Dasypus_novemcinctus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus TOMM20
Dasypus_novemcinctus
TOMM20
GeneScaffold_6220
SNORA14
1675..1810
10052
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATTTTTTTTCTCCAACCAGTTTCTGAGGCTACGTTTTAAGACATTGCTCCATTCA
ATGTTCTTCCACGCTTCATAAATTGAGACTGCATAGTACCATTCTTTTGGAACTCAAGTT
CAATCACTTGATTATGGTGCTTGGTGCACAATGGGTTGCAACTGAACTTGAAAAGCAAAT
TCAGTTTAATTTGAACAAGCTTCACAGACTCCCCTCTATTACATAAGGGTGGGATTTGTC
GTCAGCCATCTTATATCTTCGACAGGCATAACGTCGTCAGCTATAAAGTCTGAACGTGTG
CAAAACGATGAAACACCTCTTTCATCAAATTCAGCAGTTTTAAGGAAGTACGTGGTCAAT
CGCAAAGCCCTTAAATGAGCGAGCAGAACCGCCCTATGGCGCTGGATCACAGTCCCTGGG
TTCCCGCGCGCGGGTCGTCCCCTTGGCGCAGGCGCGGGTCGTCCCCTTGGCGCAGGCGCA
GGCGCGGCTTCGGCGCCCTCTGCTCCGGCACTGCGCTGGACGCCTTCGGGGCGGTCTCCA
AAGACGACGGAGCCGGAAGTGGCGTTGCGCGCGGGGCCCTTCCGCGGCCCTCACCGGCGG
CTGGTCCCCTTTGAGCGGCGCCGTCCCTTTTGAGGGTTGGCGGCCAACGGCTCCTTCGTG
GGCTGCCGCCGCCGCCCTCGATACTCCGCTGTCGAGAGAAAATGGTGGGTCGGAACAGCG
CCATCGCCGCCGGTGTGTGCGGGGCCCTCTTCATCGGGTACTGTATTTACTTCGACCGCA
AGAGACGGAGTGACCCCAATTTCAAGAACAGACTGCGAGAGCGTGAGTGGGTCCCCTCGC
CCCTGGGCCTCGTGTCTCCCTTCCGCCTCACATGGGTCCCCCTTGCCCTCGCCCCCCGCC
TTCGCTAGCCTTGCGGGCACAGGGGCGCGGCCCGGGCCCTCTCCCTGCACACTCCCGCAT
CCCCCGTGCCGCCGGGGCGTCTGGGCCGCTGCGTATTGCGTGCGGGCCGACCCGGGCCTG
GCGCCTGCGAAAGGCCTGCTGAGACCACGGGCCGAGCTGCCTTGACTTTTCGTGGTCGGG
TAGGGTCTGGGGAAAGGAGATGGCGCCGCCTGCGCGATTCCCGGTCCTCTTTCCACCTTC
CATGCGGTGCGTGATTTCCTCCATTTTGAAGGGTTTTTTTTTTCCCCTCCCCATTTTGTT
TTCTCCAAACACTTTCGTTCTGTAAATTCGTTCTGGTTTGGAGAATTAAATTAGGGTTTT
TTTCCCTTTTTTTTTTGTCGTTAATCCTTTTTAACCTTTATTCTTAACTCGAGAGTTGTC
TTTTTGCAGATTTTAGCCTGAGACTAAATCCGCAAATCTAAATGCGGTATTTTTACAGCA
TTCTTAAACCCTCTTGGTGGCTTCGCTGTAAGTGCTTCCAAGATATGAGCGAATGCTACA
GAAATTGTAGGGGAGTCCAAAGGGCTGCGCCTCTTCTGTGGTTCAGTCTTATTTCATACC
TGCGACATACTTTAAGACTGGCTGGATTTGTCACTGCCCTTAAAAGAGAAGGAAATACTG
TCACTAAAACCTTTGTCATCTGCTTTGAATTTCGGAGGCATCTTCATTTGCAACACTAGA
AAAGCATATATGGCAGTGAGAAATATTCTTGTAATCTAAGATCACTAGATTGCCCAGAAA
TTTCCGTTTCTCAAGTTAAAATCGACATGTAAGTTATTAAAGCTGGAAAAGTAAGAAGAA
CTGACTATCCTTTTTCGTATTCAAGAAGTCATTCCAAGTGCCTAATAGCCACGTGTCCCC
GCTGGCTGCCATATTGGTCGGTACTGATCGTTTACAATCTACAATGTGACAACTAGCTCT
CCTGGCTTTTACGTGTAAAGGATTAGTATTTTATTTATGGTTAGTTAGTCTAATGGGAAG
AATCCTGTTTTGGATTCAGGCACTGGGTTTCCCGCCCTTAGCTGGTCACCCCATTTACGG
CATAAACTTGGGCATTCTGAATCTTACCTCCTGCCCCTTCATCCGTATGTCATCTGCCTC
TTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGTTGATGTCAGACAGTTGATTTCATTTTTTTAGATATAATTTCTTC
TTTTTTTAGGAGTAGCTAGCTCAGTTCAGCATCTGATATCTGGTCCATGGTCATTTCCCC
TTTGTTGGCTAGACAACTTACTGTTCAAGCAGTATTTAAGGGACACTAAAATAGTCTACA
AAAGACATTTGCACCAGAAGGCTCAAACTTTCTCACTCTGCTTCAAAACAATACAACAAC
ATTTATTGATTTAATTTTTCCTTCAATGTGAAAGAACCACATATTCATTTTAAAGTCTTA
GAATTATTCACACCCACTGCTTCAGAATTATACTGCCCTAACATTTTTACAGTTGTAATA
TGTAAATGAACTTATAAATCTGTTCTTTTTTTCTTTTCATAGATCTTTTTTTTTATTTTT
ATAAATTTATTTGGTTTATTATATAAATATATTTTTAATGACTTCATAGGTTTACTTGAT
AAATGTTCTGTGGTATGTTTAAGTAAATAATAACCATTGTACATGTAACTTTATCCTTTT
ATTGAAATTAGTTCCATTGTTTGGATTCCCAAGAATTGGGCAACTGGATCAGCAGTGGTT
CTTTTCAAAAGAAGTGGAGGCAAGAAAAAATTAAATCAATAAATGTTGTATTTTAGTCCT
TAAGTAGTTGAGTAATCAGCACAGTTAATTGACTGGACATGGTAATAGTGAAGTGGAAAC
TGGGAAGGAACCACTTTGTTGTAATTATGTCTAAAGTGTCTTTCTGAAATATATTTATAT
TGTGAATAATATTTGTTTTTTGTTCACTGTTTTTAGTAGTGTTTTCTTAAAGATAGGAAA
ATAGATTATAGAAATATGAGTCAGTATGTATTTTCAGACTGAGAAATATAATCATATTCT
TATTATATGTTGGAATGACAATGCTTTCACTTTGAGAAATTTTTTTCACCCATATTGGAT
AATGAGAGCATATATAATGTAATTCAAGAGCCAAATACATTTCTTAATAAGAGCCTAAGT
TTTGAAATTTAAAAATGGAGACATCTTTGATTGACTTCTCATAAGTTTACATTTTTTTTT
TTTAAAAGCCACATAGCTGGTGTTGTATATTGCCATAATCATTCAGTCTGGTAATTTGTA
ACAAATATCACAAAACCATAAAAATACAAATGTAAACTTATTGAAATAAAGCTGTTATGG
GTTAATGTAAAGACACTTAGAAGTAATTTACCTGTCCAGCAAATAGATAACTGATTAAGC
AGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTACCCTAAAAAATATATATATAT
TAAAATGTGTTTACTTCTGTATTTTAGAGAACATTGCCATAGTACCGTATATAAATACTA
ACTATAGAAATATAAACTAGGAATGTCTTCTCTTAACCCTTCCATATAATCATCAGGTCT
TCTGCTGTATTTCTGTAGTAAGGAGTGACTTTAATATTTGTCAATTTTATATTTCGCATT
AAAAGTTAGATCTAGGAGGACCTTGGAAAATCACCATTGTTTTAATGTCTCAGAGGAGGT
TGATCACACTAATGGGTTCGTGACAGTTGATTTTAGAACAAACCAAATTATTGAATTCTG
AATTATTTTGTGCCTCATTAAACTCTTTCTTAAAATTCCTACTAAGAAATTAAAATGGTC
AAATTGACATCTGAGAGCTGTAATCCATTCAGAAATGTAGAGTCTTAATAAATTTACTTT
TAGAGTCAAATTAGCTTTTATCTCAAGTTGCTTTGAAGTAGTTACTACATAGTAACCAGT
TTTTCTTTTTATCTTGCCTCTCCTATTCCAAGAAATAATTTGACGTAATTAGAATTTGTT
TGGTTAATTTCACCTAAAGATTTGCAGATGGTCAAGTTCCTATATACTCAAGTTGCTTAC
CATCTAGGGCAGATTAAAAGTAAATGAGGGAAACGGACTTGGCCCAGTGGTTAGGGCGTC
CGTCTACCACATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGAGCT
GGCCCATGCGCAGTGCTGATGCGCGCAAGGAGTGCCCTGCCACGCAGGGGTGTCCCCGCA
TGGGGGAGCCCCATGCACAAGGAGTGCGCCCTGTAAGGAGAGCCGCCCAGCACGAAAGAA
AGTGCAGCCTGCCCAGGAATGGTGCTGCTGACAACAATAGAAGCTGACAAAGAAACAAGA
TGCAGCAAATAGACACAGAGAACAGACAACCGGGGGAGGGGAGGGAATTAAATAAATAAA
TAAATCTTAAAGAGAAAAAAAAAGTAAATGAGAAGTATTTTGAAGACATTATCTTAAGTT
ACAAATTATTCTTATGAATGTTGGATTCTGGAAGAAGTTTAGTATATAAGCAGGAGTACT
GGAGTGAGGAGCCCTGGGCTTAAGATTATTAGTTACCTAAGGCTCAGTTTCTTCACTTGT
AAAATGAGGATAATACTAGTACCTCCTGACTAAATGTTATTCTGAAAATGGTGTGAGCTT
CTCCACACAAAGCACTGAGAACAGTTTTCCAGGACAATGGTAAATGTGATTGAGGAGGAA
GTGTTTAAAACACATTGCATTTTTATGTAAAGTTAATACTTCGAAAGTACTGTTCCATAA
ACATTTGATAGCTTCATTCAAAACTCATTAAGATCAGTTTCCTGTGAATTTATATCATGA
AAAGCTGTTTTAGTAAATAAAAACTTACTAAAAACCACGCTTACTGATACCATGAACTAT
GAAGTGTCTGAAATTTTGCCAGCTTCTTGCACGCTACCAAGTTAGCCTGCCATAGTTTCA
CTGGTGCTGGCAGAAGACATAAGACTCCCAGCACTGCAGTGAAGGACAGTCTAGCACACA
GCAGTAGCAGTAGCTAGAATATCAGCATTCTCACTCAAGTGATGTTTTTTACCTTCTTAT
TTCAAAAGTAGGAAATTTTTTTGAGTGAGGAGGTCTGGAGGCAGGCAGCCTTGTTGATTG
GGCAGCTCAACAAATGAAAGACACAGACTCCTTTCATCCTTTATCTGAGACTGTAGACTT
TGGGCCTCATTTTGCCTCATTGTTGCCACAACTCGAAGTAGCACATCCTTACATCCCACT
CAAAGTTGGGAAGCAAGGGTAGAAAGAAAATAACTTGCTTTTTATTAGAGAATATTTTCG
TAGACGCTCCCCAGAAGACTTTCCCATATATATACATATATATATGTATATATAAAACAA
ATCATTTTTACTGATACATATTAATAAAGCATGTAGTCCATCCAAAGTGTACAGTCAGTA
TTTGGTATAATCACATAGTTGTGCGTTCATCACTTCAATCTTTATTAGAGCATTTTCATC
ATTTCAGTAATAGTAAAAATAAAAAACAAAAGATTCATCACCTTTCAAACTCTAGGCTTC
TTCCCCTGCTATACATAGCTGCTATTTCTGGCTATTCTTGCATATTTATTTAAAGTTTTA
TTTTATTTATTTCTACCCTCCTCATTGTTTGTGTTAGCTGTCTGCTGTCTTATGTCTGTT
TGTTGTGTGTTCATCTTTTTTTTTTAGGAGGTACCAGGAACCAGACCTGGAACCTCCCAC
ATGGGAGGAAGGTGCCCAGTCACCCAGCCACCTGCACTCCCTGCTTTTATGTGTCTCATA
TTTGCTTGTTGTGTCTCTTCATTACGTCAGCTCGCGTCATTTTGTTGCGTGTCAGCTCGC
TGTGTCTTGCTTTGTCTTTAGGAGGCACCAGGAACCAGACCTGTGACTCTGTGTGACAGG
TGGGTGCCCACCTGCTTGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCAAGTTTTACAGCAAACTCTTCCACCACCAGTGTTCCCAGATGCTTCTGA
CTAAGCTCCAACAATTAGTCAGGTAAGGAAATGTGAGGTAAAAGTAAGTAGAGTAAATCT
CAAAAAAACTGGCTTTCTGCCTACTCTTTGAGATCTCAGGCATTTTGTTAGGTGGCCTGA
CTGAAGGCAGAGGTGTCACTATGACGTACCTTGGAAAGTGCCATAAAGGACCATGGACAC
CCTCAGCCCTACTTCGTCTAAAGTTCAGTGCCTCTCCTGCGGAGGTGGGCTTTGAGTTTG
GAGCTATTTTGACTACCTTTCCAAATCACTGTTGAGTAGTTCATATTAACCTTTTATGTA
AAACATTATCCATAATTTAAGTTAATTAAAATGTATTCATTTTTAATTCATTCCAAGGGG
CTCAAATGAATTTACTTTTTTGTATGTTAATTTCCTCAGTTATTTGAAATTATTAAGATA
GTGATGGGGGATTTTTGCAGAACTTTATGGTTACTAACTGAATAGCTTACTCTTCAAACT
GGTCCTTACTCAACTAGATTGAAAAAGGACTGGAAAGAAAATAAGAGGTCCCAGAGATTT
AAGGGAAAGAGTTTGAAAACTGAGTAATGTTTGGAGCATGGAAAGATCATTCGAGCTAAT
ACTGATCAGTGTTCTTGGGAGTGAAGAATTTTTTTTAATTACATAATTGAATAATACATA
ACAATGTGATGTTATGCTTCCTTTATTAACCTGAATTTTTTTGAAGTGGAACTGACTGTA
GTATGATCATCATTTTCTCTCATGATAGATTACATATGTTGAAATAAATGTCAAAATGGA
TAAGCTTTAGCAATATTTGATTATTTGAATACAAAAAGCATTTTATGTTGTATGTATTAT
AGGATCCTGATTTAAATGCTTATGCTTATAGAAATTATTTTCCTTTTTTTTTTCTTCCCC
TCCATCAGAGAATCGTAAGTGCTCAGAGCTTGGCTGAAGATGATGTGGAATGAAAAACAA
ATGTCAGCGTAATCAAACCTCTATTTAAAATATTCAGAAAATTCTTGACTCGGAAGATGA
ACAGCTCGGGGAGAATAAGGGCAAATATGCTTGATATGGACTGTGCACCATACTAAAAAT
CTACCAAAGTTAATTTTTGCTTTGTGTAGATCCATTTGTCTTATTTATTTTTCCCACTGA
GAAATGTATTTTGATGAGGGCTTTTCATTTTATAAATACACTATGAGTTATTGAATATTG
AAATATCATGGATTCTGTTTCTTCAGAAAGTGTGCAATTAAAATGTACATACGTGTAACA
ATACTTATCTTAAAAACACCCAGTGCTTAGTTTTGAAAGATAAGGCAACAAAAAAGTGTA
TGAGAAAGCTGAAGAGTACATATTTTTAAAGCTAGTACATTTTATTACGTATCAGAAAAT
TGGGTGAAAACTCAGTCGTGTTTATCAAAGCTGAGCATTAAAATCTTCAAGAAATACTTG
TGAAACGTGCTGCTGTGCTGTATTAACAGTTTTCACTCCTACCCTTTGTATCAGTCTGGA
AATGTTTTAATTCATTGGGCTTAGTGAAATGTTTTGTTCTGGATATTTATCTCCCTGTAT
TTTAGATATGTGTAGTTACAAATAGCACTAGCAGTGTGGGCTGTGCCAATTCATGTCTGT
TCACTCTCATTTGTAAAGTAAGGGAACTGGTCCACTGATCTCTGAGGTGTCCCTTCCAGC
TCCTGATTTATATAGTTGTATTCAGCATCTTCAGGTCCACCTTCTGAGGAGTGTCTTCTT
TAGGCCACTGGGCCTTGCATTTTTTAATACTCTGAATTTTGCATGCTTGCCTGACTTAGT
ATTTCCAAATTGATCTTTTGTTAATGTCTTAACTATTGTGTTGATTTTCACAGAAATCAT
ACGGTTCAGTCACAAATGTAACAATTAATTTGAAGTGTATCCTTTAAGGTAACTGGGATG
ATGTGCTAGTAAAAAGTATTTGTTCTCCTTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 2446..2492, 4328..4409, 7979..8084, 8086..8104, 8107..8121, 9008..9052
1001..1121, 2446..2492, 4328..4409, 7979..8084, 8086..8104, 8107..8121, 9008..9049
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved