Dasypus_novemcinctus Locus SPHKAP
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SPHKAP
Dasypus_novemcinctus
SPHKAP
GeneScaffold_4645
SNORA38
175717..175848
182321
CCTACTGGTAGGAATATGGAAAAGTATATTTACTCCTTCTTGTTGGTGGAAGTCCAAAG
TTTTTTTGTTTTGATTTGGTTTTAGAGATTTTTTAAAATGTGAAAAGCAGCAGAGTCAAC
AGTGCCCTCAACACAAGCCATTGCTGCTATCAACTCATTTTTAAAGATACATCTGCCATT
TTTTGCACAATAGGATACTGAGGCAAGCAGGGGGGAGAAGGCGGGTTGTGGCAGCCCTCC
CGTCACCTCTGATGGATGGCCGTGCCACCGTCCTGAGATCTCTTCGTCGACACAACGTTC
TTACAGGTGAGCCATAATTAAACAACATAAGCTAGACGAAGAATTGCCAGGATCATAACA
CAAAAGGAAGATCCCAAGTAAAGGACCAATAAACTGAGAATCAAAGAGAGTACTGCTGAG
TGATCAACCATTACGCTCAGAAGAAAGTAAAAAATCAATCGAGAGGAGCAAAAGAAACGG
TGCGCGACCAGTGGGGGACTGTGGGCATTGCTAGAAACTGAGGGCGTGAATGTGGAAAAG
TGGATGAACAACTTCAGGGCTCAGTCCTGCTGTGCGAGAGAAAGAAAGGGAGGGAGGAGA
CTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCCTATTTTTCCTGCGCGCCCAGCGACAATGGATGGCAACTCTCTCT
CGTCTCTCCGTACCAAGGTAGGACCCGCATCCTCCAAAGCTCGCCCAGGGTCCCTCAATC
TCCGTTTCGTCCCCGGGTCCCTCGCGAACTTGCCCCGGGGCGCCTGGGTCTGCACGGGGC
TCCCACAGAGGGGACTGGGGACGGCTGCACGTGGAAATACCTCGAGCCCAAGCGAGCCGC
TCTTGGCCACCAAGGTCCCTGTCAACCGCCCCGCAGGGCGCGAGGCTGGGTGGGGCCCAG
ACGCGGGAGCGCTTTGGGGGAGTGGGCGGCAACCCCGCACCACCTCTCGATCTGGAGACC
TGGGGTCTGCTCTGCCCGGTGGGAGCCAGAAGCCGGACTTTCCGTCAACGCGCCTTGTGG
GGAGACGGGGTTCCAAGGTAGGGATGAGAAGCAGGAGGGAGCAGGACTAGGGTAAAGTAC
TCTCACTTCCCGTCCTTCTGACCCTGCCTGGTTTCTGCGGCTGCGGGTTGGGGGCAGTGT
CGCTGGCCGCCTACCCGACAGTGAGGGCGCCCTGGCCCGAACCCGGAGAGTAAAAACCTT
GGTGCCTTACAATCCCACCGGCCTCACCTGTCCCTGAATCCCTTCGCCATTGTGTGTTCC
CTCCTTAACATCCCGGCCGCGCCCACCCCTGACTTTACCCAGCCCCAAGCACCCACGTGG
AGGAGGTCAGGGCCGCCGCCTTAGGCGCGCGGGGTGGAAATAACGTGTCGTCCTTGCGTT
TGTGGCTTCTCATCTTCCTTGGCACTTCTCTCCTTTTGCCCTGCTTTGCGCTATTTTGCG
GGTTTAAGAACCCGAAACTTTTAGATTTCTTATCCTTAAACCTCAGAGGTAAATTGGGGG
TGTAGAGCTGACTGGGTTCATCCCGCTGGAGTGGTGCTTTTGTGCTCTTTGCGCCCAGGA
AGCCGCGTTCACCTCGAGAACAGAAGCGTGCTGCTGCTCTCAGCGTGAAGGTCTCGCTGC
TGCCGGCACAGCCACACCTCTCTTCCGTAGGGGGTTAGTGCTGATTGTCCCCGCATCCCT
CACGTCCCCTCTTTCCCAAGCAAACATCTAAGCAGCTTCCACCCGAGAATGTCAGGTACT
GGATTCATATCTCAAGCGCGGATTCTTGGAGAGCAGCAAAGACCCAACATCCTCAAGCAG
GGGCTCACACGCGGCGATGCTACATTGCCAAGTAGCCCAGATGGGGCTGGGAAAGGTGGG
GCTGGAGAGGACGGAGACTGCTTTTCAAAGGTGTCGAAGGCTGCCATCTAGAGACCTCAA
ATGCTATAAATATTATTCTGTAAGGAAGTTGGTTTTTCCCAACTCCACGGGTATTTCCTC
TGTAAGCACGCATTCTCTGTGGGTTTGTAAAAGGCTCTGGAAAGGCCCGCTCTGATTTCC
GTGCACCTTAAATGAGAAATCTCTTACCCTCAAAACCAGTACCTTCAAACCGCCACTAAG
CCTTTCCGTTCTGCTCTAATGAATGAAGAGGACAGAAAGGAGAGCAGGATTTTTTTTTTC
ATTTTATAAAAACAATAGTGTACTGACTTTTAGGAAAAACTAAGCAAATGAAAGTCAAGA
AAATTGAGGGTTCTCTCACTACACACATCTATTCTTCTGTTCAAGGCAAATGATCATTAA
AATTGAAATGCTGAACTGTGTGGTTCCATCATTCCAAAAGACACACTTTTGATAGGAAGT
TGCTTGCTTTAAATCCAGTTTTACAGACTATACGGCCATGCTGAAACACGAGTATCTTTC
CATTCAAGAGCTGGGTCATCTTCTAAGATACTAGAAACACATTGTGCCACTAATTTCTTA
AAATTATATCTTTTATTCAGTACTGTAAAGTGACCTTATAAAGAGCAAATCAACTGTAAA
AATATCACCCTTTATCTTATAGCAGCACTATTAAAACGGTATAAGATTTCAGGTCAGAAG
CTACAAATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCATTA
GAATTATAAAACATTCTGTTTAAAAATTAGACAGAAAATGAAATTATTTATTAATATATC
AAGTTTAATTATAGTAATACATTTTTGGTGTTCGCTTTTACATTTTCTTAAAATATTCAA
TTAATCAAACAGAAATATAAATTTTAATCAAGCAATAGCCAATGAAGCTTCAAAATTTAA
TTTGACTGGTATACTTGGAAATTTGAAACATGACTTTCAAAATGGTTCTTGAGTTATTAT
ACAATGTTACCTCACTGTGAAAGCTCCAATTATTTTTACTATGAATAATTTCATGTTTAA
ATGTAGACTAAATTACATAGATAATATTCAAGATTTCTTAAAATTACCAGTTATCAAAGC
TAGAAGATTTCTCCAATATGGAAACTGAACTGGGGAGAGATGAAATTTTCCCATTGTTAG
TTGCATTATAGATCCAGAATCCAATTGTTTTCTAACTAGTAGTCCAGTTCAAGGAAAAAC
AACAACAAAAATATTTATTATTTTAGAACTAAAAATTTTGGGAAAGATACTATAGTCATT
GATTTTACAAAGAGCTTACTTGATTCAATAAGGTCACAAAACTAGGTATTAGGAAATGAA
AAGAGTACAGGGATCAAATAACTCTCATCCAGAGTCCTTCCGCTGCAACAGTACATTGTC
TCTAATTGTTATCCCTTATAGAAGAAAGTTGGTTTCACTTATATTAGTTATGGCGTGTAT
ATAGAAAGGTTTATATTTTATCAAGCATTATCACATATATTAAATTATCTGTTCATTATG
TTCCTGTAAGTTAATTAGAACAGATATTATTATCTCCACTTCCTGGCTGAAAAATATGAG
CAAAAGGAAATTAAATGAAGTAAATAATTGGATTAAAGATCTGCACAAATTTTTATGTAT
GTAGCATGACCAGGTCATCCACAAAGTTCTTCTGGATTCAAGTCCAGTTTCTTTACGTGT
ATTGATTGAAAATCCACACTTTATTTCAAATGGGGGCAGGAGTAGATTTTGATGCACAGT
TTTGAATGAATAGTTAAATCACTTAGAACATATAGGGGTAGCCTAAAAGCAAGATCATCT
TTTAAGCTCCATGTAACTGAAAATCACTTTTTACAAACAGAAATAATATGTCACCTTGAC
CATATCAGAGCTGAATTCAAAGTTTGAAAAAGAGACCTTTCTTATTTTCTAAATCATTTG
CCTTCTATGCTATATTGTTTTATTCTTTTGTTTTCCTTGGCTTACTGCATTTCTATTTCA
ATAGTTTTTCTATGGCACTTTGAATGAGAAAGTCATTGAAGATAAACTTGTGAGGAAATA
AGATATATTGATTTCGATTTCTTGTCAGTTTATTTTAACCAATCCTAGGTTTGACCTAGC
AACATTTCAGTAAAGCCCATCCAAATCTCAAGGCTTAGTTCCTTGAGATTCTACTTAAAA
CAACAGGATAATTTTATAAATGAGTCACAAAACCTAATACTGTAAATGAGACCAAGATGT
TATATCAACAAGCTTTTATTGAAAGGGTATCTATTTTCAAATTCATACAAAAGGAAAAAG
TCAAGAGAACATTTCAGAAAGATTAACATGTCACTCTTAACATGTCAGGGAGCAGGGGAA
GGTATCAAATATCTGTACGTGAAGTGTAAATTTAAGACCGTTTTCCTGAAAGGCGAGTTT
TCTTCAAGGCAGTGCTGAGTTCTGGTCATATCTCCCAGTTCAGAATTCTTCAGGAAAGAC
TGCCCAAGGGGTGCAGTATTTCCTACAGGGAGAGAAATGGGAATTTATAAATGTGGGTGC
CCGGGACTCATGACCTCAGTGCTGAGGGCCACTGTGTGCCTCGTGAACATTATAAAAAGC
GCCGAAGCCCACCATTGACATTATACTTTAGGCACTGACACTATTGGGAGCTGGCCTGGG
TCCTTGACCTCCATCCATGTGGTTCCATTAGAAAAATCTGTATCTGCTATTAAATAATTG
ACTTGTAAATGAGCTACTAGATTTCACCTTGTTCACAAGAGGAAAACTTTGCTAAGTGCT
GTTCATTAGAATGGGGGTTCATTCTGTGCGCGTGAGAGAGAGTTATTGCCACGAAGAATT
GTAAGGTGGGGAAGAGGGAAAAGTGATGAATTTGACATCTGGAGACCTGGTGTTAAGTCC
TGTTCTGAAATTAACATCTGTGACTGCCGGGGCACCAGTGCTTGACCAGTTGGTCCTCTG
CCTCCTTGTAGATACACTGGCAGAGTTGGCAACATGATCTTCTAGGTCTCTTTTAGTTCT
AAACTTTTAGAATGCCATGGCCTTTGTTACATTAAATACTCTCCAGTGGGCACAATGTGG
GGAACTTACCACTCTCTGGAAAGGGACAGGTGAAACTGAGACATTTCAAAAGAACTGAAG
TAACACCCACCCATCTAAAAAATCACCCAACTTGGAGAATGCGTTGGCTTGTTTTTAATA
TTCCCTGATGACTTAGAGCAGCTTCAAGCACACAGAAAGTGTAGTAAAAGCTGAAGATGC
TGGCTCCACCACTTGCTGCTAGTCATACATCCTGGGGCAAGATGCTTACACATGCTGTGT
CTTATTTTCTTCAACTGGAAAATGTAACCAATAACAGTACTTCAAACCCTTCAAAAAACT
GTTGTGGGGATGAATTGATATAGCGTGTGTGATGTACAAGGAACAGTGAAAAATTAGCTC
TTGCTTCCTATCATAAACTCATCTAAGTATGAATGTTTTGTGATAGATTTTTAAAATTAA
TACTGGGGAGTAGCTAACATAACAGACATGAAGTCCTCTTCATCCGATGTCAATGTATCA
GGTTAATCTAGCTTTCCAATGATTAGTCTTTGCATAATATATCTTTCCCTTACTTTTACT
GCTAATGTATCTGTCTTTGCATTTAAAGTGATTTCTTATAGATAGAATATTATTGTCCTA
CTTTTTATCCCATCTAACAATGTATTTATATAAATTGGTATGTTCAGATAATTCACTTTT
ATTATGAGTCTAGAAAAGGCTAGATTAAAATCTAGCTAGCCATTTTTTGTTCTATCTGTT
CTTTGTTCCTTTTTTAAAAAAAATTGGTCTTCCTTTGACTTAATTCAGCAATTTTATGAT
TCCATTTTATCTCTACTATTGACTTATACCTCTTTTTAAAAATTTAGTGGTTGCCCCTAT
GGTATAATTTATATATATATTATACCCCTACGACATAAGGGTATTTTATATATATACATA
TATATATATATATGTAAATCAGAGTCTACCCTTCAAATTATATTATAACCACTTTCTTAT
GCCAAGAGATTATTAAAAAATTCTGCCCCTTTAACCCCTTTTGTGCTATAGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACCTA
TCTTCACATTCATTGATTCTTTCCCTGCTGAGTGGCATTATGAGTGGCAATGAATGAACT
CATTGAAAGCATTCTTCATTCTCTTACTGTGTTTTGCATTTCTAGCATTTCCACTTAATT
CTATCTTATAGTTTTTATCACTCTCCTGAAATTATCCATGTGATCTTGTGCATTGTCCAC
CTTTTCCACCAGAGACTTTAAAATATTAATTACTGATAATTTCAATTCATTGTAAGCTAG
TTCCAATGTATGTGTCATAGCTGAGTTTAGTTCTGCTGATTGCTTTGTCCATTAGAAGTT
TGTTGTTTTATTCCTTGACTGTTCATATACCTTGTAATTTTTTGGTGAAAACCAAATATC
TTGTATAAAGCAATAGAGACTGAATTAAACACTTTTTAAGTCAGAAAATGGTAGGCCTAT
AGTGTGGGAGTTTATGTTACCTAATTTAAGACTTGACTGAATTTAGAGGCTGTTGTTGCT
ATCGGTACCCTCAAGGCACCTAAAGTTTCACATTCCTCTAGTGCTACATTGCATTTAAGA
TTGAGCTGGTTTGCAAGATGCTTATGCCCCATATCTGTTCCAACATGAGCTTTAGATATT
CCCTTTGCTCAGGGAGAGTCTGTCTCTATGCTCTTGTAGCTTTTCTAGAAGAAAAAATCT
ACTATTACTTTTTACTCAAAGTTGTGAACCTTGTGTTAAGGAAGGTGTCTTTTTTGGTTC
TGGTTAAATCTTAGGCAGGTACTGTGATCCCCGGGCTCCAAGCTCTTCCATCTTCTCTGT
TGTTCTGAGCCCTGCATATATTCCTGCCCCTCCCCTGAGGATAAAGGATTTGCTTCTGTT
CTCTTCTCACAGCTGCACTAGATTTTCACTGGTTCCCTAAGGATGACCTTTTTGCCTTTC
CCGCTGGACATCAAGGCTTTTTGCTGTTAGGGCAGATTGGGCAGAAGGGTCCAGGCAGAG
TTGTGTGCCCCTCTTACAGAGCTCTTCTTTGCTTCCCTCAAGAAAGATGTATTCTCAGAA
TGCTCATCAATCTATGTTGTAAAAGGGTGCAGTCTCCCCCTATGTCTGCAGTTACCTGGG
TCTCTGCACTCTCCTACCAGCGCATGACAGGCCTTCATCAATTCTTTAACTATTCTTGCT
CAGTTCTTCTTGCTGGTGTCTGGTTGCATCTACCTCAGGTAAAGAAGTGCACATGTTCCA
TCTCTCCCAGGAGCACCTATCTCTCCTTAGATTTTGAGCTAGTTGGTAGCCTTATGACCT
CAGCACTTTCAGAAGTTCAAGAAAATTCATGTACTTGCAGTTTGCCTGGCTTTAGTTATG
GTGGTGATGGTAGGAATTAGAGCAACTTTCTTTCTAAGATAATCTACTCCCTCACCTTTT
TCCAGCTTCTAGAGGCCACTCATATTCCTTGGTTTATGGCACCTGTAGTTGTCAGCCAAA
GGGATGCTGATGCAAAATACCTGAAATCAGTTGGTTTTTAGAAAAGGTGTTTATTTGGAG
GTAGATGCTTACTGTCATAATGCACTAAAGAGTCCAAATCAAGATACTGTAAGAGGTACT
TTCTCACCAAGAGTCTGCTGGCACATGTTGATGCAAGATAGCAGGTAATGTCTGCAAGGG
TTCAGCCTTCCTTCACTTCCCAAGGCTCCATGGTCCCAACTTCTTCCAACCTCAGCCACA
GGCTGAGGCAAGTCTTGTCTCTCTTTTGCAGCTCATTTCTCTCTGGCTCAGCTGCTCTGC
TCTCTCCACAAGACCAGCTATTAAACTACCAAGTGAATAGCTTGTCTTTCTTCCCAGGGC
CTCTGCTGTGTCTAATGGAGCCTTCTCTCTTTCCTATGTATTGCTTCTCCATGTGTTTAC
TCCACAGGGCTCCAGCATTAAAGCTCTATCTCTCTCCTCTGCCTTGTTGTTTTCTCTGTG
AGTCCCTGCCTACCAAAGGGGTGGGGACTTGATGTCTTACTGATATGGCCCAATCAAAGC
CCTAGTCATAATTTGATCAAGTAAAAGTGAAATCTCCGAATTTAATACAATCTAAGGATA
TCACTAGCACAGAGGAACAGATCAGTTTCTAAGCATAATATTTCTTTTTGGAATTCATCA
ATAATATCAAACTACTACATAGCCCTTCCTTTTATCTCAGAGCCAGCAATGGTGGGATGT
GTCCTTCCAACACTGCATTACTCTAACTAACTCTCTGTCTTTCTCTTCCACTTTTAGACG
CTTGTGATACCTAGGGTCCATCCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTAAGGGATTTCA
AAGGTCATTTTGATTCTACACAAATTTCATGATAGGCAATGGCAATAGATCCTACACCCC
ATGTTAAATGCTTCTGTGCTGCAAAGCAGTTGACATAACACTGATAATGGTAGCATATCA
ACATGAGAGAAGCAAGATTGGAGAGTCAGTTGCCAAGCAACAGTTTTTGAACAGACCTTC
GCTCCAGACACCTTCAAGGCTCTGGAATAGAATATAGAGAAAGACTGAGTCCCACCCTTG
AGGAGCTTACTTATCAGTGCACAGGCACGTGGACATTGGGGGCCACTGAGAACAGGGGGT
GAAATGAGACATGCTAGTGAGAAGATCCTCAGCACACTTTAAGTCTAATTTCTCTTTTCT
ACTCTTGAGTGATGGCTTTCTGGGGGAACCAAACTGATCAGTCCTCTTATTTGACTCTCA
GCAGCACTTGACAAGACTGACTTCTAACTTCTTTCTTTCCTTCTTTTTTTTAATAGAAAA
GTTTATGTTATTTAACAGAAAAGATGTAGGTTTACAGAAAAATCGTGTGGAAAATACAGA
GTTCCCATAAACCCCCATATTATTAACATCTTGCGTTAGTGTGGTACACTTGTTATAACT
GATGAAAGAATATTATTATAATTATATTATTAACTATAGTCCATGATTTACATTAGGGTT
CTTTGTGTTGTACAGTCCTGTGTTTTTGTAAAAAATTTTTCTAGTAACATATATGCACTC
TAACGTTTTCTTTTTAGCCACATTCAACTATATAATTCAGTGCTGTTAATTACGTTCACA
ATGTTGTACCATATTACCACCATCAATCACCAAAACTTTTCCATCAAGTAGACTATAAAA
TGTAAGCATTAATTCCCCTAACTTCTTAAAATAATTTCTCTCAAATGAAAAATTCAACCT
ATAAAATTTATCTTTTGAAACCCCTATCTCCTGATTATTTTACTTATTCTTACACTGGGT
TTGTTAAAAATAATAATAAGGTCCAAAATAACCATTTTATTGCCCGTTTTACCATTTATT
TTCTGTTAGCTATCACAAATTGTTAGTGGGAAAAAGATGGAGTTTCCATGACTAAGTCAA
TCACGCTGTCAGTCAAAATTTTTCTTTTAAGCAATTAACAAAATAATTTTCCTGTATTTC
AGAGGAATTGAATTGAACTGTAGCAAATTGGAATTCCTATGAAATAATGACCTATTCATA
TTTAATTAGATGCTCTTGAATGATAGACTATATCTGAAAAGTTGTAATAGTTTTTAAAAA
ATGATTAGTAGTGCATAAAGTAAAACCATCTCTTTTAGAATAAATATATAATATAATTTT
GTGGGACATATTTATCAATCATTTATTCCACAATGATTATATACATTACTGGTAAGGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTGGTATTTCCTTGGATAGATTTGCTAAAATCCTATG
GAATTAATGATGCTGGTGATGTGCTTAATTTGCATGGATAGCACGATGGAAAATCATGCT
CTGATGTCTCCAATCTAGAAGAAAAACATTTGCTGGCAGCAAAAAAACAAAACGAAACAA
AACAAAAAACATATAATCTTTTTTTCTAGGAGATGAAACAAGCAGAAGAATACACAGAGT
GGTCAAAAGATGAGGGAAGGAGAAGCTAATACACCCTATGATTTTAAAAAACAAAATAAA
TCATGTTTGGAAAGACTGACCTAAACCCCTGAACCTTATGTAACAGATCAATCCCTTTGG
ATGAGAGTAAAATAAGGACATTCACTTGGGCAAACTTTTCTTTTGACCCACATGAAGGCA
TATCTTAAATATTCTTTCATATATTGGTTGTAGTGTATTATTAAATTGATTTTAATGGAA
GCATCTCGTTTTCTTGCTCAAGGTCTCATCTGAAAGATTAGAGATTTTATTTTTTTCCAA
TGTTGAAATTAAAGAATTTAGTATAAAGTGCAAGGATAGATATCTGTAATAGAATGGAGG
CAATCAAAGGTAATGATAATGACTGCGTTTTCCAGAAAACATCCTTTAAGTGGGGAAAAG
ATAAGAACAAATCTTATCTTTTAGAATCTGTTAAAATCCTTTAACTTTAAACTGCATTTA
TTTGACATTTTAGCAAGAATGGCAACAAGATCTTCTTTTCAGTCCAATGATCCTGGGAAA
TTCTTTAAATTATTTTCTCAGATGTTTTTCCCACCACCTGTCGCCACTGCAGAAAATTTA
GCATTGACTTCAAATAGGTGCTTGTGCCTAATGTTTTGAGATCAACCAAGATGCTCAGAA
AGATAAGAAGAAACAACATCACTAAATGTTTGTTGAGCATCTACCAGTGACTAGTATTGT
CTTAGATCCTTAAGTGGTCCCTGCCCTTTCAGAACTCCCAAACTAAAAGGGGAGACAGAT
ATTACATTACAAACCATTTAGGTCAGTGCTATAAAAGGACATGGTCAGGATGCTGCTGGA
ACACACAGAAGTGCACTCATCACAGTCCTTGGGCTGAGAGGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAAAAATGGTTTATTGACGGCCGGCCGGACTCGGGAACT
TTCTGTTTCAATCCCGAGCCCCGAACAAGATTTTTAAGTGTCTTTTATACAGAGAGGAAA
GGCCAAATGGTCCTTTTGTTTCAGTTCTCAATAGGCTTGAATTAGCATGTATTTCCACAT
CTTAGGTAAGCTTTTACCATGGACCTCAGGCATTAGATAAGCATTTAGCATATTTGCTTT
GCATTTCCCTGAATACTTAAAGTTTATAGACCTTGCATTGTTAAACTGTTTCCTGCTCAC
CAAGGACAGGACTGCAACCTTTCATCATCCCACACCCACAAGTCAGATAGTTCAGGTTAT
CTCTGAAGAGGCAAAGCCTGCCACCCATAGCCCACATCAAGGGGAGTGGGAAGATGGGGT
TGGGGTAGAGGGGCTTGTGTGTGTACATACGTGTGTGTGTGATGTGTATGTGCATTTGAG
GCATGCTGGAGAGGAGTTGTCACATCCTTGACAGGAAGAGAGGAAGGAGGTATGAGAGAT
GATTTATAAACTGCGATCAAAGGGCAGAGTAGGAATTATCCACAGAGTGTTCCTAGAAGT
AGTATTATGTGCAAAGACCCAAGGATAATTGAGAATGTATTCTCAATTTACTATGTTGGG
GAAAACACTTCCAAAATGTTAGGAGGTGCATGAACCACCTGGCCTATTGTAAATAATTGT
CAAAATGCATACTCTGATTCAGCAGTTCTAGGGAGGGGCCTATGATTCTGGACATCTAAC
AGGCTCCCATGGGACACCAATGCTATAGATCTTGGACCAAACTTCGAGTGAGCACCAAGG
TTTTGGATGACCTTTATGACTGCCGTTCTATTTTCCAGCCATTTAAGTTCAACTACATAA
AGTGCTTTTTAGAATCAGCTATTTTGAATTTCTTATAATCTCATATCCTACTAGCCACTT
CTCCATACTTCATCCTTTCCCATCAACCTCATTGTCCTTGTTTCCTCATAATGATACTAT
GGTTCTAGACTCCTCCTCTGCCACTGCCATTCCCATTGAAAGTCATCATTTCTGAAAGTG
ACAGTCATTTTTTGATGACATGAGTTAAAATACAATAACCAAAATACAAAACAACAAACT
CAATGTCCTGGAACTGAGATGTTTGCCATTGTGGTTATTTATTGTTTAAACTTTATTTTA
AAAGAAGTTTTAGATTACAGAAAAGTTACATAAAAAATATAGGGGATTCCCATATACCCT
ACCTCTTCTCCCTCTCAACATCTTCCCCTATTAATAACATTTTACATTAGTGTGGTATAT
TCGTTACAATTGGTGAACAAATATTGAAGCATGATACTGACCAAGCTATTTTATACTTTG
CACCAAGATGTTTTATACTTTGCACCATACAATTTTATAGGCTTTAGCAAAATGTATAAA
TGGCTTTTGTCCATCATTACAATATCATGCAGAATAATTCCAATGCTCTAAAATTGTGCT
ATATTCCACTTTTCTTCTGCCTCTCTCCCCTCAGAACCTCTGGTAACCACTGTCTTTATA
TCAATGTTATAAGTTCTTCATTTCTACAATATTAATGTCTATTTATTCCAGGGTTGCATT
ACTCCTTATGTTTGTTCATTCCTCAATCTTGGTAATTTTGGGATGGTAATGCTCATTCTG
CTTTAGATTGAGATGGGGCTTAGATCTTATAGGCAGATGGAAGAAACTGTTTTGCTTGAA
ATTGTAGATACTCTTTGCTTTGGGGGAGGTTATGCATTTTTTAAAATTTCTCTGTGGTGC
TTAAAAACTTTTTCATGGAAGTAGTCTGTCTGCTTTTGCTATAAAACAGGAATGTTTTTT
AAAGATTTTATTTTTTATTTATTTCTCTTTCCTCCTCCCCCCCCCCCCCCGCCAAGTTGT
CTGCTCTCTGTGTCCATTTCACTGTGCATTCTTCTGTGTCTGCTTATATTATTGTCAGTG
GCACCAGCTATCTGTGTCTCTTTTTGTTGTATCATCTTCCTGCATCAATTCTCCATGTGT
GCAGCACCACACCTGTCATTTTCTCTGTGAGTCCCCACCCACCAAGGGGCAGGCACTTAG
CATCCTACTGATGTGGCCCAATCAATTGCCTTAATCATTATTTAATCAAGTAAAAGTGAA
AGTTCTGAATTCAATATAATCGAATATGCCCACAGGGACAGACCAGTTTACAAACATAAT
CCAAAATCTATTTATAGAATTCATAAACAAGATCAAACTGCTACAAGGAAGTTTTCAATT
ATTTTTAGCCATAATTAATTATTAGTTATTTCTTATAAAGAGATTTGAAATGTGTGAATG
TATCCTAACATTGTTTCACACTTGGGATGTAGTGGAATGTTCTGAGCACAGACTATATAG
TTAGCCTTATGTTAACTTGGATCTTGTTTCTTCCATTTCCTAGATGATGCACAGAAAAGC
AGAGTGACTAAGTGCTAGTACTCTGGAATCAGACTATTGGGTTTGACACCAGTTCTGCTA
CAATTTAGCAATGTCTCAGTTTAGTTATCTGGAAAATGAAAATAAATTACATCTGTTTTA
CTGGGTATTTATGGAGATTAAACGAAGTAATACAAATCAAGCATTTAGCACAGTGCCTAG
GCAAGTAATTTCATTTTGTTTTCCACAATTTGTTCTTCTTTAAAATGGAAGTAATGAAAA
CAGTCACCTCATTGGAATGTGATGATTAAGTGAAATAATAATGCACAGTGCCTTGTATAT
AATATGCACCAGTAAAGCTTCACTATCATATTATTCATGCTATACAGTGTTATAAAGTGA
TCTCTAAATATTTTGCTAGTAAGAAGAATTTTATTTCACAGACTACTTATTATTTCACTC
TCAAGGACTGCATGTTTGTCTACCTGTGTGTATAACAAACCAGCCAAAGATCTTTGACTT
CAAAAATAGCCTTAGGGATCTCATATCCCATCCTAGCACAGAGCTCTCCCTGTGGCAGGG
CTTAGCCCATCTTTGTGGATGGGTTACCAGCAAAGGTGAGGAGGAGGAGGTAGAGCCCAA
AGACCATGTCCATGCATCCCTTGCTTCACTGCAAGTGACATCTTGAACCATTGGTTGGTT
TTATCAAACACATCCTAACAAGCTCATTTCAGAATGTAATGGGCATAAATTAGAGGGCAC
ATCTGGAATTTAGTTATGTTTTTAAATCAAGATTTAAACATCTGAAGACATCTGGGTTCT
TTGCAATGTAGGAAACGTGATATTACAAACTGGTTTAGGGCATGGGCTTAAAACCCAAAG
CTGATTTTGAGTGCAAGCTTTCCACGTCATACATCATAATTGCTTGACCTTGAAAAATAA
CTTAAATCCTCTAGGACTCAATTTCTTCCTTTGTAAAGTTGAGGGGTAGTTAAACTGCCC
TCCTCATCTGGTTGTCAGGAAGATTGAAAGATATATTACATATGTCTGGCATGTAGTAGG
TGCTCAGTAAATGTTTATTATTAATATTGTTGTCAACTCTTTCAGAAGTTCATAAAGAAT
CGTTGCATTCTCTAGAATAATTATGTACATGTATAATGGTTTCAGAGCCTATTAGACAAT
AAGAAAGTAAGTATTAAGTATATGACAGATCTGGGTTGAGATTCCAGCTCCTCTCTTTAT
CAGCTGTGAACAAAACTGAGTTCATTAACCTCTTTGAGTGTTGGTTTCCTCATTTCTATA
AAAAGGATAGCAATAATACTATAATACTATTAGCAAAAGAGGAGGACTGTATACACTTTT
CCTTATCAAGCAATTACCATATTCCCGGACAAATCATAAAGTCCAAATAAATGTCAATAG
TTACTGTTGTTGTTGCTATTACTATTTTCAATGCCTTGTGTTGAATAGCTACAAGAATTC
TCATTCAAATAACTGGAAAAAAATTTTTTTCCCAATTTATGTTGTCAACTGCTCCCCCCA
AGTTTGTAATAATAATAGATAATGTGCTGAGTAGGTTCTTCATGTCAACTTATTCTACAA
GAACTTATTCATTGAATCCTCAAAAGAACCCTATAGCATAGTTAGTATTATTATTATCCC
CTTTTGAAGATGATGAAAATGAGAGAGAAGATCAGTATCTGGGCCAAGGTAACACAGTTA
GGAAGTGGCAAAGCTGGGATTTGAACTTCATCATTCTGGCTGCAAAGCCTGCCTATCTTA
ACCCTTAACCTCCTCTACTCATTGTCACAAGGGTTGTAGCCTGTTCATCAAACTCAAAAT
AAGTGCACACACGAATATGCCCTGCACTTGCCAATAAAAGACATTCGCTTTGTCCTGCTC
TGATCTCTTCCTCAGCAGGCAGCAGGCTATTTGAACTTGCAAGTTAATTTCCACAACTGG
ACGCTTTTCTCTCTGGGGAAATAACTAATTCCTCCCTGGGTCTTTTTCACTACTGACGGT
GACCTACTTATTTATGCTGCATGAGTCATTGATGACTCCTGTACAGTGGTAAATTAGCAT
CTCATTCATATATAACATTTTCTATAAGGAAGGCTGCTTCTTTTTCCATTACATGTTTTA
GTCACTACTTCAAATTGTGCTTTTGTACCTTCTTTCCCACCTTTTCTACCTCCTCATTAA
AACACATTTATTAATTTCAGCAAGAAACTTTTCTGAAAGGATGTGCTTAATAAATATTGT
CAACACTTGTCAAAATCAAAGGAAAATGTTCCAGGGAAAATCTGCAGCCTTATCCATTAG
GAGCGCATTTTAAGGCTGTACTGTCTCTTGATGGCAGTTTTTAATGTCAATTTAACTCAT
GTTAATAAATGCATGAGTTTCATGCCACTTCCATCTCTGCTTCATCATGTAACCGCAAAT
GTTCTGCTTCTCTAGGGATCAAGGACAGCATTGTTGCAAATATTTTAAAAATTCCATCAC
TGTCCAAAAAGCATGGGAACAGATTGCTCTGTGTTTAAAGTCACCTATTGGAAACGCGCA
TGTCACATAGTTTAAAAGAGAATTCTTCAGTATGTATACATTTGGGTAGCAGGCATCATT
AAATTGATTCCTAATACATTTCTGGAAACCAGAAGATACATTTGCTTTGCATATTAGTGT
AATGGAGTTGCATTACACTTTTTAAAGTAATGCACTGATTTTAGCTCCACCGTGTGACAC
CTCTACCTCATTTAATTCTCAACATAATAAGCAAAAGTATCTTTGCTGTCCATGTTTAGC
ATTACAACAATTGGAGCAAGCCCTGCAAGCAAACAAAGGCACTTTCAAATTCTCTTTATT
GCCTTCATTTACAACAGGATTTCATGGTCGTCAAAAAGGCAGAAGGATTTTTATACCAAG
GTATCTATGTGAATAATTGTCCTTTCTTCCTACCCCGGGGCTAGCTCAGCAGTTCTTAAA
CTTTACATAAAATGTACATTAACAGGTTGTCTGCCTAAAGCCATATACAATGTGTTTCAT
GGGCAAATAAGAAATTTTCAAGGATGATCTTTTACTCTTCTCTATTTTCAAATTGCCTCC
TGAACCAGACCTAAGCAACTCTGCCCAATTTCGATGTGATTCCTCCCTGGAGCAGTCAGA
GATCATTGAAATTCTACTTCTGTTGGTTTTTTTAATCAGGGGTGAGCAGCCTGAGGGCTA
TCTCAGCCTTACTTCTCAATTTGCCTACTTCCCACTCCCCAGGTTGCTAACCCTGTAAAA
AGATGTAGGAGATATGATAATGCTGGACATATCCTAGGATGGCTAGATGCCTGGGGGCAC
AGTAGCCATAGTATGCCTAGCTGTGTACACACTACAGTTTGTCTTCCTAAACTCCTGCAC
ACAGGACCTTGACCAACTCCTAGAAGCAATAATATGTGATTTCCTTTACTCGTGGGTCAA
GTTATAGAGACCAAGATTAGCTTGGTCTGTGGTCTTATCTTCGACCTGTAAAAATTTGGA
ACCTAACACTCATACCTGTTTGTCCTTTGGGTATAGGCCAGACTTTCCTATGGACAAAAA
TTGTCAACACTTAGAAAACATTAAGAGGAATATCTGCAGTTGGGTTTGAGGTGGAGTCAT
CCTTAAATTGCAGCTTAACAGGAGAATCGCATCCATCAACCATGTGGGATCCAAGCCCCC
TCTCGATAAAGAGACATCACCAACCCAGGGTCCACAGGATGGAGGAATAAAATATGGATT
AGAGTGAACTTACTGGTATTCTACTGTAGAGCTATTGTGACTAGTAATGGAAGAAACTGT
AGCAATGATCTGGAGAAAGTGGCCATAGTAGTTGCTGAGGGCAGAGAAAGGAAAGAAGTG
AGATGTGCAGGCATTTTTGGGACTTGGAGTTGTCCTAAATTGAGGGCGCGCGGCGGACAG
CGGGTGGTGTCAAGGGCGGACACACAGCGGTGCGAAGAATGCTGCGGAGACGGAGAGTGG
TGGCAACGCGTCTGCTTTATTGAGGAAGACAAGCGTTAATAGTGAGGCTAGGGCGCTGGC
GGTAGCAAGGCTAAGCCAAATAAGGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTAGCTTTAAAAAAAGGACAATTTAATAAAATAAATAAATAAATT
TATATAAAAATGCTTATAAATAAATAAATGCAGCTTAAGAAGTTATAGGCCCAACTTTGT
GGTGGTAAATCTATACATTTAAGTGCTGAAAACACAGGCCTGCTATGATATTCTGCAAGG
GACTTCCAGTGGTAGGCAACATTATAGAATCTATTTTAAACACTTTTATAAATGAAGAGA
CTGAGATCAAGTAAGATTATACGGCATGCCCACGGTCATGGAGCTAGAAAGTGATAGCCA
GGATCTAGACCCAAATACTTTCTTTCTTTTTTTTTTTTAAACTCTCTCGCCCAAGTCAGA
GATATCATGGGTGCTAGCCTTATAGTCCCATAATTACTCAGAAAATGATATATGTACATT
TAAAACAAAACAGATTTTACTTCAAGTATTCTGTGCAATTTTACCTCAATTTATGATTTG
TTACATAGCACCATTAGTAGTCAGAAAAAAAAAGTCATTCATAGTAATTAATAATGGTTG
TGCTAACAAACTACACTCATACACTGACTTATGGCTAATTGTAATGCAATGAAAATTAAC
TAGTTTAGAAGGTAAAATATTAGGGTTACATATTAGTTAGAAATATGTTGTTTATTTAAT
GAATCTTCTATCTGAAGCCTTTTTAAGAGAAAAACTTTACATGTTGGGTTGAATTACATG
CAGAATTATTAGATCATATTCCAAAATGTATTTTAATGAATTGTACATATTCTATGTGGT
CAAAAGCAACCAAAAATAGACTATATATACCTGAAATATCAATATATTTTTTAATCCAAA
CTTCCCAGTAGAGAAATATTTGGAAATGTTTAAAAGACTCAGAGGGCTCTTTGTATTTAA
ATTAGGTTCAATTTTACATCTCAAGTCATATCATGAAAAGCCGTTTCAGCATTAATCTCA
ATTTCTTATCACTCCTGGAGGATGCAGAAATAGATTTAAAGCTTCCAAAATAGTTATGCA
TCACGGTACATAGTCAATCCCACTAAGATTTGACAGACTTGGGAGCAGGGATAGAAGTCT
GGAATTTCAGAAACAGAGGTTAAAATACTGCCTTTTGAGATGATAGAGTCATGACCTGCA
AATTCTCCTTATTGTTTTCATGGTAGCATCTTGCCTTCTGATTAATATTATGCTTCTCTT
TTTTCAGAAGTAAAATATGATTATGTGATGCTATAGGACCAGCTGAATTAAGGTAGCTAC
TAAAATGACTCAACTAGGGTTTTAAAACTCCCTACTTAAGAAAAGATGCTAACACTGCTA
GAAGACAGATGCAAGTGCATCCATCTAAGCTCTGTGAAAGGCATTGGATTGCAGTTTTAT
GTTCACAACACAGTAGTCCATGGAGGTTTCACAAATTACAAAAGCGAATCCAACAACAAC
AAAAAATGGCAATGTCAGCAGGAGGATTTGCAGTGTTTAATGCAATCTGGAAGATGGTTT
TTGATAAACCACAGCATGTTTCATTCCGTCTTCATTTCTGAATGTAAAATGACTCACTGG
AATGTGTTCTTTTTTGTGTTTTTGGGCACACACAGCAACTTGGAGTCCCCACCGATGTAT
GAAGTTTTGGATTCACATCAGGGCAGCGGCAGTGGCAGCTCAGGGAGCAGCTTGGGTGGC
TCAATCACAGCATGTAAGAAGGTAATCTTGCCTTACACCACTTTATTATCACAGGCTGAA
CCTGAACACAAACTTAGTTTGACTTTCAAGCGCCTTTCCTAAAGGTAAAAATAAATAACA
AAAACAAACATCAAAATGACTCATAATTTGCTGCCCACATAGCTTGTGATGATGTTAAAA
AAAATGTAGTTCATGCAAATGATCAGAAAATCTAGTATTTCAGATGGTATAAAGTGAAAA
TTATACCTACTCCCTACCACCTCAACCCCAATCTCTTCCTCAGTCCCTCTTCCCATACTT
TAACCTTGGCTAAGTTTCTGGTATTTCTTTTCAGAAAAAATTTCACATATTTTTCAATGG
TTTCATTTATATTGAGCCCATAGGTCTATATCCAAGAAAAATTTATGACTGTTCTCCTTT
CGATATTTTCCTAAAGAGATGTGTATCTTTGGCTCATTTTATTAGAAAATAGAAATGCAT
TTCCTAGAATATAGAGTCTGTAAACAAATCTTGCTTTAGGACACTTACAGAATGTTGTCA
TTTGTTTGACACATTTGAACATAAAATCATCACATTTTACCACCTTATTTTCCCAGAGAA
AACTAAAGAAAGAAATGCCTAATATCCTGATCCCCCACCTAATGTTTTTGCCACTGTTTG
ATGCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAAAGTACCAGAAATCTT
TTGGTTTTTATAAAGGGTATTTATTCTGTGGTAAAAGCTTACAGTTACAAGACTCTAAAG
AGTCCAACTCAAGGTACCGTAAGGGGTATTTTCTCACCAAAATCTATTGCCATGTGTAAA
GCAAGATGGTTGCCAATCTCTTTGAGGGCTCAGTCTTCCTCTTTCCTCTTAAGGCTCCAT
GGACCTAGCTTCTTCCAGTCTCAGCTGTAGGCTGGAGGGCTTGTTTATTCCAGGGCCTTC
TCAGCTGCAGAAGGGTTCTGGTCTCTTCAGCTGCAAACTCTCAAGTGAATGGCTCAGCTT
TCCCTGTGGCTTTAGCTTGTTGAGATTTCTCCTTTCTGTCACATGGCAGAACCGAAATGA
CAAAGTTCTCTCCTCTTCTGTGTCTATGGAGCTCTTTTCTTCCTGTGCCTTCTGTGTATC
TTCTTGAGTGAGTGTCCATTAATATCAGCCCAAGGGGGTGGGGACTCAACCGTGACCCAC
ACCCTACATGTGTGGTCGAATCAAAGCCCTAATCTTAGCATAATTTAGTCAGAGACATCT
CAGTTGAATCTAATACAATCAAAGGGGATCACAACCAGAAGAGTAGACCAATTTACAAAT
ACAATCTCTCTTTTTGGAATTCACACCCTCAAACTACCACAAGTTCCTTCTAATTTTTTT
TTAAAGTATAATTTCTACTGATTAGAGTCAGTGTAGTATAATTGTAAACAAACAATTGCA
GCCAACTGCCTGAATTTGACACCCAATTTCATCACTTAAACAGTGGTGTGATTTTGAGCA
AATTGCTTAACCTCTTCATAAACTCAATTTCTTCAGTGAAAAATGGAAATGGTATTACTT
CCCAGGTTGAGGTGAGGATTCAATGAGTTAATACATGTGAGGGGCTTAGAACAATGCCTG
TTACAGCATAAGCCCTCAAAATAATGATTTTAAATTATTTAATTATTAATAATTATTGAT
TTATTCTGCAGAATAATTTTATCAACAAGTGTTTGGTATCAGAAAATAATTCAGTATAAG
TATAGCCATGCTGAGAGAATTTTTAATCTATGCTGTTACCTCAGCTGCAATCATTTCCCT
GGAAAAGAGGTGATCATAGTCATTTCTTTAAAAAGCACATTTGGAGGCAACTGAACTGAT
AGAGCTTTTTGTAGTAGAGATTAACCTGAAAAGTTAAAATTAAAGCTTAATCATCTATTC
TATATTACTTCATCAGGACATATGTGTGTGTGTGGGGGCATATATATATATATATACTCA
CAAACAGGAAATTAAAGTTTTGAAAATAATCCCACTTATTCCACAGTTATTTCTAGAACT
CTCTCTACTTGAGCAGGTTGAAACATTAAATTATCTTTTTAACAGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTAACAGGTCAAAAATGGTCACATATTAAGGC
AATTTCATAGGGTTCAACCTAAATACATGCAAAACTCAATTAGTTCTTGTGGAGAGATAC
AAGGTCAGATGATAAATGGACCTGCCTTGAAGAACCCACAGTCTGATTTGGAAGATAATA
CTGATTTCTCATGTGAAAAGTCAAACAATAATTTATAAGTTAAATAATTATGTAAGGTAA
CTTTATTAAGTAATATCTCAAGATAGTACAAATTAGGTAAAATATTTCATTAGGTAAAAT
ATGACAATCAATGGTATTAAAAGTTAAGGGCACAGAAAGACCTTGGACCTTTAGTAGACA
GTAACATCTTCAAAAGGGAAGTGGAAATTAGTTTGCATTCTGAAATATGAGCAAGGTTTG
ATTGGATGAAGAGGATGGCCTGGCAAATTTAGGAAGGACTATTGTAAATTAATGTAGAAG
TCAACACCTTTGTGGGCAGGTAATATTATTTTTAACATTAATAGTAAATTCCCTTTTATT
TCTTATAATATCTTGAACTTTCATAATAATTGTGTATAAGAGACTACTCTAGTGGCCATG
TATTATGTGGACTATAACTGTTTGGCATCCCTTCTGAAGAATAACCCACTAGTGCTTTCT
TCTTTGTACCCAAAACACAGGCCCTGAATAAAAAGGCATGAAATATGTTGGGATTGAATC
ATGTCACCTACAAAAGGCATGCTCAACACTCAACCCCTGGTCCTATGGGAGTGAACCCAT
TTGTAAATATGACCTTTACAGATGTTATTAGTTAAGGTGCGCCCAAACTGAATGAGGGGT
CATTAATTCAATATGACTGAAGTCTTTATAAGTAACTGAAATTGGACACAGAGAAAGCTA
TAGAAAGCATGGAGATCCATGGGACCCAAAGAGAAAAGAGAAGACACTGCCATGTGTATT
GCCATGTGACAGAAAAGCCATGGCATGCCAAAGATTGCCTGCCAGCCAGGAGATACCGAC
CCCAGAAGGAAGCAAGCCTTCTAGCCCCTGAAACCATGAGCCAATAAATTCTTATTGTTA
AGCCAACACAGGGCATGCTGTTTGTTTTAGCAGATGGAAAGCTGAATCCGAATATGGAAT
GATTCCATGTCTTTCTTAATTATTTCATTATTATAGATTACTGCAAGATGACTGATTATT
GATAATTCTTTTTAAAACTAGTTAATAACTGGTAATGAAATTCGGACTATGAAGATATGT
ATGCTCATAAATGCACAAACAATGTATAATCTGAAAAAAAGAGGCAGAAACAACAAAGAA
CAGTAGTACCTTAGAAATAGCAATGCTATCCAGATGACTCATCAGTCTTTGCAGTCGATC
AAACTTCAATAAGAGTAACATGGATAATTGAAATCTATTGGTAATTCTTCAGACTCATTT
CATGGTATAGCTTCATCTTCTCCCCATCAAACCTTCATATCAGAACTGACATATTGCTAA
ATGAACTGGTGGAAGAAATAAGACCAGGGTCCAGAAGATAATGCATTTGTTAGGTAATCA
GCCTCTGAAAAATTGCACATCGACTGAACTTCTTTCATGTGCCACACAGTGAATCTCTAA
GGGTTTCACGAATCCTAACCAGCATAATTACTTCAGTTCCTCTTTGCTCTTGGGGAATAT
GGTCACTGGCAGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACT
ACTTGAGAGGACTCATTAATATATATTCTTGGTATTGAGGGACTGGCTTTATTCAGAGAT
AACTTGTCCAAACTACCCAGTCACAGTTTAAATATTTGTTCTGGCATTTTGTTAATTAAC
CATCTTTGTTCTCAAAAGTATACTGATATGCAAAATAAATAGTCATCCTAGCTCTTCTCT
TATGTCTTCTTTCTTTACTCCCCTTCTTGTAAGAGCTAGGAAAGTTTTCATGTAAATTCA
TATCAAGGTATTAATGACTGCATAACTTAATATAGTTGTGACCAAAAAAAAGTTTGCTAC
TACTACTACTGCTCTGTCCTTTAACTGACATTAATAACTGATCCCACTGAATGTGGCTAT
GATCATAGAATTCTACTCATCCCAGAGCTCTAAGCATCAAAGTTGGAATGTGAGATAACA
TATATATCATCTCTAATTTAATGAGCACCCAGTCCCAAGGGAAGTTTTAATGTATGCAGT
GTGATCCAACAAAATATTGCTTTTAAAATGATAGGATTCCAACATATTGTAATATAAAAG
GGAGAGAAAGAATTGCTGGTGGGAGGGAGCACTCAGTTACTCTCGTGCCATCCCTTGAAT
TATATCTCACATAGACATTGCCTGTGACTGGCCCTCCTTGTCATTGGGCCAGTCCTGCCA
ATAAAACAAATGCAACCACTGTTGTTAAACTGGGTAATAGAGATTTTCCAGTAAGTGAGC
AAAATAATTATAAATGTTGCCCTGCATCCATTAAACAATAAATGAAAGGTCTTTATATTA
TCTTTATAATAAATTAAAATATTTTATCTCTAGGAAGCCAGTAGTATGTCACGTAACTAA
CTTGGACTTGGCATCCAAAGACCAGAGTTATATTCTTATGTGATTTTAGGCCAGTTTTGT
AACCTTTCTGACTTATATTTTGGTGTCAATTTACATATGAAAAAGTTTATGGAAGCCCTT
GACACATAGTAGATGCTTAATAAATATTAGTTGATTCTAAATCACTGATCTTTCACCAAG
TGAAATTTACTTAAATGGAATTTTAAAACTCCTCTGAACATAGAACATGATATACCCTCA
TTTTATTGATATCTGTCATATTTTCCTCTACTTTGCAAGCATTATATTCAATGTCAGATT
TCCACAATAGCTGGATATATTCAACCCATGTTTTTACTTTACATGCTATTTTGGAAATGG
TGGAACCAAGTCTCCTAGTAACATTCATGCAAGGAAAGAATTGTTGGAGAAAAATCAACA
ACCCAAATCTTCTTTTTTTGTGTCATGTTAATTAAATCTGCTTTAAACTTATCAAAGGCA
GCAGACTGAAAACACTTCGGATTCCCAGAGGCAGAGTTTGATCTTAATATGACATCTGAT
CGACTCTTTGAAGTTTCAAGAGCATTCTTTGCCATGACAGGCCACCTTTAAATTGACTTA
AATTTGCTGTCAAATGTGGCTCAGATCCATCCAAAGGAAGATAGAATGATGTCCCTTGAC
ATTTCATCTCATTCTGTAAAATACACTTTCATCTAAATTCATATCTTTTTGATGACATGT
AATTAACTAAAGCAATTTAATTAATGTGTGCAGGCATGAGCATAGAAACTGGTAGGTTTT
TTCAGATTCTGATACATCTTTCTAAAGACATTTTTATTAGTCAAAATTATATTGCTCTTG
GCTGAAAGCCCCAGCAGTATTTCCAGGGAGTGAATTCTTTCATTGTTCTTAAAAGCTTGG
TATTCCCTTGATGGAAAATTGTTATAATTTTCTATATTCGTAGAAGCTATTTCCTTAAGG
CAAGGAAAAATTTTAAAGATAAAAAAATAAAACAATTTTAAAATGAAAAGAAATAATGTT
TAAACTATAGTTGCCTTTCTATGAAGGAACACACTGGGTTTTTAACCCTGGAATGTAACC
ACTCTTAGCTCTATAGATGCTCTTCTTTGATTAAGCATCCCGGCAAGAGTCTTAATGCCC
AGCTCTGATAGCAAAGAATGACCTATCCAATTTGTGTTACGTGGCAAGTTATCTTGTGTT
ATCACCATTCTGTAAGAGTAACTAGAAGGACTAAGGAAACAGGGAGATTTTTAAGAAAGT
AGAGAACTGTCTCACTAAAGGTGATATTTAAGGAAAGTTAACAATGCTGTTCTAAGGGAA
TTCCTTAGAGCAAAGGGAGACTGGAGTCTGGGATGCAAGGTGGGGTTAGGAGTCCAAGCT
TGGTGTGGGCAGGAGTAGGGGGAGAGAAGTGGAAACTGTGTAGAGACAGTGGGAGGAGAG
AACAATGAACCATGGTGAGATGCAGTTCGGATTAAAGATCATTAGCATTCTGTGGCAGTA
AGGGTAAAACAGGAGAATAAACTCTGACTATTTAGGTCAAGTCATGCATGATTGGGGTGC
CATCGAGGCATTGAGAAGAGGGGTTGGGGGGTAAGCAATGTCAAGAAGGCAAGAGTTCAG
ATTAAGGCCTAATTGCATCTAAAGAGCCAGCCACAAAATTCCCTGTGAGGGGCATGTGAT
GGTTAAGTTCATGTGCCAACTTGACCAGTCTATGATGTCTAGTTGCTTGGTCAGCAAGCA
CTGACCTGATTTACTGTGAGGATATTTAGTGGACTTAAATCATAAGTAAGTTCATTGCAT
CTATGACTGATTACATCTAAATCAACTGAGGAGATTACCTTCAACAATGAGAGATGTCTC
ATCCAGTGAGTTGAAGGCCTTACAAAGAGAAATGATTATTCCAGCACTCAGAAGGGAGAG
TTTTCATCTCTACTTCAGCCAGCCAGCTTCTCCTGGGGAATTCATTGAAAACTTTTTTCA
GCATCCCCAGCTTGTGGCCTGCCCTACAGAATTTGGACTTGCAATCTCCACAGTCAAATG
AGCCAATGTCTCCTGTCAGTTCTGTTTCTCTAGAAAACCCTGATTACTACAGGGCATTTT
TACAGACCACCTAAGGAAACTTCTCTATGCCCTGAACCACATTGACATCTAGGATGCTTC
AGGGTTACATTGAAGACAGAATATAAATACTGAAGGCTTCTGGGAGAGAAGCCTCTGCCC
TTAGCAAACATAGGTCAAGATGCTAGACATCTTCTCTAGCCTTCAAAGGCAGCCTGATGT
ACACTGAAACATTTGCTACTTGGTGGGCTTATTCTTTGGAAAATGTAAATTCAGTAATCC
CACATGGTAAAGTTTGTTTAAAACTATCAGTTATGGCTTATTTAGAGTTTGAATATGATT
CAGCGCATCTTATTCCAGGACTCACTAAGGACTTCTATTCACCACTCATTGTCTCCCTAC
AACAATTGATTCCCAGTGTTTAAGGTGTGTGTTCAACTTATTCTGTCTTCTACAGCTCTG
TTTCTTGAGCATCCTTTTATGCTATATGTGAGGAACTCCTGGAAGGATTTTGCAGTGCCT
TTTGTTAATGAAAAAGTAGGACTCTGAAAACCCAAAATAGCTTAGAACATTTTGTGGAAT
TGAAGATGATGCTGCACTATTAGAACTAGGCAAGTGATCTTTTTAAAAAAAAATTTTGTT
ATAATTACCCAGAAATTTATGTTATATATTAAATATCTCTATCCAGAAATGGAAAGGGTC
TAATATTAAAAATCTCTAATGTAACATCTAAAATTCCCCTATCTGTCTTCAGTAGTGAAA
GGGAGACCATCCATTCCTGCTCCCTATCACTGGTGCTCTCATCACTTTCAGTCCCCCATC
TAAGAAACCACTAGTCCAAATACAATCCACCTTTCCCATATACTACTATGCTTGTCCCTC
CGATTAAATACCAAATTTTCGATTCCTCCAGTGTGGGAGTGGGAAGGGAGGAAATGGCTC
AGGTAAATTTGAATATCCTCGTAGCCATTTGATATTATCTATGAATTCCAAAAAAAGATA
TTATGTGTGTAAACCGGTCTGTTCCTCTGAGTGTGATACCCTTTGATTGTATTAGATTCA
GTTGAGATGGCTTTGATTAAATTATGTTAAGATTAGGACTTTGATTTGACCACATTAGGA
TGTAACTCAGGTTGAGTCCCTGCCCCCTTGGGGCTATATAAACAGACACTCAAGAAGATA
CACAGAGGAAGGTGCATGAAGAAAGAGAGTTCCATAGACACAGAAGAGGAGAGAACTCGG
TCACTTCAGTCCTGCCATGTGACAGAAAGGAGACGGCTCAAACAGCTAAAGCCCCAGGGA
AAGCTGAGCCATTCACCTGACAGTTTGCTGCTGAAGAAACTAGAGCCCTGAGAGGCTAAG
AAAGCCCAGAAAGAAATGAGCCCTCCAGCCTACAGCTAATAAAGCAAGAAGCTGGCCCCA
CAGAGCCTTAACAGAAAGGAAGAAGGAGAGACCAGGCGCACCATCTTACTTCCACAGAGG
AAGATTGAACCTTTGCAGAGATTGGCAACCATCTTGCTTCAACAAGTGGAACCGACTTTA
GTGAGAAAATACCTCTTATGGTGTCTTAAGTTGGACTCTTGAGGCCTTGTGACTGTAAGC
TTTTACCCCCAACAAATGCCCTTTATAAAAGTCAACAGAGTTCTGGTACCTTGCATCAGC
ACCCCTTTGACTAATATGACCCTTTAAACGTGGTCGTGAATCCCTGAAAATTATTACTTT
CATTTTTTTGTCTACATTTGCTAGGCTTAAATCTATGTACCCCAGAAAAATATGTTCTTA
AACTTAATCCATTCCTGTGGGTATGAATCCTTATAAATAGGACATTTTGATGAGGTTACT
TCAGTTAAGAAGTCCTTTCTAAGCAGAATGAAATTCAGACAGAGAAAGTCACTGAAAGAA
ACTGGAAATCAGTGGAACCCAGAAGAGAAATCCAGGTGAGATCGCCATGTGCATTACCAT
GTAACAGAAAAGAAAAGTCAAAGACCAAGGATCATTGGCAGCTGGCCTTAGAATGCCACA
ATCTTCTAGGAAAAAGCATAGCCCTGATGATGCCTTGTAGTGTCAAAACCATAAGCCAAT
AAATTACCATAGTTTTGATCAACCCATTGAATAATATTTGTTTTAGTAGCCAGGAAACTA
AAACTGAGACTTACCCTGAAAGACCCATATCAGGACTCATACTCTCCAATGCGGGGAGTA
TCCAAAAAGCAGATGTACCCCTTGGCAAATTTTATGATTATCTGCTTTTACTCAGGGTAA
ATGAATGGATATCTTAAAAGACAGTTGTTTCCTATAGCTTCTTCCCAAGAAAAGAAGAAT
CTGAGAAAACGCCAGAGGCATGCATCAGTATTCAAGTGTTATGTGGCCATTAAATCCACT
GTCCCCTGTCCAGTGGCAAATCCTTCATTGCCTATATTTTGCACATCTACCAAAAATAAT
CCAAAATCAATGGTATGCCTTGAAGTGCCTCATATACTTGCCTGCATGTGTGTTTCTTCC
TGTATTTTGATTCTCTGAACATTAAAATAGTACATTCCCTTAACTGAGCCAGTAAATATC
ACAGCATTATACTGACTCTAAAGAACAACTAAATAGTAATTAATCAGCTGTCTTTTATTT
ATACATCCAATTTGATCCTGTTCAAACCATTGCAGATCACATATAAATTATACTACATTT
GCATTTCCTGCGTACAGCTGCTTTATGTACTTCTTGTATTTTACATTTGAGATTCAAAAT
CAGTTATCATGGTTGTGCAGGAAACTGTCTGATCAACTTTTAAAGCATTCTTCAGTCAAC
TAACTTTTTTTCTGATATGCCAGAAATAGACAAGTGTGACTTGATACATCTCTACAATTT
CCAAACAATTCCCAAAATCCAAATTTTCCTCTCTGCAATTCTACCATTCTTGTGCCCACT
CTGTTAACCATATGTGCGTAACAGAGAGTTATTAAATGAATGAATGGAAACTTAATATGA
ATGGCATTTATCCTTTTCTTAGAAATGATAGCACAAAGTTAGCATCAAATATAGAGCCTA
ACTAGTACTTTTGAATATGGATTGAACCAGTATGGAACAGAAATTTAAAAAATAATTTTA
GTAGTATCTTAAAAAGGGGAAAAAAAAATACCTTGAACCTGAAACAATCACAGTGAAATA
CATACTTCTTAAAATAAGCAAAACTGACAACATCAAATGCTGGTAAGAATGTAGAGCAAC
TAGAATTCTCATACACTACTGGTGGGAATGCAAAATGGTAAATACCTTTTAGAGCAATGT
AACAAAGTAATCTTTCTTGTACACATTTACCCAAGCAAAACAAAAATTTAAGTTCAGAAA
AAAATCTATAAGTGAATGTTTATAGCAGCTTTATTCTTAATTGCCAGAAACTGGAAATAG
CCAAGAGGTTCTTCAACTGGTGAATAGATTTTTTAAAAAATCTTTGGAACATCCATACAA
TGGAATACTACTTGACAAAAAAAAAAATACTAATACATACAACAGCATAGATAAATCTCA
AACATATTATTCTAAGTGTAAGGATGTGGTCACTAAGGCTATATGTTTCCATACACAAGA
TCTTTTAGAAATTTTAGGGAGAGAAGTCAGCCTAGTGGCTGTCAGATTATTGGACTTTGG
GCACAGTTTACTACAAAGGAGGAAAGAATTTTTCAGGGTGATGAAACTATTCTACATCTT
AATTGAGATGACGGTTACACAGCTATATGTGGTTTTCAAAACTCATGGAACTGAACAATA
AAAAGGGGTAAATTTTATAACTATGTGATAATTCTATGAAGAAAATGTTACCTACAGCAG
AGATGCCATTATTGTACTGCAGAGCAAATAGGTGTAGCTTGAGTAGCTGCAAGAGAATTC
TTCCCCTGCATTCTTTCAAATCAGTTCTTTGCCATCTTTACTACTTGCTAAACAAATCTC
ATTGCCCCACTTGCATTGCAGAGAGATTTCTTGTATAAGAAAAAAATAAGAGTTTTCCTA
GCAAGAATCTAGAACAGGAATGGGGCCCAAAGATTCTTCTCTGAGGGATGCCCATGGCTA
TTTTAATGGGTTTCTCTTGCTCCACTTATTTTGTATCATGTTTTTCTCCTTATCTCCAGT
GTGCACTCATGAAAATAATGTGTCACACTGGAAAGGATGGTGCCTTATCATGCCATGTTA
AAAAAATAACAATATTTTGACACCCTTGCGTAAGTAGATGACCTGTTGCGCTTGCCCTAT
GGCTGCCCAAACCTCTGACCAGTAACCAGACATCTGAGGGCATCAATGTCTCAAAATTCC
AAACATTTTAACTTCTCTGAGTCCCACCTGTGTGAGGGAAAGGATAAAGCTTGTTTTGAA
GTGGAGTGATGTCCTTGTTTTGATGATATTATCCACTTAATTTTAAGCAGCATTTAGTCA
TTAATCGCAATACATACATTAAGCAAACACTGCATTTTATGTGTGAAATTTCACTCTCTT
AAAAGCTTCAAGGCTGCTTCATATCTTTATGTTTACACTTATAAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAGCGAAAAATGTGGGAAATAAATTAA
TTAGATCCTCATATACTCATATAATACTCGTATCAACTCTTGAGGATTGAATCATATTCC
CCAAAAAGGCATGTTCATGTCCCAACCTCTGGTCTTGTGGGTAGGAACCAATTTGTAAAC
AGGACCTTTGAAGATGTTACCAGATAAGGTGTGCCTAAACTGAATGATGGTGCACCTAAA
TTCAGTATGAACAAAGTCCTTGTAAGCGAAGGAAATGGACACAGAGAGAGAAGCCATAGA
GAGCAGCCAGAAGCTGGAAGTCAAAGTAATCCAGAAGAGGAAGTCGAAAATGCCATCATG
CACATTGCCCTCTGAGGGAAAAGCCAAGGACCAAAGATTGCTGGCAGCCAGCCCCAGATC
TCCATTCTTTCCTGGGAGAAAGCACTGTCTTGCTGATGCTTTGATTTCGGACTTCCACTA
GCCTCAAATCCATGAGCCAATAAATTCCCATTGTTTAAGCCAACCCACTGTATGGTATTT
GTTTTAGCAGCCAGGAAGCTAAAACACTAATATCCAATGAGAAGAAAATGACATACACAT
ATTCTAAATACAAAGTAGATCAAATTAATGTTTTCATCACAAAGATTTCACAAAAGACAG
AAAAATTTGATATTTGAGGGACTCCATTTCAGGAAGCTCTTGAAGATTGAAGAAGTACAT
CATTGTAAAGGGGACAGTCTGGGCAGATGGAATGATCTGAGCAGAAGCATGTGCATTGTA
AAGAATAAGATGTGGGACGATTTAGTAAACCAGATGGATTAGAGTAGAGGGTGTGTTAAG
GGACTAGTTGGAACAAAGTCCAGAGAGCACCTAAATTGGGCAGAGTGTATTATCTTAAAT
GTAGGAGCTTAATGAATATTCATTAATGAAATAAGGAATTATTAGTCAGGATTCAGCTCA
GCTGAATCAGTGTCTGTTTTAAATGCAAGGCTATAGACTAGCAATACGCTTATAAAATTT
GGGGCTCCCTGATTGAGAATTATATAACATCCTTAATAATAATAATACTCATGATAATAA
TAGCTGTTTGTTAACATCTATACTAATCTGATATTATGCACATTCATTATTTCTAAAGTG
CATAAAATTATTCATTGTGAATAGTAATAACACTCTCATTTTATAGATGGAGATACTGAG
TCTCAAAGGATTAAGTGACTTGCCTAAGACTGGACAGTTTAATGGGAAAATTGAATTTGA
AACCAGGAATTGTCTTCAAAGCTTGTGTTCTTAGATGGATTCAAGTGGTAAGGGATNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTGACCATAAGTCAGAGAAACAATGCTAACGGTAGA
GTGAGGTGGGACCCAGCCTCTGACTACCCAGCCCAAGCCCAGAGAGAGAGATGATGCAGA
CATAGACAGAGGGATTCAGTAGACCTGAAGCTGAGAAATTGTTTAATTTCACCAACTAGC
ATGAAGCACTGCTTGAGTAGGAACTCATCTGGGGGCAAATCGCCTGACTCAGTTCAACAC
TAACTAGGCCCAATTATTAACCCCGCTAAGCCTGGGCAAAGAGAATGATAATTTTTATGG
TCACTAATGTTTACTGAGTACTTACTATGTGCCCTACACTGTCTTAAGCACTTCACATAT
ATTATTCATAAATTCTATCTCATAAGTGTAGTTTAGTGCAGTATGCTACTGACTTAGCCC
AGAAAGTTCTCAGTAAATGTAGTAATACTTGGTCAACAATTAAAGAATATGGGCATTTTA
TAATTCATAATTTCTAAGTATTAATGAAATTTATGGGAAAACCTTTAAAAATTTAATTAT
TGATGTAATAAGATGAGCTGTTTTTTAATTATGATGAATAGAATTAAAATTTAATGCTAC
CAAATGAACGAATATTCTCACCAAACCCTCTTCAAAATATTTCTTTTTAAACATTGAAAG
ATTTTCATTTTTTTCTTCCACTTCTTTACTCTGCCATTTCTACTTTTTAAAGCAGAAGGA
AGACACTCAGCTTTTCTCATTGAGTGAGTAGGTTCATAAACCTTCTGAACTTTTCTTCAT
TCCTGTGATAAGACAGAGAAAGGTCTTATATATTTTTAGTTAATATTAATTTTCAGAATA
TGATGCAAATTATATTAGTTTACTTGACACACTAATTAGTAGACTTGACAGATTAATCTT
TCTGAGCTCATTTCCCTGTGTAATAATCATCTCTTTTCTCAATCTGCTTCATCATTAGCC
TTTTCTTGCAGCTGTGGGATTCTCTCACTGTGAGGTGTCAGGATGATGCTTTTTGATGCC
ATCACCTCTGCTTCTCCGTGTTATACTCAATAAATGTGCCAACTCAGGCCATCACTTTTC
CAAAAGGCTCAAGTGAATTGTGACCAACTCTCTCCCCTTCCTAAGGCTGATCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGTGAGAATGAGAGTGAAAAGGCAAGTAACTTCCTAGAATTATTAGAAAATAG
TTGGACCACTGGATGCCCTGAATGATCTCAGGAACTCTCAGGGATCTGAGGCCACACTTT
AGGAATCATACTTTAGGTAAAATTTTTTAGAGAAATGAGAACTTCCAAAATCAACCATAG
TCTGCAATAATAACCCAAGATTGTCATTTCTTTCACTGTTCATTCACAAAGTGTCGCTTT
GTAGTGTTCTGGAAAAGAATGATGGAAAATTGTCATCTCTAGATAATGTTTTAAAATGTA
AAGAAAAAGATGAAAATAATATCTCACAGCTAAACGAAATAGGTTATTGAAAAGTATCAG
AATTATATTTGATTAACTCACTTTTCAGAGATAAAATTTAATTATTTTGAGCCTTGAATA
AAATAATTCTTTGTTGTAAAATTGAATATACGTGAACTATTATTGAAGTGCCATTCTATT
TTTTTTTTCTCTCCCCTTCCCCGCCCCCCCCCCCCACCGGCCCCGGGTGTCTGTTCTCTG
TGCCTATTTTGCTGCATCTTCTTTGTCCACTTCGGTTGTTGTCAGTGGCATGGGAATCTG
TGACATTCTATTTTTTGTGTCATTAACCAAACTGATTAAATCTGTTATGTTTCTTAAGTG
AGGGTACTAGTCAAATATTTTGAGTAGTCATGTACTCAAAAAGAATAGAGGATACCATGA
GAGCCTTGGAAATGTTATATAAGATGAGAAAATTCATAAAGTATTGGGTAATTTTTAACA
TTAGAAATGCAGGCGTTTGGTTATTTATGAGATTGTATCTTCACAGTGTGTCTCAGAAAT
ATGATTTTTCTTTCTTGGTTTAAAACCCAAACCCAGAGAATGGCTGTAACTCAAGCTGTT
GAGTGCCTGCTTCCCACATGGAAGGTTCTGGATTTGGTTCCCAGCACCTCGTAAAACAAA
CAACCAAACACAACAAATAGAAAAGCCAGCTTGGGGGAACATGACTCACTCATTGAGCGC
CAGCTTCCTATGTATACAAGGTCCCAGGTTTAATCCCCCTCCCACTCAGTACATTAAAAA
AAAAAATCCAAACCCAGAAATAAAACATTTAAGCATTTGTAAATAATATTTGGTTTTGTT
AATTCATGTATGCAAATTCTTTTTGCTTTATCCTACAACATGAAAATGGTTACTCTCATG
CACTTTTAGTCCTAATAATTTAAAAACTTAACATAGTAGAGTAGATGTTCCAAAAGAGTT
ATACCTGAAAAATTACTGTGTTTCACACTAATTAAGAGTTTAAGAATCATAATTTCAGTA
GCAGTTTGAACTGAAAGGAAAAACACTACATTATTTTTAAAATTAAAAATATTTATAAGT
ATGAAAGTATACTTTCCCTGAAATGGAGTTTGATCCCATTGCCAATTGATTGAAGATTAT
GCAGAAGTCCACAGATATTGAAGTTTCTAGTTGTTGGATTTGATAAGAGAAGAAACATCA
GGGTTAACATCAGTGGGCTCATCTAAAGCCAATTCCTGGTGGAATATTTTACATGTTCTA
GTGGTGTCATTTTGTTGCAAATTTTTCCTAATACCCAGATACTCTGAGGAAGAGAAAACA
CAGGTTCTTCAGAAGAGCAGAAGAGAGTCTATGTGTTTAAATAGAAAACGTGACAAAAAG
CACTGAAAAGGGTTTTTCGGTTCCCCCAGGTTCTTCGCAGCAATAGTCTGCTAGAGTCCA
CAGATTACTGGTTGCAGAATCAGAGGACACCCTGCCAGATTGGTTTTGTGGAAGACAAGT
CTGAAAATTGTGCTTCTGTAAGTACACAAGACTCGGGAATATTGTCTGATAAAGCAGGGA
AAAGTGCAGGTTTGCCAGTGGTTTTAAGACAGAAGTTTTATAATTCATTAAATACAAGAT
TGGAAGAGTGTCCTTTTGAAAGTACAAAATAAAATAAGACACAGAGCTAATGTCTCTATG
TGCTGATTTCAACGTGTAAATTAATCTGAACAATTTCCTGCAAAGGAATAAAATGCTTTT
GTTTTCAAAATCGCTAAGAAAAAGATTCTGAAATAGAATTGTATGATGAGAAATGAAAGA
CCATTCTATAGCTTTCTTAGATTCCTTTCTATGTATTTTATAATCCCTGTTAGTAGATAT
TCCAACTTGGAAATTGTGTAAAAAATGTTTTCAACCATTCTCTTAAGTTATGATCATTAT
TTGAAAATCTTTCAACCTAAGAAACATACAGGCATGTACTTTAATACATTGAAACTGAGC
TTTACATGCAAACCCTTCATTTTCAAGATATGAGCTATCTTAAAGATAAGAAATGTAATC
AGTATGGTTTAGAAGATGGGTACATATTGTTTGTGTGAAATATGCTCCTTCCTATATGTT
CTACAGAGCCATATGTTTTCATTTTAATTGAAGCCTCCTAGCTCTTATGAGGTCATGGTT
ACAGAAAATGGGGAGAATGTTTCCAAAGAGGAGAGAACTGTCATTCTCATGATTAAATTG
AGAGCATCATCTCTGAGTTATTCCTGGAAGTAAGTTGCATGCCTTCCATCATTTCTCTTA
AAAGAGAAAAAAACCTCCAGAGGCTGAAAATGGGAAGGGGAAGATTTTTTTATATAAAGA
GCAGAACCGGATGGAATTGGCATACAGAGGATGTAAAACATTTCAGTCTCCCACTGCATA
GTCTCCTACTGCAAGGACTGTATGGGCCTTTCAAGAGATTTAATTTAATCTCTTTATTTA
GGCAAATGATTGTGGTTATGCTGCTACTTTTTATACTTTTGATTGCTTGTCTAAAGAACT
AGTCGCTGGCTAAACATTTGGGGGGAAAACAAAAGGATTACTTGGCAAATAATAGTGATA
CTTTCTTTACAACCCTTCAACTCTTAGATGAGTTGGAAAATTCAGGGATTTGATGATACA
GATCTCTAATTACACAGCTATAAATTGTAAAAGTGAGAGAAATGGAAGTGTATTGCTATC
AGCAGCTGCACTGCCATCAAGTCTGTCATCCAAACAGCTCTTTTATTACAGTCTACCATT
TGGAGAAGACTCGGAAGATACAGCATTAAAAAATGTGCAATGACAGACAAAGAGGTCTTC
TCTCAATTTTATGTTTTGGGGGTTTGATTTTTCTTTTTGAAAAAAATCCATGGAACTACA
CTACACAAACAGTGAACCCTAAGTTAAAGCATGGACAATAGATAATAGTACAATTCCAAA
AACGTGATTTCATCAATTGTAACAGAGTTCCATACCAATGTTAGGTGTTAATAATAATAG
TCTGGCATATGGGAATCCTGTATTTTATGCATGGTGGTTCTGTAAACCCACAACACCTCA
AAAAAAGAAAAAACTATGCACTAAAAAATGGAAATCTATGATTAGACATGCTAATATTTA
AATTGTATTTAAGGATTACCTTTGGATCTTCATATATGTAAGAAAACTCTCCTCCCATCA
CCAACCAATCCCAGTTGGTTCCTAACACTCCATGACTCCCTTTCCTGTTTCATTGTCCAT
AGCTTGTAGTGTCAGTTGTCAGCAATGCAAATTAGTTAATTCACTTTGCCTTTTTGGTTC
TCCCTTTTCTTCCCAAAAAAAGAAAAATCTACAAATGAAAGGTAAATAGGAAGATTCATT
TTCCTCCAATAGACTCATTTTCCTCCAATAATAAATTATTTTATAATAATTGAAACTTAC
CCAAACTCTAAAAATTATCCATAGACCCTAAACCTAAAAGAAATCTCAGTTTCCCTGTGA
CAAAGTAGCCCTAATCTCTTACAAATATCCCGTAATCACTTTTCTTTGATTTACAAATTC
TCTCTCTTTCTGCTTGGAATATATTTCTAGCTCCAGAATCAGATATTGCTAAGGGGAAAC
TATTAGCTCTAGGAGAAACAGAAACCTGTCATGCTTGACCATGACAGGAAACTCTTAAGA
AAATAGCTATGTAGGAGAAGTGGTCAAAATGGTCAGGGGAAAAGTACTCAATTCCTTTTC
AAAACCACTTCTCCATATAGGCAGAAAATGAGAGTGTAATTTAAAGAAAACAAAGGACTA
GATTTTAAAATAATATCCTCATTAAATTTTTTAAAAAATTCATTTCACAAAATCATACTG
AACATTGATCTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATCTGGAATTCAC
ACATCAATGGGAAGTTTTAAAACAAATCTAGTGGAGCATTCACTGCCCCTGTCCTCTTAA
TCAGGGAGTATGAATGAGAAGACATAAGAGAATACCTAAAATCCCTGTTAATACATAAAC
TTACAATTAACAAGCTCATAACCAAGACAGTCAGGTAATGCTGAAATTTGCTCTTGTGAG
GAGACCCCATTTTATGATGTTTGGACACATTCTTTCTCCTGCTGGATAGTTTCCTTTGAT
GGGAGAGTATTTTTTTCTTCAGTTTTGACCTATCGAGCTTCTCCACTTCAGACAAGTCTG
GTTTATCACTCATCTTCTCTGAAGGCTTGAGACCTGCTAACAGACAGCGACTGGGCGCCG
ACAGCTCCTCACTCTGGACGAGGTTCCAATTAATTCCTTTTTAATGTTATTGCTTTTTAC
TGTTCTACTGGAATTTAGTTTTTCAGAAACTTTCCTTTTGTTTTAATGCTTCATTAAAAT
TACCTTAATAATTCACGTTATATCTATTCATAGTTACTGTCAGGCTCTCTCCTTACTGAT
CATTTTAAAACTCCTAATTTCTGGCTTCAAACAAATTACACTTTCCTTCTAACATGCACA
TTAATTGACAAATAACAGTATTTGAAAATATGCTACAGTTACCTTAAAATTTGTAAATAT
TTCAGGCAAGCAGTCAAGTTGTATTTTAACTGTCCAGTCATGACATTGCAAAAACTATGA
AGTAGCTCTTCTGGGTTTCTGATGCCAATGCAAGCCAGAGGCGACAATGACAAAATTCAG
ATCCCTGATTTTTATTTTATGTTATTTCTCCAAATATATCCATACCTAGTCTATACTGAA
ACTTAAAAAAAAAAAAAAGTTAAGAAAGAGACAAATATCCCGGTTGTTAATTTGGTCTGT
AGAAGAATGTAGTCTCACATGGCCAAGGAAATACATAATTCTACAACTGTGAAAGAACGT
TTTATTTTACTTAGTCCAGCTATATACCAAGTTTTTAAGCAACTTTGAATGATTTTTCCT
TAAAAAGTCAAATTTAGAACATAATTTTTAAAATTCCTTTCTTATTAATACTTTAATTCA
AGGTTTACAGAAAAATTGCAAGAATACAAAGAATTCCCAGATAGCCAGATGTTAACTTTT
TAGTACGTTTGCTTTATTTCTCTAAGTATATGGATGTGTCTAAATATACATATAGTATTT
TTTCTGAAATTTTTTGAAAATGAGTTGCAGGTGCGATGCCTTTTTCCAGTTACATAACTG
ACTGAGGAGCAAAAATATTTAAAACCAGAATTCAACCAGACCTGTAGAAGTCCTTGTTCA
GGCACCTAATTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTAAACAAATAGAAAGGACAATCATCAGATTTATATG
GAAGGTGAAAGGGTCCCAAATAGGCAAAAACATCTTGATAAGAAATACAAAGTTGGAGGA
CTCACACTTCTTGATTTTTGAAATTTATTATAAAGTTACAGTAATCAAAATAGCATAATA
CTGACACAAGACAGACATATAGACCAGTAGAATTAAATTGAGACTTCATATATAAATCTT
CATATCTATGGCCAGTTGATTTGTGACATGTGCCAAATCCATTCACTGGGTAAAGAACAA
TTTTGTCAACAATTGGTGCTGGGAAAACTAGATATTCATATCTAAAAAAAAGAAAAAAGA
CCCCTATCTCACACCTTATACAAATACTAGCTAGAAATGAATCAAGGACCTAAATATGAA
AGCAACAACCATAAAACTCCTAGAAGAAACATTTTCAAGATCTTGTAGCAAGAGGTAGTT
TTTTAAACCTTATACACCAAAGCATGAGCAACAAAAGAAAAAAAAGGTAAATGGGACCTT
CTCAGAATTAAACACTTTTGCACCTCAAATGACTTTGTCGAAAGGGTGAAAAGGCAGCTG
ATCCAATGGGAGAAAATATTTGACAATCACATATTAAATAAGGGTTTAATATCCATGATA
TACAAAGAGATCATACAACTGAACCATAAAAACACAAACTATCTGATTAAAAAATGGGAA
AAGACTTGAAAAGACAATTGTCCAAAGAAGAAATACAAATGGCAAGAAACATGAAAAATG
TTTAACATCATAGTGATTAGGGTAATGTAAATCAAAACTACAATAAGATATCATTTCAAA
CCTATTACATTGGCTGCTATTAAAAAGTCAGAAAATTGTAAATATTGGAAAGGATGTGAA
GAGATAGGAATTCTCACTCACTGTTGGTGGGAATGTAGAATGGTACAGCCACTGTGGAGG
ACTGTTCAGCAGTTCCTAAGGAAGTTGAATATAGACTTGCAATGGGACCCAGCAATGCCA
TTACTAGGTATATACCCAGAAGAACTGACAGCAATGACATGAACAAACAGCTGCACACTG
ATGTTCATGGCAGTGTTATTCATGATAGCCAAAAGTTGGAAACAACAGATTTTCATCAAC
TGAAGAATGGATAAACAAATTGTGGTGAATACACACAATGAAATAATATGCAGCTGTAAG
AAGAAATGAAGTCATGAAACGTATGACAACATGGAGGAAATTGGAGGACATTGCATTGAG
TGGAGCAAGCCTGACACAAAAAGACATACACTGTATGTTGCACTATTATCAACTAAATAT
ATTGTGTAAACTCATGTTGTTAATAGAAGGAGAATAGAGAATGGAAAGCTGAGGGCTAAT
GTGTGCAGAATTGGTAAAAATGTTGTTTGTGAATCTTTGGAAATGAATAGAAATAGTGAA
AGCATATCATGGTATTTGTAACTAGTAGAGCTATTAGGTATGACAGTGGTAGATAGGGAA
AGTCCAAGGTCATATATATTATAGAAGAAAAGCTAGAAACTGTAATTTTGGACTGTATAA
GATAGTAAAACCTCATGTAAAACACAAATATGTGTGATATTGGATATATGACTGTTTTTA
CAAAGTATAAATACAAATATATTAGAAGGAAAAAGAATAGCAGCTATGTACAGAAGGGGA
AGCACAGAGATTAAGAGGTGATGAGTTTTATTTGATTATTATTATTAATGGAATAATGAA
ATTGCTCTGAGAATGACTGAAGTGATGAATGCACAAATATATGACTATACCTAATATCAC
TGATTGCATATTTTGGGTGGATTTATACTTTATTAATATGTATCAATAAATTTGATTTGT
TTGAAAAAATGTATATGGAGGTGAAGGGGTCCCTGATATACAAAAGCATCTTGATAAGAA
ATACAAAGTTGGAGGACTCAGGATTCTTGTTTTTTAAAACTCATTATAAAGCTATTATAA
TCAAAATGGCATGGTACTGGCACAAGACAAACATATAGACCAGTGGAATTAAATTGAGAC
TTCAGAAATATATCTTCACATCTATGACCAGTTAATTTTTGGCATGTGCCAATTCCACTC
ATTTCGTAAAGAACAGTCTCTTCAACAAATATTCCTGGGGAAACTGAAAATCTAAAAGCA
AAAGAATGAAAGTGGACCCCTACCTCCATACCATATATAAAACTTAACTCAAAATGGATC
AAAGATCTACAGATAATAACCCAAACTATAAAACTCCTGAAAGAAACCAAAGGGAAATAT
CTTCAGGACCTTATGTGAGGCATTGGTTTCCTAGATTTTACACCGAAAACATGAGCAACA
AAGGAAAACATTGATAAAAGGGACTTCATCAAAATTAAACATTTTCGTGCATGTTATTAC
TTTATAAAAGTAAAAGTAAAAATACAATCTACAGAATGGGAGAAAATACTAGGAAATCAC
ATAACCAATAATTGTTTAATATCTGGAATATATTATAAAATATCACAACTGAACAACAAA
AAGACCACATTTTTTTAAATGAGGAAAATACTTGAATAGAGATTTCTCCAAAGATATACA
AATGGACAATAAACACATGAAAAGATGTTCAGTGCTACTAATCATGAGGGAAATGCAAAT
CAAAACACAATGAAACACCATGCCACACCTACTAGAATTGCTACTATTTAAAAAATGGAA
AATAAGTATTAAAGAGCATATTAATTAGCCAAAGAGGTGCTGATGCAAAGTACTAAAAAT
CTATTGGGTAGAAGCTTATAGTCACAAGGCCATTAAGCATAAATTAATTCCCTCATCAAA
GTCTGTTGCCATGTTTTGGAGCAAGATGGCTACTTGTCTCTGTGAGGGTTCTGCCTTCCT
CTTCTTCGTAAGGCTCCATGGTCCCAGCTTCTTCCTATCTCAGCTGTAGGCTGGCATAAG
TCTTGTCTCTCTCCCAGGGCTCATTTCTCTCCAGGCTCAGCTGGAGTTGTAGGTTATCAG
GTTCTCTCTCTTTCCAGGGCCTCCGCTGTGTCTATGGAGCCTTCTCTATTCCCTGTGCTC
TTCTCCTGCCTCAAAATTCCAACTCTCTTCTCTGCCATGTCATTTCCTCTGTGAGTCCCT
GCCCACCGAGGGGACAGGGACTCCATCAAGGGGGCAGGGACTCAACATCCTACTGACCTG
GCCCATTCAAAGCCCTAACCCTAATTTAATTAAGCAAAAGTGAAACCTCTGAAGTTAATA
TAATCTATTAGCCCAGAGGAACAGACCGGTTTACAAACACAATCCAATATCTATTTTTGG
AATTCATAACCAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGA
TGTAAAGAAATAGGAATACTTGTTCTTTGTTGGTGGAATGTAAAATGGTCCAACTGCTGT
GGATAATAGTGGGTAGTTCCTCAGAAAGTTACATATAAAATTACCATGTGACCTGGCAAT
TCTACTTCTAGTATTTACCCAGAAGAATTGAAGCAGGGACTCAATAGCATTTTTCACATT
TGCAAAAATATAGAAGCAATCTAAGTGCCCATCAACAGATGGCTGGATGAATAGGTAAAT
AAAATGTGATGTATACATATGATGGAATATTACTCAGCCTTAAAAATGAAGTTCTGAGAC
ACACAACATAGGTAAACCTCGAAGATCTGTTGAGTAGACTAAGCCAGATGCAAAAGGATA
ATTATTGTACAATCTTGCTGATATGAAATAATTAGAATAAGCAAATTTATATACTCTGAA
ACAAAAATATGGTTTATCAGGGGCTGGGAAGAGGGTAGAGAAAAAGGAGTTAATCCTCCA
TTGGTATAGAATTTCTGTTTGGGGTCATGGACTGGTTTTGGTAATGGATGGTGGTGATAG
TAGCATAAATTTGAGAATGTACTTAACACCACGAAATAATATATTTGAATGTGCTTAAAA
GGGGAGATTTAAAATACATATATATGTTAGTATTATAAAATTTTAAAAAACTAAGACTGT
ACAACACAAGCAGTGAACACTAATGAAAAATATGAACTACGGTTAATAGAATAATTGTAT
ACTATTACATGATTTTTTAAAAGCAATACTTCTGTAATTTCTTGTGCTTTCTTTTGTCTG
TTTTATTTTTAAAGTTGAAATAAAGTTTTAAAAAATAGTATAATTGTAATAATATTGTTT
CCTCACTTGTAACAAAAATACTACACTAACAGAAAGTGTTAATAATAGGGAAATCTCTAT
ATGACAGGGCTGGGAGGGTGGGGTACAGAAGGTAAAATGAGAACTCTATATTTTCTGTAT
GATTTTTCTGTAAATCTACAACTTCACCAATAAATGAATAAATAAATAACCTTCTTATGT
CACTGCTAGAAATATTGAATGCATTACCAATCCTGAGAAGTTCTGTGCCAGGTAGTGAGC
TTCTTAACACAGGTGTGTGGGACCACAAAGCCACAATCCAGGAAGGTGATTCCCACCTCC
AGGGGAGAATGGTCCCTTAAATGACCTCTGCAGGCTCTTCCACACTGAACTTATATGACT
TTGTGAAGAAGAGCTAATATTTATTGAATACTTCTGGCTTCCAGGCATTCTGTTAAGCAC
GTTAGCTGGATTCATCAATTCAGACAACTGCTCTACAAGATAGGGAGTATTGCTACAAGA
TAGGCGAGTTTGTGACATGTAGTGAATAGTAGAGTCAGGAGTAAGACGCAGGCATCTATG
CAGGAGTGCAGTTTCCTAGCGCAGCCTGCACTGCCTGCACAACATTCCAGGCCATTTCTA
GCCCTCTGACTTCACAACAAATGAATGATCTGCATGTTGCTTGTTATGCTAAGACAGAGT
GATAGTTTAGTAATTCCAAAACATTTGCACCATTTTAATGATACCCTTCTTAGGTGCCTG
AGAAGTTTTCTGCTCGTTCATTATATTTGTATAAAGTTTTAGTTTACAAAGTGCTTGCAC
TAATGTTACCTCATTGGGTTTTTTTGTTTTGTTTTGTTTGGGTTTCCTTAAAATATATTT
TTATTAGAGAGGTTGTGAACTTACAAAACAGCCATACATGTGTGAAATTTCCCTACAACA
CCCCTCCCACTAACACACTTGTGGAACATTTGTTACAGATTACGAAATAATATCATCAGA
CTATTACCACTAACAACGGTCTATAGCATACATTTGGTATATTTTTCCATACCCCCCTAT
TATTGACACATCTTTGGCTTTGATGCAAGAATATTACAAGTATTGCTGTTCACTGTAGTT
CATAGGTTACATTAATTGTATTTTTCCCATGCTTAGCCACATTCCTACCACCTTGCAATA
GTGATGTACATTATTTCTAGCTCACCGAAGGAGGCTCTTGTCTTTATACTATTAACCACC
ATTCTCATCTGCCTCTGGGTTCACTGTTATTCAGTCCCTAGATTATTATCTAGCTTTCTT
AAAATTGACGTTTACATTACTAGACTACACTTCACAGCCACAATCTCATTTATAAACCAG
CTGCGTTAGCTGTACTCACTATCATGTGTTACCATCAACTCTCTCCATTTCCATGCTTTT
GCTGTCAAGTTAATGAAAACTTCTACATTCATTAAGCATGCATACTGATACATACTTCTA
CATATTCATTAAGCATCAGTACCCATACATACATTGAGTATCATTACCCCTTCTCAACCC
TCCTCTTTTATTTCCATCTTTTAGCAATTTTGAATAATGCCACTTTGAACATCAATGTGC
AAGTGTCTGTTCATATCACAGTTTTCAATTCTTCTGAATATATTCCTAGTAGAAGATTGC
TGAGTCAAGTGGCAGTTCTATTTTTAGCTTCCTGAGAAACTGTCAAACTTTCTTCCACAG
AAGCTGCACCATTTTACATTCCTACCAACAGTAAACAAGTGTTCTTATTTCTCCACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAAT
TTATGTAGTTTTTCAAAATTCCATTTAGCAATCCATTGTAGTTTTCTGAATACAATTGCT
TTACATCTTGGTTAAGTTTATTTCTAAATATTTGATTATTTTAATCGCTATTGTAGATGG
AATTTTTTTTTTTTCTGACTTCCTCCTCTGATTGCACATTACAGGTGTATGGAAACACTA
TTGAATTTTGCATATTCTTCTTGTATCCTGCCACTCTGCTGAAATCATTTATTAACTCTA
GCAGCTTTGTTGTAGATTTTGGGGGGTTTTCTCAGTATAGGATCATATCATCTGCAAATA
GCAAAAGGCTTTATTCTTCCTTTCCAATTCAGATGCCTTTTATTTCTTCTTCTGTCCTGA
TTGCTGTAGCTATAACCTCTAGCACTATATTGAACAACAGTGGTGATGGTGGGTATCCTT
ATCTTGTTCCTGATTTCAGTAGGAAAGCTTTCAGTCCCACCATTAAGTACAATGGTAGCT
GTGGGTTTTTCATAAATGGCCTTTATCATGTTGAGAAAGTTTCCTTCAATTCCTATCTTT
TGTAGGAATCAAGAAAGGATCAAGAAAGGATGCTATTTTGTCAAATGCCTTTTCTGCATC
ATTTGATAAGATCATGTAATATTTCTTCTTTGATTTATTAATGTGTATTATGCAGGCAGA
TTTTCTTTTCTTGAACCACCCTTGCATGCCTGGGATAAAACCCATTGATTGTGATGAATA
ATTTTCTTCAATGTGTTGTTGGATTCTATTAGCAGGTATTTTGTTGAGAATTTTTGCATC
TGTATTCATTAGGGAAATGGGTCTGTACTTTTTTTTTTTCTTGTAATATATTTATCTGAC
TTTGGGTATTAAGGTGATATTGGCTTCATAGAATGAGTTTGCTAGTGTTCGTTCTTGTTC
AATTTTTTGGAAGAGTTTGAGTAAGATTGGTATTAAATCTTCTTTCACTGCTTGGTAGAA
CTCACCTGTTAAACCATCTGCTCCTGGGCTTTTTATTTCAGGGAATTGTTTGATGACTCT
TTCAATCCCTTTACCCGTTATTGGTTTGCTGAGGTCTTCTATTTCTTCTAGGATCAGTGT
AGGTTATTCATACATTCTTAGGAATTTTTCCATTTCCTCTCCATTGTCTAGTTTGTTGTC
ATACAGTTGTTGATTGTATCCTCTTATGATCTCTTTTATTTCTGTGGGGTCTATAGTAAT
GTCCCCATTTTCATTTTTAATTTTATTTATTTACACCTTCTCTCTTTTTGTCATTGTCAG
TCTAGCTAAGGGTTTGTTGATTTTGTTGATCTTCTTAAAGAACCAAGTTTTGGTTTTGTT
AAATCTATTTTTTGTGTTCTCAATTTCATTTATTTCTGCTCTGATCTTTGTTATTTCATT
CCTCCTTTTTGGGAATAGTTTGCTGTTCTTTTTCTACTTCTGCCAGATATGTAGTTAGGT
CATGATTTTAGGTCTTTCATCTTTTTAAATGTAAGCATTGAGGGCTATAAATTTTCCTCT
CAGCACTGCCTTCACTGCATCCCACAGGTTCTGATATGTTGTGTCCTTGTTTTCATTTGT
CTCAAGATATTTATTGATTTCTCTTGCAATTTCTTCTTTGACCCACTGATTATTTAAGAG
TGTGTTGTTAAATCTCCATATATTTGTGAATTTTCCCTTTTTCTACCTTTTGCTGATTTC
CAACTTTATTTCATTATGACCAAAGAGAGTGCTTTGAATAATTTCAACCCATTTAAATTT
ATTGAGATGTGTTTTGTGACCTACATGGTCTATCCTGGAGAAGGATCCATGAACACTTGA
GAAGAATGTATATCCTGCTGTTTGGGGGTACAATGTTCTGTATATTAGGTTTAGTTCATT
TTTTATATTATTCAAGCTCTCTGTTTCTTTATTGATCTTCTGCTGAGATGTTCTATCCAT
TGATGAGAGTGGTGTATTAAAGTCCACAATGATTATTGTAGAGACATCTATTCCACCCTT
CATTATTGCCATTGTTTGTCTCATGTAATTTCGGGCATTTTGGTTAGGTGCATATACATT
TATGATTGTTATTTCTACCTGGTGAATTTCCCCTTTTATTAATATATAACAACCTTCCTT
GTCTCTAATAACATCTTTGTTTTTAAAGTCTATTTCAGGGAGACGGATGTAGCTCAACCA
ATTGGGTTCCTGTCTACCACATAGAAAGTCCAGGGTTCAATGCCCAGGGACTCCAGGTGA
GGGCAAGCTGGCCCAAGTGGTGAACTGGCCCATGCAGAGTGCCAGCCCACACAGGAAAGC
TGCCCCATGCAGGAGTGCCAGTTGATGCAGAGACCTGGTGCAGCAAGATGACGCAACAAG
AGACACAGAGGAGAGAAAATAAGAAGACATAGCAGAACAGGGAGTTGAGTAGGTGCAAGA
GAGTAATTGCTTCTTTCCCACTCTGGAAGGTCCCAGGATTGGTTCCCAGAACCACCTAAT
AAGAATACAAGCAGACACAGAGGAACACACAGTAAATGGACAGAGAGCAGACAATGGGGG
CGGGGGAAATAAATAAAAATAAATCTTTAAAAAAGTGAAAAAATAAAAAAAGTCTATTTC
ATCTAAGAATAACAACTCCAGCTTTTTCTTTTTTTTTAAAGATGTATTTATTTTATTTAT
TTCTCTCCCCCCGCCCCAAGTTGTCTGTTCTCTGTGCCCATTCACTGTGTGTTCTTCTGT
GATCGCTTTCATCCTTATCAGCGGCACCAGGAATCTGTGTTTCTTTTTGTTGCATCATCT
TGCTGTGTCAGCTCTGTGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCCTAATATCCTTGATCTC
TTTAGTCATCTCACTGAATTTATTAAGGAGACTTATTTTAACATCTATGATTAATTGTCT
CAACTCCTTTGTCATTTGAAGGCTTATCTTGTTTCTTTGACTGGGCCATATTTTCCTATT
TCTTGGTATGGATTGTAATTTTTTGTTGATGTCTTGGCATCTGGCTTACTAGATGTATTT
ATTCTAGGTGCAGCTTCACTCTTTAGTTTAGGGCTTTCTTGCCTTTTCTCCCTTGCTTCT
TATGTAGTAGGAGCCAAAGATGCAGTTGATACTGTAAGCTGTGGAGGCTGATGCTGCCCA
CATTACCCCAGAAACCAATGAAGCTTCTCTAACCTGCTCCTCTGCCAGGGGAAGGGATGG
AGCCACAGCCATGTGTAGTACTCCAAGCCATGCAGGCCAAGACCATCTTTAGTTGCCCAA
TGAGAATGATGAAGCTTTACACCCCTTCTTCCTCTGACTGGGGCATGGATGAAGCTGCAG
ATATGGGCAACAAACTAAGGCATGTGGGTCAAAACAGACCACAGTTGCCCAGCTAAGCTG
ATACAGCACCAGTTCCCCTCCTCCCCTGCCAGTGGTGGAGATGGACCCTCTGTAATGCCC
AACAATATAATCCATATGGGCCAAAAAGTGCCTGCAGTTGCCCTGAGAGGCTGAGGGAAT
ACTGTCCTTTCTGTCCTTTAAGGATGGGAATGGAACCACAGGCACCAACAGACTAGTAGG
TATGGGTCAAAAGTGCCTGCAGTTTCCCAGAGAGACTAAGGGAACACAGTCTCCTCCTGT
TCCATTGGAGTTGGGAATAGAGCCACAGACAACCAGCAGTTCAGTCCATGCAGGTTGAAA
GTGTCTGCCATTGCCCAGAGAGGCTGAGGAAACACATCTCCCCTCCTTTCCTACTGGTGG
ATGGTGATGGAGCCACTGGTGTCCAACTATTCAGTCTGTGTGAGCCAAAAGCATCTGCAG
TTGCTCAAAGATACTGGCAGTTCACCCCAGATTCCTCCCTGCCAGAGTTGGGACTGGAGC
CTAGCCTAGAGCTGCAATTCAATCTGGGTAGAAAGAACCTGGTCCCTACCATCTCTGTGA
TTTTCATTCAGCCCTGTTTCCCTTTATGCTGGGAGTAGAGTTAAAATGGTGGCTACCAGC
CTCTTTCCAACTTGAACATGTACAAACTTAAGCTTTTCTTAGCATTATACTTTAACCAGT
CTAATTTACTAATCAGTAGCTGAAGTTGGTGCCCAACTGTCTCTTCCTCCCCTGTTTTTG
AGAAGTGGCACTTCCAACTCCAACCACAGAACAGCTTTTGATGCAGCTCACGCTACTGGT
CTTCATGGTATGGAGTACTCTTCTCACAAATCTTTATTGCAAATGGGCAGTCTCCTCCTT
CCATTCTTTCAAGGATGTTGCAGGATGCTCTTCTGCTCTCCTGGGCCCTCACAAACAGAT
GCTTTAGATGGCTCTGGGTGATTACTAACTGCCCTGTAGGATGAGCTGACTCTTGGAATA
CATTACTCTGCCACCATCTTGCCCCTCCTCCCATCTCATTGGGTTTTTATAAAACCTGTG
AAGTAGTAAGAATAGATATTGTATGTGAAGAAACATGTATGGGTTTTGAGAGGTTAACAT
GAAGTGATAGAGTTGGTACCTGAACTCACGTTTTCTGATTACAAATGCCATGTGATCTCC
ATCTGAACTTTTCACCAGCCAATTAAATAGTTGATAGGGAAAATAACATCTTATGATTTC
CAATCCTTGATTTTCTGAAACAGAAGTTGGCAAACTACAGTTGTTGGGCCAAATCTGGCC
TGCTGACTATGTTTGTAAATAAAATTTTATTGAGACACAGTCATACCTACCATTGTGTGG
AAGCTTTCCTGTCACCACCGAAGAGCTGAGTAGCTGTGAGAGAGACCCTATGGTCTGTAC
ACGTGGTTTTTTACCAAAAAAAAAAATTTGCTGACTTCTGGTTTAGAGTAAATAGCTAAT
ATTTTAAAAGATAACTGCTACTTTACTGGTTAATATGGTATAAATTAAGATTATTTCTGT
TGTATCTAAGAAATTTCTCAGGTCTTTTTTTGCATTTGCATGTTTAAAAGACTTCAATCT
CCATCATAAAGGCATGATTGATTTATTGATCTCTTCTTTCCATTACTTAAATTCAGATGT
TTTGAAATTTTAAAGTGCGAAAACAACCATTTCACAATGATTTCCTGCATACTTCCTCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGGTGTTATCAGAGCCTATATGTACCTATTGCTGGT
CCTCCACTTCTCATTTAAGCAAATTAATTGGGGCATGTATGCACACATCTGAGCCCTACA
TAAGACTTTACTAATTTTTTTGAGGTACCAGGGACCTCATATGTGGGAAGCTGGCACACA
GCCACTGAGTCACCTCAGCTCCCCTTGTTTTTTTTTCGCTTGTTTTGTTTGTTGTTTATT
TTTTTTAGGAGGCACCAGGAACTGAACCTGGGACCTTCCATGTGGGACGCGCATTCAACC
ACTTGAGCCACATCTGTTCCTATTAATTTTGAAAAACATACACATCTAGGTACATCAAAT
GACAATGTGCTAAAATATTAGTACATTCATGGCACAAGAGAAGTAATGTAGGTATTACAA
AAACCCTTTCCTCTTTGAGACCCATTTTTGTGATGATATCCCAGAACTTCCATAACTGCT
CTTGTTACCTGTATTAAAAATAGTTCTGTATTACATTAGCTCATCTCAAAAGGTAGTAAC
GGAGGAGACACCATGGGAACATGACTGACAAGAGAAAATCTACCCTGAGACCAGTGATTA
GTCACAAATGATCTACTGATAACCAATCATCTATTGAGAGGACAGTCGCATAGGCATATA
AACATAACCTGCAGCACTCACAAATACTTTTTTTTAAAGTGCAATTGTAAGAATAAAGAG
ATAAATAGTCTCTCTTTTTGTGGTTGGCACTCTAAAATGTGAGTATTAACACAGACACAA
GCAGAAAAATATAAGAAATGCAGGAATATCAAACATAATGCACTGTTTACTTTCAATTAG
GAGAATTAAAATTCATTGATTCAACTTTAGTTTCACATAATCATGAAGTTGGTTGCCAAA
CCAGAGCACAGCTTTAGGCAGGAATGGGACATCTATGGAAATACCCCAGGGACAAACTCA
GTGTGTATGTTTTTAGACTCCACTCTGTCACAAATTAGTTGTGATCCTTGTGCAAAGCAT
TTACCATCCCTTTATCTCCTGTAAAATGAAGGATCTGGAGAAGAACAGTCCCAATCTGAG
ACTCCTGGGCCCCTGAAGTTTGCAGTGGTAGTCAGTGAGCATCAGCAAAGAGTCCAACTA
AATCCCTCACTAAAACCTGGAAGTGCATTCACTCACATACTCACTCCTTCAACAAGTGTT
TATTGAGCATATACTTCATGGCAGGCATGTGCCATTCTTCTTGAGCAGAATGGTGATTGA
GATAGACACAGTTTCTGTTCTCTTAAAGCCAACGTTATCTTGACTTTGGAATGGAATGGC
CTCATTTTTTATCTCATGCTGAAAGGAAACTTGATTTAGAGGAATATGTATTATTGATGA
ATGAAATAGGGATAGAAATAGAGCTAGAGATGGGGGTGGATAAGAAAGGAAGAAGAGAGG
AAGGGAAGGAAGGGAGAAAGAGCGAAAGGGAGGAAGGAAGACAGGCAGGTGACTCAAATA
AAAGAAAGACTGCACCACATGTACCACGGGTATATTTCTGAAGACTTCAAATAATTCAAT
ATTAATTATCTTTTAGGCATTGATATAGATGATAGATTATGGATTCAGGGGTTATATCAA
TTTGCCTCCATTATAGAATATTTTTGCTTTTAAATGTACTTTTTAAGGCTGGTATATACT
TACAGCAACTTTTTGTATCTTCCAGTTATCACAAAGACAAGCTGCCTGAGTGTAGACATT
CCTTAGCTTAAGATCATAGGGCACACTGTGAAAACTTTGACTTTAAGACAATATGCCCAC
TTGTATGATGATTTTTGCAGACTTAACATTGAACCTACTTTGATGTTGTTTTTTATTTTC
TTAGCATTGTCTCTAATCCTTCACAGAGTGACTCGCTCCAAAATTAACCATAGGTCATTT
GACGCTTGAGAGTGATTCTTTGGCCTTCTGCATGGCACTTTATCACAGCTTACTTCAGAT
CCACAGTTATTGCATGATTTTGTATGCTCTAAAAAAGACTTGCGATAAGAATAGGAGCAA
TTGCTAAATTAACACTTATCAAAATCCCTCTCAGCAGGTCTGATGCATATAAACCCTCGT
CCACATGGTCCTCAAGGGCAGTGGGTTTATCTGTTAACAAAGTGGAATGACCACATAATG
ATTTTGGGGGGTCATATGTCACCTGAAATGCCTGCTTTGAAAGTATGTGATTATTGATGT
GAGTTGATTTAGCACAACTTAAAATCTGCACAATGAGTTCAAATGTGGAGATTTCAGGGT
GTGAAACCTTGTCTTACTTCGCAGTCTTTTAGTTCTCTCTACATACTACACTGTGTTGAT
GTTACATTTTTTCATATGTACCCACCTATATTTCCTAGGCATGCTGCCTCAGTAGTCATA
CTTCTGGCTGCATCAGTGGAAAGACTCCTCCATCCTCTCCCCCCCCACCTAACACCCACA
CACACTCACACATGCACACATAGTTATCCATTTTCTAGAAAGGGTCTGGCTTGTGGATTA
TAAAACAAACAGTACCTTGGTGGGGCTTTTGGGGACCCCCAGTGCTCTTTGAGCCTGCCT
TTATCCACCCCAAATATCTGGAGCTATATGAGCCCAGATTCCTTCTGTCTGAGGCCTTGT
CCTGTGTAGTTCAAGCTGACATTCCATACCAGGCACCCTCACATGATAAGGTGGGAAGAC
CATTTGTTCTGCCACTAATGAGCCATTAAATTCTGGGTCAATTATTTTACCTCTCTGAGC
CAATTTCTTCCTCTGTAAAGGAAACTTGCTTTACTAGTTGTTTTTAAAGTTCCTTTTCAT
CTCAAAAGTCTATGATTTTCTGATTGCCTGCACAACAAATCACTCTGGAACTTTGTAGCA
TAAAACAGTCTTTCATGATGCTCATAAATTGTATGGGTCAGTCAGGAATTGAGACAGGAC
ACAGCATGCTGGCTTATTTCTGCTCCCCCAGGTCTGGAGCTTTAGATGGGAGACTCAAAG
GCTGGCTCCATTTGGCATAGCTAGGTTGTCTGGAAGGCAGCAACTGAAACCACTGGAAGG
CTTACTCCCATGTCTGGCTCTGAGTTGGACAGATTCAGACAGCTGAGAAGTCCCATAGCT
GGACCACCTTCAGCATTCTTACTACCCCTAGGTTGTGTCTCTAAGTGGTCTCTCCAGTAT
GGTGTCTTCAGGGTAGCCAGACATCTTACATGCTGGTTCAGGCTTCTCAAGGCATGTGTC
CCAGAATGAGGTAGAAGCAGTATCACTTTTTTATGGTCTAACTTCAAAAGTCACCAGGGT
CACTTCTATTGCAGACACAGGCCCACCCAGATAAAAGGAGAAGGAACATTGATCCCACCT
CTTGATAGAGCAGTATCAATGTTGCATTACAAAAAGAGCTTGTAGGGTGGGATGAATTGG
TGTGGCCCACCTTTGGGAAATACAACGTCACATCATCCAAAATTACCTTCTCAATATGTT
TGGTTTAGTATGGATAGAATTAATCGGGCATGGTTCCCACCCTCTAGAATTTCTAGTATT
AAAAAAAAAAAAACTAATGTTTCCACATGTCAGAATGATTAGTAAATAATGGTAGTAGTC
AACTCTCACTGATGTTTCTTTGTCTGCTTAGCATATGTTTAGGAAATCCCTTAGTGCTTT
ATTCCTTAGGAATCGCATGCTCCTTGTCCCAACAGGGACACAGCATCCAGTGCTGTGTGG
CAGCAGTGCCATTGACAGCTACCAATATGGCAATGATAGTAGCACCTAGAGTTTTCCTCT
GCCCTGGCCTGTAGTGGATCCAGCCAGTTCGCTTCTTATAGTTCCTTTCTGTTTTCCAAG
CTTGGCTCATCATCTGTCTTCCTTGGTTCAATAATTTATCCAATACCCATGCAATAGTTT
TGTTTTCATTTTAGTTTGCCAGAAACTTTCACTTATTTATATACAAAAGAAATAAATTTA
CTTATATAAGTATAAATATTATACTTAAATATAAATATACTTATTATTTACTGGTTGTTA
AAGTAATTAAACATTAAGAAATATTTTAATAAATTAATAAGTGTTAGTGGGGCACTTTCC
ATGTACTAGGTACAGTGGAAAGAGTTGGCAATCTAATGATGATTAGAGTCAGAGAATTCC
AGAAAGGAGATGACCTAAGGAATCCCACATCATCTCTTTGCCCAACTGTAAATCCAGCCT
GGCTCCCTCTCATGAATGAGTCAGATGCTGGGGCTTCTAGACCGGCTGGGCTTAGGCCTA
AGAGAGCACTTAGGGAAACCCACTCACAACATAAAAATAAATTCTTAAAACTGAAAACCA
TTATTTTTAAAACTAAAGATTTCAGTAGATAGGCTGAAAGTAGGAAAAGAGTCACTATAG
AGATTCAAATGTATAGTCTGTGAGATAAAGCAAAATAAATATATCACGCCACCAAGCAAA
TATTTATAAGTATAAAAAGTTAAAGGATAAAAAAAAGATGTAAGACAGAAGACCTAGGAA
ATTTCACGAGAATAACAGAAATTTCAGAAGACAGCAAGGAGCAATGAGGGAAAGCTATAA
TTAAATCATTGAAAATAAATGTTTACTTGATCTGAAGAGAGACCTGAATCTGCAAATTGA
AATGGCTCACCAAGTTACAGGAAAGATTAATGAAAGACAAATGGCATACTAATTGTGTAT
GAGCTAATTCTTCCATTAAAAAACAGAGCAAGGTAGATCCATATGCTTCAATGAAGTGTG
CTCTAATCTTATACCATTTAGAATAAAGCAAGTTTTTATTGCTTTTAAAAATTTTTATTT
TATTTTTAAAGAAGATTCAGATTACATAAACATTACATAGAAAATATAGGAGGATTTCCA
TATACCTCATCCCCTCTCCCTCCCACACTATTTCCCATTAACTCCATCTTTCATTAGTGT
GGTACATCTGTTACAACTGATGAACTCATATGGAAGCATTGCTACTAACCATGGTCAATA
GTTTACATTAGAGTTTACGCTTTACACCACACAATCTCATAGGTTTCGACAAAATGTATA
ATGGCCTGTATCCATCATTGCAATGTCATTCAGAATAATCCCACTGTCCCCCAAATGCCC
CCATATTGCAATTATTCTTCCCTTTCCCTCCCCTCAGAACCTCTGGAGACCACTGCCTTT
ATATCATTGTTACAAGTTCTTCCATTGCTAGAACAATAATCTCTGCTTTAGCCCATAATT
GTATTCCCCCTTATGCTTGTTCATTTCCCAATCTTGATGATTTTGGGATGGTGATGCCCA
CTGTTTCTTATTGAGAGGGGGCTTAGATCCCATGGGGCAGATGGATAGAACTGTCTAGCT
TGCAGCTGTGGCTACTCTCTGGTTTTTAGGGTAGGCATTGCCCATCATCATCCTTTTCTT
AGTGGTCCTGGGTGAGTCCAATGAACGGATGAGTAGGTGTTACAACTCTGCTGAGATTCA
GGGCTCAACTGGCATAAAAACAGACCAAAGATTTAAGTCTCTGGGACATATATTTAGCGA
GTGTAGTGGCAGTCAATGCCACAGTAAACAGTGCCTCAAGCAGGGGTTTCCCGAGGGCCC
TAGAGACATCTAGACATTACCGGCACGGTGGGCAATCTCAGGAATTCAGCACCCTGTCAG
TGGGCCTTTACCTTGGAATATGTTCCCCAATGTAACAGCGTTAGATTCATTTATAATTTC
CCTACACATGGCTCTTCTGCCCCTTTTATTTTATAAAGCAAAAGTTTTAAAAAGAAACTT
TTTAAAATTTATATTACTAATATTAATGGAAGAAAAAAAAAACATTCACATATTGCTGGT
GGATATTTAAATTGTTACAACCTGTGAAGCAGTTTGCCACTGTATGTGTCCCAGAAAGGC
ATGTTCGTAAAGCTAATTCATTCCTGTGGGTGTAAACTTATTCTAAGTATGACCTTTTGA
TGAGGTTACTTCAGTTAAGGCAGGGCCCAGGGTGGGTCTTAATCCACTTACAGGAGCTCT
TTCTAAGAGAATGTAATTCAGACAAAGAGACAGAAAGCCATGGATGTTGGAAGCTGAACG
CAATGAAACCTGAAAGAGAAGGGAGGGACCAGCAGATGCTGATATGTCCCTTGCCACGTA
GCAGAGGAGATCAGGATTGCCGGCTGCTGATCAGTGGTGAAAATCATGATCCTCATGATG
CCTTGATTGGGAACTTTTCATGGCCTTGAAACTGTAAACTTGTAAACTAATAAGTCCCCA
TTGTTCATACTCATTTCATAGTATACTGCTTTCCGCAGCCTATCAAACTAAAACAACCTG
TTTAGATAGAAAACCAAAACATTTGTTAAAATTTAAATTACATATATGCTGTTCAACTCA
AAAATCCCACTTTTGGTAACTGAAAGTGAGAATCAATGCATAAGGATACACGTCATAGCC
TTCTTCTAGCAGCAGCAATAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGTAGGCTGGCATAAGGCTTGTCTCTTTCCCCAGGGCTTGTTTCTTTCTGGGCTCAG
CTGCTCTGGTCTCTCCACAAGGTCAGCTGTAGACTTTCAGGCTTATCTCTCTTCCCAGAG
CTATGTCTATGGAGCACTCTCTTCCTGTGTACCTGCTTCTGTGTGTCTACTTCTGCGTGA
GATCCTGCTTCAGCAGCCAAAGGGGGCTGGGACTTGACTTAGAGTCACACTCTAATGACA
TGGTTGGATCAAAGCTCTAATCTTAACATAATTTAATAAGACATCTCAGCTGAATCTAAT
ACAGTCAAAGGGTTATCACACCAGAGGAACTGACCAATTTACAAACATAATCTGATTTTT
CTTTTTGGAATTCATAAATACTATCAAACTGCTACATCCTTATAAAATCATGTTAAACCC
AATCCATCGCTGTGTAGTACATGCAAAACTGACATGTTTTTTGCAAGATCTGTATGAACA
GAACCAGCTCCAGACTGCACTAAAAGAGACAGATTGAAGGACAAATCACTTTAAAGGCAG
TCCCATGGAAGGTAAAGTCTGGAACAAAGACATCTTCTCTGGCCAAGAGAGCACTTGTGG
TGGAAAGGCTGATTCTGCCCCTGCACTTGGAGAGGGCGGGCCTTCTACTCCATTGATTCA
GGAAAGTGCTGCTACCTCAGCTTTCTCAGATGCCTGGGGGATTGCAGAGTCTGGCTGCCC
ACCAATGTTTGAAGAAAGTGGAGTCTTCACCCCAGTGTTTAAGGAGAGTGTAGCCTCTGT
ACAAGCTCTTGGAAGGGGTGGGGCTACCACTTCATGAAGACTGGAGGACAAGCCATCATT
CCATAAATGACTCTTAGACTTGAAATCTAATGGAGTATGCCCTGCAGAGTTTTGGAATTG
TTTGGCACCCAGGACCCCTGTTTTCCTTCTAATTTCTACCTAAGGGAATGGGAATATTTA
TCCTTTGGCTGTCCCTCCATTAAATACTGGAGGCCGAAAACTTGTTCTCTAGGTTTCACA
GGTTCACAGAAGGAAGGGAATTGTGCCCCAGGTCAGACCACACCTATAACAGATTTTGAT
GAGACTTTGTACTAAGCATTGTTACTGAAATGATCTGAGGCTTTTGGCTTATTGTAATGG
GATGAATGTATTTTGCATGTAGAAAGAACATGTCTTTTGGGGGTCCAAAGAGTAGAGTGT
GATGGTTTGAAACTGAATGCACCCCAGAAAAAACCATGTTCTTAAATCCAGTTCATTCCT
ATCGGTATGAACCCATTGTAAGTAAGATCTTTGGCTGAGGCTACTTCAGTTAATTTGTAA
CCCATCTCATTAGGATGGAACTTAACCCTATTACTGGATTCCTTTATAAATGGAAGCAAG
ACAGGAGAAAGCCAGGGGGGAAAGAAGCTGCAATCAACAGGACCTGGAAGAGAAGGGAAA
GATCAGCTGATTCTGCCATGTGCCTTGCCATATGGCAGAGGAGCCAACAATCACCAACAG
CCCGTCTTCAGGAAGAAAGCATCACCTTTATGAAGCCTTGATTTGGACATTACCTCAGCC
TCAAAAATTAAGCTAAGAAATTCCCATTGTGAGATATTTGCTTTAAGCAGAAACTAAAAA
GTTTCTTTAGCAGAAACTAAAACACGCCAGAAATATTTTTCTTTTTTTTTTCTGGGAATC
ACATGAAAGAGAATTTATCCAAATTATTTTGTTTGTAGAGCATAAACATGTAATAGTGCT
ACAAATAGTATGTATACCTATAATAACTCATAAGTGAAAGAAAACTAAATTTACCAACAA
CCAAAAAATGTACAAAACATTATCAATATAAAGTTGGGAAGCTAAAAAAGAGTTCAATCA
ACCGTATTAGAGGAAAGACTGAATTATCTTTCTATTCTCCATAAAAAATGATATTATGAA
ACTGTTGTCATATGAAGAGGCAATTAAAGAGAATGTAGCCAATCATTTAGGAAAAAAAAA
TTTTATGGACGTGTGTTGGACAGTTTATTAGTGAAAATATTATTTGTCTCTATGTCATTT
TGTGGTGTTTGTCAGCTTTTTAAATTTAAAATTTTTTGTAATTTCTTTTCTTCTCCTAAA
TACATATTCATTTTCATGTAATACAGAATTTGTAATTTTATTCTGCTTTTTTTCAAAAGA
AGTTAATTGTATGAATACCGGGCCCTACAAAACCTGGAACGTACTCTACCACCAAGACAT
AGAAAGATATATGTGCCAAGTATAAATAAATATTGTTTTGTCTCTTGCTTTGTTCCTGTC
TTAGCCCAACAAACAAGTGTGGAGGGTTTCCTCCAGGTGCAAGCAGAGTTTCACCTGGCA
GTCCAGAATGGATCAAAACAGAATTCGTCTTCACAGAACTAGAGACAATATTGGAGAGCA
GATAAATCGTTATCATAATGCCTTTCTTTGGTCTCTCTGCTTTGCCCTCTCCCACTGTGA
GAGGGAATAATAAGAGCCAGGGACAAAGTAATACACTTTTCTTTAAGGAAAACAGAAAAT
TGCCTAATCAATTGAAAAACTGCAGTCCCAGCTGCATATTATTAAAAGTTTCTGAGTACT
AATGGATATTGAACCAGTTTGCCAAGGACAAAGTTTTGATTAACACCTGAATATTCTAAA
ACTGCTCTAGCTCATGAACCATTTCTGAGCTCCACCTGGTATTCATTTGCACTATCTGCA
AAGGGACATTCTTTCCTTTTACCCATCCTGTTAGCCCAGAGAAAGGGAGCCTCTGGGTGA
GAGTATGGGTGGAAATCCAGGCTCTTCCCCCAAATGCCCATCAGGTTATTCTTTACAAGC
AAATACTGCATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTTTACCAATTGTATTTGACCTGGTTAACTCAACAACACATTATATGATTTATTTGTG
TGAAGCAAACATCAGAACTTCATACCTTTGTACAAATGAATAAAAATTCATTGAGTGTGT
ATACCACACACAAAAAAAGAGTGAATAGAGAAAAGGAGTATCAAATAAGTAAAGGGGGAA
ATGGAGAAAAGTATCTGTTGCAATTAGAAATAGAAGCTCAGAGTATTACCAACTCTTTTG
TCCTTTTTATGAGATTTGATGACCCCTTATAAACCTGAAAATTTTGTTGTGACTGTTACA
TTGCTATAATAGAAACAGATGGTTTGTACTTGCTGTACCATGAAAAGAAGAGCATTTGTG
GAGTCAGCGATAAAACCATGAATAGGGTATTAGAGATTTGCCTAGAAGGCCAAAGGTAAA
ATGACTTTATCTATGCCAGACAACATATATAAAATGTATAGGACTCTCAAATCATTTACA
CCTGATTCCTGCTTTCTGCAAAAAGGACTATCAGGATTTCCACTCAGTTAACTGTTTTTT
GCCCTCTTTCCTAGGTCTGCTTTGTGAACCTGGATGTCAACAAGGATGAGTGCAGCATGG
AGCACATGCAGCAGGTAACATGTGGAATTCAAGCTCATTACAGGGCTTTCTGAGCGGAGA
AAGAGCCCAACATGATTCACATACATAAAAGATGCTCATTTTGTAGAATGACTATCAAAT
GGTTTCCTCACAGCCTACTTCCTTCACCCTTTACCTGCCACCTCCTAGAGTTTGCATTTC
TTATCTTTTTAAAACTTGCTTTCCCAGTTGCCCACTCAGATTATCCCTTATAGATTTCCA
CTGAGCTCCAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAATTTACTTCTG
AACTCAAGCAACTGACACTTTCTCTAAGTACTTGCCTTATTTGCATCTAAAAATATTTTA
AATAAAACTGAGAATGTTATTGTGTTATTGGCATGAATTCGAATAATATTCAGGGCATAA
TCAACAAGGTATAGAGGCCAATGGAGTGCAGGCAGATTTGAATAATATGGACAGGGAAAA
AATAATTTGAGCTTCTCTCCTTCCCAGGAAAAATTATTTGTGTTCAAACAAACAAAAGGC
TAATCCCCTTTTAATCTGGCAAGGATCCTTTGACCATTTAACTTTCTCTCTTCCTGAAAC
AGCACTTTCCAAAATGCCCCTCCGTAAAGTCCTAGATCCAGTCTTACATTTTTTTTTCAA
TTTTTACAGGACTGTCCCATTTATTCCTCTTCTGTTCTTCAAAGATGGCCTTCCACTAAA
CATTGTTTGGCTTTGAAAGATTCCCCCTGCATTGTTGAACTCTGTCTCATTTATTACTTT
TCTGTTTCACTTTCAGACCCTGAAAATGGCAGGAATTCTAGATTCTACCATGTTGCTCTG
AGCACCACAAAACACAGGTGCAGTGATTGTTTTATAGCAAATTATGTTGTCCCTGGCCTG
AACACCCAGCCAAAATCACTACACACAAAATACATCCCTATTTTGTCACATAACAAACAA
TAGACTGTGACATAGATAAAAGTAGGAACAAGAGTTTCTCTTCTTACAGAGAAGAGCAGA
ATGAATGCCATTGTTGAGATAGAATGAAGGTGGATGAGACCAGGAGAGTCTCTACTTTAA
GTGAACTTGATTCTCCTCCCTGCTGCCCATATGACATTTGTGAAGGTTACTCTAACCTAC
TATTTCAAACAACATGGCAATTATTTTAAAGCTAGCAATATTTTTAGTAATAAAGGCAGT
AGACCACATGTTGACTTTTTATGAAACCCATAGAAATGTCAAATAAGGTCTCACTGAATT
AGATCATTTCTTTCTTTCTTCTTCAGTTTGATAGCAGATTTTTTAAATTTGAGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGTAAGTGGAATGAAATTCAGAGAGAG
AAAAATGGCCAGTTGCGTAGAATCAACTGAACCTGGAAGAGAAGGGAGAGGCCAGGAGAA
ACTGCTGTGTGCATTTCCAGGTGACAGAGCAACCAAGGATCAAGGGTGGTTGTCAGCCAG
TCCCAGAACACCAGTCTTTGGGAGGAAAGCATCTCTTTGATGATACCTTGATCCCGACTT
CCTTTTAGCCTCAAAACCATGACTTATTAAAATCCCATTGTTTAAGGCAGCCCATTGCAT
GGTATGTACTGAGCAGCCACGGAAACTGAAACAGAGGCTAAGAAAGCTAGTATATCCATT
CTTTCTACAGTTTGTCCTTCTCAACCTCATGTCTCTTGGGTGATATATTAATCCAACTTC
AACCAAGATCCCACCCTGACTCCTCCCCCATCACATTTTCCCAGCTGTCTCCAACTCTAG
CTGTCGGGCAAGTTGTGTTTTTCCGCCCTGCATGAGCACAGGGTTTGGTGACACGAGAGC
ACTATTAGCTGAGTCATGGAGTTTTGTATTTTAGGACAGCAAGGAAAATGCTGTCATCCT
CAGAACTCCCCTGATGGATGAATAAACAACATTTAAAAATAAGTGAATTTGTTCTTGAAA
TAAAATGAAGTTTCACGACTCAGCATGAAGATTTTGGCAAGCCCTTTAGCTGGAGGAGAG
TGACATCTGCTAACAAGCATCTGACAGAAGTCTAAGTGTGGTCAACTTCTAATGGTTCTA
GAAATGGGGGACAGGACAGCCCTGGCAAGAAGTACCCCAATGTCAATTATCCAACATTTT
ATAAATGGTTTCTTCTACTGTGGTGTTTGTTCAGGTTCATGTAGTTCAATTGGACATGGG
AACCATTTAGTAATTCAATTTTTTAGGTAAGGAAATTGAGATTCAATGGTGTGACAGGAC
CTGACTAAGGTAGTATTAAAAGAAATGTAACAAAATTGAGTTTCTATGGCTCAGAAGTTT
AAAATGGAGTCTGGAGTCATTCTGGAGGTTATTCTTATGTAGGTCTCAGCCAGGTATCAC
CAACTGCTATAGTATCACAGACTCAAGCAACAATCTTCCTCAAAAAAGTATATCTGCACC
CCATAAACAAACCACAGGATAAAGAACTCAGTCACTGTTAACCTGAAGGACACTTGGAGT
ACCCCAAATATCCACCAACTACAAATAACTTAAATAATCTTCTTTTCCTCTAAAATTCCT
TGCCTGGAAATGTCAAGACAGGACATCTATGCTCCCCAAATAGAAGTCCTAAAGAACCCC
AAATAAATGCCTTCATTGCCTTGTAGCTTGGTTTGTCATTTCTTGGTTGACATTCCCAAG
GATAATAGTAACAACAACCACAACAACTAACATTCCCTGAGCATTTACTCCACGTGACAA
ATGCTATTTTAAGCACATTACATATAGTGACTTGGTTAATCTCTACAACAGCCATATGAA
GTAAATATTATTATTATTACTTTCACTATGGTGGAGCCTGGAGCCTGGAAGAACTCAGTA
GCTTGATTAAGGTCACAGAGCTAGAAATAGGCAGAGTAGGGTCATCCCCAGGCTGTTGAA
TTCCAGAGCCTGTACTCTCGACGTCTGTTGGAAGATTTTAAATTGGCATAAATTGGAGGC
ATGAGAGGTGAGATATGTAGGAATATAGAAAGAACAAAGAGAAAAAGGAGCACATCCTTA
TGAATTAATATATCAGTTTAATCATATATTCTCTCACTACCGTTATTTTCCCAAAGTAAG
GAAAAAGAACAATGAACAACATTTCTTACTTACTTGACATTGACAATAATTAAGGCTGGG
AAAGTAGAGTTGTTGACTATTTATAAGGCTGAGTAAAATGTTTAAGAATATCCCCTATGC
AAGGAGAATATATTTCTAGATCATTCACATAAGTTGCTTTCAGACAAATATTTCATTTAA
CTGCAAAATATGCAGATGCCCTCAAGCTGGAAACACACCTGGTTATAGATGTTTTCCAAA
ACTTTAAAATCACAGTAAAACTTTCTTTTTAAAAATACACCAAGAAAATGTACTTGGCTT
CTCTCATAATGCTTTGAAAAACTTACTTTTTAAAAGACTATGTTAATCATCTTCAACAAT
AATGCTGTGGCATTCATCTGTTCGAAATGAAAAAAATTAAGCAAACTAAAAAGGACTGCT
CAATAGATCATAGCACCAGCCAAATTTTCAGCTTGGGAAGAATGACCACATCACAAAGGG
TCATGGAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTG
GAGAGCCCTATGGTGTCACTCCTTAACATTTTTCTGATGTGGGAGACACAACTCCATTCC
TAGTTTTATCATTTCTTCTTGCGGCCAATTACCCTCCTTCCCTGCCAGGGCTTTGTGCTC
CTGGGTCCCAGAAGCCAAAAGGCCACCATTTGGGTGGGTTACCTGCAAAATAGCTCAAGC
CCAGCTACCTACCACAGTGTCCACAGGAACCTCACACAGTCTCACACTGCCAAACAATGA
GACTCCTACCTGCTATGAGGCTGTCTTCCCGCCCCACTCCCACCTCCCATAAATATTCTT
CTCTGTTCAAATATGCCTAAGGTAAAATCATCAAGGTTCCTGTCTATGCAGGTATCTAAT
CAAAAGAAGAAGAAGAAAGAAAAATCCTTTCCTGATGGGGTGATCTTTTTGTCCCTCCCT
TGACTGTGAAGAGAGGCAGGAAAATTCCTCCCCCACAAGGAGGAGAGGGGAAAAAGGCAA
AGGCTGGTGACTCTATAGGTTATCTCCAATGTTTGCAACTGGGAGCAAAGGGAATTCAGA
TCTGAAGCCATGATCTTACCATTCCTAGAAGTCATTGTCAGCCAAAGAGTGACAACCCAG
GAAAAGAGGAATTCAAAATGGCCCAGAAAGAAAAAAATAATAAAGGTTCTTTTCCTTCTT
TCCTTCTTCCTGCTCTTCATTCCAGGTTGAGAAACTGGAACGAGGAAAGCATCACCAGTT
ACATAATTTGCAGGGACCAGTACAAAATGAAAATACAGGTTCCCTTGTTCAAAAAATATT
CAGAATTTCAAGATGGTGACAGTAGAGCATGAAGCCAAGTGCAGGGCCCTTCTAAGCAGG
GAGCTCTCCACAACTGTGCAGGCCATCTGCCCAAGGAGTCAGCCCTGCAGGAGACTACAG
GAGTGAGGCTAGGAAGAGCAAACTATGCCTTCTCCTCGTAGTTTGATCAGGCCCTGATCA
AGTCTAAGCTGTAAGGAAGAGAAGAGACAAGACAAATATTGCTTTGGGTTGGGAAGAGTA
AATGGACAAAAAGTAAAATAATTGCTTATTTGCAGCCTACAGAGTTCATACAGTTTAATA
AACTAACTGCACTTGAGAGAAGTCAGCTTAAGGACAATGTCAGCATTCAAGAAAATATAT
AGCTGAAAGAACGACAAAAAAACAGATCTAAAGCCCTGAACTCACCATGCCTAAAGCAGC
TCTGATCATGATCAGATACACTGATAAATATTGTAACATTAGTAAGAAATTTATTTTTCA
GTCTATCACTGACTACTGTAACTAATAATAAACCTCAGTATTTCGGTAGCTGATTATGAT
TTAAGTTTCTTGATTCATCATTTACTGATCCAGGGAGGTGACTGTTTTAACCACTTGAAT
GTAAAATGGAAATGATGCTGGGCCAGTTCTGGGCCTGACATGTGAGAAGTCTGGCAGTTT
CTATGTTCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTTAATTGTA
TAACAAGACACTATCAACAAAGTTAAAAGGCAAACAATAGATATGCACATATTTACAATA
TGAACAATACTGTACAAAATTTACAATATTTAAAGCTCCTACACTCGACGAGGAAAAACA
GCCCAGCAGAAATATTGGTAAAAGACAATGATGCAGACATTTCAAAAAAGGTGAAAGAAA
GTAACCAATAAGTATGTGGAAATATTATCTGCTTCTTTAGGAATCAGGGAAATACAAAAT
AAAACAAAAATAAGTGACCATATTTCATTTATTAGATTAACAAAATTTTAAATGATTGGT
AACTATCAGTGCTGGTAAGGATGCAAGGAAATGAGTACCCTCATACAACTTTGGTGGGAA
GGTGAATTGCTAAACTTTTGGGGTGGAAATAATAATATTAAGACATGAGCACAAGTCACT
TATAAAGAGAAAGTTACACTCAGCCAATTAAGACCTGTCCGGCCTGAACTGGTTTGCAGT
TCTGGACTTCTGTGACTGAGAAGCCAGGAAGCTCTGGTTGAAAACAACAAAATGGCAATT
TGTGAACTACACCAGAGAACCTTGCTGTTCCCACACTTCCACCCTCACCCCTCACAAGTG
CATTCTGAGACAGGTTTCAAGTTACCATGAGATAGCTTGAGAGATTGGCTGGGAAACAAT
GACTTTGAGATTCCATTTGGACTATCTTGAAGCTCAGGTCAGATTTTGAAAAGCAGAAAT
GGAAGAGGGGTAGGGAAGACAATTCCAGGCAAGAAGAGGAGAGTAGGCACTGGGATGAAG
TTCCAAGACAAAGACATACAGGACACTGATCAAGAGAAACAGGAGGACTGATATTCAATT
AGAGTCAAATGTGACAGACTTGAACGTTTAATAAGATGTAGAGGGAGTGGGTAGAGCTAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGGCAAACTTATTCCCATAGTTCCACTTCCATGGAGCAGTTTAAATATAAAGTG
GTTCATGATCCAAGGCATACTTTAAAAAAGTGAGAGGCTTCTAGTGATGTCTGCTTTATT
CATGGTCAGAAAGGCTACAACAGAATGAGTGCTACATTTGTCCTAAGAGAGTCTGGCTTT
GAGTCTTATCTGCTAGGGATCAATGAATCTTTGGGCATATCATTAACGTCTCCAAGCTTA
AATTTATTCTTCTGTAAGATGAAAATCAATACGCTTTTTTTTTTCTTTTTTCTTTTGCAC
CACATGTGTAATAGTTTACTCTATAGTTCACACTCTCCCCTAGTACATTCAATTTAGGAC
AATTCCAAGTCCCAAAAATGCCCCCACATTACATCTCTTCTTCCCTCTCCCTGCCCTCAG
CAACTACTGTGGCCACTTTCTCCACATAAATGCTACACTTTCTTCTATTACAAATCAAAA
TAGTTTTATAGCGTTTTATATTAAAATATCAGTAATTCCACTCCAATCCATATTTTATTC
CTCTGTTCTGTGGGTCCTGGGATGGTGATGTCCACTCTATCTCTATATCAAGAGGGGACT
TAGATTCCATATGAATGATGAATGCAATTCTTCTGCTTGCAGTTGTAGGCACTTCCGGTT
CCTTGGTGTGGTGGTTGACCATCTTCACCTCCCTTTTAGCTTATCTGGGTAAGTCCAACA
AACCAGATAGTAGGGGCTGCAACTCTGCTGAGGCTCAGGGCCCAGCTGGAACATAGGCAG
TTCAGAGATTCAAGTCCCCTGAGTACACACCATCCCTACCACCAACCACAAGTTCAGTAA
AAGTGACAGAAGAGACATGTGTAGAAAGGTCACATCTGAGTCCAGTTCCATCACTCTCAG
GAGTACAAATACCAAAGTAGGGCCCACGGACATGGCACAGAGCTCCAAATCTATCTGCCA
TGACCATAAACCCTGTGGGTGCCCATAGCTTTCAGGAGAACCAGAACCTAGGGTTGTATC
TACTTTGGCTGTTTCTGGGGTCCTGCTGAGACATGCATAAGCACAACCCTTCTGAAGACC
TCCCGACTCTTTTTTGAAGACTCTTAGCCATATTAACTCATTTGTCTTTGCCATTTCCCC
CTTTTATTCAAGGTCAGAAAGCAGTTTTAACACATGATTTTACATGTAGGCTGAGATATT
TGGCTGGTCTGAGTTGACCCTTTTATTCAAGGTCTCTTTCTAGTTGCATCACCAGGTAGT
GATTGGTAGTAATCCCTCAGTGCCAGGGAGGCTCATCCCCGGGAGTCATGTCCCATGCTG
GGGGAAGGTAATGCATTTACATGCTGAGTTTGGCTTAGAGAGTAGTCACATTTGAGCAAC
ATGGAGGCTCTCAGGAGGTAATTCTTAGGCACCCTGCAGCTCTAGGCCTAGTTCATATTT
CAGGCACACAGGCTCATAAACATAGTCATCATATCAAGGGCTCATCATTGGACCATCCTT
CCTTGTTCGTCTTTGCCATTGCACTTGGGGATTAGTTGTCATTTCTAACTGTAACTACTA
TGAAAATACCCAACATATATCAGAACATTTTTATGTCCCCTATATACATGCCCTGGAGAA
CTCCCTCCCAACCATGTGCCCCCATCTATAACACCTCACACCAGTGTTCCTCCCCTGCCA
TAGTTGAACCTCTCTGTGGTCCAAAACTTCTTCAACAATGAAGCCTAATATATTGCTAAA
TTCAATTAAAAAGAAAGTGAAATACAGTGATGGGTTTAAAGATTGGAAATATACCTACTA
ATTTAGAATACTAAAATAAAGTAAAAATAAATTGGTGTTTTTAAAAAACGAAAAATATTA
TAAAGCTTTGTTTTTAACATTTTGCCTTCATCACTGGAATAGGTGTTACCCTGTATGTAC
AGAGGCAAGGCACTTTCTTTCATTTCTTCCTCAGTGTCTACATCCTTTCTCCTTTCTTTT
TTTTTTTTTCCTAATTCTTAATTTGTCTTCAAAACAGTTTTAGATCACAGTAATTCACAT
ATACAATATAGGGGGCTCCCATACATCCAACATCAAACTCTTTTCCCCCTTCCCCAGCAA
TGATCTTTTCACATGTTCATGTTATATTTGCTGCAGCTGATGTACAGATTTTGAAACATA
GCTATCAAACATGGTTCCATTTTGGTTTACATTATGGTTTATATTTTAGACTGTACAAAT
TTCTAAATTTTCAGTTTCCTTATGTTTTACATTATGGTTTACAGTTTAGCTTATAGACTT
TTATATATTTTTGGTGTAAGTAACATGCCCTGTATCCATCGTTTTCTTGATCTTGTGGAG
CACTTCCATTGCCCCCTAGTTACCCTGCTTCCCTCTATTCTATACCTCTCTCCCCCTCCC
CTCAGGACCCACAGTGACAATCAATCTTCACTACTGAGGGACCAGATTTACATTTTTTTA
AAGTATTCAGTTTGACAACATGCACAAACATGCTTTGTAAACTGCAAGGCACTATTCAAG
GTATGGTGCCAGTGTGATTCCTGAAGTTTTGCTGTATTATGGAAAGTATTTTCAAGAAGC
CTGCTTGAAAACTGACATTTGAGACTACAGAGACAGAGTTAAAACAGGTTGGAGTATTTA
TAAACCTAGTTCTTAACTGGGCAAAGCATACTTTTGACAGGTGATTCTCAGGGGAAGCTT
TCAAGTGTCAAGTTCATGGATCCATGAGTAGAGACTATAATTGAGGAGAGTCGACTTTAG
CTAGAAGTACAATTCTTAAGATCTTGGGGAACATAAATAAGATTCTTTAAAATGAAACCC
TGTAATCCTTTTGCGTTTATACTCTCTGATTCTCTGTCTTTTCCAAGGCCCACATCTCAC
CACCACATGAATACAGTTCCCTGCTTTTTTTTGAAAGACTCTTAATACTGAAGCAAGAAG
GCAATTGCCTTTTAATGTAACATAATTGTAGTCCAGTTCCTGTAGTTTTGGTGGCCAAGG
TGTTTTAAACATTAGGAATTCCCTATTGTCCATAAAAAGGCCTTGCCATTATTCTGCAAA
GGATCCATGATCTCCCAGGCACCTCGCTCAAGTTGTGTTCTCTGCATGGAATACACATTC
TCCTGTAGGATGCTTGATAGGGTGTCTTCTAGCATCTATTTGCTCTACCCCAATGGCCCC
TACTTTCCATATTTATAGCTAAAGAGAAACTAAGAGCTTCCCAGCCTCCAGGGCTTAGCA
CATGCCCAAGGCTAAACCAATCATTGCATTCTATCTCCTTGACTCCAGTGGTTGATTTCA
GTTGGACATATGACTGAGTCTAGAGAGTTAAGAAAGGATTGGCTGACCATTATGGGCAAA
TAAAACAGATTGGACAAGATGGTTGGTTTTATTTTTTAATTTATATTTCCCATTGTCTAA
CTTGTTCACTAAGAATTTGTAGTACTATACATGGTTCTATTAAATTGAGGTTTCCTGGGA
CTAAATTTTATTGCTTTTTAAATATTGGAAAGATGATTCTGACAATTTTTAAAAGTTTAA
TATTGAGTTCACCAGGTAGGAAAGTGATTAAGTATTTCTCAAAATTCCTCTCTTTCTGAA
GAAAGAAATGGATTTAAGTTTTACATCTCTCCTTAAGTAACCGGTAGTGCTATGTATCTA
TGAAAATGACACCCAATAGGGTGCCAATTAAATCAGTTCTGACCAATTTTATTAAGTGAT
TGTAGGAATTCATGTATCTAAAAAGTCTTCCATAGTTTTTACCAAATGCTAATAGATCCT
CAAACCACGATTTATTTATTGTCATTTATTGCTGTAGAGCATACTGCAATCCTCCTCATT
ACTTTTACCTACTTCAAAAATACCTTGCAAATGAGAAATAATTTAAAAAGTAAATCATTT
CTCCCAACTAAATGGGGGGTAGGCAGTTTTAAGATTCCAGCTATTCCAGGTTTTGCTGAG
GTAATTTTTTTTAATGGCTGCAGGTTTAAACACTCCTTCCATTGAGAGATAAGGTCTATG
CCCTCCCCCTTTGAATCTGGGTGTGGTTCTGACTTCTCCTGTAAAAGAGTGTGGTGAGAA
TGACTCCTCAGAGTTCCTAAAGTGAAGCCATTAAATGCCAGGCAGCTTCTGCCTGGTGTG
TTTGGGACACTCACCCAGAGATAAGCCAGATGCCACGTAAAAAAAATGTACTAGCCTGAA
ACTACCATACTGGAAAGGCCTATTATAGTGATCCTGTACTTCAAGTCATCCAGCCCAGGC
ACCAGATATGATGGAGCCATCCCTCTATGTCTTATTAAAACTCCTAACCCACAGACTTCA
TTAGCATAATAAAATTATTGTTGTTTTATGCCACTAAGTTTGCAGAGGTTTGTTATGTAG
TACAGTAACAGAATATTTCCCTTTAATCCTTTAAACTATAGACTTTAAGATTTTTCTTTG
ATATATTTAAGCTATTGTGCATCTAGGTATGAATTTCTTTTTTATACATTTAGGATTCAC
TAAATATTTTTAATATATTGATTGATGTCTTTAACAGTCCTGGAAAAATTTCAAGACATG
ATCCTTTTTCTGTCTCATTCTTCCTCTCCTTTCCTTTCAGGTCTCCAATTAAACACATAA
TATCTTTGGACTGTGTCTTCTTTTTCCTATCTACTTTTCCATATTTTTTCTTTTGTATCT
CCATGTTAGATAATTTCTTCTGAGCTATCTTCCAGTTTACAAATTTTCTTTTCAGTTTAG
TCTGGTGCTAAATCCATCCATTTTATTTTAATTTCAGTTATTCTATTTAGTTGTAGAAGT
TCTATTTGGTTCTTTTTCAAATCTGTAATGTCACTTTTTAGTTTCCTATTCACTGCAGAT
ATTCTAAGTTTGTTTTATGTACCTATACATTTCTGTAAAACTAATAAGCATAGTTGCTTT
ATAATTTGTTTCTGATAATCCTAGATCTGAAGTCATAGTGGATCTATTACTATTGTGTGC
TCCATTGTTTCTCGCTCATGTCCTACAGGCTTCTTGGCTTCTTGAGCATCTGGTATCTTT
GATAGTGTGCTAGATCTTTGATTTGAAAAATATTTGTATAAATAATTTCAGGCCTCTGAT
GGTGAAATCTCTTGGTGTGCCAAAGGCTGCCAATTTAAACATTCCAGAAATGTGTTGGCT
TTTATGAAGGGGATTTTTTTGAGGTAAAAACTTAACAGTTTCAAGGCCATGAAAAGTCCA
ATTCAGGGCACCATAAGAAGTGCTTTCTCACCAAAATCAGCTGCCACATGTTGAAGTAAG
ATGGTAGATGATCTCTGCCTGTTTTCTCCTTCTCCTCCAGGCCTCCTCTCTCAGGCTCAG
CTGCTCTACTTTCTTCCCAATTTCAGCTGCAAGCTGCAATGGGCCTTGTCTCTTAGGACT
TCCTGTATCAGTCTCAGCTTTCTGCTGTCTTTCCAAGTTCAGCTGTAAACTATCAAACAT
ATTGCAGGGCTGTTCTCCTCTTGAGCTACTCCATGGCCCCAGACTCTCGGAGCTTCATGC
TTAAGCAATCCTCCCTCTTACGTGGCAGGATCAAACATAGCAGTTCTCTTTTTCTTCTTC
TGTCTATCTGTCTGAGTCCATTTATTATATCAGACCCAGCAAGGGGGCAGAGACACAACA
TGAATCACACTCCATGACATAATCTAGTCAAATGGGTCTCACATCCAAAGGGATGGATTA
GTTTAAAATATAATCTTTTGCTTTTTGGGATTCACAAAATTCAAACTGTCACAGGTGGGG
ACCAGATTCTGCATTTTTAACAAGCTCCTAGATGATGGTAATGCTGTACTTTCAATAGCA
AGGAGGTAGATGGCATGGGTAAAGTAGGATAGGAATATGAATTGAAGTTGTGGGGATTAA
AACACACTAGAGAGCACATGCCACATATATCTTTTAAAAAATAGGCAACCCCAAATCAAG
CATGTTTGGACCTTTGTTTACAAGGTCTCAGAGAGATTGAGGCATATTAGAGAGTACCTT
ATACAGTGGTAGAACTTTAATAAAGATATATTGCAAGGAGTGAGGGTCTATGAGTTAGAC
TGAGAAGGATAACAAAGAAGATAGCATGATACATGTCCTCCAGACTATCCCACGACTGGT
GTTAAAGCCAGTGGTTTTGTTTAAAGAACCTGCTTTTATAGGGAACTATGTGAGTCACAG
AGACCTAAGTAGAAGGCCACTCATCATCATCATGGTTTGCAGCATAGGAAACTCTGGGTA
ATCTGTTCCTGACCTAGCCCAGCACGGGAACTAGGAGGTATTCAAAAGTGCTCACTGAAC
AAAAGGTGGGGACAGTGGGTGGATCCCTCAACTTCAACCCAAGGACATATTCAAGTCAGC
CCAGAACAAAATACCATGAGTAAACTCTGAGCTGACATGAAACACTTCCAAAAACACTTC
CAAAAAATCAGTAGAGATGTTCTTGTAAAGGGGAAGCTGGAGGTCCTTCCACATACAAAT
GAAGACAAAAGTGTAGTCAACTTTGAGAAATTACTACTAATATAACATCCGTGGGATCCA
GAAGCTGAAGAACTGTGGGGATTAACAATGGACTTTGAATAATCAGTCTATCAGACACCA
TCAAGGCACCATGTATGACAATTACAGTCATAGTTGTGGCAGATAAAAATAACATAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAGAATTGCCA
TTTGATTTCATTTGATGGAACAATGGTGTGGAGTCCATCAAAGAGAGAAGAGGAAGGACC
ATAGCTGGTAGGACTCTTAGGAACTGTATGCTTGAAGATTGCAATGTGAGTGATATGGAA
GACTTCTGCAGCGTAAAAGTAGATGCCTTGTCACTAACTTAGCTACAGACATTTGGTCGA
TTTACAAATCTTCTCTGGGTCTTGGGCTGCTCATGCATAAAATGAAGACAGTAATGGTAC
CTAATCCATAGAGGAGTGTTTGGAGCATTAAATGGAGTAAGATATACCATATGTACAGTC
TTTAGCAGAGTGCTTAGCACATAGTAAGGCGAAAAATCAAATATAGCCATTATTTTAGTA
TCAGCTTTTTTAGAACAAATATTTTTTAGCCATTCTCCTACTAGTGGACTTAAGGGGGAA
AAGTTTCCTAAACTAGTATTTATACCTATGTCATGACAGAAATTATTAAATGTTGCTTTG
GATTTGTTTGATTGTTTACTTTGGAAATTTTATAACTGAAGATTTCTTAAAGCTTTATAG
TCAAGAGACTTTCTATTCCCACCAAAACTCTTACATTTCATTGCTGAGAGCAGGGAGAGG
ATGAAGAGATGTGACGTGGGGGCATTTTTGGGACTTGGAGTTGTCCTAAATGATATTGCA
GGGTCAGATGCTGGACTTTATATATCCTGCCATAACCCATTGAATGTACTGAGGAAGAGT
GTGACCTCCAGGGTAAACTATTATCTATGTGGTGCAGCAGTGCTCCAAAATGTGTTCACC
AAGTGTGATGAGTGTGCCACATAATGGAGGAGGTTGTTGGTGTGGGAGGAGTGGGGTGGG
GGGTGAGGAGTATTTAGGAACCTCATATTTTTTAATATAACATTTTTTTGTGATGTATAT
ATCTTAAAAAAAATACAATTTACAAAAATGATGGGGTGGGAGTGAGGAGTGGGGTATATG
GGAACCTCTTATGTTTTTTATGTTTTTTAATGCAACATTCTTTGTGATCTATTAACATTA
ATTTTAAAAGTGTAAAAAACTCTTACATTTCAATACTATACAATCTCTTTTATCAATAGA
CTTAGTAGATTAAATAACCTGTGTAAATGAATATTTACAAGAGTAAAGTATGTTTCAAGT
AAAAATATGTTGGTGTGGTATTTTGAAAATGTAAAGACATGATCTGAATAAAGATTCTTG
CCCTACAGAAATTGGTCAGTGTTTCACCAGATCTTCCAAAACTTATCAACTCCATGAATG
TCCAACAGCCAAAAGAAAATGAAATTGTCCTCCTAAGTGGACTTACATCTGGAAATCTCC
TGGCAGATTTTGAAGTTTCACAGGTAAGAATGTAAGCTCTTGATTCACTAGTTATGTGTG
GAGAGCTCTGCGCACCAATCAGTATGAACCCAAAACAGATGTTACATGTAAGCTCTACAG
TATAAAAATCCAGGACTTCTTTGTAGTCAGTAATAGTCTTCATTTGTATTTCTCCTAAAT
ATGGCAGCTCAAAGTTTGACAGAACTTCCTTTCTATCTACTAGCGTTTATTTTCTCAAAT
TCTTGGTGCAAAGTTGAACTTGAACTAAAGCAGATGCGTTAGGCATTGACTGGTTACTCT
GGAGCATCTATTTCGGACTGGAGAATCGACGCCAGAATTACCTTTCATATTATGAACAAT
ACCCTTGTTCCGAATCCTACCAAGTGGGCCCTCGGATCTGACAATATCCTCTATCTGGAG
ATGTAGATCTTCCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
ATTATCTGAGTGAGAAGTTTTGGTCACCTTGCCTGGAGACCCTGCTGGGTCAGCTCTCTG
CCCCTGCCGCAGGCCATCCAGATCTGTCTGACTCGAATTCCTATGTGTGTTCATATTTTC
CAAACTGCCTCCTGGTCCAACTAATAGAGATCCAGAGCCCACGGAAGATGTGCATTTTGG
AAAGGATGTTTGGGTGCATGAGGGCCACATGGACCTCATCAAACGTGTATGCTCAGTAAG
GGAAGGGACAGCCACAGGAGGAAATCTTAGGATTTGTATGTAAATAATGAGTATCTCAGG
AAAAATTTGCTTCTCTAGGAAAATTCTTGACTGGACTGGCCTTTTCACCATAGTATTTTG
CATAACCACTGGCTATTATAAGACTCTATGTAATTATTATTTTTCTTATCCTAAGACTCT
AATATGGAGCAATTCAGGAAGGGAAAGGTAACTATGATTCCACCTACTCTTTTGTTGCTC
ACTAGTGCACATAAATTGGTCTTTTGACATGTAAATGCATGCGTAGTGGTGTACTTGTTT
ATGTATATTTAACATGACCAGCAATAAATAAGGTCCAAGAGAATAGTAGACCATAAGTAA
GTTAGTTCCATGAAAGCAACAAACTCATCCAACTTGCTCACCACCATATCCTCAGCAACT
AGGCCAGTGCATAGCAATTAGTAGGCACATAATAAATACTTGTTGAATGAATGAATACTG
GAATGAATGAATGATGTTATGAATGTTTTTTCTTATATTTGCCAATTGTATAATTCAATT
GCAAAATAATATAGCAATATAAAAAAGCCATGGAGTAATTTGTTGAGGCACAAGGACAAA
GATAAGAATAATCAAAGAGGAAATTGCTCACAAACAACAAAACTCCTCAAGAAGTGGAAA
AGACACACCAGCTACATTATTCTCCCAACATCACTGTGCTCTTCTTGCAAAGGAGATTAG
CCAGCTGGTAACTGGAAGCTTATTCTTGGTGTACTTTGTACTCCATCCTGATACTTCATT
TTGCATTAAGCAAAGTTTTTTCTGCTACCCCTGCCTGCAAGTTTGCAATTCAACAGAGCT
GAAACCTTGTATACGCCATCAGCAATTGAAAAATAAACGCCAGTAGGAGAGAGAATTAAA
AGTTTTAAAAATTTATTTCTATCATTAATTTGGCTTACTTTTTGTTACTAGTCTTTGCCT
TATTTATTTAAAAAAAAATGCGTTAGGGATGCTTGTAAAAGAAATACTTTTTAAATAATG
CAGTTCGCTATTATGCTGTTCTCTGTATAGAGGCAGGCAGCACAGTAGCGATGGGGTGGC
GTGATGCACCTGGCAGCAGGGTGCAGAGAGCTGACCCAGCAGGGTCTCCAGGCAAGGCAG
CCAAAACTTCTCGCCCAGATAATGTGCTATTAGAATGAAAGAATTTTGTTCTAGTCTTGA
TTAGCAAATTGTCATGGGCCCCATGTAGATTTCACGAAGAATCTACTATACATTTAGGGG
ATGGCTTTCTGAGATACTTGGAATTTTGAAGAATTGAAGAATAAAAGAAGACTTTCACCA
TCAAAATTATAACCCAAGGAAAAACAATTTGGAGGAAAACAAATGCTCATCATTTGAATC
TGTAGGTGTATGACATATCACGGTCAACACATCTTATTTGCGTATCCTTACATTTTTATT
TCTTGTGAAAATAAAATTATTTCACTAAGTCTGTCTTTAAATATTGCTTAGCTGTTCATA
TTGCTTTAACTTGTCTTTGGTACCTAAAACGTTTTAACACATGCTATGTAATTTTAGTTC
AAATGGTATGGAATTGCCAATATGAAGCCATTTTGACCAACAAATATGACAACTTCATAT
GGTTCAACTGTATAAATTTTTTTTCATGACTGATCCACTAGTAGTATATTGCGCTCTACT
CTCCAGGGCAATTGTCTGTTTAGTGTTTGTACTTACACAAACACATTACATGTAGTAGGT
GCTCCAACAATGCCTGGTAAATTTAAGCTTAATATATAATGTCTAAATTCAGTGACAAGA
AAATGTATCAAGCCAACTACTATTACCCTATAGCAGTAGTTCTTCACTATTTGGCAGGTC
ATAAACCCTTTATGAATTCAATAAAAACTACAGACCAGTGCTTCTCAAACTTTAATGCGT
GTAGGAATGACCAAGAGATTCCTTGTTAAAATGCAGATTCTGATTTAGTAGGTCAGAAGT
GGAGCCTCAGAATATGCATTTCTAGCCAGCTCCCAGGGGATGCCAAGGCCACTAGCCCAG
GACCCAGATTTTGGAAAGCAAGAACTAGCATCACCTTTCCTTGAAAACCAGACTCAATCA
TGTAGACACATAGATTAATTCTATTTCTGAGAATCTATGGGACCCCTTAAAGATAATTGA
ACTTTTCATTTTAAAATCACCTGTCTTTGGGTTCCTATAGTTATAATATTCAATCGAGGA
TATCGAGAATTGCTATTCGCATAAGAAAAAGATATATTAAGTAATGAAATACAATATGAA
AGTCTATGTGTAGATATTTCCTTGTATGTATACACACTCACCACTCACATAAATATATAT
TCAGACACAAGGATTTCAAAACATATTTTAAACAATCCTTTTTATCAGTTGAACATTTAA
ACATGAAATGTTTTCCTTAAACATTTCAAATTCCACTTTGAGATACTTCTATAGCTCCTC
CCTGCACATGAACTCTTGTTTCAAATAAAAGAATTTTCTCTTTAAAACTACTATAAATCA
GCATCTTGTTCCTCCTACAAAAAAGAACACCCTGACATGGACAGGATATGTTTGTGATTT
ACTAGTAATCTGTGCACAAGCAATTGCAAAATTGTATTGTTATTCTACTGAAAGACAGTA
TGAATAGTGAAAACGAGTGGTGGAGAATAGAGACATGTTCTGTAATCCCAGAATTGAACA
GAATTAAAAGGTCTATCTGAGACAATTAGTTTGCCAAAGGGCTGCCAACGCAAAGTACCA
GAAATATTTTAGCTTTCATAAAAGCAATTTTTTGGGGGTAAAAGCTTACAGTTCCGAGGG
TATGAAATGTCCAAATCAAGGCATCATCAGAGATGCTTTCTTACCAAAGTCAGCTACTAT
TTCTCCTGGTATGTTACCACTGGTAAAACAAGATGGTGGACGATTTCTGCTACAGTCTCT
GCCTTCCCCTCCAGAATCTACTGTCTTCAGGATCGTAGCTATGGGCAACCAGGTATAGGG
CTTGCCTCTTTCTGGGCCTCCTCTCTGAGTCTCTCTCAGGGTTTCTCTGCCTTTGCCTCA
GCTGTAGGCAAACCTGGGAGTCCTCTCTCTCTCACATGGCTAGGTCAAAATGGGTAGAGC
TCCCTTTTCCTGTGTATCTGTCTCCTGTGCCTCCATTTTTATCAGATTTAGAGGGCAGAC
TCAACCTGAGTCGCCTCACTGATGTCACCCATCAAAAGGATCTCACAGCTACAGGAATGG
ATTGATTCAAAAACACAGTCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCTCACTTCCCAATTGAACTTTTTTTAAAAATTTCATGTTGG
CTGCTTTTTCAGATGAGCAATCCAAATTATGTAATTTAACTATAGTTGATAGAACAGTTT
CTACAAATCTGAAATACTGGGAACAGTTTTCCTGATTATCACCAAGGCAGAAAAAGATGT
TATAGAACCTGGGACTCAATTTAATCAAAAAGGGAAAACAAAAACATGTGATACAACTGG
TCTACTCCCTTAAGCCAAAATTTCTCCTAGAAACTCTGTGTTCTTGAACATCATTTGATT
TTTTTCAAACACTTTATCAATATAAGCTCAAAAGATATTTCAAATATTTTAAAGGTCTCT
TCTCATTCTAACAGGAGAGATTGGTAAAAGGAAAAAAGTCAGAAGCAATAGTCTCTTTAA
TAAATGCCTTCTTTTCTCCCCACTTCTAGTGTCCTTGGTTGCCAGATATCTGCTTGGTCC
AGTGTGCAAGAGGGAACAGACCAAATAGTACCAATTGCATCATCTTTGAAATCAACAAAT
TTTTGATTGGTCTGGAACTGGTGCAGGAGCGGCAGCTCCACCTGGAAGCCAACATCGTGA
AACTGGAGGATGACACAAACTGCTCCTTGTCCTCAATTGAGGAAGACTTTCTCACTGCAT
CTGAGCACTTGGAGGAGGAAAGTGAGGTGGAAGAGTATAGGAAAGGTAAGAACGTTCCAG
TACAACGAATGTGCATCCTTGCATTAGTCACTGCATAAAAAGTCTGGGTGAAGTTTCAGA
AAAAACTCAGGCCGCATCAGTTTGGCTGACACATTACAATCTTTACTGAGTTCAGGGTGG
CAAAGAGGATAAGAAGAGCTAGGGAAGATGCTGACTAATACACTTAACAGATTAATAGTC
GGATGGCTCCAGACTCCCCAGAGATGCCATAGGGATGCTGAAGGAAATCTGTGTGCTATA
AAGGGAAATCCTCCTTCCTACCAAAACTGGAGGAGATCACTGGGAGGTAGATAACTCCCC
TAAGACTTCCATATATTGGTTGGGAGCAGAGTTAGACCGGCCTGAATTTGAATCCCAGCT
CTGCCATTTTGAGGCTGTGTGACCTGGGGCCATTTATCTAACCCTTCTGAGTTCCAGTTT
CTATATCAGTAATTTAGAAGGACAATTGTCCCATAACAAATGATTGTTTTGAGGACAGGA
GGAGGTAAATTAGCCTGATTTGTTCAGCTCTTTCTGTTGATTCTAAAGGAGCTCAAAGAA
CAAAAGGCCCCTCTTCCCCACTCTCAACCACAGAGGGAGGGACCGCCTAGCTGTTGTAGC
CACTGTAATCTGCAAACTTTAGAGCAAATCTCTACAACCAGGCCTCACTGTTGAGGTTGC
TCTAAACATACTCCTTCCTTTCTCTGTAGCCACTGGGAAGCTTCTATCTTGCAATTGTTG
TGGCTTGATTTCCCTTTGAAGAATGGTGACCAGTTCTTAGTTTGCCATCACCCTCTTCTC
TCACTTTACTCTGGCATTTGTAATTAACAGTGGAAGCAATTTTGGGGGTGGTGTTCCATA
ATGAAATTAAACATGTTTTTCAGTTTCATTTTTCTTGGAGAAACATCCAACAAAAGAAAA
AAAAATGGTTGATGCCTTTAGGAAGTTTTAAAAATTGACCACTATTTTAGACTACTGACA
ACCTGCTACCCAAAAAGTAAAAGTGGCCCTCATTTCCTCTTTAATAGGTTATGAAAATAT
AAATGTCTCGGCCACTGGTTTGGAAAGTAAAAAGCTGAAGGAAGCCAGCCAAGAGGGATG
GAATTACAAGGAAAAGTTGCTTTATGCTTTGGAAGACAAATACATTAGCAAATTTCATAC
ACCACTGATTACAACAGAAGGCTCTCTGGAAAAGGTAACAGAAGAAACATACTTGCAGAG
TCTAGATCCCTCAACCAAGCCATCACAGTGGAAGGGTGAAGCTGTGGGGAATGAGAGATC
AGCCACAAATCACCATTATTTAGAAAATGTTAAGGGTCAAGTGGAAAACTCACAGGCACT
CTGTACTCCAAGCAATGCTTGTTCACCAGGATAGTAAGAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTGGCCACTATGCCATGAA
CTTGGCAGAATCTGTGCTGCAGGATGCATTTATCAGATTATCTCAGTCTCAGCCTGCACT
ACCCCAAGAATCTGCTGACAGTGTCTCTGTAGGAAGTGGTCTGCTTCCTAGTGGGTGTTC
CTCAGAAGACACCCTGGTTGCTCGATCATGGAATGAGCTCCCCAAAATCGTCATTGTTCA
GAGTCCAGATGGTGGCGATGCTGCCCCTGAGCCAGGCGTCTGTTCATGGCCTGAGTCAGA
AGTCTCTGCTGAAACCCCAGCCGTCTTCAGTGGAGAGAACTCCAGAAGACACCCCCAGAG
TGCTCTAGAAGTAGCACTAACTTGTGCAGCCACTGTGATTGGAACCATTTCCAGCCCCCA
AGCCACAGAAAGATTCAAAATGGAGCAAGAATCCCTGGTCTCAAACAGCCAACTGGGAGG
GCATGAAGCACTGCACACTCAAGCACCCCAAGTACTCAAAGAACCTCCTATCAGTGAATA
CTCATTTCCATCCGCTTTATGTGGCATGACTCAGGTAGCAAGTGCCGTGGCTGTCTGTGG
CCTGGGTGAAACAGAAGAGGCAAAGTGCTCTGTGACTTCAAGTGACCCTCAGTCTGCAGC
CAAGACCTCTGCAGCCATCCCCCCACTGGGTAGTTTAGCAATGGGGAGGAGCATGGAGAT
GGGGAATGAAGCCATTGCAGAGGCATTGCTCAAGGAGGCTGGGCTGATTTTAACAAGACC
CACCACCTACAGCAGCGTGGGAGACCTGGTGGATTCAGTGAGTGGGAGAATCATGGAAAC
TGCTTCAAGGCCTCAGACTCTAGGCTCAGAAAATATCCTCACGAATGAACTGGCACAGAA
TCTGTCCAATGTTATCCTGAAGCATTCCATTAATGAAGTTCACCAGAAAAATAAAATAAT
TGACCCCAAGGATAGAACGCACTCCCCTGACACTTTGGACATCTTGATGGAAAGTGCAAA
CCAACTACTCTTCAATGTGATGTGGTTCACATACAAGAAGATTCAGCTCGGTGAATGTCC
CCCTGTCCTTTCTAACGAGACCATCAGATGGAGGGATGCAGAAACAGGCAGTCCACTACC
TGATCAGGCTGCTAGTCAAGCATGGCCAAAAGCCACTGAATGCTCCAGTAGCCATCCAGT
TAGCAGTCCACACAGCACTAGTCTCATCATTAAAGATCTTTCAGGGGATGTGCATCCAAA
GCGAGATAACAAGAGTGGAGAGAGGCCATGTCTCTTCAAGAACCCCACACCGCAATCTGA
ATTGTCATGTAGCCACAGTGCATGCTCTTCCTTGACTACCAAAGCATCTCCTAAGGAAAT
GTATCTTAAAGGAACTATGGGAGAGAATGCAAAGATCTCCCAGCAGCTGCCCAGTCTCAA
AGAGAATGAGTGCAGAACCTCTTCAGAGGGAGAAAGGGCCCTCACGCTCAGTAAATGCAG
TTCCCAGGAGGCTGAAGACAGCCTCAATCCAAACACCCCAGACAAACACAATTATGACAC
ACCTCTGAGCAACGGGGTTCAAGCTAACCTGTCTTTGTTGGGGAATGACTTGCTGCTTCC
TGCTCAGTCCACACCACACGCCAAAAGTTCAGACATATACTGCATTACGGACTTTGCCGA
AGAATTAGCAGAGACAGTTGTATCCATGGCAACCGAGATCGCAGCCATTTGCCTTGACAA
CTCAAATGGAAAACAACCCTGGTTTTGTGCGTGGAAAAGAGGGAATGAGTTTCTGGTTAC
CCCGAACTTAACTTGCCGAACCTTGAAGAGAAAGAAAGAAAGCCAGAGCAACGGGGCCGC
CGTCAGAAAACACAAGCCCCCACGGCTCAGTGAGATCAAGAGGAAAACGGATGAGCACCC
CGAGCTGAAGGAGAAGCTGATGAACCGGGTTGTGGATGAGTCTATGAACCTCGAGGACAT
CCCAGATTCTGTCAACGTTTTTGCAAACGAAGTGGCAGCCAAGATAATGAACTTGACGGA
ATTCTCCACGGTGGATGGCATCTGGCAAGCCCAGAGCTATCCCCGGAACCGGTTGCTCAG
TGACAGGTGGAATCGGCTGAAGGCTTCCAGCTGTGAGAGCATTCCAGAGGAGGACTCGGA
AGCCAGGGCCTATGTAAGCAGCCTGGGGTTGACGAGCACCTTGAGCCAGCCTGTTAGCAG
GGCCAGCTCTGTCTCCAAACAGTCAAGCTGTGAGAGCATCACTGAGGAGTTTTCCAGGTT
CATGGTGAACCAGATGGAAAATGAAGGGAGAGGATTTGAGTTACTGCTGGATTATTATGC
AGGCAAGAACGCCAGCAGCATTTTGACGTCAGCCATGCAACAGGCGTGCCGGAAAAATGA
CCACCTCGGTGTGAGACCGAGCTGTCCCTCTAAGCAGTCCAGCACGGAGAGTATAACTGA
GGAGTTCTACAGGTACATGCTGAGGGACATTGAAAGAGAAGGCAAAGACAGCCCCTCGTC
CAGGAGCCGCAGCCAGGATTGGACTGCCAACTTACTTTCTCCTTTGCGATCCCCACTCTG
CTACCGACAGTCGTCCATGCCGGACAGCCGGGCCCTGTGCGCCAGGTTAACAGTGAATGC
ACCTGTCAAAGCCAACTCCTTAGATGGCTTTTCTCAGAACAGCCAGCAAGATTTCCTAAG
CGTCCAGCCAGTCAGTAGTGCTTCCTCTTCGGGTCTCTGCAAATCTGACTCCTGCCTGTA
TTGGCGGGGTGGGACAGACCAGATCACAAACATGTTAATCCACGAAACCTGGGCAAACTC
AATCGAGGCCCTCATGCGACAGAACAAAATTATAGTGGATGACGCCGAGCCGGCTGACGC
CAAGCCTGCGTCTGGTGGCACTCCCCTGCAAGTGGAGAAGTGTGCAAACAGTTTAGCTGG
GAGCAGAGGGGAAAGTGGGCCAGCTCTGCTTGTTCACGAGCCCACTGATTACCCCAGGAA
AGGCTCTCTTGCTGAAAGCAAACACTTCCCAGCGGCATCTCCAAGCAAAGCTGCTCCTCT
CACAAACTGCAACAGTTTAGATTCTAAAAAGGAGCTTCCTGCATGCAATAAAGCTGCCTC
TCAAAGCCACACCAGGCAAATGCTTTGCTCAAGGGAAGTGCCTTTAATTCAGATTGAAAC
AGATCAAAGAGAAGAGTGTGTTGGAGAACCTGACCATTTCCTTTCCCAAAGTAGCTCCTC
TGAGGGAGCAGAACATGCTAATGAGGAAAAAGTCCCAGATATGGCGAGGAGTGGAGACAA
AGCAGTGACCTCTGAAAACCATAGGTGAGTGAATCAACCTTTAGACTAAACGGGGTGCAT
GAGACTTGTGTTTACATTTATTCTAAATCTTAGACATAAAGGTACTTTAATGATGCAAGA
ATTGATTTTCTGAGACAATGAATGACCTCCTTGGGTTAAAATAAATTTGTAATAAAAAGT
TGGAAGTAAAATTTTTAGAAAATTATTTTCCAGGACAAATTGAATTCATCTCTATAACAG
GAAATAAGGTATTGTCCTGATTAAAATTAATCTCCCATATTTTGCTACATTTTTAAATTC
ATTCATGGCAACTTTCAAGTAAAGAAAAAAATAATTTCTACATTTGAAATCAGTTGAATT
TAAATACATTTTAGTATTAGAATCTGACAGTAAATATTTTGGCATCATTTTTCTCTCAGG
CCTCTCCTTTCAAGTTTTCCCTTTTTTTGGCTATTCTAAAGATCTCTGTAATCACACCTC
TTCCACTAATGCCGGCCCTGAAAATACGTGATGGGAGTTTAAGTATAAAGCCACACTGGA
ATATTGTTTGTTTCAATAGTACTTTTTCAAGGGAATTGTATACTGTAGGTGACAATGCAT
TTTAAAATTTTGAGTCAAGGTAGTTATTTCTCTCAGGCTGCTCAAAGAAGTGTCAAATCT
ACTCAAATCCTTTGACAACTTCCATTTTCTGTGGAGAATTCATAGACTTCATGAAGATAG
GACCAAGATAAAATTTCTTTTCTTTCCTTCTATGAAGTTAAACAACAAAAAATTAAGCTA
CTGACCTTATGAAAAACATTAAGTGAGGGAAATAACCGTGATAGTCTTTTCATAGACACA
TGCCTATTACTCATTATTTACAAAGCCCATGATTTTTTAATGTTTAGCTCCAATAAGCAA
ATTGTAAACCACCTTTATCAAATTTCAACAGCTCTCCAAAATAGCTGATCCTTCGCCTCT
ACCAGAGGGGCAGAAATGATCCATCTTCAGGTACTGATGCTCCCCATGATTATAGGACAT
CATTGTAACGTGTGGTTAATGGGTGGTCCAATTGGACTTGAGTACCTCCTTCTTAGCCAC
TTTGTGCTAAGAACTTAACTTTCTACTTGGCTAAAGCCATGGGAGTATGCAAAGGGAAGA
AAGGGGGAACAAAACATGAAAACATACAAGCTAAAGAACATGAGGCTAAACCAAAAAGTA
CAGGCTGAGCTGATCAAGATGGTAAGAACTTACATATCATAATTTTACAGTTATAGACAA
CACTTACCAAAGTCTTATAGGAGTACTGTGCTTCACTTTAGTTCACCAGCCCCCAAGGAT
TATGGAGTATTACTAGTTTTTAAAAGGGATTAAAGGGATGAAGAACAAAATAGACAACAT
GCGATTCTTTGGAATTACCTTAACCTGAAATATGAAAAAAAGGAAAACCCTTATAGATTT
GATGCCTCACTTAGAATCAGCTTGAGCACAGGAATCATGTAACCCAGATGAACTCTTCAG
TCAAAGAAAGTTACCTATTTAGGGTACTAATTCAACATAATTCACTGTTATCAGTGCAAA
TCAAACAGTGATTATCCCTGGAGTTGAATACAATTCATGATGCAATTTTGAGTTTAAATG
TAAATAACAATATTCTTAAATCTGGTACAATCTGGGAGATTTCTAAAAAACTTGGAGACT
ATATATATATATATATATATATATATATATATAAAACCTTTCAATCACTTAGGTTTGTGT
TCCATAAAATGGTCCGAGCACGACGCTGTCATCTCATAAATGTGGATCTCTGATTCTTTT
GTCAACCAATGAAAGAAAAAGAATGTGGAATCATCAGCTGTTGAATTTCAAGAGCTTCCA
AAACATAAGGACTCAGTGTTGACTGTATTCTTCTTCACAGAGCAATATCGAGTATTCTTA
TAGAACCCAGATTCTCTTCACTAACTTTCTAACCATGTCACTTTGAACACGTTCCTGAAG
CTTCCTTTCCCTCAGTTTTCTGGTCTGTAGGTAGGAAGAAAAATAGTACTTGCATCATAA
GAGGATTTTTAAGGTTTAAAGAAATGTACATAAAGCTCTTGATATCTAGTAAATTGTAAA
CATTCAGTAACTATTTACTTTGTTATTGCCACTCTTGTCATTGTTCGGGATTAGGGTATA
TGGTTGCCTTAATTCCAGGAGGTTTCTTCTCCCTAAAGAAACCTATTTGGGAATTTTATT
AAAACAAGAGAATTCCTGAGATCTGCAAAGGGAAACATTAGTCATATTTAGATTGCATTC
TCTAAGCTCAGAGTTGTTATTATGGGATTTTATGTGTCAAAATAGCTGAGTAAAAACTAA
CCTTGTGAAACAATTTCTACCCACTTCCACACAAAAGGGTGGCAGCCGATATAGGCATTC
TCGATTCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCTTTTT
CATTATTCTTACTAAAAATGCCACAAGGACTCAGCCTATTGAAACAAGAATCATTTTTCT
TATCTTTATTTTCATTTGATAATTCAGTATCCATCCTGGAACTCAAGCCCGCATAGAAAT
ACCCTGTGATCATTTAGGCCACCACATTTTTCAAGATACCTGAATTTTCATTTGCTTGTA
GAGAGTTTAAATGATTTAGAGCAGGCCTTAATTTGATTTCTGAGGAAAATATTATTCTAT
TGGTAGGGGACAATGAGTTCTTAACTCAGCCTTCTTCTCTGAGATAATTGAAGAGCAATG
TTCCTTCAAACTTTTAATAATTTCAGATTGTGAAGAATGAACAACAGAATTCTGAATATA
CATATATTGTGCTTGCTTATATAACCTTAGTTTTTAGAAACATTTTTCTTGTGTATACAT
TTATTCATTTATATTTGCTTCAAGAAAAAAAAAATATTCATCCAACAGATAGTAGGGTGG
CCATTCTGTGATTCACATTTTTCTTGGGATTGCAAACATTGAAGAAAATACAGAGTTGGT
GCCTATGCCCATAGATTTTATGTGTAAGTGGGAGAAACAGACAGCAAACATGGAAACTTC
CTTTGGAAAATGGTTATTACAGAGTGCAAGGAGAGAGATATTAAAAGAGTCATGTGATAG
AGAATAACTGGTTGGGGGAATGACTCCTTTAGATAGGATGTTGATATATGAATCTTGCCC
AAATGTATGTTTAAGGTTCCAATTTGCACCATATCTCTAGTCCAGGAAATTCCAACCTGG
TAAATTCCTTTAAAGCAATCACAGATTAATAGCACTTAGAGAAGTTGGCAGAGGCAAAAA
AAAAATCTTTGGAGATTTAAGCCTCAGTCGTATAGGAGTCCCACAAATAAAGCCCCACCA
AATATGAGCTCACAACCTCAATTTTAAGACACACATGGAATTAAGGCACTGTAAGCAATA
CTCAGCACCAACATCTAATGGTGGAATTACCTCCATCAAGTATTTCAAAAATTGGAATTA
TCAGACTCATAATGTAAAATGAATATATTTTAAGAAAATTAGGAGTCCAAAACATGAACC
AGAAACAGACTACAATCAAAATAGGATGACAAAGATTTAGAAATCATCAATCAAAAGATG
AAAAGTATAATAGTTGAAATTAAAAACCATCAGTGGACCCTCCTACAAAGGCGTGTCAGT
GGTTTCCTGTCCTTGGACATGTAAGAATTGGAGGCAAAAAGATGTGGACTTGGAGAAGTC
TGGAACCCGCTTGCTCCCTACAGGCTCAAGATCATCCTTTACCACACAGAAAAATAAAAA
AAATAAAAAAATAAAAACCATCAGTGGCATACCTGAAGACAGAACTATAGCATAAGATAA
AGATGGAGACTTCTGCTCTCAGCCACGATGTAGTAACTGAAACCACTTGCGCTTCCTAGT
AAAAAACAATTTGTAAACTGGACAAAATTTATAGAACCACTATTTTCAGACATCGTACAT
TGTACAATAAGGAGCACATTGAAAGAACGGAAACAAACAATGTAAGCCCTAAAATTGTCC
CAACAATATTCCCTTTGCAGATAACAGTGCAAGGACGACAAAGGTAAGCAGATCTTGGTG
GGCTTTCCAACCAACCAGAGTGGAGAATCCATGTTAAACACATGCTGCATTTGGTAGAGA
CCCCAAAGGATCACATCCTAGAATTAAGGTTAAAATAGACCCAAATATAGGCCAATCTAA
ACTATTTCTAACAAAACATATAAACAAACATTGAAAAGATTGAGTCGAAATAAAAGTAAT
TAATCTTAGAACAAAGTCCAACACTACTTAAAGAAAGACAATAAAATCCAGCACTGGACA
ACATAAATTCACAAGGTAATATCCAATAAAAAATTGTTACATGTGCAAAGAAGCAGAAAA
ATTTGACCATAACCAGGATAACCAGTCAATAAATGCATACCCAGAAATGAGAGAGATGAT
GAAATTAGCAGACAAGGACTTTAAACAGCTCTTATAAATATCCTCAAATATTGAAAGGTA
TACATGAATATGAAATGTTATGAAAATTATAAACTCACAAATAAAGAAGTTCAATGCACC
CTCAGTGGGGTAAACAAAAAGAAAACCCTATCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AAACCCTAATAGAGCAGAAAGGAAAGCTTCCATTAGGCTCATGATGTCTGCCTGTCATGA
TTTGTGCTGTGAGTTATCTTAATAGCCAGTTATGGCTTAAATTACCTTGACCAAGGGTAA
GAGTCCACTGTGTTCCCTTCTCTGCAAGTCCCAGCTAGTGCATTCAGTGATGACAAGTGT
GAATTTTTTAATAAGAGCTGCTATTACACATTGTGTATTTGATACCTTCTTTCTGGTTCA
TTTGTATTTCAGATGCAACACAGGCTGGGTTTACATGAGGCAAGTGTTTCCACACTGTGT
TGTGTTGTTTGGCCTGACTGTTTTCCCCCTTCTCTTCCCTGACCTCTGTATTGTTGCTCT
GGAAAAGCTAGAGAGGAACTTAAGGGAGATCACATTTGGAAGGACTCAAGTCAGTCAGGA
ACTTTGAACAGAAAAATGTTCTTCCATGAGGTAGATACTCTAAGGGAATCTCCACTTTCT
GTCCAAAGTCTTATTTGATCCTGGGCCAGCAGGCCATAGAACAGATAGTTCAATGGGAAA
ACATGTTTCAGAAGCTTCTGGGTGTGTGGTTCTTTGAAAGTTATTTCTGGCATTTATTTA
TATTTTGGAAAATTCACAATGTTAAACAATTGTACTAAAATTCTCAAATTTAGAGGGAAA
TGTTACAAGATGGAGAAGAGGAAAAAGAAGAACTTGACTTTTTAGTCTTAACAGCAGAAG
TTTATAGGGTTAATTCCCTCTAGGGCAATATTTAAATCATCAGTTTTCAATCCGTGAATG
TATCCAGTACCCACCTGAAACCCATGGCAAGACTGAGGGAGTCCAGTTGGGTTACTCACG
GTATTCCGTAGGAAAAATTGTTCCCATAGATGTCACACCAGCATTTGCCCTTTTGAAAAT
CTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTCTGTGCTCTAATATCGGTGAGTCGATAACCACAGGCTTTCCAAGATGTTCACTTAC
TTTATCTGTTAAGCCATATGGTCTCATTTTGTAAGCATTTACCAAGTCCCCCTATTCTGT
ACAAGGTTCTGTAAAAAGTCCTTGCCATATAAATCACCTCAAATATTAAAAGTTACTTTA
TCTAATGAAATGCTTACTTCAATTATGAACCCCTGGTGTCAAATCCGCCCCCCTCCCCCA
AGTCCTCTGCACCCTTCCAGTAAATAGAAAGAACAGGAAAAATTTCACCTAATTGAGATC
TTTTATTGTACAATTTAAGTTCTGTAATTCATTGTCTTTTCTCTTATTTGAGATAAAAGA
ACCATATTCAGATAGAAAAGACATATTCCCAGATTAAAATGCAGACTTGTGTTGTTAACA
TAGGATAGAAAAAAAATTATCATGACAAGATGGAAACATATAGGCCTTTAAATGATAAGT
AAAATATAGAAGAAGGATAAATCCCCAACTCAAAACTAATGACCTACAAAATATTTCTGT
GGTGGTTCTAACCTATGATAAAGGTTTACAGAAGAAGAGGTCAAGTAGAATAGAAGGACA
TGTCTCTCAACAAGAGTCCCTACCAATTATCCAAAAAGACCTATGCAGGTTGGCTGGCCT
CTTTTTGAGAGGCAGGAGGAGGATCTATAGCAAGACCCAGCAGCTCCACTTAGTAGCCAC
AATGGTATTCCTCAGTATTACATGACTCTATGAATATCATAAATCTAGAATGAACTTCAA
AAGCACATAGACCAATAAGACCCATCACCTCATCTTCCATTTACAGTTTACTCTTCCTAA
ATATCACCAACCATATATTGTTGTTTTCTCCCCAAGTGAATTAGTAGAAGAAAAGGAGAT
CCTTAAAGGACAGTCAGAAAACATAGAGGGTAAGCCATGTTCCCATTATTTGGACACACA
ATTTCCTACCATCTCCCTGTGGAAAGCATAGTAAACTGTGCTTGTGTCTGTGTTCAGAAC
ACATCTCTGGACTGCCAGTGGAGAAGGTCAGTGGCCAGAGGAACCTGCTAGTGATCAACT
TTGACCTGGAGCCAGAGCGTCCTGATGCTGAGCTTCGAGCCACTCTGCAATGGATAGCTG
CCTCTGAACTTGGGATCCCCACCATCTATTTTAAGAAGTCTCAGGAAAACAGGATTGAAA
AGGTATCATTTTCTGTGTCTGGGTAGGATATCACAAAGCTTTATGTTTTCCTCAAAACTG
GAAACTCATTAAATGCCCAGTTAATCCATTTAGGTTGAATTGTTTGGTTTTGACTTTTCA
CCTTGAAATTGTAGCTAGAATGTTGAAACATTCTACCTACAAAAATACAATCTTGGTTAG
TTTTTCTCAGCTAGTTGGTGATGATGAGCAAAGTAAATTAGGGAGATGAGAACTCTTTCA
AAGAGCCAATTATTTTTTGGTATCCTCTTGCTCTGGAACCAACCAGTTCATAACACTCAT
TTAAATAGGAGGTAGAAGGAAAGGAACTGATATATAACAGAAACCAAAGTGAGAAACTCC
TTTGGGTTGTTGTCCTAATTGAGTTCTTTATGGTTTGTAGGGCTGAGGTCTCCATTTCCA
CACTAGCTGTTAGCACGGGCCTGCACTCAGCTTCTAGAGACCACTCACATTCCATGTCAT
GTGTCCCCCTCCAGGTTCTCATGCTTTGACTCTCTCTGATGTCTCCTTCTGCCACTAGCT
GGAGAAAAACCTCTACGTTTAAAGGGTTTATGGGATTAGATCAGGTTTACCAGATAATTT
CCCTTTTGACTAACTCAAGTCAATTAAAGAATCCCTTTGGCCATGCAAGATTACACCATA
AGGGCATGATGTCACTCATATTTAGTTGCAGGGATTAGGGTAGAACCTCTTGGGAAGAGG
ATTCTGCCTAGCATAGGCACATTCTTTCAGTGTCTTATGGTTACAACGTGCCTCCATGTT
TCTCATGAACACTGTGAGAAGAGCAGAATGGATATTATTGACCCTGTTTCACTAATGAGC
AAATCAGTGTTCAGAGAGGCTGGTATGTGAGAGATTCTCAAAGAGCACAGCTGATTCTAG
TACCACATGCTGCTTTCTCGACAAATACTTCTCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1022..1036, 44555..44660, 64649..64756, 106754..106813, 161888..162022, 167009..167264, 168287..168621, 168624..168633, 168642..168757, 168763..172043, 176773..176958, 180996..181048, 181137..181321
1001..1017, 1022..1036, 44555..44660, 64649..64756, 106754..106813, 161888..162022, 167009..167264, 168287..168621, 168624..168633, 168642..168757, 168763..172043, 176773..176958, 180996..181048, 181137..181321
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved