGAATACAGTAAATCCTTTGAAAAGTGTTCCTTTTCATT
GCAATTCAAGGACTTCTGGTATATAGAAATTGTTTTTGATCAACTAGATATATCATAATA
AACATTATAAAAGACAGTGTCAGAAAGAAACTAACTTGGTACATTTAACAACTTGGATGA
ATCTTTCTTGAGGTAATTATGCTGAGTAGGAAAAGCTAATCTCAAAGGATTATGTACTTA
TTCCATTTATTAACATTCTTAAAATGACAGAATTATGGGACTCGAGAACATATTAGTGGT
TACTCAGGGTTGGTTATGGGGTAGGTTGGTTATGGGAAGGCAGGAGAGGCTTTAAGAGGG
CAAAGTGAGGGTTATTTGGTGATGCAGATGTTCTGTATCTTCATAGTATCAATGTCAACA
TCCTGATTGTGTTATTGTACTGTCGTTTTGCAAGATGGTACCCTTGGGACAAACTGGGAT
CTCTCTGTATTGTTTCTTTTTTTGTATTATTTTTCACAAGTGCATACAAAGCCACAATTA
TCTCAACATTAAAAATAATTTTAAAACTTTGAATTAACAAGAAAAAAAGAGAGTATCATA
GTTTCCATTTCTTTGGGGCTCTAGTGGTTTTTATGGAATGGTGAATTAGATGTGGAAGGG
ACCTTTCCTCCTGGATTAGTAGCCCATCAGTGGGCAAGAGGCTCTTCAAAGGTAAGACTG
AAACTTTATAAGCTATTTTAAGTGTTTTAATCTAATAGAAATTGCATATTTGCCCCAATG
AAGCTATATAAAAACCAAAATCTTTAATTTCTTTGCTTTTGTGTCAAATATTTTATCTCT
GTGTAATAATACTTTTCTTACACTGATTATATGTTCTGGTTAACAATTTACTTGTCTTTG
ATAAGTGAAAAAAAGAGAAAACATGAGTTATTACTTATAAGTGCTATTTTATTGGTAAAC
TAAATCTTTTAAAATGGATTCCATGGGGAAAGGCCATGATAAATGCAGGATCCATGGTGG
CCAAAAAATAAACAAACAAAAGAAAGAAACTAACATTGCTAGGTGGCTGTGTTAAATGCT
TTCAGAATGTTTATTTTACAATTATGGGGGGTATGTATTATCATGTCTCTTTTTAAAGAA
GAGAAAGACTCAGAAAGGTTATAAAGACTAAGAAGTACTTACTTTGTGATGCAAATCTAC
ATCTCTCTGACCGTAGCATTTTTCCATTCTTTCCATCCTACCCTGTGCATGAATCCCTTC
AACTGTATGGCAAATACTTTATCATCAAAACCAGGGTGTCTAAACTTAAAATCATGTATC
CTACTAAAGAAAAAGAAGTCGAGCACAAATTCCCAATATAGTTACATTTATTTATTAATG
ATATATGCACAACATTTACTAATCTTATACATTATAAAGCTATTCTCTGAGGGCGGGGCC
CAGAAATCGGCATTGTTCACAAACTCTCCCAAGTTATTCCTGGCCCCTCTAAAGTTTGAG
AACCACAGATGTAGCCTCTGCTTGAATCAATGCAGGCAGGCCTTTTAGTATTTGTGAGTC
CTTATTGCACGTCTTTGACTTCTGTGGCTAAGCCTCTCTAGTTCTCGAGGTTGTTTCTCA
CCTAACTTAATGCCCAGCCTTCCATCTCAACATCTTTATGTCCCAACATCTAATTTGTCT
CAAGATCTAGTTTGTTTGAGCCACAGCTTTTTCTCATAACTGACTTCACTATTTTAAATG
CAGTTTGAATTTTGGTGGTGTAGTGAGAGCATAAAAAACGCTCAGACCTCCAATAAAGTG
GATCTACAGAAATTGAGGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACCGAAGGACACGTGTTGCTGCAAAATGAGCAGGGTTGCCCTAAGCTTGGGCAGACTCA
GATTTGTCCCCTGAATGCTTCTGAGAAAGGTATCAGTTTATAACTTAATCAGTATATATA
TCATCTGATGCCTTATAGCCCTTGATTGAGATAAAGCTGAATGAGAGATGCTTTGATGCC
TGTGGGGAAAAGAAAGAAGAATTATCAGTCTACCTGTCCTCAGCACCAAATAAGGAAAGG
CTGCTGTGGTTCTGATGACTCTTGTCCTTTGTTAGGTAAAGCCTGGTGCTGGACCAACTA
AAGGGCTGGGCAAGAGTGCATCAGGGATTCAACATAGCCCACCACTGCTATGTGTCAGTC
TCTTAGTACTGGCTGAGTTTTTACCTGCAAAGAACACTGGAGTTGCACCAAAAGACTCTT
TCATTTGTGCAGTGTCTGCTGTTTACTCTGTGACCTTGGATATTGCTTATTTCTCTAAGC
ATGTTTCCCAATCTGGAAATGAAATGATGATGTTTGCCATACAGCACTTTACAGGGTGAA
ATAAAATGTATTAAAAGAACCATACTAAATATAAAGTACTAAGTGTGAGATGGTAGTGTA
TCAGAGCAGGTGGTTCTTGGGAATAAAGAGATTAATGCTTTCTTTATTATTATTGCTTGG
ATCTTCTTGGCAACCTCTTTTTCATAGATAGTCCAGATCTAAACATCATGGCAAATCTTA
CTAAACTGACCATATAGTCTATGTGAAATAAAATATGAAACACAGAAAAAGCTGTAAGAA
CAGAGATGTTCATTTTACCTTTAGTATCTGAAAACAATATAAATCTCAAAGGTAGGTGAA
CAGTTAAGTAAACTGTAAATCAACTAGAAAATGAAATTATGTAGCCAAGTATTTATGAAG
CATTTATAATGATACTGTAAATATTAATGAAGAGCTTTTAATGATTTGTTTAAGTTCAAT
TTCATAGATGTTAAAAAATGCTTAGAAAAATACATAGAAATATCCTGAAATGTTTGTTTT
TTTCCTTAAGAGTACATATAATTGTTTTTCTAAGCTTGCATATGTTTACCTTAAGAATTG
CCACAGATTCTAAATAAAGTAGGGAACACCATAAATTAGGGAAACATAATTATATTTATG
TAAAGCAGGATTATTTAAAGTATGATTTTTAAAATTACAAACTATGTATAATAAATAGAC
CAACTGATATGATTTAAAACTCTGTGTGTATATAACCCCAAAAGTGATGAGGAAACAATG
GTTTTCTTCAGTGGATGTTAAATGTAGCCTTTGTTCCCTTTGCTGCAGGTGCTGATAGTT
TGTAGCACAGGTTTGGCTGGGATTATGCTTCTCAACTACCAGCAAGATTACACAGTATGG
GTGCTGCCTCTGATCATCGTCTGCCTCTTTGCTTTCCTGGTCGCTCATTGTTTCCTGTCC
ATTTATGAAATGGTAGTGGATGTTTTATTTTTGTGTTTTGCCATTGATACAAAATACAAC
GATGGGAGCCCTGGCAGAGAATTCTATATGGATAAAGTGCTGATGGTGAGTACCTTTGCA
TGCCCCCTCTTGCCTCTCGGGTAAAAATAGTAATGGAAACATTTTGCCACCCATTCTCAA
TAGCTAACTCCCATTCTGTGTAACTGAGTAGTTGAGATTTCGACCTGTAGCACTCGCAAA
TGAGGCTAGTTGTCAGGGTAGAAAGGCCCTCTTGGCATGGACAAGACCACTTCAAATCCA
TCTGGCCGTTGATAGTCCCGGGTCAGACCAGTCTGCATCCCTGTCCCTTTCCCTGCACTT
GGATGGGTCTGAATTGACTTCGTAAACCCTCCTCCTCGCCCTTGAACTAGGACATTGGGT
CACTGATGTTCTAAGTGTCTTTTCTTCAAATGTGGCTCAAAGACAAATGTCTTATTTCCC
AGGTTCGAGTGCCTCCCTGTATTTCCCCATCTACCACCTTTCGAAATGTGATTGTTGCCG
TCCCTAGGTAAAGCTTGTCTTAAATATGCCAGCCCAACCCAAGGTGTTGATTAGTGAACA
CAGATAACAGACTAGTGACAGGAGATTGCGTTGTTTTCCATCAGCTACACTGATATTATA
TTCAACTTCTTCAGTTATGTAGTCTTGCAGCTTCCCTCTATTACAGCCTCAATTAAAATT
TTAAAAAAATGTCAACCATGTTCAGTGGTTTAAGTGCTATTATCATCAATGTCAAATGCT
ACCAAATTAAAGATGTTTTCTAATAATAGGACTTTGCTATTAAGCCGTGACATAGTCATT
TCTCCAGAATGGATAATATTGAAGCCTAAACATTAGACTTTGAAATGACAAATCATCCTT
CAAGGGCATGTCTGACCAATTAAATCTAGAATAAATGTATTCGTAACTGGCTAGACTCTG
CTTTTTTTAATAGCAAAAATTTCAAAAGTTTATCTGACCTCTTTGGTGCTGTTCCTTTTT
TTTCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCCAACTGAAATCTGAA
ATGATGCAAGCATTCATGCACTTTGGTCCATGTTTTGCAGGAGTTTGTGGAAAACAGTAG
GAAAGCAATGAAAGAAGCTGGTAAGGGAGGCGTTGCTGATGCCAGAGAGCTAAAACCCAT
GGTAGGTGAAGACGAGGAGGGGGCCGCCCTCCAGGAATTTCACTTTCACTTCCTCTCTCT
CTCTGTCTTCACCGACTGCACTTCTTCGGGAGAAGCTTTGGCTGTCTGTATCACGCAGGA
CATGCTGCTCTTTCTGTTTGTGTGCTTGCCTGTCACTTGGATGGCAGAATTCTTGTCACA
ACTGAGACCATCTTCTGTAAAAGTCAGCTGAAAGGAACAGCGCCTTCTTCTGTGCACAGA
GGGGGGTCGAGGGCACTATTTTTGTCCCTGAGGTGAAATTGCCAGGCTTTTTTTTCCCCT
TCCTTTTGAACCGTCAGTGTTTAATTTTCCCCCTCACTGAACATTTGGTTGTGCACTTGA
ACCGACGCGTTGATTTCTCTCATTTTGGAGGCGATAATGGCACTTCCTTTCAACTTGCTA
AAATTCATACTCCGCCATTTAAAAAAAATACTCTTCTGTTTATTTTGCTGTCTTTCTCCC
TTGCTGACTTTCTCTTCTTTTGCGTGGATTGTACTTTCTTGGTTTCTTAAGCTCTCTTTC
AGTAGCAAACAAGACAATTTCCATCAACACCCACATTCTCTCAGGTTTTTCCCTCCCTCC
ACCCCCAGTTTAATTGTGAGAGGGATAAATGATCTCTTGTGCGTGATATATATTTATATA
TAATACTATTCCATTTTTATTTGAAAAGCAACTTAAAAATCAGTACAAAACAATCCCGAG
TTGCCTTTCCTATAGCTAATCTCACATCCCATACTGACACATCACCAACATATATTAGTC
TAATTACTGCCTCATTTTACAAATGTATTATTGCTTAAATTTTTATGTTTATATGTATAT
GAATATACGATTTTTTTCAAGATAGCATAGCATTACTTCTCCATCCTTCAACAGCTGATT
TTAGATAATACGCCATCTAGTTGCATAAGATGTCCAAAAGCGTGAGGTCTCTCCTTTCTT
TCTTCCATATATTTTAAATAAATGATTTGATTTATAGGTTTTCAACTTGAGAAATACATG
GTATTTTTAAAAAATCCCATGGAAGTGTGTACATTTATTGGGGGTGGAGAGCCACTGTAT
GCATATGCAAATACTCACATATTCAGCCTAAATTAAGAGTCCCAACCAAACGTTTTGTTA
AAAATTCTTTGCTTTATAACCCCTTCTGGTGCCCATTTTGGTGTTCCCCTGAGTAGTGTT
AATTATAAAGTCAAAACTTGAAAGTTTTGTTTCCTGGGGCACAGATTGCTCTTACCTTAA
GTGAAAGGATATAAAATGATGTTCACTTTCAGTGTGCATCAGCCAGAACTGGATCAGATG
GGGCAAGAGGCACTGAGCAGCAAACACTCCAGGCAGGTTTCTGGCCTCCTCCACCCCTAA
TTTCTGTGTCCCTCCTACCTCACCTGGACCGCAGGGTACAGTAGCGGAGATCTGCCAACT
CTATGGAAAAATGGAGAAATGAGGGAGGCTTCCTTCCACCCGCTGTTGGGTTGTCCTGAT
TGATCAGGAAATAAAGATTTCAAGCCTAAGATTTGAAAGAGCATACAATTTTACATCGTA
TGCACAGCATTCAGAATCAACTGTATTTTCCTTTTTTCTATCTATCTAGTCATTGAAGCG
CCCTTTAAATTATTCTTTAGGAATAAGCTTTCAAAGAAAGATAGGTAATTTTGCCATGAC
TTGGCATGGGTTTCTTCATTATTTTGTGAATGGTAGAGGCTTTTTGGTAATCTAGACTAC
AAGCATACCTTTCTGTTGCCTAAATCCTTAGGATCGAGGTAATAATATTAGGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGT
GCTGAGGACTTTGCGGTAGTAGGTTCCTAAGAATGGTATTTTTAAATAAAACCCTAAAAG
AAGTGTCAGATGTTGCTTACAGTGGTAGTTTTGTTTTTTTTAAGCACTTCAGCACCTCCA
ACAACTCTTATCTCTCTTATGGGATTAGAGTTGACCCCTACTATCACCTACTCCCTTGTA
TGCATCCCTAAAGGATGCATAGGGCTGAGAATTTAGCCCTAAAATTGGACGATTGGTAGA
ATTTAAGATTGCTTATTTGTATCCACTTGGGTTAATTCACATGTTAGTCCCTTAGATGAA
AGTTCTGGAAAAGAATGTCATATTATTTTGCAATATCTCTAGAAGCACTGCTGTTTGTGC
TCACACTCTCTGCCTTCCTCCTTAATGGGATATTTTAACTTAGAATTTTTAGCTTGAAAA
AATAATGTTCAAGAAAATGAGGTCTTATATTTTCCTTTTGACAGGAAATCATTGAATTAA
ATATAAGTACTTCTGCTTTTCCTCTTGGACTTTCGTTTTATTTTTTTTAATAGAGAGAGC
CTAGCTAGTTAAGGAAACTTTGAAGGTTCGTGAGGTTTTTTTTTTTACAAGTCACTGGCA
ATTATTTTGGAAAATTTTACCAAATATGATGAGGGGGCTTAGGAAGGAGCTTTTCTGGCT
ATCCACTGGCTATCATACAGTGAAGAATTTACTGAGGAAAGGGAGAAAGAAACCTGAGCA
TTCTAAGACCTTGGGCTGGAGAAGTATGGTCTGTGTATCTCAAAGCCGATAACAGAAAGG
GGGACTCGGAGCATGTGTAGGAATTTCAGCCCCTGGAATATAGGTTCAGGGGAGAAGGAT
TCTCAGTCCATTTTGCCCTGCCGCTGTCTGTGACCACGTGTGTGTTTTTATAACATCATT
CTGGATTTCCTTTTAATGGTCATTATCTAAGATTCTACTCTGTATGACTTTGTTTTCTAG
GCTTCGGGAGCAAGTTCAGCTTGAACCTAGCCGACCGTTACGGAACCCATTGACATTCCA
AAACAATATGTGCTCATAACTATGTATTTGTGTGTGTGGGTGTGTGTATATATGTATATG
TATGTGTGTATATATGTATATGTATATACACACACACACATAATCAGCCAAAATCAGAGA
AAAGGAACAGGGATTTAATACCTTTTTTATGCTTATTTTTGTCAAACATGTACTCCTTTC
ATACGGGTGGCTTTTACAAGGCAACTTCCGTCATTTAATGTTTTCGATTGTAATTGTCTT
AATGGAAATGTTAAGATTCATATCTGATTAACATTTTTAATAACTTAGAGGAGATTTTAA
CTTTAGTTATTTAAATTAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGACTAGGCATATGCGTTCAGATAAATAAGGAATCACTCCAATCACTTTTTCCCTAATC
AATTAAGCCATGTCATTTTACTTTTTCTTTTAGAAACATGCAAGTGGGCCCAATAAGGGA
ATTTTCTTCATAGGTTATACATTTGTCAGCCAACATTAAAAAGTAACCAACTCCTCAGGT
ATTTGTAGTTTACCCTAATGCTTCTATAAACGAGAGTAGGTAAAAGAAAAGGGTAGATAA
TCTTTCTTATGCAAACTCTTTTCTTACATTTTGTCCTTCTTTCATTTTTGACTTTACTAG
CATCCTCCACACATTATGTGTGCCTGGTTTGAAAGGAAGCTGGGGCTCCCTGCAAGTTTA
GCCTTTAAGTTTCTATGGATTGGTTTGCAGAGTAAATAATGCTGGGAGGAGTAAAGAAGG
GAGAGAAACATGGAACATAGCGCATTGAAAATTCAGGTGCTTGGGCTTCTGCTTCAGAGG
AACTGCACTGGCTTAGGCCTGAATGGCCATTTGATTCAAATGCTGGCTGTAAAATCTGAA
AACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 51297..51439, 80366..80502, 91874..91967, 100031..100130, 100133..100150, 100153..100198, 102082..102171, 106207..106346, 108086..108272, 109313..109478, 110791..110947, 111785..111868, 120931..121068, 126468..126704, 128380..128460, 131460..131483
1001..1090, 51297..51439, 80366..80502, 91874..91967, 100031..100130, 100133..100150, 100153..100198, 102082..102171, 106207..106346, 108086..108272, 109313..109478, 110791..110947, 111785..111868, 120931..121068, 126468..126704, 128380..128460, 131460..131480
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved