Dasypus_novemcinctus Locus PHTF1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus PHTF1
Dasypus_novemcinctus
PHTF1
GeneScaffold_816
SNORA8
5589..5730
47041
TTCTTTCTGGCAAACAGCCGGAGACAGAGACAGTCAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCATATGATCAGCAGATAT
GGGAAAAGTCAATCGAACAGACGCAGATTAAGGTAAATGATATCATTTATCCTAGCTTTA
TTTCATTAATTTGAAGAGTGGATTGTACTTCTTGTTATTTTTTATGAGGTACTGGGGATC
AAACCCTGGGACTTGGTATATGGAAAGCAGGCACTCAACCACTTGGACTACATAACTCTC
TCAATGTACTTACTTTTTATCTGAATTCGTATCCAGCAAGAATGGCATTCTTTATTCTTT
GAAAAGTATAAGAAAACAAAATATAAGCATAATGATAAACTGACCTTTGGCCTTAGTATC
AAGGAAACAAAGGAATGGTTGGGGCTATAAGGAATTGGAGAGTAAATGTCCCATACAGCT
TGGGCTCTGGTTACTTAACACTGGCCCATTTTTGCCATGTGATAATGCAGACCCAATAAT
TGCCAGAGTTTCAGATTTTTTCAAGAGAAGCTAAAATATGCTTTTTATGTAAAATTTTGA
AAAATTTAGAAGGGTTTTTTTTTTTTTTTTTTTTTTTTAACTGTGCAAGCCAAATGAAAT
CCATTCGTGACCTGAATCCTGTCTCTGGGCTCCTACTTTTTAAGTCACTGGTTTAGCATA
TGGTCTTAAGTTGTTTTGTTTTTTTTTAGGTTCCTAAAGTTGTTTTTACACTATTCATAT
AACTGAGTAGATTCTTTGGGAATTTTTCATGCTAACTAAGCAACCAAAAACTGATGTATA
ATTCAGAATGCCAATGTATTATAACTTTATAATAGGAGAGAGAAAGGGTTAAATAAACTT
GTGTATTCGTAGGTCAGGGTTGTGGGGTCAAGATGTATAGGGGAACAAATTAGTCATGGA
AAGGTTACTTGGTAACCAGATGTAAGTGGATAGTCTCGAAAGATGTAGAAAAGACTAAAG
AACCATCTCTGTTCCTTAAAAGAATGTATCTCTACAGACTTTGATACTTAGATCTGCCAA
AGCAGTTTCTCACTTTTTTGAAAAGTTCTGAATAAATGCTGGCAAATTCTTGCTCTTTGG
ACCTTTTTTTTTTAAGATTTGCTGCAGACCTTCTGTTAACTTTTTTTTTTTTCTTTAAGA
TGGTGGCAGTATAATTTAATAGTTTGTTTTATTCATTTTCCTGATTTCTAAGTCACTTTG
AACTTGGACATTTAAATCTCTTTGGAGAAATGCAAATGACCACCATTCATATGGTGCATT
CCTTGCAGCCAATCAACTGGAATGGTATTTGAACTACAGGGTACCTGGCTAACCTTTTCA
CAAATTTTGAACAGACCTTCATTATTTCTGTTAACGGAGATGATGTTAGGGTGACTAAAT
CCCCCAGTTTTATTTCGAAGCACTCTAAATCTGGTCCTTTTATTCTCTTGTGCGCTTCAA
AATGTATTGGTTTTGGGTACGGTATAATGGAAAGAGGACTGGGAGTTAGAGCTAGTCATG
GTTCCATTGCTAGCCACCTTACTGTAGTTTGAGTTTTGGTTTCCTTATCTTTAAAAGGAT
TTTACTCTTGCTATCGAATTTCCTTTCTTACTTCCTTCCCATAGTCAATTTAAATATTTT
CTCAACTCTTCTTTCCATGCCATTTTATATGTACCTTCCTTTTAATACACCATATCAGTT
ACTTGTTAATTTATGTGGCTTCATAGGACTCAAGGGCAGGAATTATGTTTGTGTCATACT
CTTAGAGTATTTATTCATGCTAGCTCAATGTCTGTTGCTACATTTAATTGAGCCCCAGTC
CATTATATGTAGTTTTATTCATTTTCTCTCATATGACAATTTACCTAATAACTTAAAATA
TGCTTTTTAGTTTAGCAGTAGTGGGGAGAATTAAAACTGAAGACAATTATGAAAACTTAC
TGAGCATCTATAATGTGCTATACATGTACTAGGTGCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGTACCAATTGGGCCCCGAATCTCAACAGAGTTGCAACACCTG
TTCTCCAGTTCTTTGGACTCACCCAGGACAATTACCGAGGAGATGATGATGGACAATGAT
CATCCCAAGAACAGAGAGTGTCTGCAACTGCAAGCAAGATAGTCTTATCCATCTGCCCCA
TGGGATCTAAGACCCCTCTCAATGAGAGGTGGAGTGGGCATCACCATCCCAGAATCCTCA
GCATTGGGGAATGAACAATGGACTAAAGGAGACTTACTGTTATTCTACTATAGACTTATT
GTGATTCTAGCAATGGAAGAACTTTTATCACTGGTGTGGAGGCAGTGCCTATTGGAGGCT
CTGAGGGGAGGGAGAAGGAAAAATAGGTGTAATATGGGGGCATTTTGGGGACTTGGGAAT
TGTCCTGAATGACATGGTAATGACAGATAAAGGCCATAATATATCTTGTCATAACTTAAA
AAAATGTGCAGGACACAGTGTAAATTACAATATCCGCTTAATGGCAGTGCTCTAAAATGT
GTTCATCAATTGTAACAAATGTACTACACTAATCCCTATATATATATCCCCTATATGTAT
ATGTATATATATATTTTTTTAATTTATTTTTTAAAATTTATTTCTCTTCCCTTCCCCCCC
CTCCCCCAGTTGTCTGCTCACTGTGTCCATTCTCTGTGTGTTCTTCTGGGTCTGCTTGTA
TTCTTTTCAGCGGCACCAGGAATCTGTGTCTCTTTTTGGTGCGTCGTCTTGCTGCATCAG
CTCTCTGTGTGTGCGGCCCCACTCCTGGGCAGGCTGCACTTTCTTTCGCGCAGGGCAGCT
CTCCTTATGGGCGCACTCCTTGTGCGTGGGGCTCCCCTACACGGGGGACACCCCTGTGTG
GCATGGCACTCCTTGCAGGCATCAGCACTGTACATGGGCCAGCTCATCACATGTGTCGGG
AGGCCCCGGGTTTGAACCTTGGACCTCCCATGTGGTAGGTGGATGCTCTATCTGTTGGGC
CAAATCCACTTGCCCCCTATATTTTTTTGGTAACATTTATGTAATCTAAGTATCTTTTTT
AAAAAAATAAAGTATATATGTATAAAAAATAAATTGTAAAAAAAATTCCATAAACTCTAA
GTCACAAATTTCCATATAGAAGGGATTCATTGAGGGCCCAGCACAATAGAGATAAAAGAC
ATATCTGGTACGTTATTATGAAATTTCTGAACACCATGGTCAAGAGAGGATTCAGAGGAA
GGAATCAGTTCACATACAAGGATCAGGACTTAGAATGTATTGGCCTTCACAGCAGTGACA
TTGGAAGCTAGAAAACAATGCAACAGTGCCTGTATTCCTTAGGGAAAATGATTTACAACT
TAGAATTCTGTATCTCGTGGTGTAACTTTCAATCAGCTATGAGGTAGAATGAAAACATTT
TCAGATGTGCAAGGATTGAAAATATCTTCCTTGACCCATTTCTCAGGAAGCGACTAAAGT
ATATGGTCTAAGAGACATGGGATAAAGGATATAGGGACTCACCCATAGAGAGAGTTGATG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCTTAATGAGTGCATACCATGAGCATGAGGTATC
CATAACACGGGTGACCACCCAGAGAAGAGCAGGGACAACTCCCTGACGCGCATTAGACAA
TGGGCGAGGGCCAAGCTTCCACTAGGGGTCAAAGGAGTCATGGGGGTTTTGAAACCGGCG
GAACATCCCATGGTGGTAGGCGGGACGCCCTTTCCAACTGGGGTCAAAGTCCCGCTTCTC
CCGGGTAAGTTGATTACTAAAACTCAATAAATTAAGAAATAACAAGTATAAGCATGTTAT
TTAAAAGGTATGGGAGTAAATACCAAGAGAAATGGCTGAAAAAGATGAAAATGATTTGTT
TTAGAGGAATGAATCTGAGAGGAAATAAGGGGTTGGGACAGGGGACTACTGTTTTTCACT
TATTGATCTTTTTGCACTGTAGATTATTTTAAAAAGTGAACACACACATTACTTGATAAA
ACTCAAAGTTGCACTGTGTGGTATCTGCATTCCACATTTTTTTTTCCCTGCTGGGGTGTT
CAAATGACAGTGCTATAGAAATTCAGTATCTGGCATCATTGGTTTTCTTGGCTTTGTGCA
TATTAAACCTGGTATTTCTGCCAATACAATAGTTCCATAGTTTTTCCAATACTGTCCAGA
TTGATTTAATCATCAATAAGAGCGAATTCTTTGGTTTTTCTAGGTTGTCCAAGAACCTAG
ATCCGCCAATTCTGATTCTAAAGAACCTAAATTGAATAATTTGAAGAAACTAGATCTAAG
AACTCTAGAGCTGACTGGACACAGTTGTGGATTCTTTTTAAAAGGGCTGTCTTGAAGATG
TCTTTTTTCAAGCTTCAGAGAAAATAAATTGACTTGGATAATTAAGCAGTGTAATGATCA
CTTGTTGTATTCTGTAAATTAAAAATGTATTAACTTATGCTACACATAATAAAAATATTC
CTTATACTGTAAAAAAAACCCTAAAAATTAAAACAACATAAATATTAATGACAAGTTCCT
TTTAGGAGCACTGGGATTATAGTATCTCCAGTAAAAGGCAAAAAACACCACAAGTTTATC
TTTCTATTTAAAAGGGCTTTTTCCTTGGTTTATTTGTTTTTGTTTTGCTTTAACTTAGGG
CTTCAAAAACAAACCGAAAAAGATGGGTCACATAAAGCCAGACTTGATTGATGTTGACTT
AATCAGAGGTGAGTTCTAAAATTTGTTTTTATGTATATGACTACATTATTTCATATTGCT
ACCAAAGATTATTTTAAAATCTATTCCTTCTGTGATGGTGTACTTTATTTCTAAAAGTAA
TCTCTTCCCTTTTCTTTCTGACAGTCATTTCACAGCCTTTAGCATTCTTTCCCCTTGCCT
GAGCAGTAATGTGTGGCTGTATGAGTTACATGGTTTTTATAAGGTTGAAAGAGGGATGAA
CTTGGTATTAATAAAAATATGTGGTATAACAGTCAGTTGAGCCTGTCTTAGTGATTAAGG
CATGACATTATTATACTTAATGAATGTTTGAGAGGATTTCTTTTAACTGAACAGGTTGCA
TGCTGATTTTTTCTCTCCTGTTTTGAATATAGTGCTACAAATGGGCATCAGTATAGTGTA
CATAAATGTTTGGTTTTTGCTTTATTGTCTGGTTTAAAGGCTCAACATTTGCCAAAGCCA
AACCTGAAATTCCATGGACATCTCTGACTCGGAAGGGGCTTGTTCGAGTTGTATTTTTTC
CCTTGTTCAGCAAATGGTGGATTCAGGTTACCTCTCAAAGAATCTTCGTTTGGCTTCTAC
TGCTTTACCTCATGCAAGGTGAGTGGAAGGGTTGAAATAATCTATGACAGTGTTTCCTTT
TCCTCCTTTTGCTGCTAGATCATGAAGACCTTACTATTCTTACATTTACCCTTTCATTTG
ATGGTTAACAGAACAAAGAAATAAAGTGGTGTGCATCACTGGGAGTTCATCTTAAATTAT
TTGCTCAGAGAGCTAAGCGTTGTTCAACATGATTGTCTACTTCTCCTCCGTTCTTGAACT
TCTTTCCACCTGTCTCACTGGCTAAGACTTCTCAGTCTTTTCTTCTGTCTAATCTTTAAA
TATTAGATTACTTCAAGGTTCATTCCTGCACTCTCTTCTCTCCCCTAGGTAATCTCATCA
AACCATATTGTGCTAAATATTGTTGATAAACTGGTGATTCCCAAATTTGTATCTTCAGGC
CCAGATCTCTCTTCCGAACTTCAGGCTTTAAATAAAACTGCCTGTTTGACATTTCTGTAT
GGGGATTTAATAGGTATCTTGTATGTAAATCATGTCAAATGGAATTCTTGTTTTTTTTTC
TTAGATGCACTTGTTTCTCTTTGGGTCTTTTCTGTTTCATTAAATGACTCCAACAACCAC
CCAGTTTTCAAGAGAAACGTTAAGCCAACCCATTCTGTCCCACCATCAGCTTTCACATCC
AGTCTGTCATCAAGTCTGCCAGTTCTACCGCCAAAATATGTCTTCACACTCTTTATCTCA
GTTTCTTCTGCCACCACCACAATCCAAACCACCAGCATCCTTTTGGCCAGACCACTGGAA
TAATCTCTACTCTGAACCTTCTTCTTACTAACCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGAATAATAACTCCTGTAATAAATTCAGAGGAGT
AGAAACTTTGGAATCTGCACCCTTTGTTGGTGGTTTTTGGGGGACTCTCTTTGGCAACAG
GTGGGAAGTCTTGAATTGGCATTTTTATATAATTTTGAATTCATGTTAGTGTTTATATAC
AGTTTGATCAGGCCTGATGAGTAAGCAATGTGGGCATATTATCAGTATGGTGTTATTGTT
ATCATTTATTTACTCAAAATGTCATCTCCACTGTCTGCCATGTTTCCTGCAATTCCACTC
TTTTACTCTGAAAGATTGATTCTGTTGGATTATCAGTGACTTTTTTAGACTTCAAGATGA
CAAAAGTGTAAATTCCCTGAAAGGGTAAATATTTTAAGCCATATAAGCCAACATCCTGAA
AGAAGGATTTGGAAAGATTGAGTATTTTCCAGTGTGAGAGCTGATGCCTTTTTAGAAATG
CATGCAGGGCAGGGGTCTAGCGTGGATGGGCTATAGGACAGAAAGAGAAATGGATCAAAG
ACAAATTTTACCTAGCTCATGACTTTGCCAGTTGTGGCAGCACTAGTATGACTTGAAGAA
TTGCTTATTTTGTCATTTATTCATTATTATGACTTAAAAATAAAATTATTTTGCGGTTAC
TTTATTTATTAGAGAAGTTGGAGGTTTATAGAAAAATTGTTCCAAAAGTACAGCTTTCCC
CTATACCACCCCCTCACACACAGTGCTCCTTATTTTTAACGGCCTGCATTAGTGTGTTGC
CTTTGTTACAACTGACGAAGCAATATTGTTATAACAGGCTGTTAACTATAGATCATAGTT
TATGCTAGGGTTCACTCTTTGTGTTGTTTTTTTATTATGGTAACACGTATACACATCTCC
AATTCCGTGGTGTTAATTACGCTAACAATGTTGTCCTACCATCACCACAATTTAGCATTA
GCTCCCCATTCCCTCCCTGCACGGTCGGCCCTGGTGACCTATTTCTAGTTTCTGACTTTA
CGAACTGGCATTGTCTAAGTATTCCTTATCAGTGGCTCATAAAGCATTTCTCCTTTTGCG
TCTGGCTTATTTCACTTGACATGATGTCCTTGTGCATTTACCTTTTTGAAGATGAAATAT
ATTCACATCCCTTTCTAAAGATACGTTTGCACTTGAGTTGAAGCGCGTGTGTGTTTTTCA
CGTGCAGCACTGTGCGGGGTACTGTGTTTCCCTGTTTGGGATGATTTTACTGTCTAGTTG
GGAAGGTGAGAGTAGCAGGTACGATGCAGTCACCCAGCAATATAAAACTGTTGTGACTGA
TTGCGTGCTGACTACAGGCCTTGTTGGGTAAAAGGAGCAACCCGCTCATTCCTGTACGAG
TATGTGTGTTACAGGGGCTAGTTCAGCGATGGGCTGCGTGTCCTGCGTTGAAGCATTCGG
GAGGAGTCGCGGAGGCGTTGAGAGTTGCTGGGCCTTGGAGGATGGGCAGCATTTACAAGG
ATGGAAAGGAGAGAGGGAGACCTTAGCCAGGGGGAGGTGGGCCTTGGCAGGGTGTCTGAG
AGCGAAGGAAGAGAAGACTGTGAACCTGCTTCCTCGCGATACCGAAAAGTGTGGGCTTCC
TCTCGAGGAACAGGCGTCCCTGGAGAACAGAGCTCGCGCGGTATTCCGTCTCTCCACGCC
ATCAGCAAGCTTGCCGCCTGGAAAATTTCTAAATCCTCCTGATGTCAGAGTCCTATGTTG
TACTCAGAAGAAAAAGGAAAGCGGTTACATTTACTATATGGGTTTTTATTAAACTGTGAA
CTTATAAGGTGATCATGCAAACCATGCAAAATTCCCATCCATCACCCCTCTACCAACACC
TGGCGTTGTCGTGGTTCATCTTTTAAAGGTTATGAAAGAACATCATCAGGCTGTTACTAC
TGACTGTGGCCCATGACTTACATTTGGTGTATTTTTTCCCATAAACCCCCTAGTATTAAC
ACCATGTATTAGCATTGTACATTCGTTACAGTTTCTGAGAGAACTCTCATCTTGGTGCTG
TTCCCCACAGTTCATCTTCCACCACGTGGTTCCCTGGGTTAAGCAGTCCCATGCCTTGTG
CCACCCATCCAACGTGGACACTCCGTGGCTTTCCGTTTCATCAGAGTGGTGCAGTGATCG
CAGAAGGAAATTTTTGAATATTTTCCTTCATCCGAAAGAAAAAAATCCCATACCACCCAA
TTATTGACCCTTAGCATTGAATAGCACCTTCTTTGACATTGATGCAAGAATATTACAATA
TTGTTGTTAGCTGTAGTCCATAAGTTACATTAATTGTATTTTCCCCATGAATCACCATAT
TCTTACCACCTTGTAATAGTGATGTACATTTGTTCCAGTTCATAGAAGAACATTCTTGAA
TTTGTGCTATTACCCACTAGCCTCATCCGCCTCCAGGTTCACTGTTAGTCCGTCCCTACA
TTATTCTGTACCTATCTTTCAAGTGAGCTTTAGTTCCTAGACTACCTCTTTCAGCCACAA
TCCCATTGATAAACGAGGTGGGGTAGGTACACTCACAATAATGTGTTACCATAAAGTCTA
TCTATTTCCACACTTCAATGGACGAGCTGAATAAAAATTCTATATACATTAAGCATCAGT
ACCTCCTTTTAGCCCTCATCCTATTTCCTAGAAACTGATACTGTAGGTTTTAACTCCGAG
TATTTATTCTATGTATATGATTGACATAAGAGAGACCATACCATATTATTCCTTATGTGT
CTGGCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGTCACATTCCAGAGAG
GCAGTGATGATAGAGTGAGGGTTTGGGAAACTGTTTTCTAGGTATTTTCCATCCGCTCTG
TGTCTAAAACTTACCATACTTTTACTTTATAGTCTCTAAATATTTTCCCAGTGGTTAAAC
TGTCATATATTTGTAATTATAAAAAGAGCTAATATTGAGCCATGACTACAACCAGGCACT
GTTACTAAGTGCTTTGTCCACATGAATCCCTTTAATTTTTTTCAACAACGATGTGGGATA
AGTGCTTTTGTTAATAATATTACAATCTGAGCCCCAGAGCACTTAAGTAGCTAGTAAGTT
AACCTAGCTTGTAGGTCGAAGAGCTGTGATTTGAGCTTGACTTGAGACTTTTTTTAAGCA
CATTTTTTTTAGAATTTGAGAAGTACGATTACAGAAATATGCTGAAAACTTAGAGTTCCA
TATACCGCCCTGTGTGATGAACACTTTGCACTAGCTCGGCACCTTTGTTACCGCTGATAG
AAGATGATTATTCTCGGTGAGCTCTTCCCTCCAGTCCGTAGTTTACAGTAGGGCTCGCCG
TTGGTCATGGCAGGTCTCTGCTGAGCCTGTGTTTAAGTTCAGCATTTTCCTTGTTCAGAT
CCAGTAATGTGTGGGTTTGGTTTGGGTTAAGTGTATCTTTACTGCTTTTCGGTTTGACAT
GTGCAGCTCACTCGAGTCTTCTGTACTGTCCCCTGTGCTGTTGTCTCTGCAGGAGGCTTT
CAGGCGTGGCAGTGGCGTTTCCGATGACCTGTCAAGCGAGGAGGACGGCGAAGCGCGGAC
GCAGGTGATTTTATTGCGCAGGAGCGTGGAAGGGGCCTCAAGCGACAATGGTTGTGAAGT
TAAGAACAGAAAATCAGCACTTTCAAGGCACCTAAACTCCCAGGTAATTTTTATTTTGGT
TTGTAAAAGCATAGGAGTTAATTCCTAACTCATCGAATACGTAGCAAGGGATTTAATATG
CTTTCCTGTGGTTTGTTGGCTTAATTTTTGGCAGGTAAAGAAAAGCACTGCAAAGTGGTG
TCATGTTGTGCGGGATTCAGATAGTCTGGCTGAGTCAGAATTTGAATCAGCAGCCTTCAG
CCAGGTAAAGTATCCTCTGGAGAGCTCAGCGTTCAGGAGCATTCTCGAGTGTCATAACGT
CATTCTTTCCTTTTTTTAATCCGTTGCCCTAAAGCAGTGGTTATATCTGCCTGTCTCCCA
TCCTTGTTTCCAGCTGTCTGTCTGCCGTAGCAGCTTTTCAATCTCTGCTCATCCTCAGAA
AGAGAATGAATCCTTTAAGATTACGCTAATCCTAAAAGTATCACAGATGTTCAGGAAGAG
ATTATCCAGTCCCTAAATGATGAGAAGGTTACCTAATATTCACTTGGAATATGGAGTTTA
TTTGTAAGCATAATTTCTAAATAAGTGAGATGGACACTGATGAGGACTTTGGGAGATGAC
CTCAGAAAGACTGGAGCGGTAAACGTCCTCGTGGAAACGAGTGACCGTATTGTAACTACT
GGCAGACTGCCTCCCACCAGTGAGCAGAGTAGATGGTGGTGGCGTGGTTTTGGTTTGGTT
TTGATGGATAAGGCAGCTGGAGTGGTGGAAGAGCTTTCATATTTACACTTGCACTGCAGA
AGAGCTGTGTTGTTTCGTCTCCCCTTCCTCTGCCTGCGTATCCTTTTCCCTGCTGGGCTG
GATCCCTGAGCATGACCAGGTCTCCAGTCAAGCTTGTAGCATTTAGAGTAGCAGACGCTT
TGGGTAAGTCAGCAGGCTCGGCCAAGCCATTCAGGTAGGTCCCCCGGGGGTGCTTGCAGG
AGCCACCTCCCCGCCCAGGCCAGCTTAGCTGAACATCCCACGTTTTGGCAGTAGCTTCTT
AGAGGGTGTTCTTCTAAAGCCCCGCTCACTGAGAGCGTCATCAGGGTTTACCGGCTACAT
TTTAAAAGGTACCTTTGGTAGTTTGTGAACAAATGAACACATGGTGGTTGACATATGAAC
ACTTGCCGGCCATAGCCGTAGATAACTCATTTTAATTTTCTTTCAGATACATACTTGTTT
TAAAAAAATGAATGAAAAACTAGAATTTTGTTGTTGTTGTTTTTCCCTTAAAGGGCTCTA
GGTCAGGCATGAGTGGTGACTGTCGAAACCTCAACATGGCAAGAAGGGACTCAGAAAGCA
CCCGCCACGACTCGGAGACGGAGGATATGTTGTGGGATGACCTGCTGCACGGCCCAGAGT
GCCGGTCCTCGGTCACCAGTGACAGCGAGGGGGCCCGCGTGACCTCCCTTCACGCAGGAG
CCAAGCGCGACCCCAAAGAGGATGTGTTTCAGCAGGTCCGTGGCAGCGGTAGTCATAGTA
GCTATGATTTATTGTGTCCTTACCGTGTGCCAGGTACTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCTCATTATTCTCCTTAGCAATAACCGTGATGTTCATTTTGCATG
AACAGAGTTGTTGAATTGTAGGTCAGCCTCATACTGTATTTTGATAAACATCACAGTATT
GCATATGCATTACTAGAAATGACATTGCTTCTCTAATAGTGTATAAAGGCAGTGATGCTT
TTAATTTCAGGGCTTATATTATTATCATTAAATCAGATAACCTAGAATTGGGGATGCCTT
AGAAGGTATTTTAGCCTTCCAACCAATGTAGGAATTCTTTCTGCATGGATAGAAATTCCT
TCCCCATCTGTATGTGATCATAGTAGTTCCTACTTCTAAGGAATGTTGTGAAATAGCAAA
TGAGATAATAGAAAGTGTTGAGCACAGTGCCTGGCAAGAGTAAGCACTCTATAAATGTCA
GCATTATTAATATCCCCATCAGATGATCAGTTGGCATCTACTTAAATACCTCTGTTATTT
CATGAGACAGCTTGTTCCACTACTGGATAGATTGAATGAGTAAGAAATGGTTCTCATTAT
TTAGCTGGAATCTGTCTGTTATTTCTACCTGTTAATTCTATTTGTGTCCCTAGGGCACCA
AAGAATAAGTCTGCCTGTTCTTCCACATATCAGCCTTTCAGGTATTTAATGACAGTGAGC
ATGAGTCTCCTTAGATTTTTGCTTTTTTCAGCTAAATATTTCTACAGTGCCTTACAAATA
GTGAATGGTGGGTATACATTTATTTGATTATTGACTTGATTCTAAGACACCGTTGATTTA
GGTTACACATTGTCATGAAAAAAAAAATCCCACTTCATAAAATGTATTATTTTTTTTTTT
TAAGTTTTGTGGTTAGACTGTCTCTAATTGACAACTTCTTTTTTAGAGCTATCATTTTCC
CAATCAGCACTGCCTTTGCTGCTTCCCTTATGTTTTAGTGTATTCATTTTGTTCACATCT
AGATATTTCCCAATTTGCCTTGTGATTTCTTCTTTAAACCACTGGTTGTTTAACAGTACA
CTGTTTAATCCCCACATATTTGTGAATTTTCATTTTCTTCCTCAGTAATTGATTTCTAGT
TTGATTCCATTGTGCTTAGAGAAGTTACATTGTATAATTTCAATATTTTTCAATTAATTG
AGACTTGTGCTACCTAAGATAATGGTCTATCCTGGGGAATGATTCATGTGCACTTGAGAA
GAATGTGAATTCTGTTGTTGTTGGGTGAAATAGTCTAGATCTATCTGTTACGTCTAGTTG
GTTTAGAGTATTGTTCATGTCTTTTATTTCCTTATTGACCTTCTGTTTAGATGTTCTATT
CATTTTTTCCATTTTTAAAAAATTGATTGAATTATATCACCCATACATAAACAATAAATA
TATAATAATAGTTGTGAACTTAGAAAACAAACATACGTAACATCATAATAGGACCCTTAT
ATCTCACCCTACCACCAATACCTTGCATTATTGTTAAACATTTTTAACTAATGATTAAAG
AGCATTGTCAAAATATTACTACTAACCAAAGTATTCTTCCCCCAACCAATGCTATTATTA
CTATTATCTTTATCTTTTTTAAAAAATTTCTCCCCCTCCAACCCCCCCTCAATGTCTGCT
CTCTGTGTCCATTTGCTGTGCGGTCTTCTGTGTCTGTTGTATTCTCATTCAGTGGCTCGG
GGAACCCAGCCTGGGACCTTCTGGAGTGGGAGAGAGGCGATCGTTCTCTTGCGCAACCTC
AGCTCCCTAGTCTGTTGCGTCTCTTATGATCTCTCCTCTGTGTCTCTTTTTTTGTGTCAT
CTTGCTGCATAGTCCTCCATGTGGGTGGTACCACTCCTGGGTGGGCTGCGCTCCTGTGTG
GGGTGGCACTCCTTGCATGGGGGACATTCCTTGCTCGGGGGTACCCCTGGGTGGGGTGGC
ACTCCTTGTGCATGGCAGTACTCTGTGTGGGCCAGCTCGCCACATGGACCAGGAGACCCT
GGGCCAGGAGCCTGGACCTCCTATATGGTAGATGGAAGTTCTATCCACTGAGCCACATCC
ACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATGGACTATTCTTCCAATTATTTAGGGCTTTTATAAAT
TTCTTTTAACATTGAGTTGTAGTTTTCAGAATACAAGTGCTTTACATCAATGGTTAAAAT
TATTCCTGAATGTTTGGGTTTCATCTGCCATATTTATTTTCACAACTCCTTTAACACTTT
TAGTTACTTTTATTGATATAATCTTCATTTCTAGACTTTCTTCCAGGCCTCTACCTCCTG
TCTTTTCTTCTCAGGCTGTAGCACACCCTTTAGTGTTTCCTGCAAAGTCAGTCTCTTGGT
TATAAACTCTCTCAGTTTCTGTTTATCTGTGAATATTCTAAATTCACCCTCATTTTTGAA
AGACAATCTTGCTGGATATAAGGTTCTTGGCTGGAAGTTTTTATCTTGCAGTATCTTAAT
ATATCAAAACACTGTCTTCTTGCCTTCTTGGTTTCTGGTGAGAAATCAGCACTTAATCTT
ATTGGGTATCCCTTACATGTTATGCATTGATTTTCTCCTCCTGCTCTCAGAATTCTCTCT
TTGTCTTTGGCATCTGACATTCTGATTAGTATATGTTTCAGAGTTGGTCTATTCAGATTT
TTTCAGATGGGAGTACATTGTGCTTCTTGAACACGAATATCAATGTCCTTCAATAGCTTT
GGGAAATTTTCTACCATTTTTTCAAATATTCCTCCTTCCCATTTTCCTTTCTCTTTTCCT
TCTGGGACAGCTATGACATGTTATGTTTGCACAGCTCTTGCTGATATATAGCTCCCTGAG
ACCTTGTTTAATTTTTTCCATTCTTCTCATCATCTGTTCTTTTGTATGTTCACTTTCAGA
AGCCATTTCTTTAGGTTCACCAATCCTTTCTTCTGCCTCCTCAAATCTGCTATGATATGA
TACCAATATGTTTTTAATTTCATTTATTAAAATGCATTCATTTATTATGACTTTCATTCC
CATAAGATCTACTGTTTTTCTATGTATGCTTTCACATTCTTTTTTGTGCTCATCCAATGT
CTTCTTAATATCCTTAATCTCTTAAGCCATCTCATTGAATTTATTAAGGACATTTGTTTG
AACATCTATGATTAGTTGTCTTAACTCCTTTATGTCACCTGGAAGCTTATCTTGTTCCCT
TAACTGGGTCATATGTTCCTGTTTCTTGGTGTGGATTTTAATTTTTTGTTGGTGTCTTGG
CATCTGGCTTACTAGAGTATTTATCTTGGGTGCAGTTTTTCTCTTTAGTTGAGGGCTTCC
TGCCCTTTCTCCCTTGCTGGTTGTGCAGTAGGAGCCAAGGATGTAGTTGGTGCTATAAGC
TGTGGAGGCTCAAGCTGCCCTCATTGCCCCAGGGACTAATGACGTTTCTCCCAACTTTCT
CTTTTACCAGGGGTACAGACAGAGCCACAGCTGTGTGGAATAATCCAAGTTGTGCAGGCC
TAGACTGTAATTGCCCAGAGAGACTGATGAAGCTTCACACCCTTTTCTCCCCTGCCTAGG
GCAGGGATGGAGCTGCAGGTGTGGGCAGCAGTCTGTGTAGTGCGGGTCTAAGATGACTGC
AGTTGCCCTTGTAGACTTCCCGTTTTTCAGTCTGTGCCAGCCAAAGGTACCTGCAGTTAC
CTGGATAGGCCGGTGCAGGGCCCTCCTGCCTCCTCCCTGCCAGAGGTGGGGCTGAAGTGT
AGCCTAGGGCTGCAGGCCGATCTGGGTGAAGGAACCCTGTTCCTACTGTCACTGCAATTT
TTGGTCAGCCCAGCTTCCCCTCATGCTGGGGGCAGAGTCAAAATGGTGGCTACTGGCCTC
TTTCTGACTTAGACAAGTTCAAACTTCAGCTGTTCTTAGGGTTATACTTTTAGCCACCCA
AATTTTACTAATCAGTAGCTGAAATAAGTGGCCAACCTTCTCCTCCTCCCCTGTTTTTGG
GAAATGAAGCTTCCAATCCCAGCCACAGAAATAGCTCCTGGGGTGGCTTGTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAAAAGGACAGGAA
ATCAGCATCATGGAGTGATGAACTCTGAGGGAAAGAGTAGAATGATGAGAATGAACCTTG
GCAAATGTAGCCTGGGAGCTGGAGAAGGGGAAAAAAACCCAAACTAATGGAGGAAAGAAA
GGAGTGAATGAAACAACTTTATATTTTCTTCTCCTTTAAAAAAAAATGATATATATATAT
ATATAGAGAGAGTATATATTAAAATATGCTTCATCTTTATAATTTTCTCCAGAACCACTT
ATTCTGGCTTCAGAACTCGAGTCCTGCTTCTGATCGAGTTAGTGCAATAATCTGGGAGGG
GAATGAATGCAAGAAAATGGATATGTCTGTATTGGAAATAAGTGGCATCATCATGAGCAG
GGTAAGATTTCATACGTTTTCAGGTTTTCAGATAAATCTATGTAGTGATCAGCAGCTGTT
CCATTGAGTCTGCTTAGTGATCAAATGGATATGACTCTGCTTTTGAAACACAAATAGATA
TTTTAAAAATTTTGTAGTCGATCTTTACCTTTTTATTTGTTACACATTATTTCTAGTAGC
ACCATCAGTTGTTCTGTTCTACTCTACAGATATTTCTTATCTCATTTAAGCTTAATTTTT
AATAAGATCTAGAAGCCATAAATCTGTATACCATTTAAAATTTTACTTCTGTTTGTCTTT
TTTTTTGATCCGAACAGTATTTGATAAAAACTTCTTCATAACTCCACATATCTGTTCAAT
AATGCTGGAAATTTTAAATTAATTCCCAGGTTAACGCATATCAGCAAGGAGTAGGTTATC
AGATGCTGGGAAATGTTGTCACTGTTGGATTAGCATTTTTTCCTTTTTTGCATCGACTTT
TCCGTGAGAAGAACCTTGATCAACTAAAGTCCATCTCAGCGGAGGAGATACTGACTCTCT
TTTGTGGGGCACCTCCTGTTACTCCTGTTATTATTTTGTCTATAATTAATTTTTTTGAAC
GATTGTGTCTTACTTGGATGTTTTTTTTTATGATGTGTGTGGCAGAGAGAACATATAAAC
AGGTAGGTGGAAAAATAAGTAAAATTCCATAACTCTTATTTTTTTGTATATGATAATCCA
TTGCTCTGTTTCTGTTCTTGCTCCAAAAGCTAATGTGGGCAATGAAGGACAGGGAAGTGG
CCTTTATTTATTTTCTTTCCCCTCCCCCTACCCCACTCTGCTGTTTTTTGTTTTTTGTTT
TTGCTGTCTGTGTCCATTTGCTGTGTGATCTTCAGTAGCTTTTCCTCTTTTTGTCTTCTC
TTCTCGTCTCTCTCCTATAGGATTCACTGGGATTCGATCCCGGGGGCCTATGGTGTGGAG
AGAGGTTCCCTGTCAATTGTGCCACCTGAGTTCCTGGTCTCTGCTGCACTTCACCTTGAC
TCTCCCCTTTGTCTCTCTTCTGTTGCGTCATCATCTTGCTGCGGGACTCACTTGCGCGGG
TACTGCCTCACCACATGGGTACTTGGCTCACCATGCAGGCACTTACATGGGCACTCAGCT
CACCACATGGCACTGGCTTGCCATGCGGGCACTGGCTCAGCACATGGGCACTCGCATGGG
CACTCGGCTCACCACGGGGCACTCACGTGGGCACTCGGCTCTCCGTGGGCACTCAGCTCT
CTTTGCGGGCACTGGGCTCGCCACGTGGGCACATGGCTCACCGTGCAGGCACTCGTATGG
GCACTCAGCTCACCACATGGGCACTCCTCTCGCTGCTAGGGCACTCGGCTCACCGTGCAG
GCACTCGGCTCACCACGCAGGCAGTGGCTTGCCGCGTGGGCACGCTTTCTCTTCTTTTTC
ACCAGGAGGCCCCAGGGATCGACCCAGATCCTCCCATATGGTAGGCAGAGGCCTTATCAC
TTGAGCCACATCTGCTGTGGCCTTTTGGTATTGGTGGAGTTTACATTTGTGACGTGCTGT
AATCTGAAATCTAGCTGAGCCCGAGTGTAGGAGTAAGTGGCTTAGCTGGTGAGCGGCCCC
GAGCAGACTGCCTCGAACCCGCCTTTCTTGTGCTTTCGCTGTTCTTGATCCACAGCTCAT
GTTGGAATTCTCAAAAGGATAAAGGCCAAGTGAGAAAGCGATTCATTGACATTTACGAGC
GTTCGGGATTGAGGACTTACGTATTGAAGATGGGCACAAGAAATGTGGTTTTGAATAGAA
ATGTAATTTGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGGT
ACTTGGCTCACCATGCAGGCACTTACATGGGCACTCAGCTCACCACATGGCACTGGCTTG
CCATGCGGGCACTGGCTCAGCACATGGGCACTCGCATGGGCACTCGGCTCACCACGGGGC
ACTCACGTGGGCACTCGGCTCTCCGTGGGCACTCAGCTCTCTTTGCGGGCACTGGGCTCG
CCACGTGGGCACATGGCTCACCGTGCAGGCACTCGTATGGGCACTCAGCTCACCACATGG
GCACTCCTCTCGCTGCTAGGGCACTCGGCTCACCGTGCAGGCACTCGGCTCACCACGCAG
GCAGTGGCTTGCCGCGTGGGCACGCTTTCTCTTCTTTTTCACCAGGAGGCCCCAGGGATC
GACCCAGATCCTCCCATATGGTAGGCAGAGGCCTTATCACTTGAGCCACATCTGCTGTGG
CCTTTTGGTATTGGTGGAGTTTACATTTGTGACGTGCTGTAATCTGAAATCTAGCTGAGC
CCGAGTGTAGGAGTAAGTGGCTTAGCTGGTGAGCGGCCCCGAGCAGACTGCCTCGAACCC
GCCTTTCTTGTGCTTTCGCTGTTCTTGATCCACAGCTCATGTTGGAATTCTCAAAAGGAT
AAAGGCCAAGTGAGAAAGCGATTCATTGACATTTACGAGCGTTCGGGATTGAGGACTTAC
GTATTGAAGATGGGCACAAGAAATGTGGTTTTGAATAGAAATGTAATTTGGGAATAATCC
AGAAGCCCCTATAAATATTTGAGTTTGTGAAGTGCGCGTTTCATGAAGGGCTCTGATGAA
TGTCCCCTGCAGGTGTTAGGAGTGCACCGTGTTGTACTATGTAACGGGCCTTAGGAGCCA
CAGCGTGATGGGCTGTCCAAGTGGTTTATTCCCACCCAGCTAAGTGATCCGTGATTAGAA
TGTCATCTTTTTTTATATTACTATGTGCTGGTAATATTGTTTTCTATTATATAAATCCAC
ACACAGAGGTACATAACATATATTTTACTTTGTGATTTTTTTTTAACCTTTTCTAGAGAT
TTTTATTTGCAAAACTTTTCAGCCACATTACTTCTGCCAGGAAAGCTAGGAAATATGAAA
TACCTCATTTCAGACTTAAAAAGGTGGAGAACATTAAGATATGGTTGTCCCTGCGTTCCT
ATCTAAAGGTGAGTTTTATTTGATTAACAGTGGAATATATGCAAGAATATACAGAGAACT
ACTTACTGAAGTTTCTGGCAGCATTTCTCAGTAGGCAGTATAGTTCTGGATATGGTCTAT
CAGTGGCCAGCCGTCTTGTTGGGCATCCCGTTGGAACTGATGTCTCTGTAAAGCTGATAT
GGGTAAGTAAATAAGAGCTAATTAAGGGCAAAGAAAATTTAAATTTCCTAGGGCAGAATG
ATCAATATCGCATCTTTTTCTGACTTTTTAGTAAAGATTCCAGCTGAAAATGTTATTGAA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAGAATTTTGGGAAAAGAAAATTGCAAGGTTGACCATCTGGGAGACAAGAGCAAAACTCA
AATCTGTTTCCCACCCTTGCGGTGTGGTTGAGTGAGGTTTATATGGTGTGTTGATGGAGG
GGTGTTGTTTGGGAATTCTGCACATATGCATGATTGTTTTATAAGTTTACAATTTCTGTC
ACAAAAAAATATATTTAAAAAAATAATAGGGTGGGTTGGGGGAAAAACACACCAAATGTA
AGATAAGAACTATGATTTTGACAGTGTTCATTCATAGTTTGTAACAAACATCTCATGACA
ATGCAAGGTGTTGGTGGAGGGTTGATGTTTGGGACCCCTGTATGATGTTATGCATGTTTG
CTTTGTAAGTTCACAACTTTTACCATACACTTAATTGTTTATATATGTTCATATATAAAT
GATATAAAGATAATAATAATTGGTTAGGGGGGAAATATTTGTTTAGTAGTAATATTTTGA
CAATGCTTTTTAATCATTAGTTAAAAATGCTTAAAAACAATTATTGGTAGGGTGAGATAT
TATATATGTTTATGTTATTTTTTTTAAGTTCACAACTATTATACATTTATTGTTTATGTA
TATTTATATATGAGTGATATATTTCAATTTAAAAAAGTTAAAAAATAAAAAAATAAAAAT
AAATAAAAAAGGTTACAAGGAATACGGGCGTCTCAAAGTGCAAGAGCTAAGCCTAAGCCT
ACGGGGCATACCTAACTCAACCTAGGATGCCTGGTCACATGACCAGAAAATGACAGCCTA
AGCAAGTACAAACAAAGGTAGGGTGGGGAATGGTTCCTCAGGTAAGTTATTTTTGGTCAC
AATTAGTAGGGAATGCCAAAGTGTGGTCTCCTGGAATCCCTGAGAATGGGTTAAAGTTTG
TTGGGGTGGGAATAGGCTGATGATAAGGGGCTCAAGTTAAAGGGAAGCCATAAGGGGTCC
AAGGCACTAGGTATCCTTACAGCAATGAGTATGGGTTAATGAGTCCTACTGCAATGGCGG
CAATGGATGTTACAGGTAATTCCAGCAAGCTACTGTAAAAATTTTTGTCATCACAAATAA
TAATGTATCCTATAACCACTAAAAGAGATCAGCATACCGTGCTGTGTAGAGATAGGCTTT
TGCTGTCAATATTTAGCTTTATGCACTCATGCAGGATGCTTAAACTCTAAGAGCTTCAGG
TAATTGACTAAGGAAAAAAAAAGGCTTAAGGTACTGTTGGGCCATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTCTCCGTGTCTGTGGTGCCATTCCT
GGGGCGGTAGGGGTTTTTGCATGGGGCGGTTCTCCTTATGGGGCACATTTCCTTGAGCAT
GGAGCTCCCCTACATGGGGGACACCCCTGCATGGCAGGGCACTCCTTGTGTGCATCAGCA
CTGCACGTGGGCCAGCTCCACACGGGTCAGGAGGCCCTGGGTTTGAACCCTGGGCTTCCC
ATGTGGTAGGTGGATGCTCTATCAGTTGAGCCAAATCCACTTCCCTACAGTAATTTGTAT
GTTTAAATTTTTTTTAAGAACCTATCATTTTCATTTTTGAAGGATATTTTCACTGTGTGG
AATCCTAGGTTGCCAGTTATTTTCAGCATTTTTAGGCTGTCATTCTGTTATCTTCTGATT
TCCATCTTTTCTTTTCAAAAATGAACGTTGGTCTTATTGCCGCTTCTTTAAAAGTAATGT
CCCTTTTCTCTGGTTTCTTTTAAGGTTTTTTCCTTTCTTTAGGTTTTTTTTTTTTTGCAG
TTTGACTGTGATTTGTGCATGTTATCTGTTGCTGCCCAATAAATTGTATTGCTCTTGCGG
AAGAGGTAGGCGTAGGTTGTTACTAGGACTTGCTGTTCTTCCCCTAGCATGACTCATTGG
ATAGGAGTGAACAGTGAACCAAAGTAAGGAAAACATTTTCCCTTTTCAGTTATAACTAAG
AACTAGAGATGTAAGTGTTGGGTTTTGGAAAGATAGATCAGCAGGGGTCAATGAGGTCAC
TTGTTTGCCGTGGCAGGAACCACAGCTCCGGTACAAGGCAAAGTGAGGGAGGGAGCAGTA
AAGCAATGGAATTTTGCTACGAGCAGTGGGATATGTGAGTCCAAATGGGCCCTAGGGGGC
AGAGAGATGGAGAGGACAGGTGCTTGGTGACTTACGTTTTTCAAAAGGCCTGCATTTAGT
TTTTGTGGGAGTTCTATATATTTTTCCCCCCATAAATTCTATTTTACCTTAGACTTGAGT
GAATTTCTTTTATCTTTTAATCAACCCAAAGAACGGAAGAAAAGGAAAGGAAAGAAAGAA
AGAAAAGAAAACCAAACAACTTTTACTAGAAAACTTAACATATATTAATACTCAATAAAT
AGTAGCTGCTACTGTTTACCTGCTACTGTTATTTGGATTCTAAAATCCTTGGGATCCTTA
GGATTTTCTAGTCATGACGTATATCTTTAGACAAACACAATGGTGGTTGAAGTAGCTGGG
TGTGTAATATTTTACTTACTGTATTATGTTTTCCTCCTTTGTTACCTCAGACCCTTGTTG
TCTTTCGTGAAAATGAGAAAATCGAGGGTACTTGGCGAAATACATAACGATTCATTTAAA
CAAAGCTTTATGAGTATTAAGGCTCTTCTGCTTTGAGTTTTAAAATATTTGGTTTCTTGC
AAAATTTTTTAATCATTAGAGTAAAAGAATAAGTGATTTAAAGACAAAGAAAAATTTTAT
TTTGGTCCTTTCTGTAGGTTCTCCAAGGACATAAAACTTTCCTTAACGATGCGTATAACT
GGGAGTTTTTGATCTGGGAAACAGCTCTGCTGCTTTTCTTACTGCGCCTGGCCTCACTGG
GGTCTGAAACCAATAAGAAGTACAGCAACGTCTCCATACTGCTTACTGAACAGGTACTGG
ACGGGCCCTAGCCAGTTTGCGCAGCAGTTAGAGGAGACGTAATATGCTGTCAGATTTATG
CAGCGACTCAGTGTTGAGTCTAGATCCTACCCCTCTTCAGCTCTCTGGCTCCACGAGGCC
CTTTGCTGCTCTGTCATTGTTCTCTCTTTATAAAATGGATTATATTCCTCACTTGCTCCC
AGGGTTGAGTATTATGGTCTAATGGATTGGGAATACTTTCTATACAGTAAAGGTATTTTT
AGTGATGGTAATGCAGCATGCTTTCAACCTCATATTCTGTATCAAGTTTAGATCTTTAGT
TATAATTTAAATATGTTGAATAAGCTTCTTGAATTTCTTTTGTATCAGATATAGAATACA
TTTCTTAGCATTTGGAAATACTTACTATTTAGTATGTTAATAGATAATAAGATTGAGAAA
TGTTTTTTGTAAATGGAAAGTAGTATAAAATAAATTTGTAAATTCAAATTTGGTTATAAA
CTTTACATAAAAACAATATCATTAGGTTGTTTTTGGTTGTTCTTTTTTGCCTTATGTTTT
AGTCGAGACTGATTCCTGTAAGGGAAAAAAAATAAGGTGTTAGTAAGCTAAAAGGCAGCT
TATCTTCTTCCATTGCATAAATGATCAATGAAGAAGTTACATTTTTTTGGGAGAAACTGA
GATGAAGATAGCTTTGAACTCAAGTTTATATGCTAATTGTTATTGGTTATAATTAATATT
AGAATTGGTCATTGTTTTGATATTTAAATTGCCTTATCATGTATTCTTTTTTGTGTGAGG
AGGTACTGGGGATTGAACCTGGGACCTTGCACATGTGAAGCAGGTGCTCAACCACTGAGC
TATACCTGCTCCACCGTCATTTATTCTTTTTTCTTCATTGAGTAGTTTTTCTTTGTTAAA
GATGAATCTGATTGGGGATGGGAGCTAGGGTACATGGTATATGTGCTCTGTAGAAACGGG
ATCCAGAAACTTATTTTATTTGGAAAGATGACCCTCCAAATATGCCAGATTTTATGCATA
TATCCTTTTTTTCTATGAAATTTACTTTAATCCCTGTTCCTTCCTTTAGATTAACTTATA
TCTTAAAATGGAAAAAAAACCAAATAAGAAAGAACAGCTCACTCTAGTAAACAATGTGTT
AAAGCTGTCCACCAAGTTGTTGAAAGTAAGTAATACCCCATGACACATTTACTACCATTT
AAATTACATCAGGGCCTCACTTCTTGGAAAAGACCCTAACAGGTTGCTAGGCTGTGTACA
TTCTAAAGCTGATAGTTTTGCGTTAATGACTGTGTGGGAAAAACATTTTCCACCTTGTTG
CCCAAGTTCTGATGATCACTGCTGCCTGTTAGCCTTTTAAAATGACCTTTCCCCCAGTTG
AGATGTTGCCAGGCTGCACCTTGGAAGGCTCTGGAAAAGCCGGCGGCCCTTGAACTCTAA
GGGAGTAGTATGCGCGCCCCTTCGATGGCCGTCCCGCTGGCTGGGGACCCTGTGCTCATT
TCCGCTCTCTGGTGTTTCTAGGAGCTGGACACTCCTTTTAGACTCTACGGCCTGACAATG
AACCCCCTGATCTACAACATCACCCGAGTGGTCATCCTCTCTGCCGTCTCGGGGGTGGTC
AGTGACCTCCTGGGGTTTAACATAAGAGTAAGTAGCACTGCCCTCTGGAGCACCTGTCGT
TAGAAAGCCCCAGACACGATTTCACTCTTCACGCTCTTTCTGTGCCTGGCTTGGGAGACT
CCTGCGGTAAAGCAGTGGGTTTTGACTGTGGCCCACAGGCCTGCCAGCTGAGGCGTTCTG
TTTTGTACGGGGTGGTGTAGACTGTGCTCCTCCAGGACACAGACCCCAGGCTTAAACCTC
GCCCATCTTACAGCGCGGGCTGGCCGGTCTCCTCTGCCCGGGGGCAGTGGGCAGGGCAGG
GCCGCGTGAAGCTGAGAACCCCAGCGACCAGTCCTAGGCGGAGTGACGCTCCGTCCGGGG
AGCCGGCAGCGTTGGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCCGGGGAACTAACGGCTGGGCCATGTTTCTCTCCTCA
GCTGTGGAAAATCACGTCGTGAGTCGAGGCCTGTGCCTGGCCCTTCCCGGGGAGCGCGGC
GCCGGCCCAGCCCTTCCCGAGGAGCGCGCCCCTTGCGCACGGGCGGCGCGGCACCCGTGT
TTCACGGCTTTGAAACAATATGAACACTCAGGAGACTCAAGGCTCTCAGCGTGTTGTGGA
ATCCACCCAAGGAAAGCTTTCTAAGCCAGGAAGTTCGTTCCGGGCCTGTCAGTGCGCCGA
CGATATGCTTACGTGGAATTATTCTTTCGGGTAACAGTGGTAGATGCCCAAGCATGAAGC
AAATGTCCTTCACTGGAAATCTGCAAGTTCAGTACTTTTCTATTAAAGTCTGTGGAATTG
GAGATTTCATTTTTCTGAGAGATCAAATATAAACTCTGAAGTTGAATCTAAATAAAAGAA
CTTTGCTGGGTATTTTCAGTTTCTAGGTTTTTTGTTTTTGTTAAAGGAAAAAGTAATCTT
TTAGACTGCGTATTTCTCTTAACTGTGGAGAAAAATTTAAGTTTATAATTTTGAACTTAA
TCCTAATAACTGAAAGGTTTTCGGTGCACGAGTCATGCATACAATGTGCCATGTAATTCA
TTGAAATTTTAAGTCTATGAGCACTGATCCGTGTTGAGCATGCAGCGTGGCTCACACGCA
GGCCACCAGAGCGGCTGGCTAGCTAGTGCCGCGCAGGCTGCTGGCCGTGCCGCCGTGAGC
GCCCGCCCTCCACGCTCAGCGTCTAACCAGCTGCGCTCTGCCTTGGATGGTTTAGGTCCT
CTTCTACACCCCTAGTCCACGTAAGTGCATATATGTGTGTTAATGAAAACTCTAGAGGCC
CACTTATAACTCCGGCTCATTAAGTTACCTGCTTTGAAGAATCAGGCTGAGGCAAATTGA
AAGGCTGAAACTTAATGATTAAGTGTTTGTGAATTTTAAATTGGAAAATAGTTTAGAAAT
TTAGTGATTATATGTAAAGCAGAACTATATGTGTGAGGTTTCAAGATAAATTTCTCAAGA
GT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 6238..6307, 6759..6917, 7814..7970, 8071..8205, 11314..11473, 12472..12642, 12754..12843, 13853..14074, 21772..21900, 22289..22561, 24836..24967, 25361..25447, 43697..43852, 44929..45024, 45381..45506, 46021..46041
1001..1051, 6238..6307, 6759..6917, 7814..7970, 8071..8205, 11314..11473, 12472..12642, 12754..12843, 13853..14074, 21772..21900, 22289..22561, 24836..24967, 25361..25447, 43697..43852, 44929..45024, 45381..45506, 46021..46038
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved