Dasypus_novemcinctus Locus RC3H2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus RC3H2
Dasypus_novemcinctus
RC3H2
GeneScaffold_405
SNORD90
34298..34403
52385
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTATCTAATAGTTTCCCAAAGTTCACTAATTCTTAG
GCCTTACCTTCATGTGTTTTGGGTAGTGGTTATCAACGAGGAAACAAGCAAACATAAAAA
CCCCAACAATCCAAAGAAGTTTTTCTTCCTGAAAATGTAATGTGAAGTAAATCTGCTTAT
TTGATCTGATCATTAAGAAAAATACATGAAGGCTTTGATACTGTTATATGAGCAACTAAT
GCAAGTATAGAGTTTAGTTAAAAGGAACACTATGAGGGTGTTACTTTTGGACAGAATTTC
AGGAATCTATTTAAGTCAGCTGATAGATTTTTAAAAATCCAAAACTTATAAATTATTTGT
GTATATTTTAGAATCTGATGCTACGATGGTTGACCTTAGCAGTTAAGTCCTGAAATGTAA
ATGATGGATATGTGCTTTATTCTTATTTTTGTCCGTTTCCAGCTTACAAAACACTACACA
GCAAAATAATGATCTGCTAGACTGTGCATCCAGCGTCCACAATGCCTGTGCAGGCAGCTC
AATGGACAGAATTTCTGTCCTGTCCAATCTGCTATAATGAATTTGATGAGAATGTGCACA
AACCCATCAGTTTAGGTTGTTCACACACTGTTTGCAAGACCTGCTTAAATAAACTTCACC
GAAAAGCTTGTCCTTTTGATCAGACTGCCATCAACACAGATATTGATGTGCTTCCTGTCA
ACTTTGCACTTCTCCAGTTAGTTGGAGCCCAGGTAAGCGTTCAAGATTTTACTAATTTGG
TTTATGTAATGATTACTGAACTTTGTTCATTAAGGGGTACAAAATATATTTAGTGGTATT
TGAGAAATAAAAATTAGTATTAGTGTGCCTTTTGAATTTTTGTGTTAAATCCTGTGGTCA
AAATTGATTTTTTAAAGTGATTTTGGTAGATAAATATATTTTTTAAATGTAAGAATACAA
AAATATTTATTCACTACATGATATGAAAAGCAATGTAATCAAAACTTTGGCCAGAATCCG
GTCAACTGGAACCGTCAGTTAGGTTTTTTGTTTTTTGTTTTGCTTTTGTTTCTTAACTTT
TTATTGTAGTAACAAATATACAACTCAGAATTTACCATTTTAACCACTTTGAAGTTTCCA
ATTCAGTGGTATTAATTATAATCACATTATTATGCTATTATCACCAACATCCATCACCCT
AACTTTTCATTGCCTCAAACAGAAACTCTGCATCCATTAGGCAATACATCCCTTCCCACT
CCCCCTGGGCCCTTGGTAACCTATAATCTACTATCTGAATCGATGAAATTTTCTTCTTCT
AGCTATTTCATATAAGTGAGATTACGCAATATTTGTCTTTTTGTGTCTAGCTAATTCACT
CATTATATCTTCTAGGTTGATTATGTTGTTGCATGTATCAGAGTTTCATTTCTTTTCATG
GTCTGTTTAGAGAGGTATATATCAGTTACAAATTCTGCACCATTTCTTATGCTATGGACT
GTATAATGAGTATTCCGTATTTATAATTTTGTTGAATCAGAGTGAGACATTAGGTTTATT
TTTTATTTTTTTTAAAGATGTATTTAATTTATTTCTCTTCCCTTCCCCCACCCTGTTGTC
TGCTTTCTCTGTCCATTCGCTATGTGTATTCTTCAGTATCTGCTTTGATTCTTGTCAGCG
GCACCGTGAATCTGTGTCTCTTTTTGTTGCATCATCTTGCTACATCATCTCTCTGTGTGT
GGCACCACACCTGGGCAGGTTGCACTTTTTTCACAAGGAATGGCTCTCCTTTCGGGGTGC
ACTCCTTGCATGTGGGCCTTCCCTATGGGGGACACACCCCCGTGTGGCATGGCCCTCCGT
GCGCACATCAACACCATGCATGGGTCAGATTCAGCACACGGATCAGGAGGCCCTGGGTTT
GAACCTTGGGCCTCCCATGTGGTAGGCGGACCCTCTATCAGTTGAGCCAGATCCACTTCC
CAACATTAGGTTTAGACATTAGGTCCTACCTTGTGCTAGGTATGATAGTAAGCATCAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTCCGCGGTTCAAACCCCAGGCCTCCTTGATCTGTGTGAGCT
GGCCTATGCGCGGTGCTGATGAGTGCAAGGAGTGTGGTGCCATGCAGGGGTGTCCCCTGC
GTAGGGGAGCCCCACACAAAGGAGTGCACCCCGTAAGGAGAGCCGCCCAGCGCAAAAGAA
AGTGCAGCCTGCCCAGGAATGGCACTGCCCACACGAAGAGCTGACACAACAAAATGACGC
ACAAAAAGAAACAGATTCCTGTGCCGCTGACAAGAGCAGAAGCAGACAAAGAAGAAGATG
TAGCAAAATAGACACAGGGAACAGACAACCGGCGGGAGGGGGGGAGAAATAAATAAATCT
TAAAAAAAAAAGGTAGACACTCTGAAATCTGGGCACATCTATATATAATCAATAGTGTAT
CATAATTTAATTGGCAGCATATTTTCTAAGTGATGTGTAAAATAATTGTTCTTTTTGCAA
ACAATGGCATCTTTGTTTTGATATAATAACATATACTTTTCTTAGTACTACTAGCCACCA
CTTCCATAGCATCTGCTATAGATCAGGTATTGTGCCATCCCCTTTATAAATGTTATCTCA
TTTGGTCTTTAAATTAGCCTATAGGACTGTACGAAGTGATCTCTATTGCGTCTTCAACCT
CATCTTCTACTACTGTCCTCATTTATTCTGTTTAAGCGACACCGACCTCTTAGCCAATTC
ACAAATATGCCAGCCATGTTCCCATATTAGGGCCTTTATATCTATGTGCACTTCTTTTTC
AAATCTTTATTCAAACATCGTAACTCTCAAGGAGACTTTTCTTGACTTCCTCAGTTAAAA
TTGCAACCCCTGTCCAGCATTCCTAACTTCCCTTATTCTTGCAGTATAATTTTAAGATTA
CCTTCTAATAGTCTATATATTTTTTATGCTTGTTATTTATTAGTTGCCTCCTCTCCCCTC
CACTAAAATCTATGCTACACAGGGGCAACAAATTTTGTCTGTTTGCTTATCTTTAGGACT
TAAAACTCTGCCTGGCACATGGTAATTACACACCATAAATATTTGTTGAATTAAATTGAA
TTTTTAGTTTGATAATGGTCCTATCAGATAGGGATTTTCATCTTCATTTTGCAGATATTT
AGACCCTGGCTTGAACATGATCACTCACAGAAAAGTGGCAGAGCTGCAGTTTTTAAACAA
GTTTTGATTTTGATTGACAACATAGCATCTTGTGCTTAAATTTTTGACTGGGGGGCAGAC
CATAAACAATAAATAAGTAATTAAGATAGCAAGAAAATGCTAATTGCTATAGAAAAGGAA
ATCCATGCCTTTTTTTCTTCTACTTTTTATTTTGGATTCATTCATAACAAAACTTTACAA
AAATAGTACATAGGCAATCTCAATAACCATCTGTATTAGTCAGCCAAAGGAGTGCTGATG
CAAAATACCAGCAATTGGTTGGTTTTTATAAAGGGTATTTATTTAGGGTAGGAGCTTACA
GATACCAGGCCATAAGCATAAGTTACTTCCTTCGTGAAAGTCTTCTATTTTCGTGGAGCA
AGATGGCTGCCGATTTCTGCAAGGGTTTGGACTTCCTGGGTTCCTCCCTTCCTGGGGCTT
GCTTCTTTCCTGTGTGCTTACTTCCTGGGGCTCCAGCTTATGACTTCAGCATCAAATTCC
AACATAAAAAACCCTCAACTCTGTTCTTTGTCATGCTTCTTATCTGTGAGTCCCACCCAC
CAAAGGGTGGGGACTCAACACCCAAATGACATGGTCCAGTCAAAGCCCTAATTATAACTT
AAATCACACCCAGGTACATACCAGATTACAAACATAATCCTGTATCTATTTTTGGAATTC
ATAACCATATCAAACTGCCACACCATCCATAGCTTCTCTTAATGTTAACTTCTTTCATAA
CAGTAGTACAGTTATTAAACCTAAGAAATTAGCATTCATACAGTACTATTAACTCTCTGC
TTTTTATCCCCTTCATAAAGCCACCCAATCCCTGCTATTATGTAAAATGGCCTTGGTTCT
TGGAAAGCAGTTTGGCTAGCAGGGTTACTTTCACTTGAAATGCTTTGATATAGTGTCTCC
ATATTATTATAATTTTGTACTCATCGAGATAAACATCAAGTATATAAATAATACTTGCAT
GGGCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAAGATTTATTTATTTCTCTCCCTCCCACCCCCCCCACCCTGG
TTGTCTGTTCTGTGTCTATTTTGCTGCGTCTAGTTTCTTTGTCCGCTTCTGTTGTCAGTG
GCACGGGAATCTGTGTCTCATTTTTATTGCGTCATCTTGTTGCGTCAGCTCTCTGAGTGG
GCGGCGCCATTCCTGGGCAGGCTGAACTTTCTTTTGCCCTGGGCGGCTCTCCTTACGGGG
CACACTCCTTGCGTGTGGGGCTCCCCTACGCGGGGGACACCCCTGTGTGGCACAGCGCTC
CTTGTGCTCATCAGCACTGCACATGGGCCAGCTTACCATATGGGTCAAGGAGGCCCGGGG
TTTGAACTGCAGACCTCCCATATGGTAGACGGACGCCCTAACCACTGGGCCAAGTCCGTT
TCCCAGTTGTTGGCATTTATTTTAGTAAACTCACCCTTGTCCAAGGTCTGGTCCTCAGCT
TTACAGGCTTGGAGACCTGAATTGTGTGGGTACATAAAATAAATTAATTCCTCAGGAGCA
GACTCTACCTAAACAAGGTCACATATACAAGATTATCAGTTTTATTAATTTGTAATGAGA
AATGAAACTCTTAAATGATCTGAATCAAGGGGAGTTAATGATTCTAATGTTTAGTACAGT
ACTTCTCAGCTGAGTGGTACACATTGAAACACATTTGTTCCCTATTTGTTGTATCCTCTG
GTTGCATCAGCTCGTCTTCTTTAAGAGGCACTGGGAACCGAACCTAGGAGCTCACATATG
GGAGGCAGGCGCCTAACTGCTTGACCCACATCTGCTCCTCGTAAACTTTTTTTTTTAAGA
TTTATTTTTATTTATTTCCCCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTGTGAGTAGGACCACTCGC
AGGATTTGCTACAAAATGAAGACAGAAACGGGGTAGAGTTGTCCGAGAAGATGAAATAAC
AGCATACTTGTTTGTTTTTTTTTAAAGATATATTTATTCATTTATTTCTCTCCCCTTCTC
CCCCCCACCCCAGTTGTCTGTTCTCTGTCTGTTTGCTGCGTGTTCTTTGTCCGCTTCTGT
TGTCAGCGGCATGAAAATCTGTGTTTCTTTTTGTTACCTCATCTTTTTGTGTCAGTTCTC
TGTGTGTGCGGCACCATTCCTGGGCAGGCTGAACTTTCTTTTGCACTGAGCGCCTCTTCT
TATGGGGCACACTTCTTGTGCATGGGGCTCCCCTGCACGGGGATTCCCCTGCATGGCACA
GCACTCCTTGCATGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCGAGGAGACCC
AGGGTTTGAACGCGGATCTCCCATGTGGTAGACAAATGCCCTAACCACTGGGCCAAGTCT
GCTTCCCACCTGTTCTTATTGTATGTTGACAGTTAGAGAGGGCAAGATAGGTGATGTGTG
TTGGTGAGAGAATTACTGGGACAATATCCTTGAGTAGGTAAAGGGAATATTAAAACCTAA
GAGCTTGCTATTAAGTAGTGTTCTAAATGTCTTGTCTATAGTTGAAAAAAATAGCTGTTA
ATAATAATTACATTAAGGTTAAACATTTCATTCAATCTTCTTTAAGTTTACATTCAGTCA
CTTTAGTGAGGATGGAGAACAAATAAATAAATCCTAAATAATCTTTTTTTTGAAGACCAC
ATAAATCCAAAGAACAGGATGGCTAAAGAAAATCTGAAGCAACTGAAAAGTCTCCTTATT
ACCACAGAATGGTAATAAACAGTGAATTCTCATTGTTGGAAAGTGAAAGTACCTTAAAAG
TGATTCTTCAGGAATTTAGGAATTGTGGTTTAATAGTTAAAATATTGTTAATGAAAATTG
ACCTTTTTTTTCTTTTTATAAATAAAAGTTTAGTTCTCTTCGTTTCCTTTTTTCTAAAGG
TGTAGCTAGTTTGAATCAGAGTGCACTGAGCCGTCCAATGCAAAGGAAACTGGTGACGCT
GGTAAACTGTCAATTGGTGGAGGAAGAAGGTCGTGTAAGAGCCATGCGAGCAGCCCGTTC
ACTTGGAGAAAGAACTGTTACAGAACTAATATTACAGCACCAGAACCCTCAGCAATTGTC
TGCCAATCTATGGGCTGCTGTTAGGGCTCGAGGATGCCAGTTTCTAGGGCCAGGTAAGAA
CTAATATTAGAGTGATTGTCTGTATTTGTTATTTATCAGGATTTGAGAATGCCACTTTCT
AGAGCTAGGTAAGAATCTCCAGACTCAACCCATACTCTTTATTTATACATACAAATCTTA
ACATATTTGAGATAAACTACTTTTGGTTTATCATAATCTGTATAATAGGACTTCAATGTT
TGTGTTTTGTATTTTTTTCCATCTGATTGTAATTTTTTGGTGTGCTGCTTTGCTGCACAG
GGGCCTGCACCTCCCTCTGCAGGTCTGGAGCACCTTTTTTTTTTTACCTGGGTGTCCTCC
ATATGGTAAACGGGAGCTCAATTGCTTGAGCTGCAGCTACTTCCCTTTGTGTTTTTATTT
TTTATTTTATTTTATTTTTTAAAGATTTATTTATTTTTATTTATTTAATTCCCCTCCCCT
CCCCCGGTTGTCTGTTTTCTGTGTCTTTTTGCTGCGTCTTGTTTCTTGTTTCTTTGTCCG
CTTCTGTTGTCATCAGCGGCACTGGAAGTGTGGGCGGCACCATTCCTCGGCAGGCTGCTC
CTCCTTCGCGCTGGGCGGCTCTCCTTATGGGTGCACTCCTTGCGCGTGGGGCTCCCCTAC
GCGGGGGACACCCTGCATGGCGCAGCACTCCTTGCGCGCATCAGCACTGCGCATGGGCCA
GCTCCACACGGGTCAAGGAGGCCCGGGGCTTGAACCGCGGGCCTCCCATGTGGTAGACGG
ACGCCGTAATCACTGGGCCAAAGTCTGTTTCCCCCCTTTGTGTTTTAGAACAAATTTCTC
AGCTAATCCTCACTGCCTTCAGATAGTGACACAGCTTCAGTTTTGTATGAGTCAGAGGGG
CTCAGATACGCAGATAGTAGAAAGAAAAATAAACTTTTTTTTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATG
AAAGCAGGGACTATGCATTTGTTCCAAAAAGGATTTGCATGAAGACATTATCCTATGTTC
TTGTACGTTCTTTATGTGTGTCTGATAGTAAGCATATCCCCACCTCTCCATCCCTCCAAT
AAGTGGATGAATTGGTTGGGGTGAAAAAATCAGACCATTTCTGATATGTTTTTTTTTTTT
TTTAATTCATTCTGTTTTCTCAGGTCACCAAAAGGGATGAAGACTCTTCCCTGATGCAGT
TGAAAGAGGAATTTCGGAGTTATGAGGCATTACGTAGAGAACATGATGCCCAGATTGTTC
ATATTGCTATGGAAGCAGGACTCCGAATTTCACCTGAACAATGGTCCTCACTTCTGTATG
GTGACTTGGCACATAAATCACACATGCAGTCTATCATTGATAAGGTTTGTGAAATTAAGA
GATGTTGATTTTACACCACTGCTATTATTTTGAAGGGAAAGGAATTTTCTAAAGGGACTA
AAGAGGCAACCAATTGGAGATTCTTGCATTTTTAAATATCAGATTCTTCTAAATTATCTT
ATTGTTTTCTTTCTTTTTCCATTTTATTTTTTAACTTTCAAAATCAATTAAGGGAGGCAA
GAGGGAAGCAAATACAGGATATTAGCATAAAAGAACCCAGGCTTACAGATTCTCAGGTTC
ATCTTCATTCTGACCCCAGAGAACTAATAAAAGCTTCTAAATTTTCCAAGTGTCTACTGA
TGAATTTCATAGGGCAGATTCTGAGGTGAAATTTAATTCATCATTGATACTCCTACTGTG
GAATCTGAAGACACTTGAAAACCTATTTACTTTATTGACGAAATGAAAGCATTTAAAGGG
CAGATGTGCCATAAGAACCAGAGTAAAAGGCATTTTCTTTTCTGTTAGCTTCAGTCTCCA
GAATCGTTTGCAAAAAGTGTCCAGGAATTGACGATTGTTTTGCAACGAACAGGTGATCCA
GCTAACATAAATAGACAGAGACCTCATTTAGAGCTTCTTGCAAACATAGATCCTAATCCA
GGTATGTGGAAAAATGCTCAGTTGCTTTACTTTTTTGACCAATGAGATAAATGACACAGG
AAAATAGTAGCTATCAAAATTTTCCCCCCACCCCACCCCCTTGGTACTCTCTCCTCTATG
TTGCTGTTCACCAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCC
AGTGTGTCTGGAGGATGGCGAACAAGAAGAATGGCAATAAGATAGTTTTGGAATGGTAGG
CTAGGGCCCCAATCATGTTAACCTAATGAACCATGGTAGTAATAAATTTGGATTTTTTTC
TGGTTGCAGCAGGAAGCCCTTGTAGGGTTTTATTCAAAGGGAATGATGACATTTTAATTT
TGTTTTAGAAATGTTACTTTGACTTCTCTATGAATGAAGACTGATAAAGAAACTGCTGCA
ATGGTCTAGGCAAGAGGTTGGTAGCTTGGTCCTAGGACTGTAGCAATAGAAATGATGAAA
AGTGGTCAGATTTAGAATATATTTTGGAAGTAGAGCTGATAGGACAGACAGGTTGAATGT
GGAGTAGATTACTCAGCCAAAGGGGTGCTGATGCAAAGTACCAGATCTTTTGGGTTTTAT
GAGGGGTATTTGTTTCGGGTAGTTTACAGTCACAAGGCCCTGAAGAGCACAACTCAAGGT
ACCATAAGAGGTACTTTCTCACCCAGTGTCATTTGCCATGTGTTGAAGCAAGATGGCAGG
TGATATCTGCAAGGGTTCCACCTTCCTTCTTCCTCTTAAGGCTCTGTTGTTCCAGCTTCT
TCATTCTAGCTGTAGGCTGGCATAAGACTCAATTCTCAGGGTTCCTCAGCTGCTCTAGTC
TCTTCAGCTGCAAACTCTCCGGCTCATCTCTCTTCCCAGGGCCTCTACCATGTCTAGGAA
CCTGTCTCTTCTTTATGTTCTTCTTTGTGTGTCTACTTCTGTGTTCTTGATTGAGCATTT
ATATAGCCCACGAAGGGGGCAGGAACTCAACCCTGCATGCCCTAATGACGCGATTGAAAG
TCCTAATGTGAACATAATCAAGTAAACGTAGAACCTTTGAATTTAAATCATTCAAAGGGT
GTCACGCCCAAAGAAACAAGTTTAAAAACATAAGCAGTATCTTTTTTGGAATTCATAAAT
ATCAAACTGCCACATAGGGTTTAAAGAATAAAGAGTCAAAGATGACTCCAGGGTTTGTGG
CCTACATTAATGGGTGGTGTCTTTTGCTGAGATGGGAAATGCTTTAGGGTAGAAAATCCA
TAGTTCTCTTTTGGTCTTTGAAGTTTGAGTAAGTGAAGAATTGTATTTCACCAAGATTAG
AGTTTTACCAGGTAAATTCAACAGGCAGATTAGACCAAAGGAGTGAAAGGTATTTGCAAG
AAAGGGATTAATGGTGGAGAGTGGGTTCTAAGCAGGGTAAGGAAGGGAGTGAGTACTTAC
GGGGGAGCTCATGGATAATTTTTTAAAAATAGGGAGTAATTAGCTTTTTCAAGTATGGGT
CCAGATTTTAAATACAAGTGTTCCCACGTGAGTAGGAAGTGCCTTTAAATACTCTGATGC
TAGGGCCCAGTATGTATCCCTACTTGTCATTTACTTCACCTTTCTTGTTTAAATTTTGCT
TCTCATAACTTCTCTAGAGTTTTTTTAGATTTATTATAATTTTTTAAAATTTACTTTATT
TTTTCTTTCCTTATTCCCCTTTTCCCCTATATGGTTTGTTCATCTGTCTGCTCATTGTTT
GCTTGCCTTCTCCAAGAGGCACTGGGACTGAGTCTGGGACCTCCCATGTGGTAGGCGAGT
GCACAAGTGGTTGAGTCACATCCATTTCCCAGCTCCTCTCTTTTGAGTGGTAATTCTGCT
AAGCTCACAATCAAAACTTTACTTTTTATTTGCTAGACTGTTTTTACTAATCTTCAGGGC
ATCTGCAGTTTGTTCTTTGAGGATAGAAAGCAAGGTGTAGCTGGGCATTTTGTGTAAGAA
TCTTTGAAGTAAAGAATGAAAAGCAGGTTTCAGAGAGCATGTTGAAGAAAGCACAGGGAT
CTTTGGGCCCATCCATGCTTCCAAATTGCCTTTCTGAAATACAGGTCTGCTCATTTCCCC
CCTTAATTATAAAGCAATCATTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAACATTTCCT
CTTCTAAATAAAGTTGGTGTAAACAACACTGTTACAACCACAGCCGGAAATGTCATTTCT
GTCATAGGAAGTACTGAAACAACTGGGAAAATTGTTCCAAGTACAAACGGGATTTCAAAT
GCAGAAAACAGTGTATCCCAACTCATCCCACGTAGTACTGATAGTACATTAAGAGCTCTG
GAGACTGTGAAGAAAGTGGGAAAGGTTGGCACTAATGGTCAGAATGCTTCTGGGCCCTCT
GCAGAGTCTGTAACTGAAAAGTAGGTATTAGGTAAAAATAAGTTATTGCGAACTCTTTAT
CCTCTTTCCAATCCTCTGAGTGTTTTTGTTTATCCTGAGTAAAAGCTAATCAATTTTTAT
GCAGAATGTTTGATATAGTGAAAAAGCACTATAAAGAAGTTTGAGCTCTAGTCCTGGCTC
TGTCTACAACTGAATAGCTAGCTCTGTGACATTAGAAAGTCACTTTACCTCTGCTTTTTG
TTTTCCTCAACTGTAAACTAAAGGGGTTAAACCACATTAGATTTTTTTCACACCATAGTT
CCTTGAATAATAATTTCATTGAAGTGCTGGAAAGTAGAAACCTAAGCAGGTGAGATGCTG
ATCATCCAGCCCGTTTCAGTCAGAGCAATTCCATCCACTTTCTTTGTACTTTCTAATAAG
GTAAATTGGTTAAGAGGGGAAACTTTGAAGCCGAACTCTGGGTTCCTGTTCTGGCTCACT
GCTTCCTAGCTGTTTGATCGTATGTCAGTTACTTAATCTAATTGCTGTGCTGTTTCTCAT
TTCATTCATCCATTAAATTAGAATATATAACACCCATTTTATATGAGGATTAAATGGGTT
AATACTTCTAATGTGCTTTGAACAATGCTTGCCAACATAGTAAGCACTCAGTAACCACCT
ATTTTTATTATTATTATTATCACCATTATTAATATTATTGCTATTCTTGTTATTAGGTTG
CAGCATAAGATTTCATTTGGGAAAAAGGTTTTGGTGCTTTTATGTTTGAAAACTAAAAAT
TGAAAGCTTACTCCTAATTCTAAAATCTCATATTTTGTTATTTTTTGTGGGGGTCTTATT
GATATGACTTAATTGCAGGTGTTATTGTTATAGTCCAAAAATAGTTTGTCAGTATCTATA
TATACCTGCTATGAATAAAAGATTATGCTAGGCACACAGTAAACTGCTAGTGATTTCATG
TAATAAATGATGACTAGGCATTAATATTTCTACTTCTGCCGTCAGCATATGATGGAAATT
ATTTATTAAAAGATCCCTATGATCATCCCCAGGAGAGATTTTAGAAAAGGTATATCGGAG
AACATTGTCTGGATAGCAAATGTTATTTGTTCACTCGTTCTAAGCAGTTTTTTGGCACTG
TTGGAAATACGTAGGCAGTGTAAAATAATATCTCTGCCTTTAAGGAGTTTATGATGCTCA
AATTATGGAAATAGCATTTATTCACATGAAACAATACTCAAGTTTGATTAAAAGACAGGA
AAATTTAATATAGCTGGCAGAAATATGGGCGATGTCAGAAAATGAAATGTGAAACTTAAG
TTTCTTGATAATTACATAGAATATTGTGGAGACCAGCCTATTAAAACTGAAGGTTTCAGT
TATGGACTGGAATAAAACAAGATTAGATAGTTTGATACCAGATTACAAAGTACATTTATA
TATGTATATCTTTAGAAAATGAACTTTTGGGAAGCGGACTTGGGCCAATGGTTAGGGCAT
CCATCTACCATATGGGAGGTCACGGTTCAAACCCTAAAGTTCAAACCGCAGTTCAAATCC
CGTGTGGAGCTGACCCATGCACAGTGCTGATGCACACAAGGAGTGCCGTACCACGCAGGG
GTGTTCCCGCCTAGGGGACCCCCACGCGCAAGGAGTGTGCCCCATAAGGAGAGCCGCCCA
GCGGGAAAGAAAGTTCAGCCTGCCCAGGAATGGCGCCACACACACAGAGAGCTGACACAG
CAAGATGACGCAACAAAAAGAGACACAGATTCCCGTGCCGCTGACAACAACAGAAGCTGA
CAAAAAAGAACACACAGCAAATAGACACAGAGAACAGACAACTGGGGCGGGGGGGTGGGG
AGAGAAATAAATAAATCTTTTTTTTTTTTTTAATTAGCTTTTGAAGTGTTGTGGCAAGAT
AATGTAAAATTTTTATATCTTTCCAATGGAATATTCAGCCATAGCATGAAAGAAAGGAGT
TAAATACTGTTACATGCTACAACATGGATGAGCTTTGAAAACATTATGCTAAGTGAAAGA
AGCCATAAACAATAGTTTACATATTGTATGATTCCATTTATGTGAAATGTCGAGAATAGT
TAAATCCATGGAGATAGGAAGTAGGTTGGTGGTTGCCAGGGACTGTGGAAAGGGAGGAAT
GGGGAAAGAATGCTTACACATATGAAGTTTCTTTTTGATGAAAACGTTTTTTTCCAATTA
GAATAGTGGTAAGTGTTGCACAACCTTGTGATATATGTTAAAAACCACTAAATTGAACAC
TTTAAAAGGTTGAATTATATGATATTTGAATGAAATCTCTATTTTAAAAATGGATGAAAT
AGGGAATATGTTTTAGAAATGAATCTGAACATTATTTATTAATTCATTCAAAAATTATGG
ATCACCTACTATGTGCCAAATACCAGGCATACTGTATGTCCCTATCTTTAATGGTCTTCC
TATCTAGTTGGGGAGACAGACATGTAAACAGATAATATTATATCTGCTGAACAGTACTAT
AATGGAGTTGTGTTCCAAATATTATGGGAACACAGAAAAAAACTATGGCTAATTCAATAG
GAGGATATTATGGAAGGCTTCTTAGAGGTGAGATGATAATCAGATCTAGTCCCCTAGTTG
GGTAGTATGTAAGGAGGCCTTCCAGATAGAGGAAGCAACACAAAGGCACAGAAGTATGAG
AGGAGTTGTTGTGAAGGGGAGAACCCAGAATCCTGAAAGTCATCTAGAATATAGTTGTAG
TAATCTAGCTGTCTGAATAGGATGTGACTGAAAATTAACTTTTTCCCTCAATCTAAATTT
TTGGCTAGTTTGCATGATTTAATGAGACAATGTTTACCTTGTCATGGATTTTGATGCTTT
TTTCTTGGTAATGCTAAGAATTTGCCTTTTCGAAGTATAAACCCAAATACTATGACACTC
AACGTTTTGACGTGGAAGGACCAGGTAATCTATGTAAACCTTTTATTTAGTATAGTGCTT
GGAATGTGGTGACTGCTAGTTTACTTTGTTATAAAGAAATCCTAATTGCTTTCCTTGTTG
CCTTTATTTAACTTCAAAGAGAAAGTATGGGAAGTGGACTTGGCCCATTGGATAAGGGCA
TCCGCCTACCACATGGGAGGTCCGTAGTTCAAACCCCGGGCCTCCTTGACCTGTGTGGAT
CTGGCCCATGCTCAGTGCTGATGCACACAAGGAGTGCCGTGCCATGCAGGGGTGTCCCCG
CGCAGGGGAGCCCGATGCGCAAGGAGAGTGCCCCGTAAGGAGAGCCACCCAGTGCGAAAG
AAAGTGCAGCCTGCCCAAGAATGGTGCCGCACACATGGAGAGCTGACACAGCAAGATGAT
GTGACAAAAAGAAACACAGATTCCCGGTGCTGCTGATAAGGATAGAAGCGGTCACAGAAG
AACACAGCGAATGGACACAGAGAGCAGACAACTGGGAGGGGGGGAGGAGAGGGGAGAGAC
ATTAAAAAAAACAAAGAATAAGTATGGCCCTAACATATCTCTAAACTTTAAGCCAATACA
TTTGTGCCTACTGTTATTACTCAAAGATCCTAAATAAAGTTGTGTATTTTAGAATAAAAC
TGTACATAAAAGTAAACCTCTGCTAAGACTAATCTTATGGGTGAGACTTAAGGGTAGTCA
GAGATCCTCAGTAAAATTGTGTGTTTTAGAATAAAACTATACATAAAGATAAACCTCTGC
TAGACTTACCTCCTGGGTAAGACTTAAGGGTAGCTCATACCCCTTGTTTATACTGATGCT
TTTAAAAGACTTCTCTAATTTGAGGGGGAAAAAACCTCTTAATCTGCTTGAGATGCAAGA
TATTGAATTCCTGTGTCATTAACATGATTTTTTTTGAGTCACCACAAATCTGTGATTTTG
CCACGGTTTGACTTTGTGAAAGGGAGTAAGGGGAGAGGATATAGGTATGTTTGAGTACCT
GTTTCCCATGTATGAGGTCCTGGATTCAATCCCTGGTACCTCCTTTTTAAAAAGGAATAA
GAAAGACATGATGAGATCTTCTGGAGCTGATAATTTAGTGACAACAAAGAAAGTCTATTT
GTGTGTGTGTGTATTTTTTAAAGGTTATTGTAACCAAGATAATAAGTTTGTGTATTTTCT
ATCAATTTTACGAGTTACCGGATACTACTGTATTATTTGTGCAATAAATATTTACTGAGT
ACTTACTGTGTATCCAGGAAATGTTTTAGGTGCTGGAGATACAGTAGTTAACAAAATAGA
CAGAAATGGTCTTTCCTCAGGGAATTTATATTTTAGCTAATCCAACTCTTAATAGTATTA
ACAGCTCTTTCTTTCCATGTCTGTCTTTTTTTCCTAAAGAATTCTACTGGCAGAGTCTAT
TGTCTATTGGGAATTTATTGAATAAGAAAATTATTTAAAGAGGGGGTAAAAAGTGACTAA
TGGGTCACATTAGTGCCTGGGATTTGTCTGCATTTTCATTTTGCCCTCAGCAGAATATAT
GTTATTGTGACCCTTTTAATTAACAATGTAAGTTGACAGTGAAATTCACTGCCTTCTTTG
TCAGTATGGAAATGTCTATAAAGTGTTTTCTGCAAATGGCTTCACAATGTAATTTTATAA
AAAATTCCTACTGAGGGAGACTTAACAGTCACAGTGATTTGTCCTTTGCCTTTTATTAAA
TTTTCTCCCCAGTAAAGTTGGTTCTCCACCCAAGACTCCTATAAGTAATGTCGTTGCTAC
CTCAGCTGGGCCCCCTAATGTTGGATCAGAGCTGAATTCTGTGCCTCCAAAATCCAGCCC
GTTTGTAACTAGAGTACCAGTATATCCTCAGCATTCTGAAAACATTCAGTATTTTCAAGA
TCCAAGGACTCAGATACCCTTTGAAGTCCCACAATACCCACAGACAGGTAAGTAATTTTA
GACAATTTTAGACTTTTTAGATAATTCTAAGGGAAAAGTTGTGATTTAACATTTGTTGTT
TTTAGATAAGTGGGTTTATCATTTATATATGTTTAGAATGTCAATATTAAAAAAAACTAA
TCTCGTGGACTACATGGCCCCTAAGTTTCTTTCCTTCCCTAAGAATCTATGTCTGTATAC
CAGTATCTTTAAGGTCATTCCTATGCCTCAAAGAGTCCACGAATGAGCTTAAGGGGGTTC
TGTAAATCCCCTAAAATGGTATATGAAATGTTTTGTTTAGATATCCTCATGTACATTTTT
GGTACGATAATGCATAGTTTATATAGGTTTTGAAAGAGTTCTTTAGCTTCTGACCCAAAA
AGTTAAGAACCAATGATCTAATTCCTAAATTAATGGCAGTAGGTGCCTTCAAAAGAAATT
TATGAGCCATCTGTTAATAGTTGTCCTGTTTTTAAGGAGTAATTTAACAAGGTATTGAAT
GTTAATGATTTTCATATATTGGTGTCTTGGAAACATGTAGCTTCCTCATAAAGCAGGGTA
TAACTAAGGTACGGTGCAAAGCTTATTTTATTTTCCCACATTAAAGGCTGCTTTAGACTT
AAACCATTATAAAATGTTGGATTTTACTAAGATCGCATTAAATATTCCTCTTTCCAATTT
TCAAGGATACTACCCACCACCTCCAACGGTACCAGCTGGTGTGGCTCCCTGTGTTCCTCG
CTTTGTGAGGTCCAATAATGTTCCAGAGTCTTCCCTCCCTCCTGCTTCCGTGCCATATGC
TGATCATTACAGTACATTTTCCCCTCGAGATCGAATGAATTCTTCTCCTTACCAACCTCC
TCCTCCGCAGCCGTATGGACCAGTTCCTCCAGTACCTTCTGGAATGTATGCTCCTGTGTA
TGACAGCAGGCGCATCTGGCGCCCACCCATGTACCAACGAGATGACATTATTAGAAGCAA
TTCTTTGCCTCCAATGGATGTGATGCACTCATCTGTCTATCAGACATCTTTGAGAGAAAG
ATATAATTCATTAGATGGATATTATTCAGTGGCTTGTCAGCCACCAAGTGAGCCAAGGAC
AACTGTGCCTTTACCAAGGGTAAGTGATGATAGAAATAGGAATGTTGTGTAGTGGTTAAG
AGCACAATCTCTGGAGCAAATAACCCAGGTATATATATTCTGGCTCTTCTACTTACTAAT
TCTTTTTTTTTTTTTTTAATTTAAAATCTACCATTTATTTTTATTTTTTTTTTAAAGATT
TATTTTTATTTATTTAATTCCCCTCCCCTCCCCCGGTTGTCTGTTTTCTGTGTCTTTTTG
CTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCGGCACGGGAAGTGTGGGCGGC
GCCATTCCTCGGCAGGCTGCTCCCTCCTTCGCGCTGGGCGGCTCTCCTTATGGGTGCACT
CCTTGCGCGTGGGGCTCCCCTACGCGGGGGACACCCTGCGTGGCGCGGCACTCCTTGTGC
GCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCG
CGGGCCTCCCATGTGGTAGACGGACGCCCTAACCACTGGGCCAAAGTCCGTTCCGTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATAAATTGTTTTCATTATTTAAACTGACGAATAGTTTAAATTAATTCAC
TGCCTCCCTAGATGATAAAGATTGTTTCTTTTATCCCTCCTTAGGAAACCTTGTGGTCAT
TTTGAAGACCAAGTATGAAGGAGCAGATAAGAAGAAAAGCCAGAGCAGTGGGCACAGTAC
CACACTCAGAAAAGCACCTCTTGTCTCTTCATCTCTTCCTGTGGCAACACAGTCACCAAC
ACCGCCTTCTCCTCTGTTCAGTGTTGACTTTCGCACTGATGTAAGAAAGATTTTAATCAC
TTAATGTTACTGGGATAGGGTAAACAACTGTCTTCAGAACACTCTTTTAAACCAGGATTA
GCTATGTTAGATATTTTTTAGTGGTTGGGTGTTCATTTGCATTTAGTTCAATAAACACTG
AGTGTGTAAGCACTATGGCTTGCAGTTGTGAGACACTAAAGACCATTAAGACACAGTCCT
TTTTCCACCAGGAATTCAAAATCATTCCAGCATTGTAGTTCTCATTATTTTTATGTTTAT
TAATAAGATTTCTATCTACCATTTATTGAGCACCTACTCGTGCCAGGTACCATACTAAGC
ATTTACATAATGTTACTATTTTTTAATTCTCACAAAAACCTTAGGGGGCAGGTATTATCC
CTATTTTACAGATGAAGAATTCTACTCAGAGAAGTTAAGTAATTTGCCCAAGCCTGTAAG
TAGCAGAACTGGGATTTGAATCCTGGTCTCCCCGCGGCACTCCTTCCCTTCTTCAGAAGA
GGTACAGAAATGCCTACTTTATTATTCATGCTGCTTACATCTCTGTTAATTAATGTTCTT
GGCATTACAAAACCAGTTTTTGTACCAGGATAATTTCTTTTTATCCTGGTGTTTACAGTA
CTGTTTTATGTTATATTCAGAACATTACATTTTTTTTAGTAGTTTCCTCTGGTTTACTGC
CCATTCCCCACCCAGAGGTTCTAATAAAATTTTAAAAATCTGTATAATAAATGCCATGTA
CTTGTCATCTAGCTTCCATAATTATCAACTCATAGCCAGTCTTTTTTCATTTAAATAATC
CTAGACATTACATTACTTCATCCATAAAAAGTTTCAATAAATAATTGGATCTTTAAACTA
GATTCACTTCCATCTCATCAAACTTAGACTTCTTCAAAGCAGCAAAACACCTTGACAATA
GTGTGACACTTGCCTGATAGGAAAATGTATTTTCAATTTTCATACTATGCTTTAGGAGAT
AACTATTTCCGAGATATAGATCTGCTCTTTTCTAGCGGAATGAATGGGGATAAGTTATTT
TACCTTCTTGGTCTTAAGTTCCCTTATCTGTGTAATTAGTAACTAGATTTAATGATTTGT
ATTGTAGTCCCATAGTTATCTTTTCTCACAGTACCTTTAAAATTTATCTTCTTTCTCTTC
TGATACCAGAGCCATCTCTGAATTCTTATTGTACTTAATGTTACATGGTTTTTCAGCCAT
GTTCCCTAATATACACATATTATTATTTTCTCACAAAATTATGAATTCTTTTAGGATGGG
AGCTGTGATGTGTATCTATGTGTGGTGTGCATGTATTTTTCTCTTCATTTTTTCATGTTA
GAAATGGTATGCTGTAAATACTTGATTGGTTTTGATAGTGTCAGTTAAGGGTTCCTTATG
AATACTTAAAGGACAATGCAAAAAGAGAAGGCATGCTATTTGCTACTAATAAATACAAAT
AGTGTAAGTACTATTTGTTTTGCTTATGAGAGGTTTTTATTATTAGTTATTGAAAGTATA
ATTGTTCACTATGAAATCTTATATATACTATATTGTTAACTACATTAGTTACAAGTTTAT
AAATTTAAGTTTCTTACTAATTGGCTATGCTTTTTTTCCTCCCCAATCAGTTCTCTGAAA
GTATGAGTGGTACAAAATATGAAGAAGATCATCTTTCCCATTATTCTCCCTGGTCTTGTG
GCACCATAGGCTCCTGTATAAATGCCATCGATTCAGAGCCCAAAGATGTAATTGCTAATT
CAAATGCTGTTTTAATGGTATGATTTTGTGGGGGAGGGAATAATGCATGTTGACTCAAGT
CTAAGAATAATTGAATGCTTTCATCTGCATATTGTTACTGTATAACTCATCTGTAAGCAG
CAGGGTTATGTTTGGGTAAGTCTGAAACTAAATATATTTAATACTTAAACTATTTGCATA
TAGTTCAGTGGTTTAAAATTAATGGATTATAATTGAGATCTAGAGCTAATATTAAATTCA
CCAGAAATTGTAATTATCTTTTATTTAATAGCATGTATTGGGTATTACTAACTGGTATTA
CTAACTGAAGCAATTCTCAGTAGTCCTTTTATTTATTTATTTATTTATTTACTTTCTTAT
TTTTTATTTTGGGTTTATGCAGGACCTTGACAGTGGGGATGTTAAAAGAAGAGTGCATTT
ATTTGAAACTCAGAGAAGGGCAAAAGAAGAAGACCCAATAATTCCTTTTAGTGATGGACC
TATCATCTCAAAATGGGGTGCAATTTCCAGATCGTCCCGTACAGGTTACCATACCACGGA
TCCTGTCCAAGCCACTGCTTCCCAAGGAAGTGCGACTAAGCCCATCAGTGTATCTGGTAA
TCCATTTAACCTAGCCTGATATGTTCTAGGCACTGCTTTTTCATCCTCCCCCTGTGAGGT
ATGAATTTTTCCCTCCATTTAACATCCACAGTACTCAGAGTTAAATGGCTTCACCAGGAT
CACATGGCTACTGTAATAAAATAATAGATGTTTTTTAAAAAGTATACATTCAAAAAATAA
AAATAAATAAAAACAGAAGTGACAACATAAAGAGTGAACCAGAATATGAACTGTGGACTA
TGGCTAATCATATAAGTATAATAATATTGTTCCATCATTTGTAACAAAGGTACCACACTA
ATGCAAAATGTTAATAGTACAAAGACTGTGTGAAGGGTGAGGTATATATGACCTGTTTAC
TTTCTGTATGATATTTCTGTAAACCAACTGCTCTTTTTTTTTTTAAAAAAAAGAAAAAAT
ATACATTCACATATATATACTGGTGTGATTGTTTCTTTTTACATTTCTATAGACTATGTC
CCTTATGTCAATGCTGTTGATTCACGGTGGAGTTCATATGGAAATGAGGCCACGCCATCA
GCACACTATATTGAACGGTAAAGATGTTTTTAATTCTTTACAATTCTCTTTTCTCAGACT
TGTATATATCCTCAGAGTACAAATTCTAACCTCAGTTTTTCATGAATATACTTTGAGCTA
TGCAACAAATTTCTGAAAAAATTTTAAGTGTACATTTGGTATATGACTGGAGATTTCAAG
AATGATCTGTTACGGTGGCGGACTTGGCCCAGTGGTTAGGGCGTCCATCTACCACATGAG
AGGTCCGTGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGCAGCTGGCCCATGTGCAGTG
CTGATGCACACAAGGAGTGCCCTGCCACACAGGGGTGTCCCTGGCGTAGGGGAGCCCCAT
GGAAGAGAGCAGCCCAGCGCGAAAGAAAATGCAGCCTGCCCAGGAATGGTGCGACACACA
TGGAGAGCTGACACAACAAGATGATGCAACAAAAGACACACAGATTCCCCTGCCGCTGAC
AACAACAGAAGCGGACAAAGACGAAGACACAGCAAATAGACACAGAGAACAGACAACCAG
GGTGGGGGGTGGGGGAGCAGGGGAGAGAAATAAATAAATCTTTAAAAAAAAAAGAATGAT
CTGTTACCTAAAATGTATAGTCTACTGCTTTAGTTGCTTCATTCGTTTCAATTTTACTAC
AATAAAAATATTTCTCTTTAAAGGGACAGATTCATTGTTACTGATTTATCTGGTCATAGA
AAGCATTCCAGTACTGGAGACCTTATGAGCATTGAACTTCAGCAGGTAGGCTCTATGTCT
CTCAGACTTAAATTTTTAAAAAGCAGAATTGCAGGGAAGTAGCTGTGGCTCAATCAGTTG
GGCTCCCATCTACCATATTGGGCCCTGGGTTTTTGTCCCGGGGCCCCCTTGTGAAGGCAG
CTTGCCTGCACACCACAGAGAGCTGCCTGGCATGCAAGCAACATAGAGAGCTGACTCAGC
AATGTGACACAACGAAAAGGGAGACAAATTAAAAAAAAAACACAGAAGAGCACGCAGTGA
ATGGACAGAGAGAACAGACAACAAGCAAGTTGTAAGGGGGGGGAAGATAAATAAAAATAA
GACAGAGCAGACAGCAAGCAAACCAATGGGGGGGGTTAAGAAAAATTGCAAGTGAAAGCT
GTGGTTGAAAGCTGTTAATCTTCATTTCTTCCATAGGCCAAGAGTAACTCATTACTTCTT
CAGAGGGAGGCCAATGCTCTGGCCATGCAACAAAAGTGGAATTCCCTGGATGAAGGCCGA
CACCTTACCTTAAATCTTCTAAGCAAGGAAATTGAATTGAGAAATGGAGAGGTAAAGAAT
TGAACCTCTCAGCTTCATGCTTAATGTATTTGTTAAATTTTCTGCTTCTGTACTTTGATT
TATACAATAATAATACATTTATTGTACCTTTTCCTGATAGATAATTGTTTTGAAGACTTG
AGTTAAAATAAAGTTGTGATCCCAGATTTCTTAAATAATTATTTAATTATATTGTTGGGA
TTCCATTTTAATTTAAACCAGAAACCCCAGTTTCCAGAGCTATAATATCAGTGTTGTTTT
TTTTTTAAATTTACAGAGTGATTTTACAGAAGATACAGCAGATACTAAGCCTGATAGAGA
TATTGAGTTAGAGCTTTCAGCACTTGATACTGATGAACCTGATGGACAAGGTGAACAAAT
TGAAGTAAGTGCCACAATTAGATATTTAGGAGGTTTTGTTCCATTGGAAAATGAAGTATA
AAATACTTGTAAACTGAAAGATTAAGAAATTTTATTTTCTTAGGAGATCCTGGACATACA
ACTTGGTATTACTTCTCAAAATGATCAGTTGCTGAATGGGACAGTAGTAGAAAATGGGCA
TCCAGTCCAGCAGCATCAAAAGGAATCACTAGAGCAGAAGAGGCAGAGTTTAGGTGAAGA
CCATGTGATTCTGTGAGTGTTAGAAAATTCATAACCAGTGGGTAACAGATGTACCGTTGA
GTTTCATTTTTGCCTTTACACTGTGAGGGGAATTTATATATTGGATTGTCCAAATCATTG
CCTATTAACACTATTATACTATACTACTATATTGTATAGATATATTTAGTAGCCTGAAAC
TTGCTCTTTGTTGGGATGCAAGTAAGACTTTGCACTCTAGCATCAGATTCTTCAGTCTGA
TAGCCAAACCTATAGACTACAAAATAGAAAATTAAAACCTAGGATGAAGATTTCTTTTTA
GAAAATCATGTTAAGATTTTTATGGCTTTAATATTGCCATTTTGTGTAATTGCTACAGAA
AAGTAAGCCCTATTATAGGCTTAATCTTGAACTTCATGGTTTGTGTGGCCTTAAATTTAC
CAGTATTTCAGTTTCTTATTAAAACTTTTGGAAAATGTTACTTTTTTGGTGACCTGATTC
AGTGAATAAAGATATGCATTTGCTTTGAGTTCTGAAATTTTGGTAAAATTGTTCATAAGC
ATTCAAATTTTCTCTATATGTTTTCACTGTGAAAGCTAATTTGTTTTCAATGTCATTTTT
TCCCCCACAGGGAGGAGCAAAAAACAATTCTGCCGGTAACTTCTTGCTTTAGCCAGCCAC
TCCCAGTGTCCATTAATAATGCAAATTGCCTCCCCATCACCACATCTGTCAGTGTTGGCA
ACCTGATTCTGAAAACTCATGTTATGTCTGAAGATAAAAGTGACTTTTTAAAACCTGTTG
CAAATGGGAAGATGGTTAACAGCTGAAAGAAGGTTCATCTTTCAAATTAGTGACCACACC
ATGGAAACATTTACACTAGCTTTTTATATATATAATATATATTATATAATGTATATTTTT
TTTAAAAAAAAAAAGATATTACTGGGGGCATCCATTTCCTGTGGACTCTTTGATACTTCA
AGCCCTCTTGCATTAGCATTCTGAAAAAAATAATAATTTACTAGGATAACATGTTCACTT
TCCAGAAGTGATTGGAATTTGGACAACATTTAAATTAAGCTTCAAGCAGCTTTTTATGAG
TTTGTAGCAATCCGGTGCAGTAACTGAGCCATTTCCTATTTTAAATGGCTTGTATAGAAA
ACTAACAACTCAGTTATTAAACTAGCAGGATCCTACAATGATACATCTAGTGAAAGTAGA
CTTAACTTATTTATTTCTATTTTATGTTTCACTGAGGAAAAATTTCCATCTCATTCCAGC
TGCTTTATTTATCTTCTGTCATGATAATTTGCATGGATTTAAAAAAAATTTTTTTATTTT
TTACTTTGAAGAGTGAAGCTAAGCATTCTTACAATAGAAATTTACAGGGTTATACACTAG
CTTTCTTTACTGCATTTATATGTAGGAGTGTGGTGCAGTGCTTTTATCTGTAGCATTGAA
ATTTTTTTTAATTTTCCATTTTTCAAGAATAGTTTCTGCTTTATTACTATTAATATTTAT
ACACAGGCTACTTGTTGAAGTAAGTAATTAAAAATATAACCAAGTGCCTAAGTCTTTCCG
CTGGTGTACTAGATATTAAATTCTCCTAAGTTATGCAGAATCGTTTTTACAATTTTGATA
AATTATGCACTAATGTCATGGCAGTTTTTTAAAATGCAGATTTAAGCCTGTACATTATTG
AATCTGATGACTTGGCAAAAGAATCAGGTGCTTTCAGCTTTCTTGAGAAAAACCCTGTAT
GTAGCGTTTGCACTGACTAACAAGATGGTATTGCTGGGTTTTTAATTTAAACTAATTAAT
TTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1231, 29700..29817, 30959..31192, 32183..32358, 33803..34003, 34488..34620, 34737..34743, 34746..34752, 34857..34961, 35062..35174, 38231..38539, 43212..43426, 44105..44538, 45584..45586, 45588..45601, 45603..45617, 45619..45636, 45638..45671, 45673..45759, 47390..47536, 47902..48115, 48592..48676, 49343..49420, 49470..49473, 49836..49970, 50230..50343, 50443..50591, 51190..51385
1001..1231, 29700..29817, 30959..31192, 32183..32358, 33803..34003, 34488..34620, 34737..34743, 34746..34752, 34857..34961, 35062..35174, 38231..38539, 43212..43426, 44105..44538, 45584..45586, 45588..45601, 45603..45617, 45619..45636, 45638..45671, 45673..45759, 47390..47536, 47902..48115, 48592..48676, 49343..49420, 49470..49473, 49836..49970, 50230..50343, 50443..50591, 51190..51382
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved