Dasypus_novemcinctus Locus TXNDC1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus TXNDC1
Dasypus_novemcinctus
TXNDC1
GeneScaffold_3755
SNORA70
4164..4298
18311
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCTTGTTTAGGGTTATTTCAGAACTAGGCTCACCCTTGTGTATAT
TTGCCATTGTGATGGTAACCACTTTATTTTCTTGTTTGAATCCATAAAAACTCCCGCTCT
GCGTGAAGGCAGAGACACCCCCATCTTCTGTCCTGCCTGGGTTAATAAACCTGCTTTCTC
TCATGACCATCCCCTCGCATGGACTCCAATTCATCTGTCCGGACAAGAACCCTGCAGGGT
TTACCTCATACCTACTGTAATTTAAAAAACCAGGGATAATATACATACTAAAATTCATTA
AGAGCACTAAACGTACATGTAATGATCAATGCTCTTTTTAACATATGTACACACCCGTGT
AATCATTGTTCGGACTAAAATAGCACCTCATTGCGTTCCCTCGTGCACCTTTGCAATCCT
CCATTAGGAAACCAATATTCTAACTCACTTAAGCGTCCATTAGTTTTACTACAAAATTTC
TCAAAGGAAACAAATGAAAGCTTTAAGGGATGTTTACTTGGAAACTGTTTTAATCATTTA
TCACTTGCCTTAAGTGAAAACTCCAACCATTTGGCGCCAAAATTCTGGCACAGACTTTTA
CGCCACTCTTTCCACTTCCTACTCCACGTCCTCTCTTCTGCTCTTTTTCTTCTCAGCCAC
TCTGGGGCACGTGCGGCGGGAGAATTGGAAGCCGCCGGGAGTTGAAAGAGGCCGGCTTGC
GGTCATGCGCACTAGGGAGAGGCGCTCTTTCCTCATTTCCTACCAACCACTTAGAAGGAC
CAGGTCACCGTCATGCGCAGTGAGATTTCTCTAGGCACGCGCGCGGCTAAGTGCGCGCTT
ACGCGCATGAGCGAAGCGGCCCCGCCGAGGGCGGAAGTGCGGACTTTGTGCTGGGTTGGT
GGGAGCCGCATCTCTGGGTGTGGGGTGGGCAATTGGCTGACATGGCGCCCTCCGGGAGTC
TGGTAGTTCCCTTGGCAGTGCTAGTGTTGTTACTTTGGGGGGCTCCCTGGATCCACGGGC
GGCGTAGCGACGTGCGCATCATCACGGACGCGAACTGGAAAGAGTTACTGGAAGGAGAGT
GGATGATAGAATTGTGAGTGCGGGGCACTTGTCTCGGAGCACTTCCATGGGTCGGGCCGG
CTGAGGTCCGAGGTTCGAGCCTAGACTTCCCACTTCTCTCCCTCGTCCCTTATGCGGGCC
GGGTGTTCCCCGCGACTAGGTCTTGTAGCAGCGGAGCGGGCGTCCCCAGACTCCTCCGAT
TCTTCAAAAGCATATTCGGATCAGCCACCAACTTGTCCCCCACTCCCACCCCCGTCGTCT
CTTACACGGGAATATTAAGTTTCTTCTAAACCGTGCACCCTAATTTCGTCCCTAGGGCTG
TGGTGAGCATTAGAGATTATGTTCCTCTTCTCATTCCCTCTAGCGTTTTTCATGGCTATA
AGGATGGGGGTCTGCTAGCTCCTATACAAATTATTTTAGAACGATCTTTCGTAAGCAGAC
TTTCTCGATTTATTTCCACCGAACTTTACAGAAAAGGAAATTGAGCACAGCCTCTCCTTG
CCTTCCTTTTGTCTCATTATCCTTCGTAGAGAGTCAATTTATAGTTGAAACTTGGGGCTC
TTTAATTGTTAATTTTTGCAGACTAGTACATTACTTTCCTTTTTTTTTTTTTTTTTAATT
GTAAATGCCGAGGAACTTGAAGTTGGTTTGTTATTCTTTTTTTTCTTCTTCTTTTTCTTC
TTTCACGTCTCATCTCCTTTTTCCTTTCGGTGTGTTTTTGTAAAGTAGAGAATGTTTTGT
TTGTGACTCCTGAGCCTGTAAGTGATGATGCATTACAAGATAAAATTAGTATATACATGG
TGTGATTATAAACTCTTAAGCATTCCAACTCTTCGTCTCTTGTTAAACAAATTCATGTTG
TGGTGATTCCATTATAATGTACATTCTAAAGCCATAAAAAAGAAACGATCTGCCTTTACA
TTCAGTGCTAAATTGGTGGGTGTGATAGTATTAGTGATACAGTGGTTTTATTAGAAATAT
TAGTAAAAGCACCGTACTTTAGTATTAATTTTGTACCAATTACTTCTTAGCACTCTACAT
ACATTATTACATTTAATCCTCTACAACTTCTATGAAATAAGTATTTACCCCATTTTATAG
ATGAGAAACAGATGCCTAAAGCTGCTAGTTAGGGAGGCAGGTGTAGGTGGTCGTCTCCAC
GGGAGAACCCAGAAAGCGGAAGCAGTAACTCTTGAGTCATAAAAATAAAAAAGCTTAGAG
GAGAGTAAGATAGGAGACAAAAGTTTATGGTATGCATACATTATGCAACTCAGTGAAATG
AATTTTCAGGTACCATTGAAGGTGCTGGGGAGACAAATAGCATTTTTCGGTCATTGTCAT
GAGTTACTTGTATTAGATGATTTATTCAGTTTCATAAACATGTGCTCATCAATAGTAATT
ATGATTTACATGGAACACATAGTCAAGGATTCTTCATTTTAATGATTTTTAAATTCATTT
GCTCAAACTAAATATAGCAGTAAAAAGAAGTATTAAGGAGAACACACAAAGCATTGTATA
TGCACTATATTCAAATTAGAGCTTCTGTCTGAAATTATAGTGTAGGGTAGTGTTTTTTCT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNATTTTACATGAAAATGTCGATTTCCCAACTTCTTTTA
CATATGGATACCTGCATCACTCAGCCAGCATTTCTCTGTGGCTACAGTGCTACTTCATCC
TTCCTGGCCCTTGCAATGGGGCATGTGCTTCATTATTTACCACAACTCAGTCACTTCCTA
TTTTTCTTAAACCAACACCTTATACATTCCATTTCCTACAGTGTGAAATTAATAAAACTG
GTGAACGCTAAATTTAGCTCTGAGCTAAACCACATTTTAATAGAGACCACATTTTAATAG
AGAAATTCAAAGGTTTTTAAAGAACTATTTTGCATGTGAAAGCCTTCCTGTCTTCAGAAC
TGATTTCTCAGAATTATTTGTGTGTGATTAGCATCATCATTTCATAGTTCCTGATTTCCA
GAGCATTAGACCCACACTTAAAACTTTTTCATCTGCTGCATAAAATTAACTGTTTTGTGA
TTGTTAGTATTTTCAGTAGAAAATACTTTTCTACACACAAATATTTTTATAGCAAGAGGG
ATGTTCAGGTTAGAATGCTTAGCTTTGTAACATAAAAAATATATTAAGTTTTTACGTGAA
AGCCATTAGAAGTTTCTCTCTTTACCAGTGACCTCCATATATTTTTCAAATCTTGCTACT
TATTTGTCTTTGTATATATTTGTAAAATCTCCATAGATTATTAGATATCTTTCATCTTTA
ATTCCTGTTTTTTTCTTTTTAACTGTATTTCTTAGTTATGCTCCATGGTGTCCTGCTTGT
CAGAATCTTCAACCAGAATGGGAAAGTTTTGCTGAATGGGGAGAAGATCTTGAGATTAAT
GTTGCAAAAGTAGATGTCACAGAGCAGCCAGGTACTGTAAATCTGTGGTTGGTTTTGTTT
CTTTGGAGATTGGGTTGATAGTTTTTTCCTATTTTCCACTTATGTGGTCTCAGTTCTACC
TTTTGTGAGGTTTTGAAAACCTATCTGCAGCTGGTTAAGCCAACTTGCTCACCTCCCTGA
TGGGGCTCAGTGTGCAGTCCCTGCAAAAAACAGACTCCTGGGTTGTGAATACAGCTCATT
CCTTGTATATGTTGTTTGGGTGACACCTTGCCCTCCCCACTTTTTGCCCAAATAACTGAC
TCTGATCTTTTTTTGTTTACATCCTGGGCCCCAGACTAGAATGTAGGATGCCTTTGAGAA
GTTTTAGAACATTGTGATCCAGGTACTCATTGGCCCAGCCATCATTCACATCCACCCATG
TAGCTTCTGAACGAGGAGCATGAGGTTGAGATTCTTTGTAGATCAGGGTTCAGTTCCCTG
ACTGGAGAAGATCCTTATCTCTGAAATTGGATTTTTCCCAAATTTAATGCCTGTGATTCA
AGGAGCTCTTATAAAAGCTCTCAAGGTGCAGAGTCCAGTACATTTCTGACTTGATGCCTG
ATATAGGTGGCAGGCCCTGACCATAAGTAGAGTCCTTCTTCAGAACCAGCTTCATCTCAC
TTGTTCTTGGTGATCACAATAAACTTGGTCCTTGGCTCTCTTCCCATCCCAAATGGTAAA
AATAGTTAATATTTATGAGCATTTCCCTATTGTAGGCACTGTTATAAGTGTTTTGCATTT
ATTATTTAATTTTTGTGGAACTTTGTGAAGTAGGCAACATCCTTATTTTACAGGTAAGAA
AGCTGAGGCACAAAGAGGTTAATCCTCAGTTTTATCAATACTTGGTGCATGCTCATAATG
AAAACTAGCTGTTGCTGTTGCCCCTCTTATGAAAGATTCATAATAACATTTTCCGTTTCA
GCAACACCTTAAAATCTGCTTTTGTTTCTTGAATGTCAAATACATTTGATTTTACTTTTT
TTTTTTTTTTTTTTTTAGGGTCAAGCCATATTATTGAGGGACTTCTAGGGGGTCAAGGAA
GGGGTGGGTAGGGATGAGGTATGACATTAGCAAACCAGCAGGGATCTCCCAGCCTCACAG
CTGTGAAATACAAATGCATTTGATTTTAGACCTTAGTAAAATGATAGTGTTATATTCTGC
TGTTCTGTTAGTCATCTTATCACACAGTGGTATAATTGGCAAGTGTTTATATATATTTAC
GAATGTCTCCAATAAATAAAATTTTTTATTTAGATGATGGACGGTAGTATTTTTATAAAG
TTGCCATGAGTACATAATTGAGATTTTTTTCATTGTTTATTACAAAGCTCAACTGTTATT
AAGTCTGCTGATGCAAAAATACCAGAAATGGGTTAGCTTTTATAATGTGGCACTTACTAG
GGAAATTATAGTTCTGAAGCTGCGGCAGTGTCCAAATCAAGGCATCATCAGACATTTGTT
TTCTCACCAAAGGTCAGCTACTGGTTGTATCCTGGGCTCCTGCCACATGGTGAAGCAAAA
TGGCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTATAGTAATTCCTTTAA
TATTTGTATTACATATAAAGCTTAAAAGTGATTTTTCTGAGATTTATCTTTGATATGTGT
ATTACATATAAAGCTTAAAAGTGATTTTTCTGAGATTTATCTTTGAACTGTGTTTCATAG
TTTTGTTATTTCTAAGAATAACAAAAAGTCTTAAGGCTTATGCTTGTTTTAAAAGTGTAG
ATTCGTTTAAATTTTGGGCTACGGTATCATGAATAATTAGTATAATTACCTGTGCATTGC
TAATAGTTTTACATATTAGAATGATGGTAAAATGACATGAATGAATAGTACAACAAGCAT
TGTAACCTACAGGGTGCTGGTTAATTCCTAATTCTGATCTTCTTCAGTTGTAGGGATGGT
GAATTCAGGCGCTATCAGGGCCCGAGAACTAAGAAGGACTTCATAAACTTTATAAATGAA
AGAGAGTGGAAGAGTATTGAACCTGTTTCATCATGGCTTGGTCCAGGTTCTGTACTGTGA
GTATGAAGGATTTTTCTCTTGTCCATTTTAGAATTAATTGGAATGGATAATTATATTTCA
TGCAAGTAAAGCATTCTTAATTATTTCCTGGGCTCTTGAGGTACACTCAGATTTATTATG
TGTTAAGACCAGAACACATACTTTCATCCTGTCAAACTTAAAAGAAGCATTCTGTAGACT
TAAGTTGAATCCCTTTTCAGGAATATTTTAGCTTTGTAGGTATGGCCATATTAATCAAGA
AAGGGAAGTAATCCACCCAAAAGCGTGAGCAGTGTATGGGTTGCAGTATATAACGTAATA
GTTTGAATGAGAAGCATCAAATGTTTACCCACTCATGTTAACTTTAGACATCGATTCTCC
ATAATGAATTATTTATGTTTGTTTATTCCACCTGTCTGATTACTTATATGAATAATATGG
GTAATTAGTGACCATATTAATAAGAATAACCACAGAGCTTTATAGATAGCTAGAGGGTAG
CTGTAGTTTTTGATAGCACCTTCCTGCGGAGCAGTAAGGATCAGAGATTGCAAGCATTTT
TTGCTATGCCATTGGGATGCAGGTCCTCATAGATCATCTGAGAGACATGGGGATAGTGAG
TTTTGCTGTGGTCGTTACGGATTCATTCTGGCATGGCTGAGCTATCTCTTCCTTCCTCAC
AGTTATGCTTAAAGAATGGGGAATTGGGACACTGTATAAGATTAAAAAAAAAATAGCCTG
GCTTCTGGGGAGTAAGGTCAACCTTAAGTAGTATTTTGAAATAGAACTTCATCATTAGCA
CATTTCCTTTACATGCTTCTTTCTTTTCCTGAGAAAACTTTGAATTCATTTGTCCTCTAG
CTGATAGAACTCCCCTATCTAACCACCATGCCCAAGCCAATTGAGGAACCTAGTCTTCAT
AATAATAGCTTAGCCAGTGCAGGCTACAGTGATGCTACAGAGTGCTTTATGTTCAGTTCC
TTGTTCCTAGCCCCATTTTGCATTTTAAACCACAGAAGCAACATGGAAAGCAATATGATT
CAAGTATTTGCTATGTTGAACTGAAAATGTAACTGATTTTTGTTCTGTGAAATCTCATCT
CTCGTAAATGAATCTTCCTACTTTTTCCAGTAGAAAGTGGTTGTTTATAAGTCTCACTTG
ACTCTTCATAGCAGCAGTCTTCCCCTTTTTTTATTGTCAAGCGGAAGAGAGGGCACTGAC
AGTGTCAGCTCATCACTTTCTCACCCTAGTGATTGGTATTTAGATGAGGACATTCTACAG
TAGCTTTGGATTATGTATGAGGAATCCACAAACCCTTCTTATTTTTGGAGCAAGCCCTTT
TCTAATTGGCTCTCTAAAGTCTTTGTCTTTATTTTGTAAAAAATACGTATACTTTTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAAAAAAAAAAA
GAAAAAAGACAAGTCAAAATGGCAAATTATCACTGTGATAGAATACTTTGAGTAGTAGAG
TGTTTTAACAAAGGAACCTCTTGGGGTTTGGAAATGGATCTTGAGCTGGGCAGTTGTTAG
ACAGGTATATATATATCTGTAAATCTTCATTAAGGCTTGCAAGGTATATTATTCTTTAGT
TACTTTTTAAAAATTTTATATTTTAATGGACTCTGCTGAAAACACTAAGTTGGTTTGTCC
TGAGTTTTTTTTCTTCCTTAGATTCCCTTCCGTGTTCATTCTTTGGAGGATATTAAGGGT
ACTGCTTGCTTATAGTAAATGTAACTTAACTAATTAGTTTCATAGAGCCTGTGATCTGTT
ATTCAGAATATATTGAGAGTCCATATAACATCTTATTTGCTTGGCCTCAGAAGGCAGAAG
GGGATATTTTATTTTCACTTCATAAAAAATAAACAATATCCAGATACTTACCTCTCCTTA
TTAAAAGCATACTTATTACATACTTGGCAAAATCATCAAATAAGACAATGATGTTAATGT
CAGAGCAGAAAGAGAGAAGGAAAAAGAATTTTCAAGTATTTTATTTATGAGGAAGTCACA
TAATGGCAAAATTCAGAAACATTACTTTCCATGAGCAAGCATTCTTATTTCAGCCATGAA
ATCAGTCTTGATTAACACCAGCTATAAAAACTGTTGTGTTGGGGAAATTGTGGGGAAGAA
AATAGATATATAGATACAGATATAGATATATACACCCACACATGTATATTCTACTTCAGA
GCTGTGTATTTTATTAGTTTTTCAGTAATCTCTCTCTTATTTTAGGATGAGTAGTATGTC
AGCACTCTTTCAGCTGTCTATGTGGATCAGGGTATGGACTAAAATTTTATCTCTATTTTA
AACATTTTGACACTACTTTTTATAAAAGACCAGGTTTTTATTTTCTTTTTTCTTTTGATT
TTAGACTTGCCATAACTATTTTATTGAAGACCTTGGATTACCAGTTTGGGGATCATATGC
AGTTTTTGCTTTAGCAACTCTGCTTTCAGGACTATTATTAGGACTTGTAAGTACTTCATT
TTCAGAGTACTTGGGAAAGAATATTTAAAGAAATTTAATAATTTGATATAGTTGCACAGC
TGTATCATGTATTACATATTCACATTTCTTACAATGTTTTTGCAGTGTATGATATTTGTG
GCAGATTGCCTTTGTCCTTCAAAAAGACGTAGACCACAACCATACCCTCCAAGTAAGTAT
ATTTTAAAGTGTTTCATGTTTAATTCACTATAGTCTTGTTCATATCGCTAAACACAGTCA
CACATTTTACAGATTGTCCTTCTAGCTTAGGTTTCTAAATATGGAATTGTGGTCTCTGAA
TCAGTTATGACATACAGAAAAGGGTAAGGGATATATATTTCATGTGAGAATGGCAGCTGA
GTGGATTAGGGGATGCTGTTATTTTCTTGACTTTTATAGTATGAAAGATTTTAACATTGC
ATATAGCCAGTAGATATTTAGTAACATTTATCTAATACCAGTTCATTTGAAATTTTCATA
TTACTCATAGATCCAATTGAATAGACTTAAGTCAGACTTTTAAAAAAATTCAAAATATTC
TACTCTTTAAAGTTATTCATAAGTAAGTGAGCACATACGAAGATTATTTATATATGCCAG
CTAATTCTAAGTTTTCTTGGTGTAGGGTATTGGGAAAAGCATATTAAGGATTTGTATTGA
CTCTGTATTGTACTACAGACTGAGTTTATGTAATTAGAAGCTTCTGCTACTGTCTTAATA
TAAATGACCTATTGATTACTTATTTTTAATCCAGAAAATCGTACTGTCATGGAAGCCCTG
GTAGTTCCCATTTTGTTAAGAACTTCTGCATATCTTTCTCTCGTCCTATCTCCAATAACG
TAGACTGCATAGGCAATTTCTTCCTATTTTGTAGTTGAGGAAACTAAGGCTCAAAGAGAT
GAAATATTTCTCCAAACAAATGACAGAGCTAAGAGTAGATCTTTAATCAGACTCCCTTGC
TATGTTGCCTCATTTTACTCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGAAGTAAATAAACATAAAATGTTCATTCACCAGCTTTTCATTATGAGTAATACAAAA
TTTGATTAATGCAAAAGGTAAATATATAAAAATAGCTATACAGTTAGGTTTGGTTTTCTT
GACCAATTCTCAGTCTTCACCTTCACATAAATCTTATACAGGTATCAGAAAATTCTGGCG
GGTAACCAGGGTACTACTTGCTTTGGATCCCATAAATACACCAAAATCAGTACTGAGTCC
TGGGAGATATAGACTTGCCAGATTTTATTCTTATCTCTGTCAAAGTCATCTGCCAAGAGT
CTACTTTGGGAGTCTGCATAGATCATTTTTCTCTGAGAATTTAGGTGTTGAAATGTGACT
CTTACCTCTTAGAATGGTGGTTCTCAAACTTAAGAGTACATCGGAGTTGCCTGGAGGGCT
TGTAAAACAGATTGCTGGTCCCTCTGCTGAGTTTCTGATTCAAAGGTTCTATGGTGGGGG
CTGAGAATTTGCATTTCTAATAACTTGCAAGTGAAACTGATGCTACTGGTCTGAGGACCA
CACTATAAAAACCACTGTCTTACAGAAAGTGTTTGCCAGTAGGAAAATCTACAACCCCCA
GGCTTCCCGAAAGAATTTGTCTTTTGGTTTTAACTGTACAATCTTCTTGAAAGGCTCTGG
CTGTATAATTGGCATATTCAAAAGGAGGTAAGTGTTCTTGAGTGAGGAGGGTAGAAACAA
TGAACAGATAATTTTAGAAACTTTTTCTAAGAGGTGAACCTAAGGAAATGATCAGAGAAG
ATACTGTACCTCTTATAGCAAGTTACAGGACATTCATTTCTTAGAAACACAGTTTTAAAA
AAGTGTCTTAGCTAATTAATGTCAAGCTACTCAAGTTTTTTTTTTGTCTCTAGTAAGATT
CACTGTAAAAGTCAGAGGAACCTATACCTTTAAATATCTGAATTTGGAGAGATTGAAAAA
CATAAAGAAATGGGCTTTCTAAATGCCATCCCATATTATTCACTAAGAAGGCAGTGTGGT
CTTTGCGTTAGAGAGATCTGATTGGGGATTCCAGCTCTGCTACTTAAGAGCAGTATGACA
GAAGATTCCTAATCTCTATGAACCTGTGTCTCAATAACATGGAGCCTGTGTCTCAATAAC
ATGGTTTAAGATTAAGTTAACTAGCAATAGGCCCTATAAAAAATAGAAGGGGTGTGTGTT
TGTGTTTATACATATTAAAAATTCATTCAACTATATACTTAAGATTTGTGCGTTTTAATT
TTTGTAATTGTACCTTAATAAAATTTTGTATGTAGAGTTTGGGAAGTGCAGATTTATGAA
ACCAGGTGAAAAAAATATGTATGTGAATAGAATCTTCAACCATAAATGTCTGATTCCTAT
TCCTCTGAGAACTGAAGCAAGGTTAATGGTGAAGTTTGTTTCAGTATACGTATTGACTGA
AAGTACAGCTATACCTTGGAGATATTGCACATTTGGTTCTAGACTACTTCAGTAACACAA
ATATTGCAGTAAAGTGAGTTGTCACATGAATTTTTTTGTTTCACAGTGTGCATAAAAGTT
ATGTTAAACTATACTGTAGTCTATTACATGTGCAGTAGCATNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTTCCTTTGCATCACACTGCTAC
TACTACTCAAGAGGCTAGCTTAGCCTCTCAGCTTACGACATGCTTCGTTAACTAAGCTTA
ATCATTTCTAGCTTTTGATTTAAAGTGAGAGATGTGATTCTTCCTTTCACTTGAACACTT
AGAGACCATAGAGGGTGATTAATGGCCTGATTTCAATGTTGTGTTTCAGGGACTAGAGAG
GCCTGAGGAGAGGGAGTGGGGAATAGCAGGTCAGTAGAGCAGTCAGAACACACACTTTTA
TCAGTTAAGTTCTCCATCTTATATGGGTATGGTTTGTGGTTTTCTAAAACAAATATAATA
GTAACATCAAAGATCACCTATTACAGGATCAGCATAACAGATATAATATTGAGCAAATTT
GAGATATTGCAAGAATTACTTAAGTATGAGACAGACACAAAATGAGCACATGCTGTTGGA
AAAATGGTGTCAATAGACTTGCTTAGTTCAGGGTTGCCATAAACCTTTACTTTGTAAAAG
ATGCAGTATCTGCAAAGCACAATAAAATCCATTAAAATGAGGTGTGCCTTTGTAAGATTG
TTCTATTTAATGCAGTATATTTTCTTACAACTTGATATTTCAGAGCAGTAACTCTGGTTC
ATTAATTTCAGTTTAGCTTACAAATAGGTAATTGGAATGAATTTGTAAAGTAAATGATTC
TTACAAGCCAGTTTTTAAATTTATAATATCTACTATTTTTTGTCTTATTGTTGATGGTAG
CTGCTTCTTTTGGAAATCCAAATATGTGATAGATAAATACCAAACTAATTTATGGGCTTG
TAGATCATTATTGCACTTTGAATTTGTCTTGATTTTAATCTAAAGTGAATCTAATATATG
AAGAAAAACACATTTCTGATCTTTATCTTTAAGAAAAATTACTACCAGAATCTTCTCAAC
CTTTGAAAAAAATGGAGAAACAAGAGGCTTATGAAGATGATGTTTCAGAGGAGGAAGGTG
AAAGGAAGGAACGAACAAACGACAAAGACTTTCCACAGAATGCCATGAGACAGCGTTTTG
TGGGTCCTTCATTGACCACAGATAAATCCTAATTTAAAAAAATATTTTATTATGGTTTTG
ATAAAAACAGAAGATCATTTCTTTTGGAGCAAACTGACTGACTTTTACATTGCAAGGTTC
AGTCTAGATTGTCATTAGATTGAACAGTCTATCTTGAGAAAACAAAAGCATTAGGTATAA
AAGTTGAAATATGATTTAAGAACAGTATGGTGTTAAAAATCTGGTGCCAAGCAATAAAAT
TTGAATATTTTTGTTTAATAGACTAGTTTAAGTCTGACTTGAGAATTTACATTTCTTACA
TTTTGCTTTATTGAGGTATTTAAGAAGATGTACTAACGAATTTACGTTAGGGAAAACTAT
TTCATTTGATTTTTTTTTTTTTCAGTTTCACTGTGTGAAAAAAAGAACATTTCCCATAAA
TGGGAATTTTGCCCACTGTCTCAAGAAATGTATATTTCACTGACAACTCTGGTCTTTTCA
GAGATATAGTCCAAAAATTCCCCACATTTTTAGATAATGCAATCAGTAAAAACTACCTTA
ATTGAATTACAATTTTCTATACATGATAAGTAATATAGGATATGCTACTGATTTTGGACA
TTTTTATAAATCTGTGGTACTGTCTTAAATTCCTATAAAGGTTAATTGCCTGTTTTATCC
CTCTCTGTTCATTGTGTAGTTTTTCATTTTCCAAATTTCATAATTTCCTGGAAATTTTCA
TTTTTTGGTATATAGTACTTTTTTCTTAGTTCAAATTAATAAAGTTTACTGAGGGACCCT
TAAAATTGAAATGTCTACAGATAGCTTAAAAGTTTGGCTATTCATCTCAGATTTTATGTC
ATTCTTATAAAACCTCTACTTGTATTCTTTTTATTTTTTATTTGAAGGTGAACATTCTTG
ATTTTTATTTGATGTTGTGGAAAACCCTTGATATTTTACATTTCAAAAATTCACAGAAGC
TTAAATTGATAGAAAAATTTGCATTCTACTCAGGAAGAAGCATCTTACAGTGTGTGTTTT
CAATGTATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 3935..4050, 6690..6735, 8207..8335, 11745..11790, 11884..11985, 12105..12171, 17133..17311
1001..1152, 3935..4050, 6690..6735, 8207..8335, 11745..11790, 11884..11985, 12105..12171, 17133..17308
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved