Dasypus_novemcinctus Locus CNOT1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus CNOT1
Dasypus_novemcinctus
CNOT1
GeneScaffold_1414
SNORA50, SNORA46
64325..64459, 75432..75570
114172
ATTATGGGCAGATTTTAGAACAGGAAGCTGTGGATAAACTCAGCACCTTGTAGTCAAAG
TTACTTTAGGAGTTTCAGTAATAGTTGGTGAGTTCTTAAGAAACTCATTAGTATTTCTTA
AGAAAAAAACCTTTTTTTTTGTATTTGTCTTTTTTTTAAATGAAGACTAAAGGATAGCTA
AAATGGGCTTCTCTTGCTAAATACTCCTAGTGAACAATTTCAATAATGCAGGAAGGAATT
TTATTTCTGAAGTTCTTACCTTCCTTTAAATCAGTCACTCAAACTTGAAGCATACATTCT
GAGGTACAATTTTAAGACCATTACTCTGATTCTGTAACAGCATATGAGGATTAAAGTTAA
CAAATGGGTTCTAGTAAATAGGTTGTAGGTATTTTTGAAAAGTGGAACTTTTAAGTTGGA
TGAGTGTCTCCTAATTTTAATTCTAAGTACTTTGGTGCTAATTCCAAAGAATGCAGTAGA
AATTATTGATTCAAAATTGGGAAATGAGAAATCTCAAATTCATAGGTTATAAATAAAACC
TGCTTATTTAATTTATTTGTTTACTTATTTTGAGGTTTCAGGGATTGAACCTGGGACCTT
GTATATGTGAAGCAGGCGTTCAGCCACTGAGCTACACCTGCTCCCCATTCCTTGTCTAAT
TTAAACATGGCTTCTTTTGTCAAAGGTGGTGGAGATGTCCTAAGTTTGGTTTTTAGTCTT
CAAGTGGCATTTTAGGCCCTAAGGCAGAAAAATGAAAGTTATTTTAAATCTTTTTTTCCC
CTACTTCCACAGACTGACTGGAATTCTGGAATTTTTTTCGTAAACAGGTGCCATGTTTCA
GAACAGAGTAAGACTCCTGGTAAAGAAGAACTGAAGACATTGTACAGACACCAGATATAG
GCTCATTACAGAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGAT
TTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCT
CGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAG
CCAGCCAGCAGGAAATACAACATGTAAGTAAACTAGTCATACAAAACAAGTATGGTTGAA
GTAATGAGTGCTGTGTTTTTTCAAAACTGGTTATATGGGTATGTTCCATGAAAAGTAACT
TTTGCCCTTACTTAAAATGATTTCTCTTCAACTTAATATATAAAAGGCATCTTACCCCAT
TATTATTTAGTATTTACAGAATATGAAATATTACTCTGAATTATGGTCAAGTTTCAACTT
ATTTTTATTAAAATTAGGATGTAATTGATAAATCATAAAATTCATTTGTAATTATATAAT
TCAGTGGCTTTTAGTATATTTATAAATTTATGCAACCATCACCACTATCTAATTCCAGAA
CATTTTTATCACCCCAAAAAGGAATGGCCATATCCATTAGTAGTCATTCTTTGTGCATCT
TTAGCAACCGTAATCTTTTTTTGGTCTCTCTAGCTTGTTGTATTTTGGACATTTCATATA
AATGCAATCATAAGTGGCCTTTTGTATCTGGCTTATTTTACTTAGCATACTCATCACAAG
GTTCATGCACTTTGGGGTGGTTTCTGCCTTTTGGCTAATATGTAAATAATGCTGGTATGA
ACACTGGTATGTAAGTATATGTTCAAGTCCCTTCTTTCAGATCTTTTGGGTATATACCCA
GAAGGGGGATTGCTGGGTCCTATGTTCTGTGTTTAATTTTTTTTTTTTTTTTTTTTTTTA
CTGTTTTTATTCCCCCCCTCCCCCCACCGTTGTCTGTTCTCTCTGTCCATTCGCTGTGTG
TTCTTCTTTGTCTGCTTGCATTCTTGGCAGTACCGGGAATCTGTGTCTTTTTTTGTTGTG
TCATCTTGCTGCATCAGCTCTCCATGTGTACGGTGCCACTTCTGGGCAGGCTTTGCTTTT
TTTGCACAGGGCAGCTTTCTTGAGGGGTGCACTCTTTGTGCGGGCTCCCCTACGCCGGGG
ACACCCCTGCGTGACATGGCACTCCTTGCGCGCATCAGCACTGTGTGTGGGCCAGCTCAC
CACACTGGTCAGGAGGCCCTGGGTTTGAACCCTGGATCTCCTATGTGGTAGGCAGACGCT
CTATCAGTTGAGCCACATCTGCTTCCCATGTGATTAACTTTTTAAGCAACTGCCAAACTG
CACCATTTTACATTCGCACCAATAACATAAAAGCATTCTAATGTCTTTTCATTCTTTGCC
AGTACTTTTCTTTTCCCTCTCTTTTTTTTTAGCGTGGCTGTAGATTTATAGAAAAGTCAT
GCATAAAATACATAAAATACAGAATTCACATATATCAACCTTTTTTTTTAATAAAACTGA
TTTTATTTTATTTTTATTTTTTTGGAGGTACCAGGGATTGAATCTGGGAGCTTATACATG
GGAAGCAGGTGCTCAAACACTGAGCTACACCTGCTCCACTCTGTGTATTGTTAATACCAT
GTATTAGTGTGGTATATTTGTTACAATTCATGAAAAAGAATTATTATAATTGTTCTAAAT
ATAGTCCATTGTTTAGAGTAGGGTTCATTGTGTTGTACAGTCCTGTTTTTTTTTTTTAAT
TTTTAGTAACATTGACCTAAAATTTCCCAGTTTAAGCTCATTCAGATATATAATTCACTC
CTATTAATAACATTCACAATGTTGTGCTCCTATCACCACCATCTATTACCAAAGCTTTAC
AATGAACCCAAATAGAAACTCTGTACAACTCAAGCATTAACTCCCCGTTCCTTACCCCTA
GCCCAGTCTCTGGTAACCTATATTCCAGATTCTGACTCTGTAAGTTTGTTTATTATTCTT
ATTTCTTATCAGTTATATTTGTCCTTTTGTGTCTGGCTTATTTCACTTAACATGTTGTCT
TAAAGGTTCATCCATGTTATTGCACTTACAGAACCTCATCCCTTTTTATGGCTGAATAAT
TTCCCATTGTATGTATACACCACAGTTTGTTGATCCATTCATCAGTTGATGGACACTTGG
GTTGCTTCCATCTTTTGGCAATTGTGAATAATGCTGCTAAGAATATCTGTGTATAAATAC
CTGTTCGAGTCCTTGCTTTCAGCTCCTTTGGGTATATTTTAGAAGTAGGATTTCCAGGTC
ATATAGTAATTCTGTACTCAGTTTCCTGAGAAACTGTCAAATTGTGTTTCACAGCAGCTG
CACCATTTTACATTCTCAAAAGCAATGATAAGTGTTTCTATTTCTCCATATCCTCTCCAA
CACTTGTAATTTTTTAAAATAGCCATTCTACTGGGTGTGAAATGCTATCTTATTGTTTTT
TTTTTTACTATTAAAATTGAAGCTTATTCATACATGAACATCTGTAAACACTAAGTATTG
GGAAGTGGACATGGCTTAAGTGATAGAGTGTCTGCCTACCACATAGGAAGTCTAGGGTTT
GAACCCAGGGCCTCCTGGCCTGTGTGGTGAGCTGGCCCATATGCAGCACTGCCGTGCACA
AGGAGCGCCATGCCACACAGGGGTGTCCCCCGTGTAGGGGAGCCCCACGCGCAAGGAGAT
CCACCCTGCACGAAAAAAGTGCAGCTAACCAGGAGTGGTGCCACACACATGAAGAGCTGA
CGCAGCAAGATGGCACAACAAAAAGAGACACAGATTCCCGGTGCCGCCAAGAATGCAAGT
GAACACAGAAGAACACAGCGAATGGACAAAGAGAGCAGACCCTGGGGAGGGAGGGGTGGG
GAATAAAATCTAAAAAAAACAACAACCAGTAAGTATATAATATAAGTTGTGAACTTAAAA
AGCCAACATGCATACCATCATACAGGGCTCTCCCGTACATTACTTCATCACCAATATTTT
GCATTGTTGTGAAACAATTGTTACAAACTATAAAAGAGCATCCTTCAAACATTGCTACTA
ACTATAGCAAATATCTTGTATTTGGTGTATTTTCCCCCAGCCCACCAGGTTAATGACACC
CTGGATTAGTATTATATACTTGTTTTAGTTCATGAGAAAATGTTCTCATATTTGGTCTGT
TAACCACAGTCCATCTCCCACCACAGGATTCATTGTGTTATTACAGTCCATTCATAGTAC
ACACTCAGAGCTCTCATGTTGATCACAGAATTGTCTTGTCATCACGTCAATCAATTTTTA
GAATGCTTTCATTACTCTAAAAGGAAAAATCCCATAACTTTTTACATCCCTTATTGTTGT
CCCTTAGAATCGGTATATCTTCTTTGCCATTGCTGTAAAAATGTTACAGTACTGCTGTGA
ACTATAATCCATAAGTTATATTAGTTGTAATTTTCACATATATCACCATATATATAACAC
TTTGTAAAGGAAGAGTTTTTTTTTTAAAGGAGGTACCAGGAATTGAACCCAGGACCTTGT
ATATGGGAAGCAGGCGCTCAACCATTTGAGCTACATTCACTCCCAGGAAGAATAGTCTTA
TACTGTTGACACAATCTTCATCTCACACAGCGCGAAAATTACTATGTTATACAGTCTACA
TTATTCTCTAGCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTTTTGATTGGGTGTC
TTTTTGTTGTGAGTGTATAGTCTTTATGTATTCTGATTTAAACCCTTATCAGATATATGG
TTTCCAAATACTTCTATTCTGTAGTTGTCTTTTCACTTTCTTGGTAAAGCACTTGGCACA
GAAGTCTTAAATCTTGACAAAGTCCACTTTATTTTTTATTTGTTGTTCATGCTTTTAATG
TACAGTCTTAAGAAAAATTTTGTATATGGTGTGGGAGTAGAGATCCTTCATTCTTTTGCA
GATGTCTATCCAGTTTTCCCAGAACATTTGTTAAAGAGACTTCCCCATTGAGTGGACTTG
GCACCCTTATCAAAATCAGTTGGCTGTAGACGTACAGACTTACTTTGAAGTCCTTAATTC
TCTTTCATTGGTCTGTAACAATGGACATCTTTACTTGTGCCAATACCACACTGTAAAAAG
TTACTGTAGATTTGTAATAAATTTTGAAATCTCAGAGTGAATGCTCTGACTTCTCTCTCT
CTCATTCAACATGGTTTTGGCTGTTTGGGGCACCTTGCTCTTCCATGTGAATTTGAATAT
GAGATTCTTTGTTTCTGCCTAAAAAGGCTTTTGAAGTTTTGATTGAGATTGTGTTAAGTC
TGTAAATCATTTTGAGTAGTAATTGGCATCTTGATACTGTGTATTTCAGTCCATTGAACA
TGAAATGTTTCCATTTATTTAGGTCTTTAATTTCATTTAGTGATGATTTGTAGTTTGCTG
TGTACAAGTCCTTTATATCTGTGGTTAAATTTATTCCTAGATATTTTTTCTTTAGTTGCT
GTTGTAAATGGAAATGTTTTTCTTGATTTTCCTGTATGTGTCTGTTTTTGGTTTATATAT
TGGTCAAGTTCTCTGTTTCTTTCTTGATCCTATGTTGATATGTTCTTTCCATTTTTGAAA
GCGGTATATTGAATTCATACTATTTATGTAGAACCTTTGGTCTCTTCAAATCTGTTTCCT
TCTTATATTTTGAAACTTTGTGTGCATGTATGTTTTATAACTATTACATCATCTTTTTGG
TGAATTGACCCTTTTATCAATATATGGTATCATTTCTCCCTTTAACCAATTTTTCATTTA
AATTCTGTTTGGTCTCATTCAGATAGCCACCTCTGCTTTCTTTTGGTTACTATTCACATG
AAATATTTTTTTCCCATTCTTTCATTTTCAACCCACTTGTGTCTTTGAATTAAAGGTGAG
TCTGTTGTAAACAGTTTATAGTTGGGTCATGCTTTTCATTTATTCTATTGCCAGTTTGCC
TTGTGATGGAGTGATTAATCCATTTACATTTAAATTAACCACTGATGGGGAGTGGATGTA
GTTCAAGCATCCTGGGTTTGCTTCTGGTTCCTGCTAGGGACAGGGAAACAAGCAACAAGC
AAACAAATGAAGGGGCCAACTCTGTAGAGCAGACAGACGCTTGCTGGTTGGGTGCAGGCT
TTCTATATGTGAGGTCTTAGGTTGAATCCCTGCCTTGTTAACCTCAAAAAAAAAAAAAAA
AATCTAAAGTAACTACTGATAATGGAGAAGTTCTTTCATTTTGCTCTTTGGGATATCTTA
TTTTTATCCCTCAATTTTTTCACTTTCGCTTACTTTTGTGTTTAATTGATCTTTTGTGGA
ATCTCCTCTCATATCTTCTGTGCATATTTTTCAAATTTCTTTCTTTTGTGGTTAACCTAG
GACTTAAATTGAACATCTAAAATCCAAAACTGCTTCGTTTGATTTGATACCAGGTTTAAA
CTTTAAGTAGCATACTACAAGCTATGTTCCTTATAACCCCTCCATCCTCCCTACTGTTAT
TCTTGTCCCAAAATTTTCATCTTAATTCCTTGAGACTAAAAATCGTAGAAATTATAGTTT
TTTTTATGTATTTTTTATTTCTAGATCCTGTGAAAAATTCATAGTGGGAGGTACTAAACC
CACCAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAATGTTTT
CATAGATTTTGGTATCAGGATTATGCTGGCTTCATAAAATCAGTTGGGATATGTTTTATC
TTCTGGTTTTCTGGAATAGTTTGCCCAGAGTTGATATTATTTTTTCATCAACTAATTGTT
AGAAATCACCAATAAAATCAATGTTTCTTAGAATTTCTTTCTTGGAAATGTTTTTTTTTT
TTTAATTGCAAATTCAATATCTTTAATAGCTATAAGATATTCAGATTTTATATTTCTTTC
TGTGTTGATTTTATTAAGTTGTGTTGAAAAGGAATTTGTATATTTTATATGTTGTTAATT
TTTTTTATATAAAGTTGATCACAATATTCCTTCATTATCTATTTAATATATGTAACTCCT
TATTCATAATAGTACTAATTTGTATTTTCTCCCAGTTTTTCTTAGTTTATGTAGGAATTT
ATCTGTTTTATTATTCTTTTCAAAGAAACATTTTTGGAAATGTTACTGTGGTAATATACA
TACAACACAAATTTCCCCATTTCAACCACTATTACATGTACATTTAAGTCATATCAATCA
CATTCACAGTATAGTGCTACCACCACCACCCTTCATTACCACATTTTTTTCATCACCCCA
AACGGAAACTCTATACTCAACAAGCAATAACTACCCATTCCCATCTTACTTCAAGCCACG
TAACCTATGATCCACTCCCTGTCTCTATATATTTGCTTATTCTAGGCATTCTTATATGCA
AAATCATATGATATTTGTCCTTTTTTGTCTGACTATTTGATTCAACAGAATGTCTTCCAG
GTTCATTAGTGTTAATACATTTATCAAAATTTCACTTCTTTTTATGATTGAATAATATTC
CATTGCATGTATAAGCCAAATTTTATCTATTCATCTGTTAATGGACTTTTTTTAAATACT
TATTTTTTATTTCTCTCCCCTTCTTCCCCTACCCCACCCCATTGTCTGCTCTCTGTGTCC
ATTTGCTGTGTGTTCTTCTGTGTCTGCTTGCATTTCTGTCAGTGGCACCTGGAATCTGTG
TCTCTTTTGCTGCCTCATCTTCCTGCATCAGCTCTCTGTGTGTGCAGCGCATTCCTGGGC
AGGCTGCACTTTTTTCTCTACATTTTAACATCTCTGAAATTGGGATGTGACTTATGTCAT
GAGAAGTAGTGTGTCATAGAAAAATGCTGCCAATTAAGCTTGCTTATCGAAATATGAAAT
ATGGTATTACAGTTAAAATTTGATGTCTTTTATTTGAAACATGGTATATACCTTCCACTC
ATAAAAAATAGTTTTGTCTCAAGTATTGTCTTTCAAATTGTAGGTTATGAATTTCGGGAG
TCACACCAGCATTAAAAAGGGATATAGTAGAAATCTAGGGTACAGCTGCATCACTCAAGT
ACTATTTCATCAAACTTGTTTCAGGTACACATAAGTGTGGGTATTGTGTAACAATGTGTG
ATGTATTGTAGGTCTTAGGTGATTTACTAGCTTTGCCACTTGAGTGGGCCAGGAAACCAT
TATTAGTGTTATTAAGGGCAGAGTTTTTGTCAGAGAAGTTAATGAAGGTGACCTTAAAGA
AAAACCAATATGATAATCACAGATAATTATCACCATCTCCAGTGGATGGTAAAGGTGGAA
GAAATTTTCCATCTTTATTTACTACATTTTATTTCTCTTAAAAAGTCTAGCCAAATTATA
TTTTAAGGGCCTAAAAATAGAATACTGTCTACTGATATTAGACATACAAAGATTCTGGAC
AGTTTTCAATACTCAGAGCTGGTTGTTTGGTTGGAAGTAGTGGTAAGAAAGAGAAACAGA
ATAAAGCTGAAGTATGTCTGTGGGAGTTGATGAAAAGGATAATATACATGCAACAATAGT
GAAGAGTGTAATTTTATTTTATAGTGCATAATACATACTTTTGGGGGTGGGGGAGTAGAT
TCACCATAGCTGTAGTAGTCTCTGGGAGGCTTTGGAGGGGGTGGGGCTTGAACTAGGCCT
TTTCTTCCTGTACTTATTTCCTTGTGCTTTAGTTTGAGCTCCTTACCCAACTTCCAGTGA
CCGTCTCTTGAAGGTCATGAGCAATCCATTAATTGCCAAATCATATAATTTATAATTCTT
TGCTCTTGTACACTGAAGGACATGTTCCTCTTTCAATCTCTTCTTCATACTTTCCAAATT
TAAGGATGCATAAGTTACCAATTGTTGCATAACAGATAATCCCCAAAATTAGCTGCTTAA
ACTCCCCACCATTTGTATCTCGCTGTATGTTTGTTTTGTGCTAGTCTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTAGCCACTGGGAACCAAACCTAGAACTTCCCATGTTGTAGGCAGGC
TCCTAACTGCTTGAACCACATCCGCTTCCCCTCTCTAATATGTTTGTATTTATATTTTGT
GTAGTCGGAGTCAAGCAATATGTAGTACCTTTTGAAAGGCCAACTAAGTTTTCATTATAA
CACACGTTAGGTTTCTTCCATCTTGTGGTGCTACCCTCGTCTAGGTCTTGGGAGTCTTAT
TTCAGCTGGTAGATGGTGATGGAACCAGAGAGTCATGAGTAGGTTTTATGGGCCAGGTCT
GGAAGTGGTATGTATGTAATATTTGACCTACATTTCAGTGGCCAGAACTTTAGTGTATAA
TGGCCACACCTGATTTCAGGATAGACTGGGAAATCTAGTCTAGCTGTTTACCTAGGAAGA
AGAAACAGATTTGGTATCTAGTCAGTCTATCATACCTTTATTTCCTGAAACAACCAAACC
AACCCAGTATCTTCTGGGATTGTCTTGGTGATGAAATTCAAAATTGTAAAATATATTCTG
AAAGTACTAGAGAGGAAATCCATAAACTAGGTTCTAATTGCTTCCAGAACACATTCATCG
TGGTCACTAGGTCCCCAAGACTGTCCTTAGGTTTGTGATTTGTTGGGAGCATGCACAGGA
TCCAGCTGTGATTGATTACAGTGAAAAGATACAAAACAAAATCAGCAAAGGGAAAAGATG
CAAGGGGAGAAGGCCAGAGGAAACCAGGTGCAAGCTTCCAAGAGTTCTTTCTCACTGAGT
CACACACTAGGCTTAATTCCTCCAACAGCTGCTTACCAGGGGAAGCTTATTACATACTCA
GTGCCTATGGGAGGTGGGGGTGGGGTGGAGTGGTTAAGTGGGTATCCTCTGTCTAGCATG
AACCAAAATTCCAGACTCCCAGAACAGCAAGTGTTCAGCATAAAACATTGTTTATACAAA
CCATCACAGCCCTTCTCAGGAGTGGTCAGAACCCTCCTGAAACCCAAGTTCTCAGACACT
AACCAAGAGCTAGCCTTGTAAGCAGGCCTTTCTAAGGATAGCAGTCTTCAGGCCTGCTAT
GTTACCTCTACACAGTAGTAAGTGAGATGAACAGCATCCATAGATTGGGATTTTGACAGC
ATAGAGAATTTTGTACTATGCAATATTTACTGATGTAATAATTTGTTTTTCATAGTTAAT
TTTCTTCACATAAAAAAAGTTCAAGTCCCTTCTCCACTCCTTTCATCTAACTTTTCAGAT
GCAGTTATTATTTGTATCCTTCTCTATGAATGTGAACACACATATACACAAAACACTTCT
ATAATTTGCTTCCCCCAATAGATTTTCTAACACCCTAAAAGCGGCTGTATAATATTTCAT
TTTATGATTTACTTAACCTACAGTAACCTATTCGTGGATATTTAGTCTGTTTTCAGTTCA
TATGTCCCCCTTCCCCTTTTTAAAATAGTTTTCTTGAGATACAGTCTTGTACCATACAGT
CTATCCAAGGTGTATAACCAGTGGCTTTTAGTATAATCATAGTGTTATGTATTCATCACC
ACAGAAAATTTTAGAACAATTTCATCACTCCAAAAAGAAAAACTCCACACCCCTGGAGTG
GAGCTGCCACCTCTAAATCCTTTATCCTTCTCCAGTGCTACATAACTACTAATACAATTC
CATCTTTATAAATTGATTGGTATTTACATTTTATATAAATGGAATCATGCAATATGTAGT
ACTTTGTGACTGATTTCTTTCACTTGGCATAATTATTTTTGCTTGATATTAATATCTTTT
AACATTACATTTGTTCAGTTTCAAAGAAAAATTGATATATATGCAGTATTACCCATATTC
ATATTTCACAAGAAGTTTTACTATGAGTCCCATGTTACATATTTTAGTTTTCCTTGTAGT
AATATACGTGACCTTAGACTTTCCCTTTCAACCACTGTGATATGCATATAACAGCACTGC
TAGTTACAATGTGTTGTGCTTTCTCCTTTTCTGTTCATTTCCAAAGATTTACATACAACC
AACCTTTTTACCAATTCTGCACAGTTTAACCCTTAGCCTTCCATTCTCTAACCTCATTCT
ATTTTATGGTGACCCATATTCTAGTTATTAGCTCCATGAGATTACACCATATATTTATTT
TTATTTATTTCTCCCCCTCCCTCATGTTGTCTGCTCTCTTGTATCCATTTGCTGTGTGTT
CTTCTGTGTCTGCTTACATTCTCAGCAGCACTGGGAATCTATGTCTTTTGTTGCATCATC
TTGCTGCGTCAGCTCTCCGTGTGTGCTGCATTATGCCTAGGCAGGCTGCACTTTTTCACA
GTGGCTCTCCTTGCGGGTGCACTCCTTGCGAATGGGGCTCCTCTTCACGGGGGGGGGCAC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATTCTTTTGAATAGAAATTAGGGAGGTATTTCCTGACCCC
TTTTTTTGTGAATGACAACATATGGTATATACTATTTTATATCTCAATTTATTTTTGTAA
CTGTAACTATATATCTTGAAAATATCCCTTCACATATGAAGAATTTCTAGTTGTCCTCTT
TTTTTCTTTTTAATGTTTATTTATGGTAATTTACATACAGCATAACATTTCCTGTTTAAA
TTCTGTATAGTAAACCTTTGCTTGGATGAGCCATAATTTATTTTACTAATCCCCTACTGG
TGGACGTTTAGGTTATTTCTAATTTCTGATTTCTCTTTGGCTTTTAACAGTACTGTTATA
AGATCATTTTTTTATATTTATGTGCTATTACATTTGTAGACTAGATTCCTACATGATTTG
CTTACTTTAAAGATTTACATTTGAAATTTGAAATTATCTGATAGGTTGGAAGGAGCACCT
TAGTATATTTTTAAGTTAAATATTTTATTAAAAGAAATAATTTTTCTGAGGTGCTGGGGG
TTAAACCTGGGACCTCATGTGTGGGAAGCCAAGCTCAACCACTGAGCCACATCAGCTCCC
CTGAGTTGTATATTCGTTTGTTTTTGTTGTTTAGGAGGCACCGGGAACAGAAACTGGGAC
CTCCCATATGGGAAGCAGGAGTCCAATTACTTGATCCACATCTGCTCCCCACTTAAAGTA
TATTTTTTTAATGCCAGTATCATTTTCTCTGGTTAGTCAAAGAGAAGAAGTTCTCTTGTT
ATAGAATCTGTAGTTTTTTTTTTTTTTAGCACCTATCTAATTTGTATTACAGTTAATTTG
GAAATGGCTGTTTTCTACATCATTTTATTACCTTTGAATAAGAAGGATTGGATTTGAATT
AGCCATCTGTTTCCACTATTACTTAGATCCTTATTCTAAAAACAAGTTATATGTAAATAT
TGAGGTTGTTTATGAAGTACACATTTCCTTAGAAATTTGGGGGCAGTGAGAGAGAATTAT
TGACACTTCAAGTGCTGACTTTTATTTTCAATGAAAGTTGTTAAAATGATTACTTGACTT
TTGGCTATGTTTTAAAACAGCATTTTACTGAATAGGTTATCTGAAAGTTGTAGTATGTCC
CAAAATAGTACCCTTGGCCTTGTAATGACTAGGGGCTGGTTATCTTAAAATACTAGACTA
TGGTATTAGGCGTGTTTATATTTTTAGATGTGGGTCTATATTTACTACTTCCTTCCCTCT
CTGGCTTTTCTGATTCTTCCTTTCAACCCCACTTGTTTCTTCTAATATACTTTCAGCTAG
AAGTTATTCAGATTTGAGGTTCTAATAAACTCTGAATTTACTATAATTCAGAGATGTGTT
AAACAAGGATCTTACTTTTCTGGGTTATTTTAGTTGTTTAGATGCCTTTTCTAAAACTTC
CTCTTCGGTTCACAGCTGTTCTGGAGGCTTGCTTACTGGAAATAAGACCTGGATAAGTGT
GTATTTTATCTCTTAACCCACCATTCAGGTTTTTGCATAAATCTACCTAAGCCAGTAACA
GCTCCTCAAGAACTCTAGTGGATAAGAAGCAAATATGTTTTAGCATTTTCATGTGTATGT
GTGTGTAAAATGACTGATACATAAAAGCAATCAGGAAATAAGTGTTCTCCACTTTCTTGC
TTTCCTTTTTCTGTTTGGCTCCCTGGAGGTTCTTCTCTTGTTCTCTATATTGTAGATTTC
CATTGTAGAATTGTTCTTATCTGTTTTCCAAGAATATGATGGCCAGATTTTATTGGCAAA
TGGTTAGTTTTTCACTGAGTATTTCTAGTCCTGAACAGGTTTTGTTTTTTTTTTTAATTT
TTTTAACAAGATATTTTTGATACATATTAATAAAGTGTACAGTCAGTGGTATTTGGTATA
ATCACATAGTTGTACATTCATCACTTCAATCAGTATTAGAGCATGTTCATTATTTCAGTA
ATAATAATATACAAAAAAACAGACAAATAGGAAAATTCTTCTTCTCAATCTCTGTTTCCC
CTGCTGTATATAGTTGATAATTCTGGCTATTTTTGCACATTATTTATTAAGCAGTTTTAT
TGAGATATATTCACATACCATATGATCTATCTAAAGAGTATAATCAGTGACTTTTAGTAT
AAACACAATGCTGAACGGGTTTTTGAATTTTGATCCTTAGAGACTTTTGGATTGCATCAG
TATCAGCTCTTCACTAGTAAATCTGAAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTAGATGTAGAACTTCTGTGTC
AAAGGGTTGTATTTGTACTTTGGTAGATATTTTCAGATTGCTCTGGAGAAGCTCTAAACT
CCCAACAGTGAACAAGGGCACCCAATTAATACCCCGAGTCCTCAAACTCTAGGAATTATT
AAACTCTGTAATCCTTTGCTGTAGTTTTTTTTCCCTTCCTTTTTCCCCTCTCCCTTCCCC
ACCCTGCTGTTTTTGCAGTGTCTGTTTATGTGTGATCTTCTGTATCTATTTTTCTTTTTT
GTCTTCTTCTCGTCTGTCTCCTCTAGGATTCTCTGATATTCAATCCTGGGGACCTCTGAT
GTGGAGAGAGGTTTCCTGTCAATTGTGCCACCTCAGTTCCTGGTCTCTGCTGCACTTCAC
CTTGACCCTGCCCTTTGTCTTTCTTTTGTTGGTTCATCATCTTGCTGGTTACTTATTTGC
ATAGGCACTGGTTCACTGTGCGGACACTCAGCTTGCTGTGCAGGCACTGGCTCACCATGT
GGGCACTTGGCTTGCTACACGGGCACTCGGCTCACTGCATGGACACCCACGCAGGCTCCT
GGCTGACCACACCAGCATGCTTTCTCTTCTTTTTCTCCAGGAGGCCCCAGGGATCGAACC
TGGGTCCTCCAATATGGTAGATGGAGGCTCTATTATCTGAGCCACATCTGCTTCACTGCT
TGTAGCTTTCTGAAATTATTTGTAACTAATGCAAACTAAATGAATGGAATTGTGAAAGTT
TCTTCTCTATACTTTGCATTTTAGATAAGTAATGTGTTTGAACTATAATCATACTGTTTC
ATAAGTATATACATCTTCAAACTTGGGTACCTCTTCTGTTTTGCTTTACTTTCTAATGGA
AAGCTTAATTCTTGGAATCATCTAGCTCCTATGCTCTCTTTTTCTGCAGTACCATTTCTT
TAGGAGATTGCAGTATCAACAGGGGTACGTGCTTATGTAGTTTATTGCATTTAGTTCTGC
TTTGTTTATTAAACCTTAGGCAAAGAGGAATTGTATGTTCTTGTTAATATGCAATCAGGG
ATATCTCTGGTCAGAGGTGTAGAAGTAACATCAGTTATGCTTGATTTCATTGTTTGTACT
AATTCCTTCACTGGTCCTCTTACTACATAACAAAATTTAAGTTCCTCATTTATGTTTCAG
AGCCTTTTTAGCTCCAGTCCTAAATGTTCTTCCTGGGATTTTCATCTTTCAAGAACAATA
TCCAGTGTCTCATTTCCATTGAAAACATACCAAGTTTCCCTTCATTTTTAGAATAAATCC
CAAAAACTGAGTTGGTTAGAATTTTACCTAATAGCAGCTGCAATGTGCTGCCACACATTT
TTTTAAGTCAACTTTTTATTGAAGTCTAATGCACAAAACAGAATATTATATATTCATACA
GTTCACAAACCATAAACCTGCAGATTGATGTTATCACCATCTCAGAAGTGTCCCTTCCAG
TTATTGAACATACCACCTCTGACTCAGCAGTTCCATTTCTAGCTATATACACCAGGACTG
GTGTTCTGGGGCTGGATGTCCACAGAAATGCCTATACATATTCACCCAGAAGCATGTGTG
TGTTGGAATAGCCCTAAACTGAAAAGAACCTAAGTGTCCATCAATAACAGATACTATAAA
GCAGTGAAACTTACATGGCACATTGTGGGTGCATCTACCAATGAAGAGCAAATGTTCTAT
CATTCAGTCAAATTAAGCCTTTGTAATTTTTCATTCTTTTAAAAATTTTAGGGTAGTGGG
TGTAGCTTATTGGTTGAGTGCCAGCTTCCCATGTATGAGGTCTTGGGTTCAATCTCCGGT
AACAACCTAAAAATAAAAATAAAAATTTTGGCTTACATTATGAAAGAAATTGAGTAAAAT
ACAGAAGTTAAAATCATCTGTAGTTTGTCTACTCAGACAACCTTTTAATGTATTTGAGTG
TTCTCCCCGCCCCCCCCCACTCCTTTTTTAAAAGGAGGTCCTGGGAATTGAGCCCGAGAC
CTCATACAGGGGAAGCAAAGCGCTCAACCACTTGAGCTACACCTGCTCCCCATGAGTATT
TTTCTTTTAATAGTATCTAAACAAAATGTTTGTTGCCTTTGTCCTTATTATGTCTCTCTT
AAAATTTTAGAAGTTTTGGATTGTTTGTCCATGGTTACCCACAGTAATGAATTTTGTTGG
TTACTTACAACCCTATGATGTTCTTTCAACGTCTTCCAATAATATGTCATATTGCTTCTC
ATTATTCTTCAGAAACACTGAGTGCCTAAAGCTGCCTCTCTCTCCTTGTCATCCTCCCCT
ACCACCTAATCCATTGTTGGTGATAGACTTTTCCTGCCTGTAACTACTCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGCCATTCCTGGG
CAAGCTGCACTTCTTTTCACGCTGGGCAGCTTTCCTCATGGGCGCACTCCTTGCGAGTGG
AGCTCCCCTACGCGAGAGACACCCTTGCGTGGCACGGCACTCCTTGCGCGCATCAGCATT
GCGCATGGCCCAGCTCCACACGGGTCAAGGAGGCCCAGGGTTTGAACCGCGAGACCTCCC
ATATGGTAGACGGACGCCCTAACCACTAGAGCCAAAGTCCGTTTCCCCCTCTTTTATTTT
AAATGTCTTTTTCCCCTATTTTTGTTATTGCTGCTGTTATATAGCTATACTCTCCTTCTT
TTTCTTTCCCAAGCCTTATCTTCATTTCTTTCTGTTATCTTACCTTTGAACCAATGTTTT
GCATTTTCAGAGAACTTTTTACCCTTAAAAAACAAAAACAATTCCTGTAATTTGTTTGAG
ACGAATGAGTACTATTTATCTGAACTCTTTCTCTGTTTGAGTAAGGCCATTTGAAGCTTG
TTTCTCGCCTATGGTGTTTGTTTCTTCCCTCTGTTTACTTTCTTTCCCCCAAATAGGTCC
TTGGCTGCTCAAGTAAATACCTTGCAGTGGGCTAGCATAAACAATGGGAATTTATTAGCT
CACAATTTTTTGTTGTTTTTTTAATTTTATTTGTAATTTTTATTTACCTCCATATGGCTG
CCTTTTCTGTTTACTCATTGTTGGTGCATTGTTTTCGCTCCTTGTCTGCTCATATGTTTT
TTTTTAGGAGGTACTGGGAACCGAACCTGAGACCTCCCCCATGTGGGAGGTAAGTGCTCA
ACTGCTTGAGCTACATCTTTTCTCTACTCATTTTGTTTTTTTTCCTTGTTTTCTTTGCTC
TACTGTGTGAGCCACAGCTGCTCCCCTAGCTCACAGTTTGAGGCTAACAGAAAGTCCAAA
GCAAGGTGTCATCAAGGTGATGCTTACTTTTCCAGGACTGGTGTTCTGGGGCTGGATGTC
CATAGTCCTTTGTCCTTGGCTCCTCTGTCACATGGCAGTGTACATGGTGGCCTCTTGGCT
TTTCCCTTCTCTTCCTGCTTCCTTGAATTTCATCTTCTGCCTATTCCCTGTAGCCTTCTC
TGTCTGAATTTCATTCCACTTATAAAGGATTTCAGTGATAGGATTAAGACTCATCCCAAG
CCACACCTTATCTGAAGTAACTCATCAAAAAGTGTACTTATGATGGGTTCACACTTACAG
GAATGGATTAAGTTTAAGAACATGTTTTTCTGGGGGTGTATATAGCTCCAAACCATCACA
AGCCCCATGTTGATTCCATGACTTTTTACTGATCTTTGAATGGGCTAGTTATATACTGAC
ACATAAACAGTGTTCAGTGTACATCAGTGTAGGGAGTTATCTCCAGGTAGTATGACATTT
CTCACTCAATTTTTAGATTTGATAATGGTTGTCTTCTCTACTTATTCTGCTTCTCTGCCA
GCATTTGCACTCTCCTTGGCTAGATGGTTAGCTTTACAGACATTAAAAATGGCATCTTGA
GCTTGATTATAGAATTCTTCTCTATTCTTTGCCTCTAAATGGACAGCCTCTTTTCTTTCA
TGGTTCATCCATGTACCCAGACCTCATCCCTTGATAATTATATGTTTAGGGATGTTTTTT
AATCCTAAACATTTTTATTAATTTATAACTGAAATAGAAATTTGTATTTATCCTGTTATC
TGAGGTGGTAGGAATGAGCTCTGCTATATCTCTTGACCACTCTTCTAGAGAGAATGTTTC
ATTGTAGATGGAATTTTAAAAATTTTATTTGGGAGATTAGAATAGAAAAAATGTTTATAT
CCTCCTGTTTAAAAGGTGTAGAATATGTTTAGCTCCTTATTAGAAATTTGGAGACGCTTC
CTTGTTTGTATGGAGCATATGAATTTTTAGATACACAGAATGTATCTTGGACGTTTTCAA
GACCTTTGAGATAATCTGTTAGGCTAAATTTTCTATTTCTTCTTTCTACAAATTTTCTTG
AACTTAAGTGAAAATCCCCATATGGATTTTTTTTTTAAAGATGTTTTTAGGAGCTGGGGA
TAGAGGCACAAATCCTCAGATAATTGCTGCTTTGTCACTATTCCATCCAAAGAAGGATTT
AAAAAGGTATTGAATGAGATTTCTGTTCATGATTATGGTAGTTCGACTGTCTTATAAACT
TAATCATTACCATTTATGGGCAACCATAATGGGAACTTCTTTATAATGAGCTTAAAATCT
CAAACCTTTTTGTTCTCTTTTCTGAATGTTTTCACTATGTATCTTTTCACTGAGTCTTTA
ATCATCCTCCTTTATATATCTTCTCTAGGTCAAATAATGACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGAA
AATTACTTTTAACTTTTCTTACTCTTAAAATGAGAGTGTTTCATGAAAGCTGTGGACATC
AGCGGACTCCTTTGCTATATTATCTGCTCCTAAGTATGTATATATGTACTCTACAAATAC
TTGCTGAGCCACATCTTCCTACTTTTTTGAGGGAGAGGTCTGGTTAGTTGGGGCATAGGT
TATTCTCTTTAATCTGAGTTTAAGCTCTACTTAATCTGAGTTTTATTTAATAGAGATAGT
GTGTTCAGCATTCTAGAGATGGAGTAAATAGTCCCTGCCTTTACAGAACTTAATGAATGA
AATGTAAGAACCAACAAAACCAAACGTGATTAGAGTCACAGTAGTCTTTAGAGATGCAGA
AGTTTTTATTGATTACCTTATACACATTTTAACTTTTAGATATGGGTCAATATAGATTGG
TCTTATCTAACTCCCAATTAATTAAATTTCTTAGCTTTCACATAACTAGCATGATGCAAA
GATCATATGTTTTACGTTTGAGTATGAATCCAGATTCCTCAACTCATAAACTGTTGGATC
GTAGTCTCATGGAATCTGTTTAAGTGTGTGTCTCTTCTTTCTTAAAATGGGGGTAATTGT
TTGCAGGGTTGTTGAAGATTAAACCAAGGAACCTCAGTACTAGCCTAAAGTAGGAAATTA
AGTGTGTACTACTTTTAATATTTTTATGTAGCATTAATATTTACTCTGTACACTGTGCTA
AACTCCTTTCTAGACTAGATATGTAGAAGTGAACATAACCATACAAATTCCCTGTTGTTA
CATAACGTATATAGTCTAGTGAGAGATATAGACAGTAAACATAAATACAGCAGATGGTGG
TAATAAGTGTATGGAGAAAAGTAAAGTGGGCTGAGGGGTGATGATGGAGCAGGTCGTATT
GCTATTTTAGGGAGGGTAGTCACGAAAAGACTCATTGAAAGGTGATTTTAAGCAGGAACC
CAAAAGAAGTGAGAGAACTAACCATGTGCAGATAATCTGGAGCTTTCCGCTTAGAGGGAA
TAGCAAGTACAGGCATTGCTAAGTTTGAGGAATAACAGGGAACTAATGGAGATCAAGGGC
AGCATCTAAAACAGAGGTCAGAGGTAGCTGGTGGCCGGTTCATTTAGGGCCTTTCCTTGT
AATATATTGTAAAGATGTGTTGGCAGAGATTGCAGGTTATATTTTTAGAGTAAAATAATA
TGTAGAAAAAGTGATACTCTTGTGAGTCCAGTTATAAAAATAGTAGAACGTGTTTTTTAA
AACTTTGCCTTCCTACTTTGTGTCATTTTATGCTACTTGGTGTTTTTGGTGTAGATTTGG
TGTTGACTAAAGTATGCAGAGTTATGTGGGCTAATTACTGGTAGTTACTCTTCCACTGTG
TCCTTCCCGTCGATGACTATAGGAAACATTAAAAAAATATTTTATTATAAAATATTAGTA
CCTTCATCTCAGTATTTCCTATACTCGTATTCCAAAATGAGCAATTACTGTAACTTGGGA
TTTTTTCCTAGAAGTTGACTCCCTTCATCACTACCCCCCCCAAATGTTGACTGCAAACTT
ATATTTTTGGTCTTTTTAGATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATT
ACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTT
CCATCAGGTATTTGAGGCTTACGGAGTTTATGTCCACCTAGCTCTAATTGTTCAGTGAAT
TGCATTTTGGGCAAGTGAAACATACAGATAGCATCCAGAAATAATCTTAACTGGGTGGCT
AAAAGGTCTTCTTGCATTTTCCCTTTCTGCCTGGCTGCAGACCATTACTTATGTCTAGTT
CAGGCTTAGAGAGCTGGGGGTTCTGACCTGCCTGAAGGAAGCAGGAATGGGATGTCCTAT
TTGACAAGTAAGTAAGGCAGAGAGAGGGTCTCCTGTCTTGGATTGAGTCTTTTTGGCCTG
ATTCTCAATCTGATAACAGTTTCTCATGATATACTGTCCTTATAGTTGTCCTGCGAGTAG
AAATTATTTTGAGGAGGTTTTATGTTTTAAGACTTGTTGCTAGCTAATAAAACTTTTAGT
AGTTTAAATGGGATTTTTAAACAGCTGACTTTGATAATGTAGAAATAACATATACAGTAT
TAGGTAACCCTTTAATGTTCTGAACACCTCTCCTTTTATATGTGCAAGAAGATTATTTTG
TCAGTGCTAATGAAAATTCCTTTTTCATTCTTAAAGACTCAGTTTCTGATTCAGGAGTGT
GCATCGCTGATTACAAAGCCAAATTTTATCTCAACGCTATCCTATGCCATTGATAATCCA
TTGCACTATCAGAAGGTTGGTATTAATATTTTTAGCATTCCTAAGAATATAATCTCATAT
TATTCATTCAAAAAAGGCCATAAACCTTGCTCTCATAAGGCCTTGTCTTTATTTTTAAAT
TTCAAGTAGTTACTTTGGGCTTTCATTGTAGTTTTCTAACAAAATCCAGGCAGTTGGTTT
GATGATAAATGGAATCTTACTAAAGCCAGAAGATGTGAAGGTGTAAACTTTATTATTATT
ATGACGGGGTTAGTTCATAGGATTTTAGTCCACAGTTCTAGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTG
TAGTGTGGAAATGACTTGGGTTTTCGGTTTGCCTGACTTCTAGCTGCTCAGTTTATCAAA
CAGAAGCTTCCTGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAA
GGTGGCTTCCAAGATATAGCAATAGAGGTCCTACACCTTCTCCTGTCCCATCTCCTCTTT
GGGCAGAAGGGAGCCTTTGGAGTTGGGCAGGAACAGATAGACGCTTTTCTTAAGACACTG
CGCAGAGGTAAGAGAGTCTTTGTACCTTACAAAAGATAATTTCTTTGGATGATCAAAAAC
GTAACAAAAGCATTTTGGGTATAAGTGAAAACAGGGATTTACATTTACCATCCTTCTTTA
TTTTTATTATTTATTTTTGTCTTTTTCTGTGTTTTTTTTTTCTTTCATCCTTATGTTGAT
AATCTTTTTGGGGTAGAGAGTGCTTTTTAAATTTAAAAGTTGAAAGTAATACAGCCTCAG
TAGAAAGGTACAAAATGAACACAACTTCACTAATAATTTTGTGAATAAATTCAGTCATAG
TTAAGACATGGTACTTTCCCATGCATTCTTTATTCCTCTTAGTGTGACTACATATGTAGT
GACATGCTGTTTTCGTTTTTTAAAATTTTAAGTAATTTTTCTGTATTGGTCAGTTTTGGT
ATACTCACTTTGCCTGTTTGGCATTTTGCTATTGTTATGCTAAGATGCTAAGATAATTCC
TGGGTCTAATGTTGTTTTTCTTTTTCTAATGTTGTTATTCTTTGTTTCTCTGATCCTTCT
TTTAGAGAGATAAGTATTTCTTTAAAAAAAAAAGTCTTGATAGTGGGCTAACATCCTTCC
TGGTTTGCCTTTTTTTTTTTTAAGATTTATTTATTTACTCCGGGCGCCCCCCCCCCTCTG
TTCTCTATGTCCATTCGCTGTGTGTTCTTCTGTGTCTGCTTGTATTCTCATCAGGCAGCA
CTTGGGAATCTGTGTCTCTGTGTTGCGTCATCTTGCTATGTCAGCTCTCGGTGTGTGGCA
CCACTCCTGAGCGGGCTGTGGTTTAGCGCAGGGTGGCTCTCCTTGCGCAGGCGCCACTCC
TTGTGTGGGGGGCACCCTTACGTGGGGGCATCCCTGCATGGGCTGGAACTCCTCGTGGGC
CGGCATTCCTTGTGGGCAGCAGCACTGCATGTGGGCCAGCTCACCACATGAGCCAGGAGG
CCTTTGGACCTCCTATATGGTAGGCGGATGCTCTGTTGTATCTGTTGAGCCACATCTGCT
TCCCACCTGATTTTTTTTGTTGTTGCTTTTTTTCTTTCCTCCTATTGCTTATGTAGTTTT
AAATTTTTAAACTGCTTTTACTTTTTCAGTGATAGGAAATTTTCCACTAGTCAGTGAAAT
AGACTGATATTCGAGTGTTTGCGTTTCTGAATTGATAGTTAACCCTATTGAGAAAATTTA
AAGTAATATTTGGGTTGTGACTTGGTCAGTAGGTACCGGAATCCCAATGTGAAAAATAAA
AGTATTCATGAGAAATTTTTGCGATATGAAAGTATTCAAAATTTGAAATTAGTGTTGAAG
TCATAGCTTAGGCTAGTTAGGTTGAAAAAAACTAAACTTTGCATTGAATTATGAACTTTT
TAAGTATCAAGTTTGAAGGATTTAAGGAGAGAAAAAGAGGATTGTTTGCATTTAATCAGT
ATGCAAGTTGTAATTTGTTCCTTCTTCCTCCCTCAGATTTTCCTCAGGAACGCTGTCCTG
TGGTGCTTGCACCACTTTTATATCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGC
CTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTCTGGCTGATTTCATGCAAG
AAGTAGGCTATGGCTTTTGTGCGAGGTTAGTAGTAAGACATTAAACTTCTGATTAGTCTC
GTGGGAAGCACGATGTGATTAAAGCAAGTTCCTAAGAATCCTTAATGTTGTATCTATCAT
CTTTTAACTTTAGCATGTTTGCTTTCTAAAATATCTTCCACATACTAATTTTGATGGCTA
CATTTATTACTTTGTCCACGCTCCTCATCCAGTTTCTCAATCTTAGCACTCAAAACAATT
TCAGAGGTTTTAAACTAGTTGCCAGGACAGGTTCTTATTTTTTTTTTTTAGTTTTTGGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTTTAT
AAAACCCCTTGTAGAAACCATATTTCCTCTTTTGATTGAAACTGTATTGTTTTGTGTGCC
TGGCATAAAACTTTTGCTTAATTAACTTTGAAATGCAAACTGAAAAAGTTAGCTGCATTT
TCAAGGCTTTGTACCTATCAGAATAATCAAACTCACCTCAAATTTCAGTGTTTTGATTTA
TGCTGAAGATTGAGGAGAGTAATTTTGCAGGTCTTGGGAAAGAAACCATTACTCTTCGAT
TCATGTTTTCTTATACTGAATATTTAAAGGTTTTCTATTTTCTTAGTGGATATTTTTTGC
AATCCTTAATAATGGAACTTATTACTAGGCTTTTAATAAACGAACTTTAGGGATTTCACA
TAAGGGCTCATTTTATACAGGCAGTTTAAAATCTTGGTATTGAGGGAAGTAGCAATTTTT
AAATTGTGTGTTTTTTTCAGTATTGAAGAATGTCGCAATATAATCATGCAGTTTGGTGTT
CGGGAGGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCA
GGATTAACAGATGGTATTCCATTACAGGCAAGTGTGTAGACTTCAGGCATTTTACGAAGT
GAGTTAATGGTCCTGTGTTAGTTTTTTCTTTTTAAAAATTACAATATGATACATTGTTTT
ACCAGCCAGAGGTGAGCACATTGTTTAATTCAAGTTTTACCTCTGCAGAGTATCTCTGCT
CCTGGCAGTGGGATCTGGAGTGATGGAAAGGATAAAAGTGATGGAGCACAGGCACACACG
TGGAATGTAGAAGTGTTGATTGATGTTCTTAAAGAACTGGTGAGTATGTGTGGTCATGGT
TTTTGATTGACTGCAATATTATGCTGTAGCCCAAAGAAAGAATTTTAATGAATAAAATGC
CCACCTGAATGAGAGCAAAAATAACAACCAAAAAACAGTAACGTGTCCAATATATTTTGG
TCCTGGAAACAGTATGTAATCAAATTCAGGTTTTGTTCATTAGTGCTTGTTCCCGTTCAA
TTCAGAACCAGCGCACTACTGGACTGAATTGGTGAGTTCTTTTGGGGACTAATTTGTTAG
AAAGTAATGATTGCATGAAGAATTGTGAATAGGAATATTAAATCCACACTTACTTTTCTA
CTTCCAGGTTATCTACAGTCTAAATAATTGGATCCCAAATAAAGTACTGCCTAAAATGTT
GAAACAGTTAAAAAAAAAAAAAGAATGAAATATTGAGACATTGGAAGGGAGTAATGAAAT
TTAGTCAGTGGGAGAATCGTGTAATCCAGGCTTAATGCTGTCAATCTTGTTAATAAAATG
TCGAGAAACAAAATGTGACATTTGGGTACAGAATATACACACACACAAACACACACAATT
CTTTGAGATGCCTAGATCATTTATCTTGTTTCTCATCTTCAGTTTTCCACATTTGCAGTT
TATAAGAAAAATCTGGTTACAGAGAATCAGGCTATTCTCTGCATCCAGCGTTAATGAGTT
TTCTTTTTACTTTTAATAATTGATGGGTTTTCAGTGTTCAAGCTATTCTTTCGTAATAGA
AATAAAAGAATATAGGGTCATTGCAGAAAACTTGGAATAATGGAAGAAAGAAAAAACAGA
ATAAAACCACAGTTTCATCACGTACAGGAAACCATTTAATTGTTTTTATCCTTGTGGTTA
TTTTGGAAAAGTGGAAAAAATGCCTTTTTCATTCAGTAGTTCTGTTTTTGTGCTTTATTG
CCCTATTTTAAAAACTTCTTTTAAAAATTACTAAGTACAGTTTTCCACATTATTTGGAGT
CTTATTTTGTTCCTGGTTTCAGAGAGAAAGAATTGACATGTAAATTTAAAGCCCGATAAC
TATAGGTTGAACAATGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTTCTGTACATTTTTTGTGGGCAGGAACCAGAATTTTGGATAC
ACGTGGGGTCCATTGTTTGGTTTGTTCATTGCCCAAAGGGGGAACCTCATGGGCATGTTT
GTGAATTTATCAAACTTGTCTCCATCTAGATAGTATTATTTAACTGTACATTTATGGTAC
TGTTGAAGCCAGTCCTCAAAACAAATAAAAATTTTATATATTTTTTCTGAAGAGAAAACA
CTGAAAATAATGCAGAGATGAAAAAAGCTACTCATAACCCCTATCTGTTTTTTGAGACAT
CTACTCTTTCTCCCCCAAATTGGGCTCATTCTAGACCCTTGCTACTTAAAAGTTTAGTCC
CTGGTCAAGCAGTATTGACATTACTTTCATCACTTGTGACAAATGTGTCACACCAATGCA
AGGTGTTAATAATAGGGTGTTATATGGGAATCTTTTATTTTATAAATGATTGTTCTGTAA
ATTCATAGCTTCTCTAATTAAAAAAATAGAATTAATGCATCTATCAGGATGCTTCTAAGG
TTATCTTTAATTTAGTTAATTAAAAAATGGTGTTTGGGAAGTGGATGTTGCTCAACTGAT
AAGAGCATCCGCCTACCATGTGGAGGGTCCAGGGTTCTATACCCAGGGCCTCCTGACCTG
TGTGGTGACCTGCCCCATGCACAAGGAGTGCCATGCGATGCAGGGGTGCCCCTGTGTAGG
GGAGTCCGACACACAAGGAGTGTGCCTGGCAAGGAGAGCCGTCCCGCATGAGAAAAGCGT
AGCCCGCCCAGGAATGGCACTGCACACACAGATTGCTGACTCAGCAAGATGATGCAACAG
AGACAGTTTCTCAGTGCTGCCTGATAATACAAGTGGACACGGAGGAACACACAACGAATG
GCCACAGAGCAGACAACGGGAGGTGGGGGAGAGGAAGGGAGAGAAATAAAATAAACCCTT
AAAAAAAAAAAGACAAAAAAAAAATGGTGTTTGGGTTGATTTGTCTTTACCACTTTATTC
CAAAAATGATAGAATCTTAGTGTAAAAAGAAGTGCCAAGTGAAGAGCTGTTTATTTGACA
GATTGTTATGGGAACTATAGTTAGATAAAAAGAAGTGCTCCCCTTACATACTCACAAGTG
CAAAAGGATGACATGAACTCAAAAGGTTGGAATATCTTGTTCGTAAAGCCCTTTTATCCT
GAATATTATGAATAGACTTATCTCTTTCAAAAAGCCAGAAAGATTAAGACGATACGACCA
CCTTGATTGAGTTACTGGTTTAATTTGGCTCTTCGTATAAAAGCATCAAAACATGCACAT
TTTTGTTTGTTCATTAAACTTTGACATGCTTATTTCCTTTTTAGAACCCGAGTTTGAATT
TCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGATAGTAAAGGAC
TTCATAATGTGGTTTATGGCATTCAGAGGGGTTTGGGTATGGAAGTATTCCCAGTTGACC
TCATATATAGACCTTGGAAACATGCAGAAGGCCAGGTAAGCGAATGGTGTTAAGCTGTAG
ATGGGATGCAGAGTAACTACTTATGTATAGTGCCATCTACCGAATGATTGAAATATTCTT
TTTGAATGGAGTTTGTTTTGCATAGCTCAGCAAAGCAGGTACTGTCAAAAATATTTAAGG
ACTGTTACTACAATTTTAATACCAGACAGACTCAGTTGAGATTCAGAAATCAACTTGTTT
TCTCCCAGTAATTTAATGATGTTTGTCTCAAGGCCATCTCATGCACTTTTCACCTTGTCT
GAATTATCTGTAGAGTTTGAAAGGACAAAGAAATAAGATTTAAAGAGAAAATTTCATTCT
TATATCCTTAAGAATGAAATGAGCCCGAGCCTAATAAAAATATTTCAAGTTTAAAGCATT
TGTAATCACATGTAGTGGTAAGGACATTTCTTCTCTTGTTCCAGCTCTCCTTCATTCAGC
ATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATTCTGTTGCCA
CTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCTACCTGGTAAACAC
TCTCATCTAGCTTTTCTTTTTATGGTCACTTTTGCTTTTTTTAGAATATAAAGTTTATAG
TGAGCAAATATATAGTTAAGAGATTTAAATGAGTTAATATATTTAGTGAGCTTTGTTTTT
AGGTATATTGTTGAAAAGCCTCACTTTTTTTTCTCTTTGAATTATGTTTTGATTCATATA
TGAGATCTTGTCATAAGTGATGCTAAGTATTGTTTTTATATAGGGGTGTTGGTAATAAAA
ATCTTTTTAATGTCCTTATCATCACTAGACAGTTACATCATAAAGGTGTCACTAGGTATT
TTCATAAAGCTTCAGGAATTTATAATTATCAAATGTTGGAAGGAGGTTCATATGGTTTCC
TTAGTGTTAAAATTCCTTTCTTCTTTCTGTAGGTTTGCTTGTGTTCTTTTAAGTGACTCA
GGTTGGCCAACCCATCTATTCTAATACTTTCAGCTAAATTATCCAGTTTCTCTGAGTTCC
AGTTTTTAATTTCTGAGGTACAGTCTGACCTCGGACCAGTGTCTAGATTAGGTTTCTCTT
GGAACTCTCTGTCCAGTCATACAGTTCTCTGGGGATGTAAAGTAAGGATGGTGAAAGTAC
GTACGTTATTGTTGTAATACACACATGGCTAGAGGGAGGGCATGGGCTAGATGGGTCCCT
AAAGGGCATCTACTTTATAACATCTCTGATGGGCTTAACGTTTTAAGATTTGTGAGCCAG
AAAATCTTTGTAGCAACTCTTCATTGTAGCATGATAGATAATATATGGTTGTTGCTCTCC
TGCAACAAAACTTTATACCAAAATGAGCCTTGGGGCAGGTTTGGCCTTTGGGATGTAGTT
TGCAGACCCCTGTTCTAAAAGATTGACTCAACCAGTAATTCATTCTAATGTATGTCCTTT
TCCCAGTTGCTAGCCAGTATTGGATTTGCAGACTTCTTTGCTTTCTTAATGACATCATAT
TTAACAGTTCCTTAAAATAGCTAGTAGTATACATTTAAGTTTCTCTAATTGTCTCAAAAA
TGTCTTAACAATTGGTATGCTGAGGATCCACACAGGTCCACATAGTTTTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGAGAAAATAAGATCATTTGTCCTCTA
CCCCACATTATGTGTTGTTTAGTGTGGTGTTTAATTTGTCCTTTTTCATGGACTGAGGAT
ACAGTTATATCTTGAGACTTGATTAAAGTTACCAGGCTCCACGTGGTGCAAGAATAATTC
ATGAGGGGTTGCTGAGAACTTCCTCTCACGTCACATGTGGGGTCACCTAAGTTTCAACTT
TCCATTACCAAAGTACATGCTTGGGTAGTGTTTTTCTTGTGTGTACATTATGTTTTCTAT
GTGTGTATTTTGGATTTTTGACTATTTGTAAATTCTGATGTTGTTTGTTTCTAGTTTTCT
TTCCAGTAACAGAGAATATTGATTATTTCTTTGGTTAGGAGCATCATGATTATGCAAACT
TGAAATGGTTTCACCTTCTCCATCAGTTATTCTCTGTTATTTTGGACTGCCTTTGAAATT
ATGTATCTATATTTTAGTAGGTACTGGGGATTGAACCTGGAACCTCATGCAGGTCTGCTC
AAGCACTGAGTTACTTGGCCCCCTCCAGCATATGTTTTTGAAATGAGTGTCAGTACCAGT
TTAACCAAAAGTTTAAGTTATTAAAAAATCTTTAAAATTTTGAAATATTAAAAAGTTGTA
AGCTGCTTTTTTGAGGGGGCACTCTTGGTTTTGTCCTAACTGGCATGACTCATGGAAAAT
TTTGTGTACTTGAACTTTGACTGATAGAGCGTCTTACTTCCATTCTTGTTAGGAAGAGCT
TGGATCTGATTGAATCTCTGCTGAGACTTGCAGAGGTGGGGCAGTATGAGCAAGTCAAAC
AACTCTTCAGCTTCCCTATCAAACACTGTCCAGACATGCTGGTATTGGCCTTACTACAAA
TCAACACCTCCTGGCACACCTTGCGCCATGAACTCATTTCTACTCTGATGCCAATTTTCC
TCGGAAACCATCCTAATTCTGCTATTATTTTGCACTATGCATGGCACGGGCAGGTAAGAT
GTGACTATTTCCTCCTCATCATTTCTTCATTTAAATAATTGACATTCTTTGGAATATTTA
GGACATTAACTAGAGAAATTTACTGTAAATCTTTGAATTATAACTGTACTAGTCAGCCAA
AGGGGTGCTGATGCAAAGTACCAAAGCTAAAGGGTATTTATTTGGGGTAGAAGCTTACAG
TAATAAGACCCTAAAGAGTCAACTTAAAAGTACCGTAAGAGGTACTTTCTTGTAAAGTCT
GTTCCTACGTGTTGATGCAAGATGGCTGTTGACGTGTGTGAGGGTTCAGCCTCCCTTCTT
TCTCTTAAGACTCAGTGGTCCCAGCTTCTTCTGATCTGACCTATAGGCTGGCATAAATCT
TGTCTCTCTTCCAGGACTAGTTTCTTTCCGGACTCAGCTGCTCTGGTCCCTTCATAGGTT
AGCTGTAGACTGTCAGGCTCATCTCTCTTCCCAGAGCCTCTGCCATGTTTACTTGAGCTA
TCTGTTTTCCTCTGTGTTCTTCTCTGTGTATCTCCTTCCATGTGAGAGTCTGTTTTATCA
GCCCACCAAGGGGGGCAGGACTCAACCCTGAGTCACACTCTAATGACACGGTAGAATCAA
AGCCCTAATCTTAACATAATTTATTTAGACATCTCAGTTGAATCTAATACAATCAAATGG
TTATCACACCCAGAGGAACAGACCAGTTTACAAACAATCTTTCTTTTCTTTTTGGAATTC
ATAAATAATCTCAAACTGCCAGAGTAACTTTCTAGAAATGTTACGCTCATGAAACTTGCT
TTATATTTTAGGGGTATATAAGCATTAAAGTATAAAACATCAAAAAACAGGGAAGCAAGA
GCGAGTTTTTAAAAAATAAAATTATGAAAGCTCTCTATGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGCTAGTAGCTTAGATGCCATTTCTC
CTGTTCAGGTAAATTAAAACTACAGTTGATACATTTGCTTTTGTTCATAGTCTTGGAATA
GACTAAACTTCTTAATCATCATTAGTAATCTCTCAAAAGGAAAAACTGTCTGGTTTATTA
CATCCTAGATAACTGCATGAATAGTACCCACTTACATTTCAAAGGTCATCCATAAATAGC
CATTGTAGTTAAGAATAGATTCTAATTATTAAATAGAAAATGATTATGAGAGCCAAATTA
GAAAACAACTATATTAGGTAAATAGGGTTTCTTTTTAAACTAAGAATTACTTAGACTCAA
GCTGTAAGCACTGCCTTTGAATCTAATATGTCTTGTTTGTAGCTTCTCAGCCAAGCAACA
GTACTAGAGCATAAGGACTTGTTATAACTGGGGCTCCTCAGCTCTCAGCTGAACTGCAGT
TTTAAAAATGAGGTGCATTTAAGATACTCCTCACATTGACCCCACCCCCTTCTTTCTGGG
AGCAACATAACATACTCCTATTTTCAGCTACGTTGAATGATAGATTACGACTTAAGAAAG
AGGCACTAGGTAGTTCTTCAGTGGCCACTTTATAAAAGGCATTTGGTTTATTTTCTCTCG
CCAGGAAGGTGTGAAGCAGTGCCATAAACTAAAAAGTTTAGAAAGATATCACTTGGTAAA
TACGTTTTTTACAAAGTCTCTTGGTGACTGACATACACTGGTTTTGTTTGTTTAATTAGA
ACCCAGTCCCCAAAGTTCTCACATTTTGATCATTTTGGTTTTTTGGACTGGAAAATTTAT
TTCTGATTCCTAATGTTTTTATTGTGTTGAATATTACATAACTTGAGAGATTCTTTTTGC
TTTAAAAAGGGACTAGAAAACTGCAAGGACCTAATGTAATAATTGCCCTTTTTCACTTAA
CTAGATGTTTAGTACTACTCCAGCTGCAGGGCAGTTTATCCAGTGTATTTTCTTGCAAGT
TTTATAGCCTTCATTTTATGGCTCTCTAGTACTTTGTCAGGGGCTGAATGAGTCTTTAAA
CCTCTTCTGATTATGACAGTAAGAACAGTTACTGGCATAGTCAGTGTAATATGATGTAAG
TATCACAGTTGTGTCAGGTGTTGCAATTTGCTTATAAATTGCTGTTGCAAAAGATTGCTT
TACCTGTGTCGTCTGCCTTTGCTTACATATGTTTAATATATTTTTATAATGCTTTTCTTT
AGATTGACCCCCTTGCTGGAATGGCATCTCTCAATATAGGTGGTTCAGCTGCCCCCCATA
CCCAGAGTATGCAGGGTTTTCCTCCAAATTTGGGTTCTGCCTTCAGTACCCCCCAATCAC
CAGCAAAAGCATTTCCACCACTTTCTACCCCAAATCAGACAACTGCATTCAGTGGTATTG
GAGGACTTTCATCACAGCTTCCAGGTAAGTGTGGGGATGGAGTTCTGTAATTTTCCTTGT
GCCTTATTGTATAATAAGGCCTTCAGAGCCATTGTGATAAAGATAACTGCTTAAATTAAA
TAGTGGGGAAGCACATGTGGCTCAACTGATAGAGCATCCGTCTACTGTATGAAGTGTCCA
GGGTTCGATCCCCAGGGCCTCCTGACCCACGTGGTGGGCTGGCCCATGCACAGTACTGCT
GCCATGCACCAGGAGTGCCATGCCATGCAGGGGTGTCCCCACGTGGGGGTCTCCCACATG
CAGGGGGTGTGCCCTGCAGGGAGAGCTGCCCTGCATGGAAAAAGTGCAGCCCACCCAGGA
ACGGCGCTGCGCATGCGGAGAGCTGACACAGCAAGATGATGAGGCAGAGGGGAGACGTGG
TGTCCCAGTGCTGCAAGGTGCAGGTGGACGCAGAGGAGCACACAGTGAATAGACAGAGCA
GGCAGCAGGGGGAAAGGGGAGAGGAATAAATGAAATAAATCTTTAAAATAAAAAAATTAA
ATTTAATTAAAAAAATAAAATAGTGTATGCTTGCAAAAGCTCTTTCAACATACAAAGTTG
GTAAGAGAAAAATATACAACTGTTACTTTTAGTTCAGTCTAACTGGAATAAAGAATTAGG
ATATTGATAGTTTAAAAATTGGCTTTTTAAAGTAAGGTTCCTGAGTCACTAGATGATAAT
ATAAAGAGGAACAAGTATCTTAATCTCATATTTTAAAGGGCTTGGATCAAGAACTAACAG
CTTTATGAATTATTTAAGATTAGTGTAATAAAGGCAGAAAATACCACACGTATCAGATTC
AGGCCTGTGTTCTGCCTCATTGCCCTTCACCTACTTTGAAAATGATAGTAAATTCCTAGA
ACTTTTTAAATCTTTTCAGATATTTTGACTTTTAACTTTACACCGAAGTAAAGGTTACAT
TTTGGTGCTTGTAATCACTTACCTTAGCCATCTGTAAAAAAATCAATAGAGTATTAAGCT
AGGTCCTGAAACCGAAGGACTGAAATGTTGTCATGACCTGCTTAACACTGCTGCTGTGTG
TACCTAGCCTTGATGGTTAATTAATTTAAGTCAGAGTTACTGTCCTTATTAAGACCTTCC
ATAGTAAGATTCTGTTTGCTAGAGTTGAGGGGAATAAAGTCCTCGCTCATGACAAGATAG
AAGCATTGAACCAGTTTTAGTCATTGAAAGGAGGAGGTCAGCCTCTCTTATTTTTGACTA
CCTTGCAATATAGTGGTGTGTACTTAAAGAATTTACACCTTAACAATTTTGCATATTAAT
AACAGCAAAAATATACAATAATAAAACAACTGTAAACTAAGAAATATTGGCATTTTCCAT
TTTTTACTCCTACTAGTTTAGATTCTTTATAAAATCAAATAGACATTAATGGAGTTAACA
AAGACCCTGACTTTAAAATTAGAATTTATATCTGAGATGTGAATAAAATTAATTATATAA
GTAATGATAAGTCTTTTGGCTGCCTTCGTTCTAACAAGTGGTCTTGGCACAGGCAGCCTG
ACTGGTTTAGGATCTGGAGCTCTTGGACTCCCTGCAGTGAATAACGACCCTTTTGTACAG
AGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCT
TGTAAGTGGTAGTGTTGTCTGTGATTGTGAAGTGTGATTGATGCACCTAAAATTTTTTTT
GATTGTGTGTCCTTTGTTTGTGTCCCTAGATTATGATCATCATAAAGTAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAGACTAGTGAACTTC
CATAGTAATTAAGTTCTGATGAAAAAAATATGTAAGGCAATTAATGCTAAAAATCTTTTC
TGTCTAGCCCAGAGCATTTTCATGTTGAAACTTGAACATTTAATACTTTCTTCAATTTTT
GTGTTTTTTTCCCCTAAAGATAAATTATATTGGTTTCTGGTTTTCTGTGTGTTTTATGAG
GGAGTGTACAAAGGGCTTTAAATGCCTACTGGGTACTTTTCTGTTTCCAACAGCGGACTT
GTCTCAGGTGTGGCCAGAGGCAAATCAGCACTTTAGTAAAGAGATTGATGATGAAGCAAA
CAGCTATTTCCAGCGAATATATAATCACCCACCACATCCAACCATGTCTGTTGATGAGGT
GAGTGACTAGGGTGATGTTATTTATTCATGGTTTAGGCAAATTGCAAATTTATTTTTTAG
GTTTTTAGAAATTCAGCTCAAAGCATTTTTGCTGTCTTTGAATTTCTTAAAACCTTACAA
TTGTCTCAAATTGAAGTCATTCAGGAAGCACGGATTATTAAATCTTTGTTCAAACAAGTT
TTCTATTAACTTTGAGGAAGACTCTTACTCTAATAGTTTATGTGTGTTTTGTTTTGTTCT
TGCTTTTTTCAGGTATTAGAAATGCTTCAGAGGTTTAAAGACTCTACTATAAAGAGGGAA
CGAGAAGTATTTAACTGTATGTTGAGGAACTTGTTTGAAGAATATCGTTTTTTCCCCCAG
TACCCAGATAAAGAGCTACATATAACAGCCTGCCTATTTGGTGGGATAATTGAAAAAGGA
CTGGTTACTTACATGGCACTAGGTCTGGCCCTGCGGTATGTTCTTGAAGCTTTACGCAAA
CCTTTTGGATCCAAAATGTATTATTTCGGAATTGCTGCACTAGATAGATTTAAAAATAGG
TGAGTAGAATTTTGACAGATTCATGGTTGTGTTACTACCACCACAATCAAGATTCTGTAT
ATTTCTATCACCCCCAAGGAGTTTTCCTGTTCCCTTTGTCAATCCCTTTTCTCTGCCCCC
AATCCCTGGCAGTCATGGATCTGATTTGTCCCTGTAGATTTACTTTTTCCTGAGGGTCAT
ATGAATGGAATCATATGTAGCCTTTTGAGTCTGACTACTTTCACTTACCATGATACTTTT
GAGATATCCATGTTACTGCATGTTCAGTAGTTATTTACTGGGTAGTAGTTCATTGTATGA
ATTAGCTACAAACTATTGGTCCATTCATCTCTTGATGAATATTTAGAGTTGTTTCTGCAT
AGCAGTTTTAATGAGACCTTGAAATCTAATTTTAAGCAAAAGCAATGTTTTCTAATATAA
TGGACTACAGTTTTTAAGTATTGTCCCCTCTATTACTGTGTTTTTCTTTTGGCATTCTCT
TCAAATAAGGTGTTTGGTAAGTAGAATGTGGGGGAAATGGCCTTGACTAGCATATGGAAG
AAAGTTTTTGTTAATAGTGCTGCTTCTGCTCTTATGTAAAATTGTGAATGAATGGTTTTG
TTGGCAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCCTCTATCAATCACTTTA
TGCAATTTCCACATCATTTACAGGAGGTAAGTGCCTTCAGTATTTTTAAAAATCCTGTCT
AGTAGTTTGAGGGTTTCTCTAATGGAAAGATTACTAATGTTTTTGAGTGTTTATCTTAGT
ATTATGTCATTAAGATTTCTTAATGATTCAGATACTTATTACTTATTGGTCAGTTTATAT
AGAAGAGCAGTACAGCGTTAAAGAAGTTTTCATTCTTGAATAAACTTTTTGGATCGGTTT
TCTTTGATTTAATAGACATTTCTTTTCATGATTATTAAAGAAATCATTTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATCATTTTAAAATTAATTATGTTTAGA
TAGCTGTCTTTACTGTACTAAGGGAATCTTTATGCTGTATCATCTAAACCCTTCCTTATT
CTAAAAAGAATTTGGAGTGGGAATCTGGGTATAATCAGTATAATTGTTCCGTTGCCTTAA
ATACTAATACAATTCAAAGCTATTATATACCTTAAGACTTAGATTGTTCCGTAATAGTAC
AGCTCCCTTACACCTTCTTAGATTCCTTTGAAGGAGCTAAAACGGCAGTTCCTTCAGGGA
ATGGACCTAGGGAATCTACATTTTTTCCATCTCTTTGGGTGATTATTATTGTTCTTGAAA
TTTGAGACCTGTTGTCATAGTGATAGATTTTAGACTGATTGGTAAACATTATTCAGACAT
TTGTCTTGCCTGTGGTCAAAATCCCCTTAAAAGAGAACAAGAAAGCTGCTTAATCTTTAC
TAGCCATATTTTATTTAAATAAATACAAAAAATATTTACACAGAGCAGACATATTTTATA
AGGTCATATTTTAAGGACTCAAAGACCAGAATTTGAACCTACTTGAATTTCTCTTAAAAT
TTAATCAGTTGTTTTCTACCTCATCCTGCTGGGTAAGTAGGAATGGCATTTATTGTGATA
CTTAACCTAGGAGACTATAGAGTGGAAAGGAGTGTATTCATTCAGTGAGGGGGCTTGAGG
GGAATATGCCAAAACCAACAGTACTGAAAACTATACAACAAAGCATAGATTTGAAAAACT
AGAATGGGAGGCCACAGTCTTAACAGAATCAAATGTTCCAAAGAAGAGTACTTGAAATTC
AGAGCTGGAAATAAAGAGCTTAGAAGACCAGAAAGCAAGAGATGTCATGGCGGGTGATCA
CAAAAAAACAAAACAAAACCGTGGTCCCCAATACCCATTGTAGCAAGGGAGCCAAGAAAA
GGAAAGAGATCATTGTTTATCTTTCTATACTTAGTCAATTTAAGGGCTATACTTTCTTCA
GAGATTGTCTTTACTATTTTAAAATGTCCTGTCTTTTATGAATTTATCATATGTGGAAGA
TTATTTTATTTTGCTAGGTAAGGACTATTGAAATAGCTTCAGGAACCCTATGTAATTCTT
ATATTTTGGCACATGAGAGTGGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTCACCAG
GCCAACCGGAGTCAGCTTTAAGAAAGATGTGCCAGTAAGTAGGCCTTTTTTCCTTTTCTA
GGACTTGCTTTTTTTGTTTTGTGTGTGTGTGTTTTGTTGTTGTATTTTATTTTATTTGAA
TTTTATTTTGAAAGAAGCTTTAGATTATATAATGTTACATTGAAAATATAGGAGAGTTCC
CATTTACCCCACCCCCTACCCCTCCCACACTTTTCCCCATTAACAACGTCTTTCATTAGT
GTGGCACATTTGTTACAATTGGTGGTGAACACATATTGAAGCATTGCTACTATGGTCTAT
AGTTTACTTTAAAGTTTTTATACTTTGCACTGCACAATTTTATAGGTTTTGACAAAATGT
ATAATGGCCTGTACCCATCACTGCAGTTTCATGCAGGAAAATTCCAATGTCCCCACAATG
TCCCGTGTTAGATTGTTTTTTTCCCCCTCTCCCTCCCTTCAGAACATCTGGTGGCTACTG
CTTTGTATCAATGGTACAGGTTCTTCCATTACTAGAAATAATAGGTCTATGTTAGTCCAT
GGTTGCATTCTCCTCTTATATTTGTTCATTCCTCTATCTTGAGAATTATGGAATGGTGAT
GCTCACTCTGTTTCTGATGTAGAGGGGGCTTAGATCCATGGGGCAGATGGATAGAACTGT
ATCGCTTGTGGTTGTAGATACTCTCTTTTTTTGCCATGGGTGTTGTCCCTCATCATCCTT
TTGTTAGTTGTCCTGGGTGAGTCCAGTGAACTGGAAAGTAGGTGTTACAACCTATGCTGA
GATTCGGGGTTCAATTGGCTTGTGAACAGACCGAAGATTTTAGTTTCTGGGACATATATT
TAACAAGTATAGTGCTAATTATAGGTTCAAATGAAAAGGCAGAAGAGCAATATGTAGGGA
AATTTTAAATGAGTCTAACTGTTAAATTGGGGAGCATATATTTCAAAGTAAGGCCTAGTG
ACAGGGTGCTGAATTCCTGAGATTGTTTGCCCAGCCTATACTGTCTAGGTGTCTCTAAAA
CCCCTCAGGAGCACCGCTGTGCTGTTTACTGTGGCAGTCAGTGGGATCCTCCTGAGATGT
GCATAAGCATAACCTCTGGAATGACCTCCTGATTTTTTATTTTGTAATATATCCACTAGT
GAGTGTGTATTTTAATTTTATTAGCATAATATATGCCTATCAGTATTTCTTCCTTTGTAT
CTCCATCTCCCATATTTCCCAGAGACAGTCACTATTAATAGTTCAAAACAGTCTTGCCCA
GTACTTCCAATGCACAGTCATACCATGTGAGTTTTTTTTAATACTAAAGGAATTTGTATA
CATTTTGTTTGGGGATTTGTCAAGCATTTCAACTGGTTTGCTTTATGTACTTCGTATTTT
TTTAGCCATCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGATC
AAACTGAGAGAATTCGTTTGGAGCCCCCAGAAAATATCCAAGAAAAAATTGCTTTCATCT
TCAACAATCTCTCACAGTCAAATATGACACAAAAGGTGAGCATGATATAATAGTTCCTAA
ATCACTACAAATGCTCTCTTTTCCCTAATGGGTTATGAAGATTTATTTTTGGAAGTCTGT
CCTCTTTGTAATACTTTCAAAATAGAAGGAGTAAAGTCAAACTGAAGGCAATGTGGACAG
TAAACATTGGTTGTGGTTTTTGTAGGTTATAAATAGCATGCATTTAAAATGTATTGTTTT
GAGTGAGTTAGAGAAAGAAACTTCATCATCTCATGGCAGTGGAAGGTTTGATCTGCACTT
TTAGTTGTAACTCATTTCTTCCTAGAGAACATTCAGAGCAGTAGGTGTCTTAAAAACCAA
GATGGACCTTGTGAAAAGACATAAAGAGTGATGCATGGGAGCAGATGTGGCTCAAGTGGT
TGAGTGTCCCCCTCCTGCATGGGAGGTCCTGGGTTTGGTTCCCAGTGCTTCCTGAAAAAA
AAAAAACAAAACAAAAACAGTCAATAAGCAAAACAAACTAAAAAACCAACTTAGGGAAGC
AGATGTGGCTCAGGGGTTGAGCACAGGCTTCCCATGTATGAGGTCCTGTGTTCAATCTCC
AGCCCTTGGTATCTAAAAAAAAAAAAAGGCAGCACTTGCCTTCTAAGATTAAATGCTAAG
GCAATACTTGGAAATACCAATTTTAGCCAGTAAAATTAGCTTAAACAAGTGAAATGCAGA
TACCATCTTTCACAATTCCAACATGCTTCATTGGAGGAAAACTTACACAAATTGACCCCT
TTACTACTACCCGTTTTGGGAAGAGAACTTTGACTTACAGATGATTCCTACAGGTGGAAA
TTTAGAAAAAATTCTATTCAGTCTGTAACTGACAGATTATAGATTAATAACTTTCCTTTG
TTCTTAAGGAGGATTCAGTAAGATAAGGGTAGGAGACTACATGTTTTCTAATTTTTTAGC
TGACAGTGGCTGTAGATGTTTAAGTCTTTGTCATCCACAGTTTGAAAAGATGATTGACTA
TACCTACCACAGAATCGAACATACTGTATTTCAAAACATCTGATATCTTATGTGGTTGAA
AGACATAGTTTAGTGCTTTAGCTAATTTTGCAAGGAGTCTACATGTATAATATGATTCCC
AGAAACAACCTTATTTTATTATATTGTAATTCTATACTCTTCACATCCTATTGATTGACT
TAGGTTGAAGAACTAAAGGAAACTGTGAAAGAAGAATTTATGCCTTGGGTTTCACAATAT
CTGGTGATGAAAAGAGTCAGTATTGAGCCAAACTTTCACAGCCTGTATTCAAATTTTCTT
GACACACTGAAGAATCCTGAATTTAATAAGATGGTTCTGAATGAAACTTACAGAAACATT
AAAGTAAGTTGTTGGTTCTTGTGTTTCCTTTCTCTTTGAATGTGGAAATATTTGGTAATA
TACGTAGATTTGGGGGTTTAGGGGTCTGTTTTTCCCCATATTTTGTTTTCTGTAATGTTG
TTTTGCCTGTATCTTGCTATTTTTCCTTATGTGTTGTTTTTCCGTATATGTATATGTACT
AGGTTTTTTCAAATATAGAACTAAGTTTAATGAATTTAATCTTATAGACATATCCTTTAT
TTTGAAAATAACAAAAATAATTACTCTTTTCATCATTCCATGTATGGTTTTATACCTTTA
CCACCCATTTTTCATATGCAATAGTATTACTTTGCATATTCTAAAAATACATGTATAGTA
TTACCTCTGTGTCTTTTTAACTTGCTTTTTGCCCTTCTGATTATTGCTTGTATATTCTCT
TAACTCTAGTCCCTCTATTTTTTTAAGTAGATTTATAGAAACCCACTGTGAATATATTAT
ATTTGATATTTAGGTTGTTGATAACTTTATTACAATGTTGCAGGTTATGTTTTCAATTGG
GTCTTCTAGTACTCAAGTGTCAGATATCCCTAGACTCTAGACCTATTTTTAGAATTGCTA
TTGTCTAGGATTCTGAACAGTTTATTTTAAGGTCATACTGTTTCTATGAGCCTGATCCAT
AAAATTCAAGTATTTTAATCTCCAAACTGTGACTTATTTCTTAGGAGGAATAACTTTTAG
AGAAAACAGTGTGAACCATCATAAGGTTGTGACAGTTCTTTCCTGAGGAACTTGGGACAT
TGGCTGGAAGCCAGCACTATATTTAAACCTATGGATGGGAATTTTCCCCATTCTTGGTTA
CGCTGTAGTGCAAAAGAATTCCTTGGCTCTTTCCATTGCACAGCTGACTATGTGCCATTC
TGCTGTTGCTCTTTGGAGTTAAGGAACACAACTATATTCAGCTTTTATTATCTGATTTGA
TACCAAGGATGATTTGGATACATGAAATTTTCCAGGTACTCTGGAGCAAAATTTCAAGAT
CCTTTTTAAACAAAAAATTTAAATATAGCCATAAATAAGAGGTGTTACACAGCAGATGGA
TGTTTCTGTGCATGCGTGTGTGTGTTTGTGTGTGTGTATGCACCAAAGCACTCTCCTTTG
ATAGTTATGTCCCCCCTTAGGAAAGCAAGAAGTGGAGAATTATGAGAAATAATGTAAAGC
AAATTCTTTTAATAAAATAGATTGGGTTTTCTTGAAGTATGAAAAGAAGTATGTAGGCAA
TATTATACCTGTTGTCTTAATTTTCTCTAGAGATGTTTAATGACCAGGATAATGCATAAG
ATTGTAAGAGGTGGCTTTGGTTACATTCTTCTATATTCCTGCTTCCTTGAAAGACTTAGA
AGCATAGTTGTAGTTTGAATTGAATTTTGTCTTTAATAGATTTTAATTTAGGTGTCTTCG
TCAAACTTAGCTAAAGTTTTCATAGTCTAATACCTGTCCATTGTAAAATACCTGACACTT
TTAACTTATGTTTAGTTTTTTGAATTTTATGCCATGTCTTTGTATTACCTATTTCAAAAA
CTAAATGTAAAAACTTTTTAAAGATAAAAGGTGTTATTTTTGGGTAACCAACATAGACCT
TTTAAAAATGATGTTACTGTTGAATAATATACTTTTAGGGCATGATCTCTCAGAACTGAT
GATTTGTTGGGTAGCATGCTTTTATCTTTAAAGTAGGATAATGGAATTCTCAAACTTTTA
GTTGAGAATTTTCTTTTATAAGCACATTCTCATACTTTTAATCCTTCACTATTTTAGTGC
TCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGG
GACATTGGCTAGGAATGATTACACTAGCTAAAAATAAACCCATCTACACACTGTGAGTTT
GGCTAAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGACCTTGTTCAGTTATTCCCTTTTCCTCCACTGGAACTTGGCATTTCCAGTTTGTG
AGCCTAGGTGAAATTAAAGGACTGATTGTAATGTGTGGCTTTCATTTTGGTGCTTTTTAT
GAACTACAATACAGATGGAAATGCTAAAGTATTTGTTATGGCCAGATAAATAGAAGTGCT
TAACTGTTTTAAACAATCAATTAAAAGGTGATTTTGGGGCAGCTTAATATAGTAACTTTT
CTTTAGGTTTTTAGACCACCAAACCCCTGGACTATGGCAATTATGAATGTATTAGCTGAG
CTACATCAGGAACATGACTTAAAGGTAAATTTGTTGCTTCTTTAACCCTTGAAAAATTCT
CTGCCTTCAAATTATTTAAATTTACAGTAAATGTGGGGAAGCACCACAACAGTTAGTTTT
AGAATAGTGAATATTATGACTAAATCTAAAATTTTTCTCTGTCAATTCTAATCAAATATT
GAAATTATGCAGTTAAACTTGAAGTTTGAGATCGAGGTTCTCTGCAAGAACCTTGCTTTA
GACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCTTAAAGAATTTA
GATGAGCAGCTCTCTGCTCCAAAGAAAGATGTGAAGCAGCCAGAAGAACTTCCTCCCATC
ACAACCACAAGTAAGTGTGATAATTCCCTCTACTTACCAGAATGTTATCTGAAGTGGTAC
ATCTCCATGTATATAGTAGGTTATAGTTGTTCATATAATGTGGTACTAAAACTAGTGTAA
CTTTCAGGTGAGCCTTTTAAATTATTAAGGAAAAGTTAGTGACTTAACAGGTTTTGTTCT
TAATCCTAGTGGAATTCATTCTGACAATACATATGGTATACATACCTAAATGTGATTAGT
CCACTGTTTTTCATATCCCAACTAGGCAGATTTTTTTTTTTTTTTTTTAGGTACTTGGTA
TTGGTACTCATATGTGGCAAGCTGGCACACAACTACTAAGCCACACTGGTTCCCCCAGAA
TTCTCTCTAAGTTATTTGAGGGTTCAGAAACCAATTACATGACATGGGGATGGGCAGACC
ACGTAGACCTATAAGGATATTAGAGTAGTTGAAGGGGATCAAGAGGACTGGAGGTGTGGG
GTGGAGATGTATTGAACAATTGGCAGGTATGGCTCTAATACATCAGCTTTTCTTTCTATC
CTAACCTTTAGTAGCTAAGAATCCCCAAGTAAAACCAGGGGACAATATAGGTTGAAAATC
GATTTTTGTAATATAGAATAATTTCACAAGGCCTACGACTGCCCATGTGGCATGACCCCT
CATTGATTTCTTTGCTCTGGACCACTACCACAGACATAGTTTTTCATTCTTTGTTCTAAT
ATCAGTTCTATAATACCAGAATTTCCCTTGTGATCATTCAAGGTGGGAAATACGTAGCCT
GAGATACCACCCCCAACCTGCTCCAGTATTAGTCTAGTTTACATTAGATAATGACCATAG
ATATCCAGTTAATTTTTTAGTAAAGCCAAGAAATGCCCTCATTTCAGCTCATTTTACCAC
TTTACATCTAGCAACTTCTACAACACCAGCTACCAGCACCACCTGTACAGCCACGGTTCC
ACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCTCTCGCCGGCCTGGCACC
ACACATTACTCTAAACCCAACAGTAAGTAAACACCACCATGTTCTCCAAGTTTGTGATAC
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTGCTTACTCTTTAA
ACTGTTTCTCTTTACTCTTTCCCTGTGGATTTGTTGCAGAGAGCAGGGATCAGGTATTGC
TATGTAATACAGTTGGGAGTGTTTTCCTCTTTAAAAGTAGTCACTGTGACTAAACTTCAT
TTATATTGGTTCCTCATATCCAGATAGCAGACAGCTTCAGTGGACATTTTAAAATGCTCA
TTATTTGAAGCAGTAATATTTTTTGTAAGAAGCCTTTTTTCCATAAACTTGATTTTTTTT
TGCATTTGCAAAGCCAATAGAGAAACTGTTTTCTTTAAGGAGGACTTGAGCCATAAATGT
GAACGTAACAGGTCATGTATTTATGAACAGGTAATGCATCTGGTAAAGAACAGTTTATCC
ATTGAATGTGGAATTTTTTTTTTTAAATGAAGGACATCCGTCATTCTGTATCTCACAGAT
TATTATACTGAGTACTTTTCCTTCTCATTATTATTTTAAGTAGAAATTAGCAGGTATTGG
TTAAACCTTGAATTAATTCCAAAGTCATGAGTGGGGTGGGGTGGTGCTCCTGATAGAAAC
AGGTTGTCTTACTTAAGCTGTTGATTTGACTTGTTTTTCCCCACTTAGATTCCCTTGTTT
CAGGCCCATCCACAGTTGAAGCAGTGTGTGCGACAAGCAATAGAACGAGCTGTCCAGGAG
TTAGTCCATCCTGTGGTGGATCGTTCAATTAAGATTGCTATGACTACTTGTGAGCAGATA
GTCAGGAAGGATTTTGCTCTGGATTCTGAGGAATCTCGAATGCGTATAGCAGCTCATCAC
ATGATGCGGAACTTGACAGCTGGAATGGCCATGATTACTTGCAGGGAACCTTTACTCATG
AGCATATCTACCAATCTGAAAAACAGTTTTGCCTCAGCCCTACGAGTAAGTTATTTCCTT
GCTAGTGTAAAATTTACTAGTGTTTTTCTGTTAGATCTTTTCTTTGCCTGTAGCAGTGGA
CATTACCATTCATTCTATTAGGTTGGTGCAAAATGAATTGCGGTTTCGGACAGTAAATTT
TAAATCATAACTGAGCTCAAGTACATCTTTATTATTCAAAATAGGAACTGTTAAAATCAA
CACATTTTTGCCAGTGAGAAATAAGTTTGTTCCTGTTGTGTAAAAATCCATGCTTTGGGA
TTCGACAAACTCTTGGAAAGCATCTTCTGCATCCTCCTGGGTTTGGAAGTGTTTTCCCTG
TAAAAAGTGTTGAGATGCTTGAAGAAGTGGTAGTCAGTTGGAGAGAGAAAGGTTAGGTGA
ATATGGTAGATGAGGCAAAATTTCGTAAGCTCAATTCGTTCAAGTTTTTGAAGCGTTGGT
TGTATGACATGAGAATTGGGCTCTTTCTGCTGACCAGTGCCAGCTGCAGGCATTGCAGTT
TTTGGTGCATCTCATCGATTTGCTGAGCATACTTCTCAGATGTATTGGGTTTCACCGGGA
TTCACGAAGCTGTAGTGGAACAGACTGACAGCAGACCACGAAACAGTGACCATGACCTTT
TTGGTGTGGGCTTGGCTTTGGGAAGTGCTTTGGAGCTTCTTCATGGTCCAACCATTGAGG
TAATTGCAGGTTGTCATATAAAATTTTCAGTCAGCTCATGAGGCACTTACTTATTGAGCT
TTTTCACTTTTCCACTTAACTCCAAATGCTGAACGACCTTAGAATGGTCGGCGTTGGGCA
CTTACTTATTGAGCTTTTACACCTTTCCAATTAGCTCCAAATGCTGAATGACCTTAGAAT
GGTCAATGTTGAGTTCTTCGGCAACTTCTCAAGTCATTTAACAGAATCAGCTTTGATGAT
TGCTTTCAAGGGTTGTTGCCAACTTCCGATGGCCAGCCACTACATTCTGCACCTTAAAGG
TTCTTGTCTCCTTTGCAAAACTTCTTGAACCACCAAGTTCCTAGGCCAAATGCCTGGTTG
ATGTTGCAAGTTGTCTCCTTAGCTTTATGACCCATTTTGAACTCAAATAAGAAAACTGGT
TGAATTTGCTTTATTTAAGAATGTATACCAGGAAGCGGATTTAGCTCACCTGATAGAGTG
TACGCCTTCCACATGGGAGGTCCAGGGTTCAAACCCAGGGCCTCCTGGCCCCTGTGGTAA
GCTGACCCACACACTGTACTGACATGCACAGGGCATGCTGTGCCATGCAGGGGCGTCCCC
CGTGTAGGGGAGCTCCATGCACAAGGAGCGCACCCTGTAAGGAGAGCTGCCCTGTACAAA
AAAAGCACAGCCTGCCCAGGAGTGGCACCACACACGTGGAGAGCTGATGCAGCAAGATGA
TGCAATAAAAAGAGACATAGATTCTTGGTGATGCTGACAAGAATCCAAGTGGACACAGAA
GAACATGCACAGCGAATGGACACAGAGCAGACAACAGGGGAACAGGGGGGAGAAATAAAA
AATCTTTAAAAAGATTGTATGCCAATATCAAACAGCATATTTCAACAATGCAAAACTGCA
ATCACTTTTGTACCAACCAAATAATCACCATGTTAGTTAATGACTTTTTTAGATTTTAAA
TTCTGTGAGGTGAAGAATTATGCATATTTTTTGCCCTCTTTTGTATCCCTAATATAGTGT
TTGCTGGATAGCAGATATCCAAATATTTGCTGGTCTGAAGAAATGAAGGGCTTGTAAAAT
AAATGCAGTAAGCCAATAATTTCCATTCTGTTAGCCATATAAGACTTTCGATTAAAACAG
TTGGAATAGGACATTGAAAATGATTTAAAGTGATTTTATATATAAAACCAGAAGTACATA
TTGTTTCTTTAAATAACACATATATTGGTTCTGTGTCTCAGGTATCATGGTTCATAAGGC
CTTCATTTACAGGTTTTCTTATTGTTCATCATCATTAACAAAAACCTGATAAGATGCTTA
GGGCAAGTGGTATTCTCATCTTACAGATTAAGAAACTGATTGTTAGACTATTTTGAGGTC
ACAGCTAATGAGATGGAATTAGAGCCAGAACTTAAACTCTTTTAACTGATGCTTTTTCTA
CTATCCTATGCTATCTAGCTCTCAGTCTATGAACAGAACACTTTGTATTTTTCTTTCTTT
CTTTTTTATAAATAGACTGCATCCCCACAGCAAAGGGAAATGATGGATCAGGCAGCTGCT
CAGTTAGCTCAGGACAATTGTGAATTAGCTTGCTGCTTTATTCAGAAGACTGCAGTAGAA
AAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGTAAGTTTTTAGCACTTGCCTTTT
TAAGTTTTTTTTTTTTTTCCTTTCTCTCTTAGGCAAAGTATCTCATAACAAGAACCTCAG
TGACTTCTTTTGTTTGCAGGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAG
GTACTGTGATCCTGTTGTGTTAACCTACCAAGCTGAGCGGATGCCAGAGCAAATCAGGCT
GAAAGTGAGAATTGTGGCGTGCACGTGCTCTCTTTGTCCCCACACTATCCTCGTTTTCCT
TATCTTGTTGCTTGAATGCCTCGCCAGGAGTAGTAGGACAAGCATGGCTAAATGTTTCTG
AGAAAGTGTTTCATCTCAGTAACATTTTACTTTTACTTTAAAGGTTCCTATGGATCAGAT
ATGGAAATAGATTAGATATTCCCTTAATGTTGATGAAGTGCTACTGTGTAGAGTTCATAG
GTCTGTTAGCTTTTATGTTTCCCAACTTGGGCTTCCTTAATCGTATTTTCTGGTATTTTA
ATTTTTATTGCTAGTTGCTTATTGGTCCAAACAGAACACTGCAAAATTTGATGATTTGTC
CAAGCACTAAAAGAGAATTGTAGTAGCATGGTCCTACTTGAGGCATTTTCCAATGGAAAA
ACTCTTTAATTTATAAATGAAGACGACTCTGGCAGGATTCAGGGCAATGGGAAACCCTCT
TTCTGAACTGTTTGTATGTATGTGCTGCAACTTGTGTGCTCAATCATACTGTTATGGTTC
ACTCCTGTGATTACCCCAAGCAAACTTTCCACTTTAAAAAAGTTTCCTTTGATTGTAGAG
TGGGTACTGTCAAACCAGATTTTCTTTCTCCAAGGTTGGTGGTGTGGACCCAAAACAATT
GGCTGTTTATGAAGAGTTTGCACGCAATGTGCCTGGGTTCTTACCTACGAATGATTTAAG
TCAACCCACAGGATTTTTAGCTCAGCCCATGAAGGTAAATATTTGCTTTGGATTAAGTCG
AGGATTTTGCAGTCTTAAGTTGAATGTTTTTGCCAATTAATGTATAACTTGCTTCCTGTA
CCTTAAGTTACAAGAATAAAATGCCCGCAGTTGTCGAGTGTAGGTGTTTTTGTGTCAAGC
CATGATAGTATACAGGGCTTTTTTTTTTTTTTTTTTTTATCCATGAGGTTCATTTTTTTT
TCACACTTGGTTTAGTAAGGAATTTGCAGGGTGACCTCATGGTTCCCTTCCCACCCCCCC
TTTTTTTTTTTAAGGATTAAAAAATTGTTTTTGAAACTACAGTAAAGTGGAAAGTATAGG
GGAAAAAATATTCCCTTGAGCCATTTGAGAGTAAGTTGTTTACCTGATGTCCTTATCACC
CCTGAATCCTACATGTTCTATCCTATATAGCTATGATAAAACCATTGAAATCAGTAAATT
AACACAGATATATTGCTACTGTCATATCCTTAGACCTCATTCACCTTTCACCAAGTGTCC
AATAATGTCTTTTATAGTGAAAGGACCTAGTTCAGAATCACATTTTATTTAATTGTTCAA
AATCTCCCTCAGTTCAGTTTGGAATAGCTTGTCATCTTTAATGGTCTTACACTGAAGTTT
ACAGGCCACCTGTTTCTAGAATGGCCTGATGGGGCTTTGTCTGACGTTTTCTTATGGCTA
GATTAAGGTAATATTTCTTTGATAGAAATATTACATAAGTAATGCTGTGTGCCTTTTTTT
TTTTCTTTTCATTTTTCAAAGATCCTTAGATTACATAAATGTTACAGAGAATATATAGGG
AATTCCCATATGCCCTGCTTCCCACACTTCCCACATTTTCCCAGATTAGCAACATCTTTT
GTTAGTGTGGTACATCCATTGCAATTGATAAATACATTTTGGAGCATTGCCACTAAACAT
GGATTATAGTTTACACTCTCTTCCACTCAGTTCTGTAAGTTATGGCAGGATATATAATGG
CTTATATCTGTTGTTGTGATGCCATTCATGAATGCTGTGTTCTTATATCCTGTCAGGCCT
TGACAGTTGGGCTGAGAGGACTATATTTCCCATGGTACAGAAAACTTCCTTTCTCCTTCA
GATTGTAAGCTCTTACTAGATGTTGCAAATGGTGCTGCCCTCAGTCTGTCCCATTACTGG
TGGTGATGTTTTTGATAACTCAGGGTGGTCTGTGCCACACTTTCCACTGTCAAGTGAAAT
ACCTTTTACCTCATGTCTTTCTTGCACCATCCCCACCTAAGTTAGGACTGCATAGTTTAG
GGGAGGACTAGTGAAATAACCTTACCATGTTGTTTTGGTTTTGTTTTTTTGTGTGTTTTA
TAAGAAAGAAAATACAGGAATAAACATACTACTAGATTCTTGTTTGCTACATAAGCCAGT
AAAAATCCTCAAACATTTTTATTTAACCCTCTTTGGTTGTTTTTGTCTCTAAAACAGCAA
GCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATCACAGAACTGGAGCAG
CATCTGCATGCCATCCCACCAACTTTGGCCATGAACCCTCAAGCTCAAGCTCTTCGAAGT
CTCTTGGAGGTTGTAGTATTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTG
CTTCAGAAGGTTGGTTCTTAAGCTAATGCTTTTACAAGAAGGTAGCTTTTATAAACATCT
AATGACTTGTACCATCATCCGCATTTTTATGCAGTTATGTTTATGATATTAAAAATTAAA
GCAAACTCTGCTTATATAAACAGGTGATTGTCTCCAGAGTAGAATGTAGTTATGATGGTT
ATGAATGTGAAATCTTTTTTGTTAAGGAAAGATTTCCTGGAAATATGATTACTGAAGAGA
ATTTCAAAGATTGCCTTTCAGTTGTGAAAGACAGGTTGGACAAATTGATCTAAGTACTGG
GGTAATGTTGGGAGTTTGGATTTTGACTATGTAGGTGGGGACAGAGGAACCTTTTATGTC
TATGAAGAGCACAGAGTGAGCATGAACTAAATAGACCTATGGATAGTTAGTGTGTTAGGC
AAGTGCAAAAGGATATTTGGAGGGTGGAGAGCTTGTTAACTTGAGGCTTAGGAAGTATGT
TATAGTTTCTTTTGAGATTTGATTTCTGGCTTTAACTGTTGGGGTGTGTCCTACATTTTT
CATGTTTCTGAACACTTTTTCTCCCATAGGCTGTAGAGGGCTTATTAGACGCCACAAGTG
GTGCTGATGCTGACCTACTGCTGCGTTACAGGGAGTGCCACCTCTTGGTTCTAAAAGCTC
TACAGGATGGCCGGGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTCAGTGG
CCCCCTCAGAATAATAGTAATTATTAGGTCTGCTTTTTGATATTTATGACCCTATTTATG
TCCAGAGGTTTCTAATTTTTCTAGAAGGTAAATGGGATATTTAGAATTCTTAATTCTAGT
GGTGAGAATTGTTGAATCCTTGTCCTTTTTACAAGTGGTACCCACCTTTTCCCATGATGG
AACTGAAAGCTCTTAATATCTTGCTTTGGGGATTAAATTATAGGTCATTTGTTTTAAAAG
GTTTCAGTGATTGCACAGCTGTGGTAATCAATATTTTAATGTCTCAGTTGGAATCCTCTG
TTTTCTAGGCTTTGAGAGCAAAGCCTGGGTTTAATACCAGGTTGCTTGTTCTACTTCATT
ACTGATCATTTTGAAACTTGGATAGTGACTTGTAATTGGCTCTTAAGATGTCCTAAAGTT
AGAACAAATTTTCATTGATTAAAACAGAGCCTTTATTTTACCTGTTACAGAATGTGAATA
CAGAAATATTGACTTTTTTCTAGGTGCCTAATTGAATGTCGGGATGAATATAAATATAAT
GTGGAGGCTGTGGAGTTGCTAATTCGCAATCATCTGGTTAATATGCAACAGTATGATCTT
CACCTAGCTCAGGTATGGGAAAAATTTACTTGAATAGAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTG
CTTTGGGGCCCCTGTATATTCAGCAGCCGCCTAGGAAGAGCTTTAGAAATGCATGTGCAG
ACTCGTACTAATGATACATTTTATAACTGCCTTATCTACAACATATGAGAAGCTTTTAGT
GAGGTATATATAATATTGGCCCCTGAAGTATGGAAGTTTAACTAACTGCCAAACCTACTT
GCTGTGCAGTCCATGCAATACTAGATGGCACCAGGGGTCTGTGTGTAAGCCCTGGCTCTG
CTACTTAAAACCTCTGAATTTATGCAAGTGACTTAACCTCCCTAAGCCTCGGGTTTTTGT
GTGTGTGTGTGTGGTTTTTTTTTTTTGTTTTTTTGTTTTTTTTTTGAAGAAATGATACCT
CAGAAAACTGTTGAGGATTAAGAGAAATCACATAAAGAAAACATGGCACATAGTAGGCCC
TTAGTGACTATTTCTTGACTGAACATCAAAGCTCAATGGGCAATTTTTTTGGTCAAGAAC
TCTTAACAGAGATCAGTCATTTGCATAATGTCTTCATAAGCAGGCATGAAGAGACCATAG
GAACAGCAAAGCACAAGGATAGTTATGTGTAAATATGGAAATGATAAAGTGAAGTAACCT
GCATCCTTGTGGTTTCTACTAAATCAGCAGATTGCCCAACTGTATGTCTATGAAATCACA
ACCATGAGTAGACTGATTTTCATTCTGGATTTATTGTATTAGATTGCCCCAGCTGATGGA
AGTAGTGCGATCCAACTATGAAGCTATGATTGATCGTGCTCATGGAGGCCCTAACTTTAT
GATGCATTCTGGGATCTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAAAA
GGCAGAGTATCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGA
CAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGAAAGGTGCT
TTTTATTCAACATAAGTAGGGTGTGATGCCTCCAATATTAAAGCTCAGTATTATGTACCT
GTGGTCAGACAGTTACCTCCATACTCATGCAAACTGAAAATGTCATCATTGCACTGTTCA
AATTGATATGTTTCCTCATTGTTGATTACTAAAGAGATAAAGTCAACATTCCCCACCTCC
TTTAGTTCTGTTTATTCCATCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGATAATTTTACTAGCCTGATCATCGGCAGTGATAGGTATGGGCTAATAAGTAAAA
TCTATACTATTCATGTTAAAAAAATCAGAAAACAAAAACATAAGATTTAAATGGTAGAGC
ATTTATTGTATTTTCTAAGTTAAGCTTATCTTTCTAAAATTTATTGACATGTCCTTCTGA
GAAATACCTTGATCTAAATTGGACTTTGCTTTAAAGTGTTAAGAACCAGGTCCCTAACTA
AAGGTTAGGTGTGGCAGGAATATTAATAAATGGGAAGAATAGGAAAAAAATTTTAAGAGA
GCCATAGTACAGTACAGCATTCAGATTCTGATCCTCACTGCCTGCTTTCAGCCACTGTGT
GGGACTAAGTGCAATAAATCAATGTGTCCTAATTTTATTACTTGGCAAGTGTGCTACTTT
TCCTGAATTGACCTTAGAATTTCTTCAGTGGAACTATTACTATAATGTTTGGAGTTGGGG
TGGGATATATGCTTATTTTTGCAGATTGATCATTATATTTTTTCAAACAGACCAAAGTTT
AGATGTGCCACCAAAGAAAGATAACAGATTATTAGCTCTGCTTTCAAATAAATGACAATC
GAATGGGGAAAGAGCTAATTGGGTGATTTGTAGTTAGAAATTGGATTCCCTTTTCAAAAG
CTGAATGTTAAAAGATGAATGATACTTTTAAAATAAAACTATGTAAAATTTCCCCCAAAA
GAATCTAGGGAGTTATAAAACAATATTCTGTTTGATTTCTGATTTGGATGCAAGAAATTG
GAATCATTTGGTTTTCATGGGTATGGATGTGGCACCTGTCTCAGCTCTTCCTTCTGGCTT
ATTTGCTCTTATTTCTTTTTTCCATTTTACACTTTTTTTATACTGCACTTTTTTCTCTTC
CCTTTTGCGTCCTTTTGAAAATTTTATCCTTCTAGTGCCCCAGTCTTTTCCTTATTCCTC
CTTCTCTGGTAATTTTTTTTAGAGTCCAGTGAAGACAAAAGTCTGCATTGACTTCTGTCT
TGGCTTAGGGTACATTATTATCATAGTTAGACCAATTCACCTGTTTTCTTGCTTACCAAG
ATAAAACAGGTTATCTTGTTTTAAAATTTCCAAGGTAACCTTCAAGTTTTCTGAGCTTGT
TTTGTTTTTGAAGCACTGACCTCTTCCTCTCTCTGCCACTTTAATGCTTATTTCACTTTC
CCCTTTTTTCTTCTTTCTTTTGGGGACAGGGGTGGAGTACTAGCTAAATAACTGTTCTGC
TCTGCTTCACTACCAGATCATAGAATCTCCTTTCTTATAAATAAACTTGCCTTTTCCACT
TTAACTTTATGTAACATTTAACTAGCTGATAATGATTTGTGGGTATTTTCATTTGGTACC
TATCTATTATACCAATTATTGTTTGATTTTTCTGGGGTAACTAGTTGAGAGTTTCAGTAG
CTTCTATCCAGCTTCGTTATTGGTTAAGTCAACTGGGAAAGTTATCTTAAATTCTGTAAG
AATGTAAAATACAAGAAATTTTATCTCCTCCTTGGAGGAAACATGCATTATCCAGAATGT
CTTAATATGACCTCTGGTGGGTTACTGAAATTTGATTTTCAATATGTATAATTTTCTAAA
TTGTTTCACCATAGGCTACTTATTTTCTGTTTTAAAATTGCCATGAGCACATTCTCATTT
TTCATTTTCTCTACTAAACTTAAAACTGGAGGAATTCTGTCCTCGTTCCGTAGTGGGGAG
GTCATTCTCCTAATTATATCCTTTTTACAAAGTGAAAATTAGAAAAGTGAAAATAGGAAC
ATATTAGAGATTACCTCTTAAGCATGAAAATTAAAGTTGTAAGAAGCTTGTTTGTGTGTG
TTATCTCATTTCTGTCTTTGTTTTTGTTCCTATGGTAGATGCACCAGCAAGGAATCCTGA
AGACTGATGACCTCATAACAAGGTTCTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCA
GTTATCGTGCTCAGGCTGAGCAGCAGCACAATCCTGCTGCTAATCCTACCATGATCCGAG
CCAAGTGCTATCACAACTTGGATGCCTTTGTCCGACTCATTGCACTGCTAGTAAAGCACT
CAGGGGAGGCTGCCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCTGAAATCCTT
TCTTGCCTTAGTCATGGTACCCTTGAAGTCTGTATATCAGAGGTTCTCAACCCCAGAGCA
TTTTATAATATCCCTTTTAAATGTCCTAAAATTAAATTGTGACTATGTGAACATATCTAC
AAAATTTTAGAAATACTAATACAAAAGAAAAAATATCCATGGGACTGTTCAGTACAAACA
GTGAGCCCGAAGGGTAAACCATGGGCTATAGCTAATAGTGTAATTACAAAATAAATGTGT
GTTCATTAGTTGTAACAAATGTGCCACACTAATGCAAGGTGTTAATAATATAGTGGTATT
AAAAGAAAAAAGAGGGAAACGGACTTTGGCCCAGTGGTTAGGGCGTCCGTCTACCATATG
GGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCTGTGTGGAGCTGGCCATGCACAGT
GCTGATGCGCGCAAGGAGTGCCGTGCCACGCAGGGTGTCCCCCGCGTGGGGGAGCCCCAC
GTGCAAGGAGTGCGCCCGTGAGGAGAGCCGCCCAGCGTGAAAAGAAAGAGCAGCCTGCTG
AGGAATGGCGCCACCCACACTTCTCGTGCCACTGACGACAACAGAAGCAGACAAAGAAAC
AAGACGCAGCAAATAGACACCAAGAACAGACAACCAGGGGAGGAGGGGGAAATTAAATAA
ATAAATAAATCTTTAAAAAAAAAAAAAAAGATATACAAAGGCTAAATAGCAAAAGTGGCA
GAATATTGTCCTGAATTATCAGTAGTGATTTTAAATGTAAATGGATTTAACTCTCCAGTC
AAAAAGCAGAGATCAACAGAATGCACAAAATAGCATAACCCAACCATGTACTGTCTGCAA
AAGACTCACCTTAAATTCAAAGATACTGGTCGGTTGAAAGTGAAAGGATAAAAAAATATA
TACCATGTAAGTAGCAACCAAAAGAGAGCTGGAGTAGCTATACTAATATCAGATAAAAAT
AGACCTTAAGTCAAAAACATTATGAGGGATGAAGACAGTCATTAGCTACTAATAAAGAGA
ACAATTCAACAAGAAGACATAACCATTATAAATATATATGCACCTAACAGATTTGAAGGG
AGAAAATGATGGTTCTACATTAATAGTAGGAGACTTTAATACACCACTTTTAATCATGGA
TACAACATCTAGTCAGAAGATAAATAAGGAAATAAAAGACTTAAATGATAGTCTATATCA
ACTAGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCTGGCTTTGTGTATGCCTGGCTTGAGCTGATATCCCACCGGATA
TTTATTGCAAGAATGCTGGCACATACACCACAGCAGAAGGTGTGGCTGCAGTTTATCTCC
TACAGAAGAAGATTGCTAGCTGGGGTTTATTGGTGCTGCATGCAGATTTCTCTTAGTCAT
TTAGTGGTGATTCTTCCAAGGTTTGCAAGAGAAAGTACTTCCCAAGCTTAGCTGGGAATT
CTTTTCTTTAATGTTGAGTCAAGTAATAGAAGCTTACCTAAGTACTTGACTTTATGCCAG
AAAGCCTTTTTCAGTGATTAGCGTCTTGTGCCTCCAAGTCTGTCTTTTATGTCAGTTTCT
GAAAAGGTTTTTGTTAAAAAGTTCAGACATTTGGGTACCTCCCTAGACATGTGAATAAAT
CTCTGGATAATAGGCCTCTGGAAGCTGACAGTTCTACAGGTGATTCTAATGATAAAGACT
TATACCTAAGCCTGAGAACTGCTGAGTTTTGTTGAAGAATTACTAATCCAATTGGGAATA
CAGCACAGTTAATATGAGAAAGCTCTCAACCGTTTTTGCAAATGACAAATGAGTACTGTA
GAAAGTACCTTTGTTTGGCCCCTCAGAGCAGAAGAAAATGTGATTATTAGTAGGTCCTGG
AGTGAACACGGCAAATATAGTGAATTAACCCTTTAATGGAATTGTTTTTGTTTGGTGGAG
AAGAATATTGAAGGAGGAGGAAACACACTGTGTAAAATTACCCTAGAATGAACATAATTT
GTATAATTGTAAGTTTGGCTATTATAATGTTGAGTTTGGCTAAAAACAGAGTATTCCTAT
TACAAACCAGGTGATGTTATTTGTCAGAAATTGAGTTGGGAGTGGGAAAAGAAATGGCTG
AGGCCCATGTTTTCTTTAAAAGAAGGAATTTAAAAAATGGACCCCTGCTTGTTAGAGCTT
TTCTATCAGAAATGCCCCAAGGTCCTCCCCTCCACTTAAATTTTGCTGCAGGCACAAGAA
ATAATATGACCTGGAATTTCTACTGTCAGTTTTTTCCTAATACTGTTTCCTACTACTACC
ATAGAGAGGCACTTATGTGCCAGGTTGTATTTGTTGTAAGTGGGTCGAAATCAAGTCATA
GTGTAGCTGCTTGTGCAGACTTACTTGGTGATCAAACCACCACAGAGTTTATTTATATAA
GGCTCATGTACATTCCTTTCTTTCAGGGATGGCCTATGTATGCACAGCTACTGATTGATT
TATTCAAATATTTAGCGCCTTTCCTTAGAAACGTGGAACTCACTAAACCTATGCAAATCC
TCTATAAGGTAATTAATGCCTATTTATAAATGCAAATATATTCTTCCTGAAGTGGGAAAA
ATAAAAGTAAATTCTCAATTGAGACTAGAAGGCCTAATTTATTTACTTTTTGATATTATG
CTATTAAAGTATAACAAATATTTAGAAAAGTACAAAAATCAATCATCCCTGTAAAACCAG
CACTCTGATCATAGAGTATTCATATGTTCAACTTTAGTGTAGATATTACTGGTATTCCAA
GGTGTCTATACAAATTTACACTGACAGCAGCAAGAGTTACTATTTCTTCATGTTTTGCTA
CACTTGGTATTACCTATTTTTCATTTTAGCCATTCTAGCAGTGTGTAATAGGATCTCATT
GAATATTTAATTTATATTTCCTTGAAGACCTCTTAAAGAGGTTTTTTGTGTGTATATCAA
GCCATTAGGTTATGCCTTTTTTGTAAAATTCCTCTTCCAGTCTTTTGCTCATATTTCTGT
CATTTGCTATTTTTTTATCAATGTTATGAAATGTATTCATAAACCAGTCTATCTAAAGTG
TATAATCAGTGGCATTTGGTCTAATCACAGAGTTGTGCATTCACACTTCAATCAATATTA
GAGCATTTTTATTACTCCAAAAGAAAAAAGAAAAAAACAACAAAGACCCCTTAGTAGTCA
CTTCTCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGATTTATCAGTGAATTTCTAATATTTAGGATTTGGGTTCCTACGTTCCT
GAGAGAGAGCAGTCTTTTATAGTTTCTGCCTCAGGTTTTTATATCAGCATTATGCTGGTC
TTATTAAAAGAGTTGGTAAACATTTTCTCTTTCTCTGTTTCCTAAAAGAGATTCTGAAAA
TAGTGTAAATTTTTCCGTAAATGGCAGAAATTTGCCAGTAAAGTCATCTGGGCCTGTAGT
TTATTTGTGGAAAGGTTTTTAACAAAATTGTCTTAATTTTATAAGTTAAATTTCATTTTC
TTCTTGTTGAGTTGTTTTAAGGAATTTGTCCTCTTTATCTGAATTGTCAAACTTATTAGT
ATAGAGTTAAAATCTTTTTATGTATAGGGCTCTATAGTGTTATTTACATTTTAGTTCCTC
TATTACTAACTTTTTTTTCATCATCAATCTTGCTAGGGTTTACTCATTTTACTCTATTCT
TTTCAATGAACTAACTTTTTAGCTTTCATTTTCCTTCCCCTGCTCTTTATGACTCCCCTG
CAATTCGATTAAAATTTCTGCTCTTTTCTTCTACTTTCTTTTGTTTTCATTAGCTGTTCT
CTTCTAGCTTCTGGAGAGAGAAGCCTACATCATTGCTTTTTTCTTCTTTGTTTTGTCCAC
CCTTTTATAACATAAAGGCCTATAAACTTCTTAGGACTAATATTTAATCATTTCCCAATA
AAAATATTTTGGTAACTCCCCTGTTATATAATTATTAGAATTGATTAAAGCCTGTAACTT
TTTTGTTTTACTAAAGTATCCATTTTTCCTTGGGTGTTAAATTATTAAAAGAAAAAAATG
TTACCTTTTTTTACTTACTTTTGAAAGAGCTAATGGTTTTTTGTTGTTTTTAAAACAGGG
CACTTTAAGAGTGCTGCTGGTTCTTTTGCATGACTTCCCAGAGTTCCTTTGTGATTACCA
TTATGGGTTCTGTGATGTGATCCCACCTAACTGTATCCAGCTAAGAAATTTGATCCTGAG
TGCCTTTCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTAAAGTT
CCAATCAAACATTAGAAAGTTTATCGGAAGCTTATGTGGCTCAAGCAGTTGAGTGCCTGC
TTCCCACATGAGAGGTCCCATGTTCAGTACCCAGTGCCTCCTGAAAACAAAAAAACACAA
GCAACCAAATGATTAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTCATAAGAGTATGGTATGCTGCTGC
TGAATGTGTTTGTGTATTGTGTAGTTGCTATTTTCATCTTAATTTTGATACTAAGTTTAG
CTACATTTCATTTGTTGGATGGCCCCCATAAGGCGAAGAGTTGAAGAACAGACCTTTAAA
TGCCCATATCCTTATTTCATTGCATTTGCCATATGTGCTTGCATTTTTAATTATCAAAGT
AACAGACATGGGACTACATAAAAATCATGCCACTGTAATGTGACTGCTGAAATTTTTATG
TATTTTCTACACACCCCATTCATTTAATAGGTACCAAGTGTGATGTCTCTTACTTTGTTC
TGCTGGGATTTCTTTTTGAAATTTAAGTCCAGGAAATAAAAACCCTACCCTGACTTATTT
TAGAAAGGTGTAATAAATTATGGAATGAGATGTCCTCATCATTTTGTATATAAGTTCTTA
ACAATTATGATGGTGGTCTAACCCCCTTTTAAAAACTGACTAATAAAGATTGATGAAACC
AATAAAGAGGCAGCTCTATTCTTCATGGCTTTATTTGTGTAGCCTTAGGAAAAACAATCC
TACCACTTTCTAGTATAGATAAAGTTTGCCTACAAATGATTCTGGTTGTGATTTTGCATT
TGTTTGTGGCAGGTGGACATGTTGAGTGAAATTAACATTGCACCTCGGATTCTCACCAAT
TTTACTGGAGTGATGCCTCCTCAGTTCAAGAAGGATTTGGATTCATATCTTAAAACTCGA
TCACCAGTTACTTTTCTGTCTGATTTGCGCAGCAACCTACAGGTTATTTGGTGTTTGGCT
TAACCCACTTTTTCAGCTGTCTTGCATAGAAAGCACTCGGTGTATGAATTATGCAATTCC
GTGTGTTCAGTTGGGAGATGGCCTTTTCAATCTTACTGCCATGCTTTGATTTAAATATTT
TAAAACAGTCATATCTAATAGTCAGATGTGATTAGGGGAGATAATACCAATTTTACTAGT
TCATCAGTGATGCATTACTGTAACCTTTGGAAGTCCAGAGAACAGAGCCTTGGTTTTCTC
TCTAAAAAGACCACCAACTCTCATTCCGTCTCTACTTGAAGATTTTTCTAATACGTTGAT
TCTGATTTTAATTTGCTGAAAGGAATGGCTTAAAGTTGTATCATCTTTCCAGTCCTCTCA
TACCAAGTCACCACTACTTTCTCCTCCTGCAAAATCTGTTTAAAAATTGGGATAGTGATG
AATTTTGACCTTATTAACTTAACAGTAGAGTACATGCTGTTAATACGTGCTAAAGCTTTG
GCTCCCTGAGGAAAATGTTTTGATTGTTGATACTGCCCCATCTTAGGGCAGCTATATTAG
TTGTTAAATAACCTCCCAATAGTCAAGCAAGTTTCTGAAATTTAAAACACAAAGGATATC
AAGCAACTCAGCCTTTCTATGAAAGCATAAGAATGGTTTAGAAGTTTTGACAATCGAACC
AATCCTCTGTAGAAGTCAGCTCTGTTTTGCTCATTTAGGTGTCCAATGAACCTGGTAATC
GCTACAACCTCCAGCTCATCAACGCACTGGTGCTTTACGTAGGGACTCAGGCCATTGCAC
ACATCCACAACAAGGGCAGCACGCCTTCCATGAGCACGATCACCCACTCGGCACACATGG
ACATCTTTCAGAACCTGGCCGTGGACTTGGACACTGAAGGTGAATGAAGCTGGCCAGTTC
TGAGTCAAGCTTTATGTACCTTTGGACACCATCTGATTTCGTGTGAAATTAAACATGGTC
CTTTTATTAGTCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAGGGGCTT
AGTCCTTGGAATGGGGAGCTTATAAGTTATTGGGGAAACACCACCCCTTTTCTTGGCATG
ATTAGGAGCTGGAGTCCAAGCTTGAGGGTTACAGCTATATAAAGCTCCATTGTGGTAGTT
TGTATCTATGTACCCCAGGAAAACACGTTCTTACACTTAATCCATTCCTGTGAACACAAG
CTCATTGTAAGGAACTTTTGATGAGGTTATTCAGTTAAGAAGTGGTTCAACTCTATCAGG
ATGGGTCTTATTGCTAATGCTGGAGTCCTTTATAAGCAGAATGAAATTCAGACAGAAAGC
CATGGTAAGCAAGAAGCTGAAACTAAACAGGACCTAGAAGAGAAGGGAGAGGCAGGGGGG
GCCTTCATATGCATTGCCATGTGATACAAGAGCCCAGAACCAAGGATCACTGGCAAGTAG
ACACAGAGCACCATTCTTCAGGAAGAAAGCATCACCTTGAAGGTGCCTTGATTTGGACTT
TTTCCTAACCTTAAAACTGTAAGCTGATAAATTCATTGTTTAAACCAACCAGTTGTGTGG
CTTTTGCTTGAGCAGACAAGGAAAAAGCTATACAGATGATAAATAACTAAATCATCTATC
TGCAGAAGGTCAGGCACCTCTCTGTAAAGCCTCCTACTTGGATTTTACCTCTCATAGACT
AAGGCGGCCATTGATAGAAGACAGCTAATGTTGCCTTAGTCCACTTCTAATCAGGGCCTC
ACATTCCTCTTACCAAAGTATTCAGTTATCAATCATAAGAAAGGTGATAGATGACATGTA
ATTCTTCTGTGGTACTTCTTTCCTATTTTGTCAGAGGTAAAACTGTCAAATTCATTCAAG
AGAGTGTTCTTTGATGGTAGAGTTGGAGAGGTAATGACAAACAATTTCTTTAGGGGTTAT
GACCGGGGCCTGTGGACTAATATATTTGTACAGCATGTATAGTGCTTAGATTAATTTTTT
TGTTGTTGTTGCAGAGCAGGTATAGGTTGGTTGAGCACCTGCTTTGCATGTATGAGATCC
CAGTTTCAAACTCTGGTACATCCTTTATTTATTTTTATTTTGAGAAGGAAAAATGATTTA
TTGACAGCCAGCTGGACTCGGGACCTTTCTGTTTCAATCCCGAGCCTCCAACAAGATTTT
TGAGTCCCTTTTATACAGAGAGGAAAGGCCCAAATGGTTCTTTTGTTTCAGTTCTCAATA
GGCTTAAATTAGCATATATCTTCTACATCCTAGGTAAGCTTAATTTAGCATGGACTTCAT
ACATTCTAGATAAGCTTTTAGCTTATCTTGGTTTGCATTTCCCCTGAATATTCAAAGTCT
AGAGGGTTTGCATTGAAAAACTGTTTCCTGGGACTGGAGTCGTTGCCATGGTCACCAAGG
GCAGGACTGCAGCCTATTATCATCCCACACGCACAAGTCACAGCTTAGGTTATCTCTTAA
GAGACAAAAGAGCCTCCCACCCATAGCCCACATCATTCCCCTCTTAAGCCAAAGTTTAAC
TTGCTAAGCTTTGGCATAATTATTGTTGAAGCTATGAGGTGGATGACTGTTTGTTGTTTT
GATTGATTACTTATCAGTCTTTAGTGTAGCATCCAGGACTGTTTTTAGGACTGTTTTTAG
AAGTTTAGAAGTTTTCATTCTGGTGCTTGCTTTGGCAACACATATACTAAAATTGGCACG
ATACAGAGAAGATTTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCATT
CCATATTTTTTTTTAAAAAAATTTTCATCCTGGACAGCAGAATCCTGGGGTGGGGGTCCC
CTACAGTCATCCTGGGGCCACCGGCGCTCACGTGGATTTCCAGTCAGGCTCCAGATCCAT
CTGTTAATTTTGTTTTATCCTTAAAGAATTTACACCTTTAATCTTAAAGGGGTGCTGAGG
GGAGATGATGTCTTTTCTGTAACTGCTTCCTGCTGGCCATGGGCTGTAGTCATTGCCTAA
CAAGGTGTAAAACTCTTACGTTATTTTAACTGGAGGAAGATGGATCTGGCATTCTTTACG
AAGTTGGATGAAGTTTTCATATGGTTAATGAGATATTCACTCTTCTTCCATGTTCAGAGT
TATTTTTCATTCCCAGAATCTTTCTCTTCAGACCTTCCATTGCCCTCAATTTTCGTCAGG
AAGATTCTGGTGGAGCCCACATCTTTTCTGGATTAAATTTAATCCAGGGGCACCCAGATT
TGGGGTTCACCCGAGTCCTCCCGGACTGCCTTGGGGAATTGGAAGGGGCAGCAAAATGCT
ACCGTCTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACAG
TTAAGTTACACCACCTCTTGGAAACATCAGTTGCTTTCATGATGAAATCAAATATAAATC
ATTTGAGCTCTTAATATGCACGTTTTAATTATGAAATCATCTCAAGTGGTTATATTCCTG
CAAAACACCCACATTTATAACTTGAAGATGTAAAAATATACTGATTACCATATTTGGTTA
ATTACAAAGCAAGTTAAAATAACAACACATTAATGGTAAACAGTATATTTCAGACTGGTC
TGAGTATTTTTATTCTGAACATTAAAGGGAAAAAGGCTTAATTAGGAAATTTAGAAGCTT
ATATTTGAAGTTTTTGTACTCTAACTATGGATGCTTGAAAAGGAAAAAATGCAAGATGAG
TAAAATCTCACAGGGCACCAGTCCATCTTATTGGAAGTCTAAAACCTGAGAGAGTAATTG
TCTTAATTTACTAGTCAGAGGAATGCTTTTGAAGCTATAAACTGATGTAGAAATCAACAT
CATGCTTATGAGCCCAAATTAACAGGGACCAATTTCTCTAAACCAGTTTCAGGCTTAGAT
CTAATTAATTCTTGCATCCTATATTGTCATACAATAAACATTTTCAAATGAATGACAAGA
AGAACGAAAGATTATTTTGGATGCCAAGATTCTGGTGCAGTGTCAGATAGTGTCAGACAA
ATTTAAAAATTAAAAACATTATTGAATATCCCAAATCCAGGTTACTTAGTAATCTAAAAA
TTCATATGTCTAAGTTAAGAAGGCATTTTTAAATCTCTGAATCCTGATTTGTGGAAGTAG
GCCTAATCCTAGAAGGAATGAAGACTTTGGAGAAATCATTTCTAGCAAGTATTTTTATCT
GGATGTAATCAAATTAATATTATCATTAAAGAACCTCTGAAAACTGCAAGAGTATGGGGG
ATGGAAGAAAATCATAAATCCTTCTCCCTAATACACGATATATGGAAGAAAAGAAGGACC
AGTTTTGCTCAATTTGCTTTATTTGTAGTAAGGGTTTTATGTTCTGATTTTTCTGGAAAT
CCCAGAACTTTTCTAACACTAGTTTGTAGAGCCTCATTTCTAAGGAGCTCCCTTTGGGGT
CACTGCTCATTCTATGCTTGTACAGTGCCACAAAGTACAGATGGGCAAACTATGACCCAA
TGACCAAATCATGCTTATCACCTGTTACTCTACAGCTCTGGAGCAGAGAAGGCTTTTAAA
AATTTTAAATGGTTGGAAAAATTAAAAGATGAATAATATTTCATAACATGCGAATATTAT
GGAATTAAAATTTCAGTGTCCATAACTAATTTTTTATTGGAACACAGCCATGCTCACTCA
TTTTCGTATTATCTATGGCTGCTTTTGTGTTACAACAGGAGATATGAGTTGCTGTAAGAG
AGACTACTAAATTACTCACTATCTGGCCCTTACAGAAAAGTTTGCCGACCTCTACTCTAA
AATCATGGAACTTATGAAGAGAGAGTATCTGATATTCAATATCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTA
TCTGTTTGTCAGGCAATATGTTAAATGTTTAGTGTTCCAAAGATTGATAGGACTGCCCCT
AACTGATCTTTAAAAAGATCACAGGATAACTCCTTTTGTGTAAGTTCTGTCTCGTGTGGT
TGTGCTCCATTTCTTTTGGTGCTCTATATTTATTCTTGTACAATAGACCCCAACAGCTGA
TAACCAGCTATATAGTTCTGGTTATCTTAGCACAGATGTGCTTTAGAAGGACAACTACTT
TTAACTTTGCCGTGGATTCTCAAGAGGCTGATTAGTCTTGAGATACTCTGCAGGCCTATA
TGTGGAAGGGATTTGAGACAGCTTATAGTCAAGGTTTAATAAAATTGAATTCATTAATTC
CAGAGCCCAGCAATAAAAGCAGGGCATCTTTTAAGGAAATGTTAAGGTTCCACTGTGATA
ACCCTCATAAACATCAGGCAGAGGCAGTCAAGCCAATAGATATTTACTCCAATATAATTT
AGACGAGCAATTTTCAAAGTGTGGTCTGGGGATTTCCCCAAGCCACCTTTAGGAGGGAAA
TGAGGTCAAAACTATTTTTATAATAGAACATTTGCCTTTTTTGCTCTCATTCTGTCACAG
GTGTAGGGTTTTCCAGAGGGTACGTGAAATGTGATGGTATAACATGGAATACAGAAACAG
ATATTAGAATCCAGTTGTCTTCTAATTAAGCTAAATTCTCCTTTTGGAAAATCATTATTT
TAGTAATAATTACTATGTAGTCGATTTTAATATGAATAAATACTTCAAGATTTATTTCAA
TTATCTAATGTGAAAAGTATCAGAATACAACCCACGGAAATGAGAAACTTTTGAGTCCTG
AGATTAAAAAAAGATTGAGAACCAGTTTAGTTAGACTAAAAGAATAATTCCTTTGAAAGT
CTGTACCAGAAAATCCAAACCCTAGCTGATCACAACTTTTTAAATTTCCCTGTTGGCCTT
TCAGAACAAGTAATCACTAAGCCAGATTTTCTTACTGTTTATTTTTAGGTCGATATCTCT
TCTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGTCACACTCACTACTTTAGTT
GCACCATGCTGTATCTTTTTGCAGAGGCCAACACTGAAGCTATCCAGGAGCAGATCACAA
GGTAAGGGAGAAACTTGGTTTTCACATGCTTCTAAGTGGTACCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTT
TTCTTCATCACCCCTAACAATAGTTAGGAATCTGTTGCAGCTTGCTTGGATTAAACACAA
CAATGGAAACTGGGTAGATTCTAGTGAGAAATAGATGTGTTTTATTTAAAAAGTGGGGAA
CAGACTTTAAATGTACCCATTTACCTAATATTAGTATCTGTGCTACTAAGTATGCTGTTT
CTTAGATTTATATACCAAACCTACCTAGTATTTTATTATGGGATATATAAGATGATAGTG
TCTTTTGGTTTTGATTATACATAAAGCTGCAGTGACAGTGAACCACCTTGTACTTTGATT
TCCTTAGGGTAAATTTAGATGTACAATTAGAAGGTCAAAAGATATGAATATATAAAGCCA
GTACGTGGTATTTGGAAAAATTATATTTACAAATGCAGTAATGGGGTTAGTTTCCTCACT
TTCACTGGCTGTTCATCCTTTTAATACCTACTTCATGTGCCATGGTACTCTGGGCTTTAG
CTTTAGGTGGCTTTTTCCTCCCTCCTCCATCTTATCCTCAACCACTCTCTAAGATTTATT
AAGAGCAACCAGATTCAAAATTGAGTATTTCAACCCAGAAATCTATCTGCATTAACTCAG
GCTATATATAGGCATTTTTATAAATCCACCTGTTTTTTGGTAAAGCCAATAACTTTTGTT
TTTTTCCTTATCTCCGACTATTAAACCATATTGCAAGAGTGGTCATGATTTTGTGTTTCC
TTGTATATTAACCAACCTTTTCTCCCCTATTCCAGGGTTCTCTGGGAACGGTTGATTGTA
AATAGGCCACATCCTTGGGGTCTTCTTATCACCTTCATTGAGCTGATTAAAAACCCCAGC
ATTTAAGTTCTGGAACCATGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTAAGTTAT
AAAAGTATTGTTTAGGAATGGGACAGGAGAATAAGAAATACTTGACATCTCCAACTTGGG
TGGGTAATTAAGTAGGTAATAATAGATAAAGCAAATGAGTAGCTAAATGAAGTTGTAAGT
ACTGTTAGGCATGAACTTTTCTGTCAAATACAATTGTATTTGCCCTCTTTTCAGGTTATT
CCAGTCAGTTGCACAGTGCTGTATGGGACAGAAGCAGGCTCAGCAAGTGATGGAAGGGAC
AGGTGCCAGTTAGATGGAACTCCATCTCTGTTGTTGTATCAGCCTGGAGGTTTCATCGCA
CCAAGTTCATAAACTGACTGAAGAATCCTTTCGGCTCTTCCTGGCTTTCCCAGCCCTTTG
GTTCTCGGGTATCTGCCCCCACTCCTGTTGGGGTCAGCCTACTGTCTTATGTGGGCACGT
TCCAAAGTTTAAATGCATTTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATAT
CATTTTGAACTTGTGTAAATATATCAAAGAGAAAACCTTTGTCTGGAACTTCTTGGGTTT
GTACAAAATATGTCTTAAGGCAAGTGGACCCGCCCAGCTTGTAATAAAGAGGCAGCTGCT
GATGCCATGCACTTGTCTGGGGGGCATGGCTCCATGTCTTCTGATATTCTTAATATTCCA
AATACTGAAAAGCCAGTTTAATTACATAACTTATTTTTAGTGTGGACAGGGGACCTTAAA
AATCACTAAAGTCGTCACATGGATGTGCAGGGTATGTGGGAAAAGCTCATGATTGAGGTC
CCATGGTTTTTGCCTCTCCCCTTCCCAACAAAGCTGACAACAATTGCACCAGCTTCTAAA
CTCTGATGCAGACAACTGCCCCATGAGACATCACCTCTTTTTATGAAGGGAAACCACTCT
AGGCCCATAGCTCCCCTGGTGTCTCTCCTCCTAATTATTTGTAAGTGGTGGGGGGAAAGG
AACCAAATCTTATGAACTGCCTTCCCTCCATTATACCTCTGAATGGCCATAATAAAAGTC
AAAAGGACCAATCCCAGCCCCTTTGGGCAAGGGTTTTGAATGTTTTGTATGTGTATTGGT
CCACGTGTTGCCTTTTTTTTTTGTCTGAACTTTAACTCCGCTACTAGTATGTTGGGGGAC
ACTCTAGTTAAACATTAAAGTCATGACATGCATGTGAGTCCACCTTTGCTTTTCTCATAG
GCAGCACCCACTGTTGGTGGTAAGGAGGAAAGTGAAATAGCCCATTCTAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 51259..51366, 51936..52034, 52767..52835, 52936..52990, 53503..53706, 55176..55344, 56300..56426, 56568..56678, 59204..59374, 59804..59931, 61852..62092, 63080..63199, 63300..63422, 63523..63674, 63775..63891, 63994..64027, 65222..65423, 66934..67080, 67913..68037, 68292..68578, 69187..69265, 71503..71733, 73085..73091, 73158..73294, 74463..74642, 76436..76543, 76546..76551, 76782..76892, 77346..77423, 77592..77769, 78671..78801, 79548..79844, 82035..82175, 82279..82383, 83014..83133, 84597..84788, 85349..85491, 86003..86111, 86422..86591, 87582..87813, 90038..90286, 91923..92086, 92501..92618, 93746..93847, 99658..99831, 101712..101861, 102578..102758, 109968..110100, 112775..112855, 112857..112910, 113094..113172
1001..1102, 51259..51366, 51936..52034, 52767..52835, 52936..52990, 53503..53706, 55176..55344, 56300..56426, 56568..56678, 59204..59374, 59804..59931, 61852..62092, 63080..63199, 63300..63422, 63523..63674, 63775..63891, 63994..64027, 65222..65423, 66934..67080, 67913..68037, 68292..68578, 69187..69265, 71503..71733, 73085..73091, 73158..73294, 74463..74642, 76436..76543, 76546..76551, 76782..76892, 77346..77423, 77592..77769, 78671..78801, 79548..79844, 82035..82175, 82279..82383, 83014..83133, 84597..84788, 85349..85491, 86003..86111, 86422..86591, 87582..87813, 90038..90286, 91923..92086, 92501..92618, 93746..93847, 99658..99831, 101712..101861, 102578..102758, 109968..110100, 112775..112855, 112857..112910, 113094..113169
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved