Dasypus_novemcinctus Locus UTP18
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus UTP18
Dasypus_novemcinctus
UTP18
GeneScaffold_4317
SNORA28
3256..3377
59557
GACTATGGACAGCGCAGGGGGAACCCCAGTGAGGCCGGGGCTAAGGGGATGGGGGGAGG
GGAGACCCTGAATCGTTTAACGGCCGGGAGGGGGAGGGGGACTTTAGAGGAAGAGGGGGC
GTGGGATAGAGAAGCAGGCCTGGGATAGTGGTCAGGGAGCTGCAGGAGTCCCTGAGGTCG
GGGAGCTGCAGGCGTCCCCCCCCACCTTGCACACAAAGCGGCTGCCGCGCTCGGCTCTCA
CCAGATCCTTTGTGTTTTCCATCAGGGCCTCATGGGTAGGGGATGTCCGTGCTCCCCGGG
CCCGCGGCGCCCCCTCCCCGCGCTGGGGGGTAAGCGCCTCTCCCCGGGACTGCGGCAATT
ACAAGGGGTCCCCGGCTGGGCCCAGACTGGCGGCGGCTGCGGCAACCCCCGGATTTCCCC
CCTTTAACTCTGGTGGCCCCAGGATATCAACAACATTAGCATAGCCCTCCCTCCAAAGCG
CGCCTGCGCCGTGACCCGCGCCACGATTGGCCCGCTCCCCTCCATACCCTCCTCTCTTTC
TTCCAGCGTGAGACCCTCTGCAGGCTCCGTACTCTTTGGGCCGTACCAAGACGAAGGGGT
GGAAAAAGTAATCGGGGCTTGGGTTTAGTCGAGTGGTTAAAAAGCAGAAGAGTAGAAGTT
TCATTCAATCATCTTGGTTTATACTCTGGATTTCTGCACTCCTTTGACTATGTTGCACCA
GCGAAGATGAGTTGGGAAAATTTTCCATTCCTGTCACGCCGCTTCCCACTTCACCCGGAA
GATTGGTTCTCCGGGAGGAACTCCCACGTGGGGAGGGGCTCGCTAGAGTAGTGGGCGTTG
CGTAGAGAGGGCGTGTTGGGTCACGTGTTGGGAGGCTGCACAGGCTCCTTCCGGCTCCTT
CCGGCTCCTCCCGGCCTTCAGTGGCAGCGGAAAGCGAGGCGTCTCGGCGCTTGCGCAGTA
AGGCTCCACGTGAGCGCCTGCGTTTCTTCTCAAACCCAACGATGCCGCCAGAGCGGAGGA
ACCGGATAAAACCGAGTCGAAGAACCGAAAGGATGCCCGCTTCCAAGACCCGAACGAAGC
AGGACCGGAGAAGCGGAGCGAGGCCAGGCGGACCGGCTCGAAAGGCTGCTCGTTCATCCC
AGCGGAAATCCCCCGCCCAGCTGAGCGAGGCGACCGCTGCGATTGCGGTGGCGGCGGCTG
AGGAGAGGCGGCTCCGACAGCAGAACCGCCTGGTGTTGGAGGAGGACAAACCGGAGGTGG
AGCAGTGTTTGGAGGAGCTCGTCTTCGGTGACGTCGAGGGTGATGAGGATGTGCTTCTGC
GGCGTCTGCGGGGCCCGCGGGTGAGAGAGGCCGCCGAGCTCGGGCGGGGCGCGCCGAGAG
CGGCGGGGCTCCGGGGGCGGAGACTGGGGGACCTGCGGCGAAGAGAAGCGCTCAGGTGGG
AGGGAGCTGGCGAACGCGGGCGCCGAGGGGGCGCTGCTGTGCGTCCCCCGCCTCCGGGCG
CCAGACGAAGTCTTCGGAGGGCGTAGACCTCGCCTTTCTCCGCCTTCCTGGCCTTGGGAC
CCAGCAGGTGCTCAACATGTAGTCCACAACATTTTCGCAGGCTCATCTTAATTTTTCCCC
AAAACTTAATGTCCCCCCCTCCCCTCCCCAAGCGTGGTAGGTCGAGCACTTGCTTCAGTC
TCTTGCTGTGTTTGTTGATGCAGATTGTGGAGTTACATTTTAGTTGTGGAATCGAGATGC
CTGGGCCTGGGCCTGGGAATCTGCATTTTAACGGTCTCCTCTGGGATTATTCTGCACACC
AACTTTTAGGATTACTATGTATTCGTTTATTCAACAAATATTTGCGAGCCTGTTTGGTGC
CAGATATTCTTCCGGCTTTGGCAAACCCTGCGTAATTGCTAATAATGTTTTATGCTTTTA
ATTTTTTTTTGTTATTTGTATGGCTTTTCTCCCGAATTTGGGAGATCCAGGCACTGGAGT
AGACACACCAATGGACAAAACTGACAGAAACTCTTATTTTCTTGGAGTTTACATATTAAG
GGAAGAGACAAGGTAGGGAAATAAGGAAGAAAATCTCAAGTATGTTAGTGACAAGTGCTG
GAGAGAAAGAGAGGGGAAAAAAGCATTCAGGGAAGGGTGATAAGTGCTGTGGAGGAGGTC
TGTGACATTTTAGATAGAGTGGCCACGGAAAGCCTCAGAATTGCTTAGTAGATGTTTGTT
AAATGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAT
GTTGACTTTCCTTGGCTTCCAGTTTTCCTCACCTATCCAGGGTGTGGTGGTGGTTCACTG
TCTCTTCATTTTCTTATTGGCCTCTAGCACTTTGGTGGCATTCCATCCCATTGTTTCATC
AGAGGACTTCAAACATAAAGCATTCTACAATCCACCTGACTACAAGTCGAATGAAAACAT
TATTTTTAGGGCATTTTGTCTTCTCTAGGTTCATGTAAATGAAGAATCTGGTGACTCAGA
AGTGGAGAATGAAGCAAAAGATACTTTTCCACCTTACAAGAAGCCAGTTTGGGTGGATGA
AGAAGATGAAGATGAGGAAATGTAAGTTGCCTAACTTTTTTCCAGAATTCCGCTGATCAC
TTGGAAAGTTATTTTGCGGGTTTTAAAAATTATCATTATGAAAATACGATTCAAAGTTTC
AAAAATATAAAAAACATGGAAAAGGACATTCATAATCCCACAGCTGAGAACCACTGTTAA
CATATTTACATACTTCTTTCCCTTTCTCTCCCTTTCTTTGCTGTATAGGAAAGCTAGGAG
AGCATAGTGTTTGTACAAGCAACTCTGTGTCAGATGATCAAAACTCTGGCACAATTTCTG
CTTGCTATAGCAAGAAAGTCTAACCTATTCCCATGTTCACTGTTCCGTGAGACAAGCCGT
TATAAAGGCTTAAACAGATTAAATTTGCTGGCTAAAACCTAGTTAAGATTCGGCTTAAGT
TCATGAGGGAGGGATGGAGGGGAGGGACAAAAGGGCCAGTACTGCCTGCTTTTTGAGGCA
TCACCACTTTAATTTTGCCCAGCAGTAGCGTATTAGAAATACCTAGATGATTACATAATA
AAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTATTCATATCAATCTGGTTATTTTCTTTCAGACATGTCCTTTCATGTACTCTATG
ACTTGGTTTATAATCATGAGGAAACTTTTTACTTAGTCTCCAAGATCGGGGATGTGTTGC
TTTAGCAATTAAAAGAACCATGTGACTAGATTTAATTAAAACCAGATATATATTAAGGAC
TAGTTTAGATAGGCAAATGTTCATGAAAGTTTCCAAGATAGGCAGGTTGTGACTTCCCTG
TGAGTAGGTGGTTTTTTTTTTTTTTAAGATTTATTTTATTTATTTCTCTTCCCCTCCCAT
TTCCCCCATTGTATGCTCTCTGTATCCATTTGCTGTATTTTCTTCTCTGTCTGCTTGTAT
TCTCATTGGGTGGCTCCAGCAACCAATCCTGGGACCTTCTGAAGTAGGGGAGAGGCAGTT
ACTCTCTTCTGCCACCTCAACTCCTTGGTCTGCTACATCTTATTTTCTCTCCTTCTGTCT
CTTGTTGCATCATCTTGCTGTGCCACCTCTCCATGGCGGCTGGCACTCCTGTGTTGGGTG
GCTTTCCCATGCTAGGTGGCATTCCCACACAGGGAGGCACTCCTATGTGGCGTGGCATTC
CCGCGTTGGCCGGTACTCCATGTGGGCCAGTTTGCCCTCACCAGGAGGCCCTGGGCATCG
AACCCTGGACCTCTCCTGTATGGTAGACAGGAGTGCACTTGGTTGAGCCACATCTGTTTC
CCATGAGTAGCTCTTTTGTTCCTTTTTTTTTCCCAAAGATTTTTAATTTTTAATTTATTC
CCCTCCCCCCATTGTCTGTTCTCTGTATCCATGCACTGTGTGTTGTTTGTTCTTTGTCCA
CTTACATTCTTGTCAGGTGGCACTGGGAATCTGTATCTCTTTCTCGCGTCATCCTTCTGT
GTCAGCTCTCTGTGTGTACGGCGCCACTCCTGGGCGGGATGCGCTTTTTTCGCGCGGGGT
GGCTCTCCTTTCCCATGGGGTTCCCCCTGTGTGGCACTGCACTCCTTGTGCGCAGCAGTG
CTGCACGTTGGCCAGCTCACCGCACCAGCCAGGAGGCCCTGGGTACCGAACCCTGAACCT
CCTATATGGAAGACGGACTCTCTGTCAGTTGAGCCACATCTGTTTCCCGTTCTTTTGTTC
TTATAGATAATAGGTTGTACACATATTCTCGAGGGTGAGCTAACCTATACTGTATAAATG
TATTAAACTCTGTGTACCTAAATTGTTTACCAGAAAATTTAATTTTTGTATTTTTGTTCA
GATTTCAGCATGCCATGGGGGGAGTACCTGAATGGGTACAGTGTAAAAAGCGGAGAACAT
CTTCAGATTGTGAGTGCTGATGGTTCTGTTTAAAAAATTTTTTTTAAATTTTATTTCTGT
GTTTATTTTTATTTCTGTTTTAAGTTAGTAAATAATTCCCTTTTTCTGTTTATTTTTTTT
GAGCTTTTACATGAAGTTCATCAAAATCTTGTATTTCAAATATGTCTGGTTTTGAAATCT
ATTTCTCTGAGGGTAGCCTTTTTTGCAATTGTGTAAAGCTTAATAGCATATTTTCCACTG
TCAGAACAAAAAGGGTAGATGGATTTTATGATGTTTCTCTCTCAATAGAACTAGGTTTCA
TTACAACATAGAATTAAAGGAGAATGGGTGATATTGCTATTACTTGATTCAGAATCCCTT
CTGGAGACATTGGAAGCTAATCTGGAAATTATTTTCTGTTTTAGAATGCAGTATTACTAG
AACCATAGTGTTTCAGATTGATATGATTATGCATAAAGTTAAGGTAGCTGTTTAAATGGA
AAATATCAAAGATACCAGTGGCTTACTTCAATAAAAGTTGTTTACTCATGCATATAAAGT
TGAGATGGAGGGGAGGTCTGTCTTCTATTCTTGGAACCCAAATTTACAGAGGCTCCTGCC
ATCTTTAGGCTGGGTCTTCCAAAGTTGCCCAAGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATTAATTCCTGTTTTAGAAGAACCTTGTGTACCAGGATGCTCTCTGTTTG
CTGAACAGCTATGGATTGACTGCCCTTGATTGAGGAGCCCACTTCTAGTCCAGCCAGCTG
TGGTCGAGGGGTGGGGAGGATAACTGTCACATAAAATGTGCCTTCTTCCTTCTGTTAAGA
GTTTAGGAGTAAACTAGTAAGCATGCTTATTTAATACCTCCTTTTGTTTTGCTGTTCCCC
TTGCTTATAGTACCATTCTTGTTTTTACTTAATGCCTACCTTTCCAAATCTCAATTTAAG
TTCCAATTCATCCACAAAGCTCTATTTGCAAGAGCTTTGTCTCATACTGATGTTTCTCTT
TTCTGAGGTTCTAGATCACAGATATAGTTTAGTGCTGAATTATCTTTTTGTATATGGGTA
TTCCATGCCTGTACCTTGTTCTCTGGGACAAAATCTTTCTGTTAGCCTGTATTTCTGTGA
CACTTTGTTTATTACTAGACATATGGATATCACTCAAGAAATACTACTCTTGGCATATTA
GAATCAGTTATACCCTTTTAACACAAATACCACTATAAGAATAAGTTTCCATATAGCAAA
ATTATTAACTTGTGCTATTTTTGTTCCACTGATTTAGCAATAATCAAATGAGAATTAATT
GGCATTATTTAGGAAGTTTCTGGTGTTTATGATGGTAGAATTTGATCTGTAGTTGGTATT
TTTGTCCTTAATTAAGGTAGATTTAGGCATCCATCAGATCTTAGCAAGAAAAGAGATACA
GCATAAAATAAGTACAGTGAGTGGATATTTGTTCCAAATCAAAAATATAAATAAGGAAAA
AATAAAATTATATAAACCAAGATATTATAGTCTTTCTACTAAATGCTTATAGTATGGACT
ACTTACATTTAGCTCAACCTAAAGAAGTTGTCTAGACTCAAATGAAGAAATGTATGTTTA
AGTAGTTTGGAAATTTAAAATACTAAATAATGCTGACATACTGTTTGCTTGTTGGCTGTA
ATTTCAAGCTAGAGGATCTTTCGTATGAATTGAATTTGTCTTGTTTATTGTAGGCAATCA
GTAGGTATTGTTAAATGAATAGATGAGGGTATTTGAGTGGTAGGAATGAGATTACATTTA
GTTGAATGTGTTTGTCACCCCTATGAGATTGTGGTTTAATTTATAGCATCTTTCAAGTTT
ATATAGGAATTACTAATTAAGTATGTGAATTGTAAGTACCTTATTCCCAAACTTTATAAA
TGATGCCCATGTTGGGTGGTGTGAATACTGAGATAAAAGATGTTTAAAATTCTTGTCTTT
GAGTGATTATGTTAATAATGTATGAACACAAGATTATTAGGATTTACTTTTTTAAAAAAA
TTTTTATCGAAGTATATCATTCATACATGAACATAGATAAACAGTAAGTGTACAGTAAAA
GTTGTGAACTTACAAAACAAACATGCATAACTTCATACAGCCGTCCCCTACATCAGCTCC
CCCACCAATACTTGGCATTGCTGTGAGACATTTGTTAAACATTGTGAAAGAACATTGTCA
GATTCTTACTGACTATAGTCTGTATCTTACATTTGGTGTATTTTTCCTCCAACCCACCCT
ATTATTATTTTTAAAAATATATTTTTATTGTTGAAGTTGTGAACTTGCAAAATAGTCATG
CACATATGTACAATTCCCATGCAACATCAACACACCCCACTGTGGTGGAACGTTTGTTAC
AGATTATGAGATAACATTATCAGACTATTACCACCAACCATGGTCCGTAGCACACGTTTG
GCACATTTCTTCCCTACTCCCTTATTATCCACACAGTACAGCTTTGGCATTGATGTAAGA
ATACTATATTATTGCTGTTACCATAGTCCATAAGGTCATATCAGTGGTATTTTTCCCATA
CTTCTCTACAGTCCCAACACCCTGCAATAGTGACTTACATCTGCTCTAGCTCACAGAAGA
ACACACTTGCATCTGTACCATCTGTACCATCAACCACAATTCTTACCCACCTCTGGGTTC
ATTGTGTTATTCAGTCCCTAGATTATTCTCTAATTTTCTTTAAATTGACATTTACATCCT
CAGACCATGCTTTCCAGCCACATTCCCATTTATAAACCAGCTGCTGCTCACATAATGTGT
GCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTTTTTTTTTTTAGATTTATTTATTTATACTCTTCCCTTACCCTTCGTTGT
CTGCTTTTTGTATCCATTCACTGTGTTTTCCTGTGTCTGCTTGTATTCTCATTAGGCAGC
TCCGGGAACTGATCCTGGGACATTCTGAAGTGGGAGAGAGGCAATCATTCTCTTGTGCCA
CCTCATCTCCCTGATCTGCTGCATCTCTCATTGTCCCACTTCTGTGTCTCTTTTTGTTGC
GTCCTCTTGCTGCTCCAGCTCTCTGCATGGGCCAGCACTCCTGCGCAGGGCAGCACTCCA
TGCAGGGCAGCACTCCTTGTGGGCCAGCTCGCCACACAGGCCAGCTCGCTTTCACCAAGA
GGCCCTGGGCGTCAAACCTTGGATCTCTTATGTAGTAGATGGGAGCCCAGTTGCTTGAGC
CACATACACTTCCCTCAGCTGCCTTTTTAACTTCATTGGTTACAAACTAAGCATTATAAT
ACACACTATTTTTATTAAGTAATTGAAATTTTAATGTAGGGAATATAATTCATAAAAGTA
AAAGAAATAATCAAAAAGAGTCTGTTTGGGGAATTGGCTGTGGCTCAAGCATTTGAGCTC
CTGTTTACCATATGGAGGACCTGGGTTTGATCCCCAGGACCTCCAAGTAAAAAAAGAAAA
AAAGTGTCCCAGACCTGCATGGTGAGGTGCAGGGCCCTGCGCGGCAAAGCAGTGTACCAA
AAAGATGACGCAACCAGATAGGAAGGAAAAAAGTGTATTTGGTGCTTCAGATTGTCACTA
CTTAAAACTAGCTATTACATACCCTGAGAGGAGAATATAAGCAACTCTTGCCAACCATAG
AACCATGGGGGTGACCACTCAGTGGCTCTTGTTTTGTGCTATAAATGCAAAAATGCTGAA
GTAGGATTTTTAAGTAAAATTTCCTGAAAGTCAGCATCTCTTAATCAACTAGTTGTATAT
TGGTGACGTGATTATATACTAATGCTCTAAGAATGCTTAATAAATTTAAACTTCTAGATG
TGAAAAGGACCTTAATGATTCAGTCCTTCCATTTCACTGATGATTAATGTGATATCTGTT
GTGGTGAGTGACTTACTAGTTGGTGCCAGAGATGTGGTCTTCTGGTTACCATTCCAGTGC
ATTTTCTGCTGCCATATAAACTGCTTTACAGTGTCATCTTTATGGTCCATAGAAGATGAT
GTTAAAGCATTTAAAGAGAAATTTACAGTTTGATTTTTCCATAGATGAAGAACTGCCAGC
ATGCTAATGCTGAACGCGCCTACTGCTGCACAGATCTCATCCGTGCAGTTCCATCCTTGT
GCACAAGTTGTCATGGTCGCCGGATTAGATAATGCTATATCTCTGTTTCAGGTATGCATT
TTTAAATGAAAACTCGTAATGAAAAGTGTTTACAACCAGGATTCAGATCCATGACAATAA
CCAAAAGAAACATTTGGTGCTTTCTTAATAGGTGGATGGAAAAACAAATCCTAAAATCCA
GAGCATTTATTTGGACAAGTTTCCTATTTTTAAGGCTCGTTTTAATGCTAGTGGAGAAGA
GGTTTTAGCCACAAGCACCCACAGCAAGATCCTTTATGTCTATGATATGTTGGCTGGAAA
GTTAGTTCCTGTGCATCAAGTAAGAGGTATGGTTTCTATTAATCGCTAACCCCACCCAAG
ATAAGTTAGTTTATTGGTGTTATGCTTACTCCCCAACCTCCCCCCACTCCAGGATTCTTG
AAAAATGAGTTCTTTTAATTATAGTATTTAGAAAATGTCAGGTTGTTGAGATCATATGTT
TGAATGAAACTGGTACACTGACTTACTTATTAAGCACTTACTATGGGAGGTGGTCAATTT
GGAAATACACATTTTCCTACACCAGAGAAGCAATTATAAATACTTGACTATGAAGGAAAC
AGTTAATATAGCTGAAGGTATATGAGCTTGGGAGCTAGACAGCCTGGGTTCCACTTCCTT
GGTGAAGTTAATTCCTCTGATCTTAAGGGAATTTGGATATCCTTTAGTTCTAGTGTTTAA
TAGAATTTTGGTTTATACTTAAAGGAAATAAAGCACTGGTTTTTTTGAGTTATATAATGT
TTTTTTTTTTTTTTGGTAATGTATTTTAAAGAATATTAAAGAATATTAAAGAATAAACTT
TTTATCATGTGAAAATTTATCTGTCTTATTCTGCCTTGCCATTCTTCTATATCCCACTTC
CCCAGTTACCACAAAATATAGTGACACCTTCATGAATCCTTTGGGAACCAAAACCCTTAT
AATGAGATTGACTGGGGTAACATAATAAATCGTGAGTGGCAGGTTTGGCATGTACTACAG
CTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACAAGCGTTATTCTGAGAAGGGGTGCATATACTTCATCATACTGTCAGAG
ACTCTGGGGCATGAAAAGGTTAAGAACCCCAGATTACTGGTTTGAATTCCAGAACCAGTT
TCTATTGCATCATTTAAAAAGACAATTCTTAAGAGATGTAGCTTGTTCTGAGTAAACATG
TAACAAAAGGAATTTGACCATTTGGTAATCAGATTGGTCAGTCGGGCAGCCATTTTGATT
TTTTTTTTTTTTTTTTAAAGATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGTTGT
CTCTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCG
GCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGCTCTTTCTTTTCACGCTGGGC
GGCTTTCCTCACGGGCGCACTCCTTGCGCGTGGGGCTCTCACGCGGGGGACACCCTTGCG
TGGCACGGCACTCCTTGCGCGCATCAGCACTGCGCATGGCCAGCTCCACACGGGTCAAGG
AGGCCCGGGGTTTGAACCGCGGACCTCCCATATGGTAGACGGACGCCCTAACCACTGGGC
CAAAGTCCGTTTCCCCGGGCAGCCATTTTGATTGTAGGCATTATGTTAAAGTAATCTCCG
AGCCTTTTTGTAAACTCAGAGGATAATAAATACAAAAAGAGATGACTTCAAAAAGACTTC
CAACTGAGGAGTAAATGCTCAATAAATGGCAACTGCCATAATTGTTAGGAACACCATATA
ATGTACCAGATCACAGTCAACTACTTGCCTTTGTATGGAATTTGGCTGTATTCTCATTAA
ATCTGTCATTCCTGTTACCAGTTACTCAGTAGTTGACCCTTATTTTGTTGGTGGTTTGGT
ATTTCTTTCTTGAGGACACCCCTATCTCCTGAATTACCCCCAAATAGTAGTCTTACTGAG
GCCAAAAGAATAGAGTCTCCAAGGTGCCTATATGTGGAGAGAGCAATGGAATGTGTAGTG
GGTCCTCTGGTACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAC
CAGATCACAGTCAACTACTTGCCTTTGTATGGAATTTGGCTGTATTCTCATTAAATCTGT
CATTCCTGTTACCAGTTACTCAGTAGTTGACCCTTATTTTGTTGGTGGTTTGGTATTTCT
TTCTTGAGGACACCCCTATCTCCTGAATTACCCCCAAATAGTAGTCTTACTGAGGCCAAA
AGAATAGAGTCTCCAAGGTGCCTATATGTGGAGAGAGCAATGGAATGTGTAGTGGGTCCT
CTGGTACTTTCTTGCTGCTGCATTAGATTTGGATTTATACTGGTCCTGCACAGTATAGTG
GAACTTGGTTCACTGTTGCTCTGAAGATAGCTATCTTTATCTCTTCCAGGGGTTCTGTAT
TGGTGCCCAGCTCTAACACGTTCTACCTCACTCTCACCTTCTCACTGCCTAGTACTGTGC
CATTAGGGTTAGGTGTAAAGGTTTCCAGCTTTAGTCTCACTGTACTAGAACTAGCCTCTT
TCTCCTCGTTATACTATCATTGCTTCTTTTTTTTTTTTTTTTAAATGTTTGGAATCGTGT
CCATAATACTATTGTCAGTACATAAGGTTTGTTCAGATTTTGGAATTAAAATTACTTTTT
TTTTTTTTTTGAGGTACCAGGACTGGAGTTTGAACCTGGGACCTCGTGTGTGGGAGGCCA
GTGCTCAACCACCGAGCCACATGGACTCCCCTGAGTTGGCTCCCTTATCTGCCCATTGGT
TGCTCATTGTTTATCTTTAAGAGGCACTAGGAACTGAACCCGGGACTCCTATATGGAAAG
CAGGCACTCAACTGCTTGAGCCACATTTGTTCCCTAAAATTACTTTTTTTTAATCTCCCC
CCCTGTGGTTTTTTGTGTGCTGTCTGCTCTCTGTGTCCATTCGATGTGGGTTCTTCTGTG
TCTGTATTTTATTATTTTTTATTTCCCCTCCCTCCTTGCTGCTTGCTTGCTGTCTGCTCT
CTGTGTCCATTTGCTGTGCGCTCTTCTGTGTTTTTGCCTGTCTCCTTTTTTGTTGAGTCA
CCTTGCTGAGTCGGCTCTCCACGTCACCTGTGGGCGAGCCTGCCTTCACAAGAAAGCCCT
GGGGGCATGAACCCAGGGCCTCCCATATGGTAGACGGGAGCCCAACTGATTGAGCCACAG
CAGCTTCTCCCTAAAATTACTTTTGATAGGAATAGATTGATAGTGAAGGAGATTAACCAT
CAGCATAAATGACCTTGATCATTAGAAATATCTGAATTGATTATGGGAACAGGAATCCAA
GGGAAGTAGAATATAATCTTTGGGAGGCAGGATTAGAGTACGATGGGCCTGGTTAGTGGT
AGTGTGAACCATCTAAATGAAGACTGTTGACAAGGTAGAGATGATCTGGATCTGGAGCCT
TAACCAGCAGTCTTCAAGGGGAGCAGGGTATACTGGATTTTGTAGGAGAACAAGGATCCT
TCACCAGATTTTTCTAAACCCTTTTCTCTAATTATATTTTCTTTTCTTTTTTTTTTTTTT
TAAGAATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGTTGTCTGTTCTTGGTGTCT
GTTTGCTGTGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCGGCACGGGAAGTGTGG
GCGGCGCCATTCCTGGGCAGGCTGCTCTTTCTTTTCACGCTGGGCGGCTCTCCTTACGGG
GAGCACTCCTTGCCCATGGGGCTCCCCCACGCGGGGCACACCCTTGCGTGGCAGGGCACT
CATTGTCCGCATTGGCACAGGGGGTGGTGGAGTCTCCAGTGGTCAAGGAGGCCGATGTGT
TTGAACACAAACCTCACACAATGAAAACTGAGGCTCTTAACCAGGGGTGCCAGCCCGCTT
GCCTAGTGTAATTCTAAATGAACGAGACCAATTTCCCTAAAAACTTTACAGGCTATGAGT
CTAGCTGTTTCTAGGATTACGCTTTAGCCCCTCAAATATAGCAATCAGCAGCTGACTTGG
AGGCCACGACTGTGTCATCTTTGCCTGTGTTTTGCGGAGTGGAGCTGCCCCAAACTCCAG
GCACAGAATAACTCCCAAAGATGGCCTGTGGCATGATGACCAACCTCTATGGGCGTGCAA
GTGCTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
TTCAGAAGCATGAGAATCTGTGTGGTTTTTTTCATCTTTTATTTTTATTTATTTATTTAT
TTCTCTCCCCTTCCCCCCACCCCGGTTGTCTCTTCTCTATGTCTATTTGCTACGTCGTCT
TTGTCCACTTCTGTTGTTGTCAGCGGCACGTGAATCTGTTTCTTTTTGTTGCGTCACCTT
GTGTCAGTTCTCCGTGTGTGCGGCACCATTCCTGCTTTCTTTCGCGCTGGGCGGCTCTCC
TTACGGGGCGCACTCCTCGTGCATGGGGCTCCCCTATGCAGGGGACACCCCTGTGTGGCA
CGGCACTCCCTGTGTGCGTCAGCACTGCGCATGGGCCAGCTCCACATGGGTCAAGGAGGC
CCAGGGTTTGAACCGTGGACCTCCCATGTGGTAGATGGAAGCCCTAACCACTGGGCCAAG
TCCGCCGTCCTCTGTGTTTCTTTTTGCTGCGTCAGCTCTCCGTGTGTATGGTGCCATTCT
TGGGCAGGCTGCACTTTCCTTTCACGCTGGGTGGCTCTCCTTACAGGGCACACTCCTTGC
GCATGGGGCTCCCCTATGCGGGGGGTACCCCTGCGTGGCGCAGCACTCCTTGCGCGCATC
AGCACTGTGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCTGGGGTTTGAACCACAGAC
CTTCCATGTGGTAGATGGATGCCCTAACCACTGGGCCAAGTCTGCTTCCCCTAATCAACT
CTTGAATACACTAAAACATGGTTTTGTTTTGTTTTTGACCTACTAAGTTAAGGACCAGAC
TCTTATTCATCATGGGATGCTTGATAGGTGGCCAGCAACTATTTCATATGGTGATGTGTT
TTTTACTTTCTAACTCCAGTATATTTTTCTTCTGGTAATAAACTTTGGACAAAGAAGTAT
GATTTGCCCTTTTGATTAATTAGAGCAAGGTTCTTAACAAGGGTCCATGAACTTGAATTG
ATATTCAGAAAAACCATTATTCTTGGGATGTGTTGATGAGGGTATATATTTTATTAAATA
ATACATGGTATAGTGTGGACTTAGTAAGGGGTTCATGGTTTTCACCTGACTGGCAAAGGG
GTCTATGGGAAAAAAAGTTTAAGAACTCCTGAATTAGAAGTACTACTGTTGACATTTGGA
AAATAAGTTATATTTACTATGTGGAGAGCTCAGTCTCTGGTCTGTAATTAAAATGGTTTA
ATATTGACCAGGAGAAAAAAGAGAAGTTTTTTAATCACTTTGTCGTAATCTTATAATTGA
GTCATATTTAGCAGTGCACGTGGTCATAGTTTTTCAAAGTCTGAGTCTGTTTTAATTAGT
TAAAGGCACTCAGATAAATTTAAAAGGTGAACAACTCAATTGCCAGTAAAAGAAAGCTTA
ATTGAAAACCATATTAATCCTTATATAATTGATTTATGTCTCTTTTCTAGGTTTGAAAGA
GAAGATAGTGAAGAGCTTCGAAGTCTCACCAGATGGATCCTTCCTGCTTATAAATGGCAT
TGCTGGTTATTTTCATTTGCTGTTGATGAAGGTGAACCATTATTGTTGCTTGTTTGTCTA
GGATAAGAAGTAAACCTAGGGATAGTCTTGAATCTTAATTGATTATGTCCTTCAATCTGC
CTCTCAAGTCCAGGGAGTGCAGGTGGGACTTTGGGAGAAGTTGTGCACAGTGGGGGGGAA
AATTCTAGGTATAGGGAAAAACAAAGCCAAGTAGCTGTTGGAAAATAAAGAGCTAGATTG
TTTTTATTCTACATAATGTGATTCTTTCACACATCTCCTAACAATTTGGTATGTAATACT
TACCATTCTTTTAGACTAAAGAACTGATTTGTAGCATGAAAATTAATGGAAGGGTTGCAG
CATCAACATTTTCTTCAGATAGTAAGAAGATATATGCCTCCTCGGGTAAGTTAATAACAC
AAGAGAAGCTTTGGGTGTGTTTAACATTTCAAATTTAACCAAAACCTTTTTGATTTTAGA
CTTTCTTTTGGTAAGAAAATCAGTATAGTTTTTAGAATTCATTTTTTGTTGTTGTTGCCA
TTTGCCTTCTCATTTATTAGCTACTAATAATGAGGGGATAACAATGCTAACATGCAGTAT
TGATGTGTTTGGATGGAAAAATGAGTAAGACTTTTTTTTCAGTGTCTGAAGGGTTTAAAA
TCTTTGTAAAATTGTGGTAACATACATAATACAACATTTCCCACTTTAACTACTTACTGT
GTGCAATTCATTGATATTAATTTGCCCCAGGCCAAGGGAAATAAAGGCGGGGTATAGGCC
AGCCTATTAAGATGTTTTTAAAATCAAGCAGAAGAGTTGAGATTTGTTGTGGTTGGAATA
TTAAGAACCAGGCTTTGATCTGATATGAAGTGCAGTGTCCGAAAGCCAGATTTTGAAAAG
ATTAATCTAGCCTCCGTGTTGAGAATGAATTAGAGGGAGAGAACCTAGAAGATAGGGAAG
TCAGTGTGATGGAAGTTAAAGCCTTGATAGTAGATGTGATGAGATTATGAGTGACTTCCT
TTGCTTTCTCATTATCTGTATTCTCTTTAGATTATTTGTTTGCAGTGATCAGAGAAAAAG
AGGTTTATATATGGTAGATGTTAAACAAAACATTTGTTCAGGGAAGCGATGTGACTCAAC
TGATAGAGCGTCCGCCTACCAGATGGAAGGTCCAGGGTTTGATGCCCAGGGCCCCCTGGC
CTGTGTGGTGAGCTGGCCCACATGCAGCACGCTGTGTGCAAGGAGTGCCATGCCGTGCAG
GGGTGCTCCCCGCATAAGGGAGCCCCACGTGCAAGGAGTGTGCCCTGCAAGGAGAGCCGC
CCCGTATGGAAAAAAAAAAGCTCAGCCCACCCAGAAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTACTCTTCATTAAGCTTGGCATATGCCTAACTGTAGGAAGTACTCAAAAATTCTTAGC
AACTACTACTATTGTTCATGATAATTACTCCCAAAACTTTCAGATCACTTTCAAAATTTG
GATCATTAGTTCCTCAAAAACTTTGTAGTACACATGAATGATTTTAAAGCTTTTTGACTA
TACGGGAGGGAAAGTTGGCATTGATATAGGTATATGAGTTGGATGAAGGGATAAAATATT
TACAAATTTGTTCACTATTGTTGAGATCTGGTTTACTCTAAGAAAGGTATTAAAAGAAAG
GAAGGAGTAACCAAAAGTTGAGCTTGGGTATGTTGGAGATTGACCGTTGTGCTGTTGATT
GGTGTTCTACCCTTTTGAAATCATATTGTTCATATTTTATTATTACTTATAAAGAATATT
TTAAGGTAGAAAGAGTTGAAGAAAGAATTGGCCCTTTATCTTTTCAACCTAATCAGTTTT
TCTTTTTGTTTCCTCTTGGGTACCCCATTGCCTCTTTTACCATAAATATCCATCAGTTCC
TAACAACTTAATGCAGTTACTTTCTAGATGATCTTCCTGCCCTTCATCTCTTCCCATTTT
CGTCTTTTGCTAGACCAATCTTTAAATATCTTCTTTTATCATAACATTACCCTACAGACA
AACATGAGGCAGAGGTTTTTAAATTTGACCCTGTTCAAGTTTTTAAATTTTACTACTGCC
TTACTTGGATCCTTACTCTAGCCTAGGAAATTTTACTTGTCAAGGAGATAGTTGAAATGA
TTAGGTTCATTGAATTCTCATTGGGAGAATAAGAGTAGAGCATAAAGGGTGAACTTGGGA
GCAAAATCCATAAAAGAGGAAGAGATGAAGTAGGTAAATGAAGAGCCATCTTTGAGATGG
GTGTAGGACCTTACAAAAATCTATGTTGTGGAGAGAGTGATCCTCAGTATTGAGTACTGT
AGGAGAGAGAAAAGAATAAGGAGTCATTTTATAATGAAAATATTTGTGGCCTATTCAGAT
TTAATAATCTGTTTTATCTTGCAGACATTATTTTCCCTTATCTAGACTATTTTAGCTCAT
TGCTCACATTCACTAAGTTCTTAATATTCAAATGATTGACTATAATAGATAAATTGTGTG
TATCTTCTTAATTATAGATTCTTTGTGTGATCTGAATCTTCATCTCCTCTGTCACTTTTG
ACATTGTCGTTATGTATTCTTAAACACCTAGCCTTACGTATTAGGTACTCTAGTACCTGT
TGATAGATTCTGGAAGAGCTTTGTTGGTGGGTGTTTTTTTTACCTCCCTGAAATTTTGCT
CCAAGAATCGATTTGAATGAAATGTGGAAGTTTTTTCTAAAAGGTCAACTTAAACTAAAA
ATTTATGATTTTTACTTTATATCTAAAGGTGTTATTTATTAATGACTAATTGAGTATGCA
GTTTATATATGCAAATGTATACAAGAAATACTTTTAGGTCAGTTTTATGGAATTAAGTTT
ATAGTAGCTCTTTATTTTTAGTACCATGTATTATTAAAGAAGGACTAAGAATGCTTAGTT
CATTTGCTTTTCACTTTTATTTCTTCTTTTTGTTTGTTTATTTTTATTTTTTAATTATTT
ATTTTTATTTTTCTTTGCTTTTCACTTTTAAAGCAAAATTAACCAAACCCTCTTTTGGCT
CTTTAATTTAGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCATACAATTCAAACAATGGTGCAGCTAC
CAGCTTGTAATTTTTTGGGACTGCATACAAGGCTTTTCCTTAAAGTTGAACCCAGAAACA
GCTTCTTATGTTCCTTAGGCTTTGTAATATGTGCAGGAATATATGGATACTGAGGAGGTT
CAAAATTTGGTCTCCACCAGTTATCAGTGCAGTCATCAATGACCCAGTCTTGCAGGACTC
CATCCTTATGACCCAGTATCTTGTCAGTAAGCGTTTTGGTCCTTCAACTTCATCTTCTCC
TGGGTTAAGTTTTCACCACCAGGTAGTTTGAAGAAAGTTGTTTCCAGTTACAGCAGTAAC
TCATGGAGTACCTGGTGTTTGTGTATAATCAGAACTCCTTCTGCTGTTGTCCTCATTCCA
ATGTTATCAGACTCCTCCCTCATGCACTGAAATCTGGCTGCAACAGAGCTGTCCTTCTCA
TAGAGGGGCTCTTTTGTACCAAATGTATAATTGGTAAGAGGGTACAGGTTGATGGTGCAC
TCCAAGGTGAGGGGCTTGGTCTGCTGGATGTACCTGTTGCCAAACTGGTTGACTCCCTGG
GGCCAGCTGGTCTGCGAATGATTAGGCGGCACCCCAGACATGCCGGCAAGCTTGAGCACT
GGCGGTGAGCGGAAAGGAGGAGGCAGGGGATACTATCCCCGTGCAGACAGTGATTATCTG
CGTCCTGCTCAGCAGCCTTCACTCGCCATTAACATGAGAGCTCTCCAGTGTATTTTAAAT
TTCATTTATTGCACCTTTAATTCCCATACAATCTGCTGTTTTTCTATGTATGCTTTCAAA
TTCTTCTTTGTGCTCACCCAATATTTTCTTAATCTCTTTAGCTGTTTCATTGAATTTATT
AAGGGGATTTGTTTGACCATCTATGATTAGTTTTCTTAACTCCTTTATGTCATCTAGAGG
CTTCTCTTGTTCTTTTAACAGGGCCATATCTTCCTGTTTCTTGGTATGGATTGTAATTTT
TTGTTGGTGACTTAGCATCTGATTTACTTGATATATTTATTCTGGGTGAAGTTTCTCTTT
TTCAGGACTTTCTTGCCCTTTCTTCCTTGCTCGTTGTGTAGTAGGAACTGAGGATGTAGT
TGGTACTGTACGCTGTGAAGGTTGAAGCTGCGTGCGTTGCCCCACGGACTGATGAAGCTT
CTCCAACCTTTCTCCTTTGCCAGGGCTAGGGTCTGAATCACAACCGTGTTTAATAATCCA
AGTCAGACAGACCAAGACTGTCTGAGGTTGCCTGGAGAGACTGATGAAGCTTCATGCCCT
TTCCCCTCCTGCCTGGGGTGGGAATGGAGCTGCAGAGGTGGGCACCAGTCTCTGCTGTGT
GGGTCCAAGATGACTGCAGTTGCAGTTGACATAGCACTGCCACTGGGGGTGGGGGTGGAT
CATCTGGACTACCCAACAATCTTAATTCATGTGGTCTGACTGTTCCTGCAGTTGCCCTAA
GGGCTAAGGGAATACTATCCCTTACTGCCCTATAGAGGGTGGAAACGGAACCACCAACTC
CTAACAGTTCAGTGTAGGGCGAAAGTGGATACTGTTGCCCAGAGGCTGAGGTAACACCAG
CCCCGTCCTGTGCTGTTGGGGTCATGGGAGTGGATCCACAGGCACCCAATAGTTCAGTCC
CTATAGGCTGAAAGTACCTGCCATTGTCTGGAGAGGCTGGGGAAACACCAGCTCCCTCCT
GTCCTATTGGAGGGTGGGGGTGGATCCACAGGTACCCACCTGTCTAGGCTATGCAGGACA
AAAGTGCTGCCGTTGCCTGGAACAGGATGGAGCTATAGGTATCTAACTGTTCAGTCTGTG
TGGGCTGCAAGCACCTGCAGTTACACAGAGAAGCTGAGGAAACACAGTTCCCTTCTTATT
CTGTTGGGGGGTTGTGATGGAGCTACAGGTGCCCAAGTGTCCAGTTTGTGTGGGCTGACA
GCGCCTGCAGTTGTCCAGAGAGACTGAAAAAAACCCCAGCCCCCCGCCCCCATCCTGTGA
GAGCTGGAGGGGTGGAGGTGGAATTGAAAGCTCTCAACAACCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTTGGGAAAACTATGCTGTCCATTCTC
AGTTACCCCACTTTAAGTGGTGGTCCTTATTTTCAGAGCTTTCTTTGAACATGAGGTTTG
ATATATTGAAAGATATTTAAGGCAAATACTTTGTTCTCTACAACATTCTTTTCTCATTCA
TCGTTTTTCAGACTTAATGGAGTGGAGGCAGTTCTTACATAATGAAAATAAACTGATCTT
GAAAATCTGTAAAAATATTGCTATTTAAATAACTAGATATCATTTGTGAATGTACTTTTG
GGTTGGGGGTCCCCAAGACCACCCTCAGGTTTGATGATTCATAAGGTAAGTTTATAGGAC
TCAGCATATAGTCTTACTCAGAGCTAAGATTTATTACAATGAAAAGATGCAAGTTTTCTT
GTCTGTGAATGATTCAGCAAAGGGAAATCAGCAAAGCAAAAAGGCACATGGGTTGAAGTC
TGGAGGAAGCCAGGCGTACTCCTCTCCCAGTGGAGTCACTAGGACTTGTTTAATTCCTCT
AGCAATGAGTTATGGCAGCACATGTGAAGTGTTATCTACTAGAGAAGCTCATTAAAAACT
TAGTGCCAAGAGCTTTCTATTGGAGATAGTCACATAGGTATCCTCTGCTTAACATGTACC
AAAGTTCCATACCCCACAAGGAAAGCAGGTGTTCATCTTCAACCACATTGTATAGATATT
TTAGGGACAGTGAGCCAACCTTATCATTTAAGGAAACTTTTGTATCAAAAAGGCCTCCCT
TGCTGCAAGCCTTTTGCAAAATAGCAGTTTCAGACCTGTATGGTAACTCTTCTGCACAAC
CTTAGATCTGAGCTTAAATGTCATCTCATTTCTGAAGTTTCCTAGCCCTTCATGCAAAAT
TTTCTCTAGGTGCTAGTTACATAGATGGCATAGAACTTTGAATATCAGTATTGCATTGTG
CTAGTCTTACATGAATACTGTCAGATTATATATGCTTTATACAGTCTATGTTATTATCTT
GCTCACTTAGCAAAGTCTTGCATATAATATATACCTCATCAGCTTTGTATAATAGTTTAT
AATTCACAAAGATTCCACAGAGAATTCAACAAAAAAATTTGGAGTCATAAAACAGTCATC
AGAGGATTAACCCAAAGTCAGCAGCTTGTTAATAGCAGAATTATGATTTGAGATTCCATA
CTTTTTCTAATACTTCAGTGGTTTTCTAACTGAATTCCTCTGAGCCCTAGAACCTGGTTT
CTGTAGGAGCTTCATATGGCAAGTAGGGCAAGGAGGAGGCTAAGCACCTACCTGTTACGA
TACAGAGCAGCTCCACTGTTGTCTGTGGTATATATTGGGATTCTGCATAAGCTTTGAGAA
GAGAAAGGGTTCTACTGGAAAAAGAACTTGAAAAATTTGACATTTGAGTTTTATTGCCTT
TTGTTAAGTGAATCATTTGATAAATGAGACATTTCTAATTCAAGTCAGCTTTAAGATTCC
TGCTCTAATGGGGGTGGTATACTAGTACTTATTAACCTTTTATCATTTTAATGGTAGTAA
ATTGTTTTAGAAAACCATGGGATCTATATCCTTTTGACGTAAATATTCTGCAAGATGTAT
AGTACTCAGTTCTGCCTAGTTTGCTTCAGTGATCATGACAGCATTTATTTTTTTTATTGT
GGCAAAATCACACAAGGAATTCATTAGTAACAGCCAAATCACATTTTTAAAATGGTAATC
AACCGTAATATGTAATGGAGGAAAGGCAGGCATAGCAGCTTCAGAATGCCTCAGTGATAA
GAGGATTAGTATCATTAAATGCAATCACTTACAATGATCTAAACAGTTTTTTTTTTTCAT
CCCAGCACAAAGCAGTGGGTATAAATTTTAAGTCATTGCACTAGTAGGGGACCCAGAAGT
TGAATTATTATCATGTCTACTCTCATGGATGTAATAGAAAGTTGTGGAACTTCTTACCCA
TTAATCAAGGATGAATAAGCTTTTACTTGTTGAGGTTTATTTATTTATTTTTAACTTGTT
GAGTTTTGATGCCTGGGTCCTTAAATGTTGTAACAGAAATGGTGCTGGAGATACAGCAAA
CTTTCTAAGTGAAAGAAGTTGGGTCTTTGTGGGAGTTTTTCTCAATAGTTCAATTACAGT
TTTAAATACAGGACCTATAAAGACAAGTAGAAGTGTGGCAGAGGTCTACCCAGATGGGAT
TGTTGGTCTGAGAGAAAATATATTAATGCAGTGAGAGATTATAGTGGGGAAATCTGGAAG
TATTAAGTTGGTGTGTCTCCTTTCTCAGAAGGAACAGACTGGCATGTTGTGTAGATAGAT
GAGTAGCCACTGTATTTGATTTTGTAGGTTATTTGTTGCACAGGCCACCACATCTAAGGG
AACACCATTCATATGGATTTTATGAATGTGTGCATTTATCACACTATATCTTTCTGTTCT
GTTAATTCAGCTACAGGAATACATAGCTTCCTTCTGGTTAAAAAATAGCCTTTAAAATTT
TGCTCTGTGTGTTTTACCCCAGTTTTTGCCCTGCAGTGGCTCTCCCTATTTGTTATAAGC
AATTGACTTGATTAAAAAGTTACATGAATCCAAATTAGGAGGCCAGTTTTTCCTATTTTG
GTTGAAAATTAAAGGGGTAGTTTCATATAATTATCTTTAAGAGTTCACTCACGTAGAGAA
GGTTGGTTCCATTATATTTTGATTCGAAAGAGTCAGAAAGCAGCTCCCTAAACTTCAGAG
TCATGCTGGGAGAGTTAATGAGTGAATATCTGAGGCATAGTTTAAAGAGTATCATGGGGT
ATATAGGGTGAAACAAAAGGCATAGAGCAGGTCTGTTATTGTCACGTGCAGTAAATGGTT
ATTTCTTAATGTTCTGTACCAATGATGCTTTGGGTTTCCTGTTCATGGTTAGTACACACT
TGGTAAACTTCTGATAAAATATAATTAAGCCATGCCATTTATTAAAAATTAATGTAATGT
GCATTCCCACATTAAGTGTAAATATATTTTGCAATTCCATATTGTGTTTTCTTTCTGGAA
AACACAAGAGTCTACTTTATGAAGTGTGTTCTCTTTTTTTTTAAATAAGTAATCTCTCAA
GGAACCTGTAGAGAGAGTGATATTTAAGAATTTGAAAAGTTAAGATCAAATTGGGATACT
GCCACCTTCTTAGCTCTAATGAGTCAGGACCACTTCTCATTAACCCTAATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTATGAAAATCACCTTTAATTGGTATT
ATTAAATCTCTTCTTAAAAGAGTTGAAGGATGACAGACTTATTAAGATGAATGGCTGAAT
GATAACTGTGTTTGAATATGAATGTACCCATATTTCTTTAGAAGAGCTAGAGGACATTTG
GGAAGTGAGAGTTGTTCTTACCCCTAGACTGTTTTAGGTAATTGTTTCCACCCCCTGGGT
TTTATTCATTCACAAATTGGTTGACTTGTCTTGCCTGTCTCCCAGTTGGACCCCTTTTCC
CTAGGAAGTGGCGCTCTCTTGGAGAAAGAGATGGTATCCTTTCTCAGGCTTAGGCCTGAC
CTTCAGTTGTGCTTCAACTCTATTTAAATTGAATGGAGTATTTCACTTGATGAATCAGGT
TTTCATGATTTAGCTCTCCTCAGGAGAGATTGCAAAAGGGAAAGAATATGTCACATAGTT
GAAAAATGAAAGTGTAAAAGGAAAGTATATGATATTGGAAAACTTGTTATGACTGCCTAG
GCTTCAGTTATATGAAGTCAGATTCATTCTTCATAATGGTTAAGGTATCTGTAACTTTTG
GTTGAATTTCATTATTTTTAAAATTTCGTCAGTAAGTTGAAGCATTAATGAATATAACCA
TTGACTTTTCACTTTGGTTTATTCATTCAGCAAACATTGGAATCTTAACAGTGTTTCCCA
GTTCTTAAAATTTAAAACTTTTTCTTATTTCCTGCAGGTTCACCTTCCTTCCTGTACGGT
ATTTTCAAACTTTCCAGTAGTTAAAAAGAAGAATATTTCTCTTGTTCATACCATGGATTT
TTCTCCCAGAAGTGGGTATTTTGCCTTGGGGAACGAGAAGGGCAAGGCCCTGATGTATAG
GTAGGTATAATTTACATTTAAAGGTCAGAGATGCCTGTAGACTGCTTTGGAAACATGAAG
AGAGATTTGTTATATTCCCGGCCTTTAATAAATTATAGGCTGTTCAGCTTGACTTTCATC
TTCATTATCCAGCAAAATATGCTTTTTTGTTGTTTTTTTAATCATAAAATGTTGTTAGCA
GGAAGGTTCACCTGGGAAATTTTAATTTAATAAGCTGTATTGAGAATGTCAGATTGATGA
AGAGTAGCCACTTTAATGATACTGTCTCTTTCTTGGTTCCTTATGTTTAGATTAACCTTT
TTTGATTTGGCAATTCACTATTTACTCCACTAGATTCAAGTGATTTTTTTAAAAAGGTGT
TTCTTTCCCTGCAGCTGTAAGCTATAAATAAAGGATGTTAGCCACAAAGATATTCAAAAG
TTATATGCTCAGGGGAGGACAGACCAGTATGTCAAGTCCTCAGTTTTGTTGCAAGTAACT
ATGAATCTGGTCCTGCAAGGAGTGAAGCCTGGTGGTTGCTGTGGGTCCATGTGGGGAAGG
GGAAGAAGGAATAGAATAGAAGAAACAGGTGACCTTTTGAGGGCGATGGAAGCGTTCTAC
ATGATCTTGCAGTGATGGATATAGGCCATGTTAGTGTCATCAAATTTATAAAAGTATGTG
AAACAAAATATAAACCATAATGTAAACCATTGGCCATGGTTGGTAGCTGTGTTACANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1339, 2908..3020, 3646..3744, 5101..5168, 36419..36507, 37844..37876, 37878..37970, 38071..38245, 45590..45690, 45974..46064, 49315..49438, 49539..49713, 58417..58557
1001..1339, 2908..3020, 3646..3744, 5101..5168, 36419..36507, 37844..37876, 37878..37970, 38071..38245, 45590..45690, 45974..46064, 49315..49438, 49539..49713, 58417..58557
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved