Dasypus_novemcinctus Locus RPL4
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus RPL4
Dasypus_novemcinctus
RPL4
GeneScaffold_6262
SNORD18, SNORD16, SNORD18, SNORD18
1221..1292, 1653..1751, 2171..2242, 2804..2872
5082
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTGGTTGGGTTTTAA
ATTGTTGTCAGAAGAAACTCCACAGTTAGGTGGCTTGAAGGCTGTGAGAACACATGCCAA
GTATCTTTAGTGTTGATTTGCTCCCTCATACAGCCACAGCATCGTCCTGAAAGTAGGATT
AAGAGATGGGAAATGAGGATAGAGAGGTGGAACAGATTTTGGCGCCTGTAGACCATTCTA
AGAACGTTTGGTTTTACTCAGAGATGGAAAGTCATTGGAGGGGGTTGAACAAAAAGTAAC
ATGACCTTGTGTATTTACTAGTAAGCCCTGGGAATAGGCAGGGATAGAAGTTATCTATCT
TGGTCGCTGAGTAAGAAAATTTGCTTTACGAGAGGGGGAAGAAGGTGAAAGAAATTAGGT
TGTGGCGTGTATGATTTTGCTTTATAAGATTTGCTTTGAAAATTGCGTGACAACCCATTT
TCTCTGAAAATAAGGAGGCAGGACTTAAGATTCTAAGTGTCCTGCAAGTGTAAGATTTTA
CTGATGTTTATAGACCACTTGGTGATGCATTAAGTTAGCCTTGCTTTTGGAAAGAGTGTG
CCTCTAACATTGCTTGCTAATGTATTTTTCTTCTTCCCAAGGCGTGTGCTCGTCCACTGA
TATCTGTGTACTCTGAAAAGGGGGAGTCATCTGGCAAAAATGTTACTTTGCCTGCTGTGT
TCAAGGCTCCCATTAGACCGGATATCGTGAACTTTGTTCATACCAATTTGCGCAAAAACA
ACAGGCAGCCCTATGCTGTCAGTGAGCTTGCAGGTATGGATTTAGATCCTTCTACGAGTG
GATACTTTAGGGTCTGCTTTACAGTAGTGATGAAATAACACTCCGTTGGTCCGTGTTTCT
GACCCACATGATTTCCCTGGATGTTCTGATGCTGTTTGCTAATGTGCGTAATGGTCATAG
ATTGGTAAGATTGAGAAGCTAAAACTTGTGTTTTTTCCCCAATTTTAGGTCATCAAACCA
GTGCTGAATCCTGGGGCACTGGCAGAGCTGTGGCACGAATTCCCAGAGTTCGAGGCGGTG
GGACACACCGATCTGGCCAGGGTGCTTTTGGAAATGTATCCTTTCATTTTGGTTTCACTT
AGACATAGCTGCCATGTAGAATTTATAGCAGACTAGTACAAAATACTAAATGTCCCATTA
AACATGGCCCTGGGCAGAATTGGAATCTGGAAGATCTTTTCCTGCCATTGAATTTTTCTT
GAAGAAAAGGGTGGTTTTGACATTCGTTTCGCTTGCAATGATGTTGTAATTTGCGTCTTA
CTCTGTTCTCAGCGACAGTTGCCTGCTGTCATTAAGCTGGTACAGAAGGTTGACGAAAAT
TCATCCTGAGCAGGACATAACTTCTTAGTTCCTAATATTGGAGAAATGTGATTCTTAACT
GGGAAAATAGATGTGTCGTGGCGGCCGCATGTTTGCACCAACCAAAACATGGCGTCGGTG
GCACCGGAGGGTGAACACAACACAGAAGCGATATGCCATTTGCTCTGCCCTGGCTGCTTC
CGCCTTACCAGCACTGGTCATGTCTAAAGGTGTGAGATAGTCTGTATCATAGGGCTAGTA
CAAAATACTGCTTTCTTCATCTGAAACTCTTCATTCATGTTGTAATTTAGTAAATTATAC
TTGTCCCAGAATGCCTATTGAATCACTCTTCTGAGCACTATGTATACTTGTTCGTGTACA
TGACTAAATTTTCCATGCTTAAGTAATTAGCTCCAACTACCTTAATGCAACAGATGACTC
ATGTTTAACTTTCAAAATGATGACATTCCACTATATTGGTCCGTGTTTCTGAAACACATG
ATATTTGTGGAAATTCTGACTTTGCAAATTGTATATAATACTGTTGTTTTTGTGAATTGC
CTAAAATAACTATCTTGTACAGTTTGTTGATTTTTCAAAAGTTTCATGGTGACCAGATAA
GTGTTGGATTGACTTTTTCAGGTCATCGTATTGAGGAAGTTCCCGAACTTCCTTTGGTGG
TTGAAGATAAAGTTGAAGGCTATAAGAAGACCAAGGAGGCTGTTCTGCTACTTAAGAAAC
TTAAGGCCTGGAATGATATCAAAAAGGTGGGTTCATGGAGCACATATTGTTTGGTAGTCC
TGGGATAGGTATGAAGGACATGTAGCTAAGCCTTAGGGAGTGAAGTGCAAGGACTCTTAA
TTCTAGTGTAGGAATCTTATGTCAGAACACTAAGTAGTCTCACTTTGTTAGGTCTATGCC
TCTCAGCGAATGAGAGCGGGCAAGGGCAAAATGAGAAACCGTCGTCGCATTCAGCGCAGG
GGACCGTGCATCATCTATAATGAAGACAATGGTATCATCAAGGCTTTCAGAAACATCCCT
GGTAATTATTTTTATCAGCCATCCTATGTAAGCTTATTTAGCTATTGTTGTGATGAGATT
CCACTTAGGTCCGTGTTTCTGAAACACATGATTTCTGTGGAAGTTCTGATTCTTGGCTGA
ATGAGGGCACTATTGATGGTTGAAGCTCCTTCAAAGTTGTAATTTGAGAAGGTTTAACTG
TTAAATACCTCTGGTACCTTATGTTGCAAGTAAGCCATAAAGATGATTTGTAGTTGTTAA
CATGGTCTCCCTAAATTTCCTTCCCTTTAAAAAGGAATCACTCTGCTTAATGTAAGCAAG
CTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAA
AGTGCTTTCCGCAAGTTAGATGAACTATATGGCACTTGGCGTAAAGCTGCCTCCCTCAAG
AGTAACTACAAGTGAGTTTTTCATATTCTTAATGTGGTTTTATTCTGTTATATTTTACAT
TCAGAGTTGGTTTGCATGTTCCGTAATAATTGTATTGAGACCTCTCAGTGTAGGAGGGAC
CTCATTTGGTCCATGTAGTGGAAATTTTGAATTCTGGGGAGCTTAAATGAATTTAAAAAG
CAATTTTATGTTGAGGGTCATGTTTTTTAGTCAATTACATGAGAAATAGGAATTCATGCA
TCCGTTGGCAACCTTCTTCACCTTTTTTACTTCAGTCTTCCCATGCACAAGATGATGAAT
ACAGATCTTAGCAGAATTTTGAAAAGCCCAGAGATCCAGAGAGCCCTCCGTGCACCACGG
TAAGTTATTACATTTATGATATAGTTCTTAAAATCCACTCCTCTTCCTTAAGCTTTTGAT
TATTTCAAAAGTGTAGGTGATGAGCAGGGTATACGCTATAACGATGTGAATAAATACAAT
GTCTACCTTACAGCAAGAAGATTCATCGCCGAGTCCTAAAGAAGAACCCACTGAAAAACC
TGAGAATCATGTTGAAACTAAACCCATATGCAAAGACCATGCGCAGAAACACTATTCTTC
GCCAGGCCAGGAATGTAAGCAATAATTCTTTATTACAGTTAATTAAAGTTTCCAGAAAGA
CTTAATTCTTACATTTTCCTAATTTTTTTGCAGCACAAACTCAGGGTGGATAAAGCAGCA
GCCGCACTAGAGGCCAGATCAGATGAGAAGGGCGTTGCAGGCAAGAAGCCTGTAGTGGGG
AAGAAAGGCAAGAAGCCTATTGGTGTTAAGAAGCCGCAGAAGCCTTTGGGAAAGAAAGCT
GCAGCTACCAAGAAACCAGCGGAAAAGAAATCTACCACAGAAGAAAAGAAGCCTGCTGCT
TAAATTGCTTATTACATAAGTCAAATCATTTTGGACAGCTTATTTTGAATAAAGGCCAGA
TCAAAGAGGCAGTGAGAAACATGGCTTGTGTTGTATGAATCTTGGTTGGATTTTCAGAAT
AACCTTAAATCACTTGAGCCCTTCATTCCTTCCATTTTAGAGTTTGTTTCATTTTATAGT
CTAGTACAAAATACAGGCTTCAATTTTATACATTGTGAATCCATGTAGAAAGGAACAGCT
CTCAAATGTACATTATAAAATCCATTTTATATAAATACCACCTGTCTTGAAAAACAAGTG
GTTAAAAGAATTTAAGAAACTGGATAAAATACGTCCATGAGTATTTGCCATTTTAAGTAA
CCACGAGGGCAGAATAGTAACCACATTTAACAGCTTCAGTACAGGATGGACATGCTGACC
CAAATGTACTACAGAAATTCCCCAAAAATTGCTTGGGTAGTTTAATTTCCTAAACATTAC
TATTCTAGAACTCTCTCCCTGTGTTTTTTCATGTCATGGTCTCCCTTTGCACCTGGGCTT
ACCATTGGAAGGCTGTCTCAGTTGGCATTGACTGTCAGGGTGATCGATTGTAGGCATATT
GAGGTAACATCTCACTGCAATCCTTTCTTGCAGAACCTCTCCTTAAAGTGTCAGTGGCTT
TGTACTAGTTGCTGGTGATTTAGATCCCTCTTAAGATTAAGAGATTTGTTGCAACAACAC
ATTGGAAGTGTAACAAAAGCAAGTACTGTTAACCATTTGAACTCTGGCCTATCTTCAATG
AAATGGGCCGTGAGGCTAAAGAATGTCCTCAAATTGGATATTCACAATTTTATGGCAGTT
CCAACGTCCTATGCTTTAGGAATATCCATCAAGAATTTCTAAATTCAGTCAAAAGGATTA
GAGACCTCCCGGATGGAGCGGCGTGCGTGGGAACAGATTCCGGAAATACGCTCGCAGTCC
TTTCCCAGTTTGGCAGCCCGCCCTGCGTTTCGGCTTCCGGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1368..1474, 1810..1948, 2361..2485, 2631..2760, 3034..3190, 3455..3538, 3673..3793, 3873..4082
1001..1172, 1368..1474, 1810..1948, 2361..2485, 2631..2760, 3034..3190, 3455..3538, 3673..3793, 3873..4079
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved