Dasypus_novemcinctus Locus DAD1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus DAD1
Dasypus_novemcinctus
DAD1
GeneScaffold_5572
SNORA3
4414..4543
32325
GGGCTGGGAGGTGAAATAAATTTCTTGTGGAATTAAAAAGGCAGAGGAAGCCAGAAGTT
AAGGCAGGGATTTTCTTTTTTCAGTCAAAACGCTAAAATTAAATAGTCAACCCCACTTGT
TAAAATAAAAAACTTCAAACCTTCAGTTTTCTTTGCAATATGACGCGGAGCGGGTAGAGG
TTGGACCACGCACGCTCGTGCGGGCTTTTCACGCTGACGTCCTGGGATTTACACCTGGTT
CCAGATGACAGTTTGGGGGCAGAGGGCTAATGAACTTGATCATATACTCTATGAACGAAA
ATAATCGGTCCTTTCCTTCTGCTCCTTGCATCAGGGGTCTTTGAAGGCGGCGACTGTATC
TGATTCATTTGAGAGTACCTACAACTTAGCTGAATGAAGGAATGAATGAATGAGAATACC
TGCGGGCTTAGAGTGCTTATCCGTAAGCACTCTAAGGGTCAAGCTCCCGCCACCCCCAGA
CTTGCTCCAATGTTCCATGACAGGCATCTGCAGTTAGCGCCCCTAACAGAATTAGGGCCT
TTACCGAACAGCAAGAGGGCCAGATATTGGGTCAAACAGATCCAGTTAATCTTGAAGACA
CGAGAGGACCAAAGAAAGCCGGAACCCTCGTGCAGTAGCGGTGTCCGCAGTAAAACCCTT
CCCTCTCTTCCTACTACAGTATCTTGTTGCCAGAGCAACTGTGGGCGTGACCTACCTGAC
GGAAATAGGACAAAAAGAGTACACGTCTCAGTCCCGGGACAAACTCACTGCGCAGGCGCA
TTAGCTTTTTCTGGCGGTAGGTGCTGTCGGGAGATGAATTTTGCATCGGCGCGTTAATTG
TTACGCGCCTTGACCTGCTAATACGCCTGCGCAAATTGGCGTGCCGGGGAAGAGGTGGAG
CTAGTCGACTGCCGTACGCATGCGAAAACCTTACTTCCGGCGTGGTGGTAGGCTTCGTTG
AAACTTGCTGGAGTGCGGATTGTAGTAACGAGCGTGTAGTTATGTCGGCATCGGTAGTGT
CGGTGATCTCACGGTTCTTAGAGGAGTATTTGAGCTCCACTCCGCAGCGCCTGAAGTTGC
TGGACGCGTATCTCCTGTATATACTGCTTACCGGGGCGCTGCAGTTCGGTTATTGTCTCC
TCGTGGGGACCTTCCCCTTCAACTCTTTCCTCTCGGGCTTCATCTCCTGTGTGGGGAGCT
TCATCTTGGCGGGTAATGATTGTATAAGTAATCTTAATAATAATGTGTTACTTTGGTGCA
CTGCTTTTTTTCTGGCGGGTAATGATTGTATAAGTAATCTTAATAATAATGTGTTACTTT
GGTGCACTGCTTTTTTTTCTTATAAGTATTCTATATTATTATCAGACCANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAGTTACGAGAAGAGCCATCAGTTGCC
TTCATTATCTTCTTTTCTTATGAATGGAAAATATGAGTCCAGAAAGGCTGTTACATGTCT
ATGCCACACAGCTGCCTAGGAGCTGGAATCAAATCTCTATAAAAGCCACTTTTATGTTGC
TATTCATTCTGGTGATCTCCATTTCATATTGAACCAAGGAAAACCCCATTCCAACTCTCA
TAAGTTGCTGGTCTTTTTAAATGAAAAATCCACCTCTCCTTGGCCTAACCACTGTAACTT
CCAGGGAGACGTTTCAGTGGACAGTGTAAAGTGCAGTCTTTTTTTATATATATATAATTT
AAAAAAATTTTTCCCCTCCCCCCCAAGTTGTCTGCTCTCTGTGTCCATTCGCTGCGTGTT
CGTGTCCACTTGGATTCTTGTCAGTGGCACCCAAAATCTGTCTCGCTTTGTTGCGTCATC
TTGCTGCGTCAGCTCTTTGTGTGTGTGGAGCCATTCCTGGGCCGGCTGCACTTTTTTCGT
GCTGGATGGCTCTCCTTATGGGGCGCACTCCTTGTGCATGGGACTCCTCTATGCGGGGGG
CACCCCTGCGTGGCACGGCACTCCTTGCGTGCATCAGCACTGCGCATGGGCCAGCTCATC
ACACAGGTCAGGTGGCCCTGGGTTTGAACCTTGGACCTCCCATGTGGTAGGCAGATGACC
TATCCGTTGGGCCAAATCTGCTTCCCTGCAGTCTTTCTTTGCCTGCAGTCTTGGTTTTTA
GTTTCTCCTATTTATTGCTTGTTGATGAAATTGTTAATTTACCATCCTGAACTCAATTTT
TATTTACATAATTGTATTTTAGCTTTAATTTTTTCCTTCTCTGAGCATTTGATATCTTGT
AATCCTTCATATTTAATGAAAATTGACTATCCCCATAAATTTTTGCCAAAATCTAACTAA
CCCTTCCTGCCCAACAGGGATTCAGGGAATAGAATCCAGGCTTGGCCCAAGGGGTGTAAG
CTAGTCTAATTTATAGATGGCCACTATATGTGCTTTTGCAATCATTGGTATCCCCTGCTT
CCTGACTTATAGAGAACATGCCAGAATTCAGAGTTTTTTTTGATCAGGGTGGCCATCAAC
TGAATTTTAGTCTACTACAAGTTATTATGTTAAAAGCTGTTGAAGATAGATTAGGGGTGT
GTTGCTTGTACTCAAAGAGTACAGTCTAATTGGGACACAGACATACGAAAATAGAACTTC
AGAATTGTCTGGAGGCTTCATATATAGTGATTCTCTGCTTAAAGTTGCAGATCTGTAGAA
TGCTTGAACCTAGTTCAAACTCATTCCAGAGATATTTCTGCCCTCTTCCCACCTTCTTAG
GACTTAATGACTTGTGTGCTAGCCTGATCTGGAATTTCAGAGTTAACTTTTGGATTGGAT
ATTTAATTATGATCTTGGAGTTTTGCCCTAGAGGACCAACATCTGGTTCTCTGTGGCAGG
ATCCTGGCCTTCAGGAGTTGATAGGTAACCAAACACACCAGCCTCTTAACTGCAAACACT
CATCCAACCCACTGTGTTGAATTTTATTAGGCAGGCAGGAGAAAGAATCTTGAGAACCTC
TGATAAATTTTAATGTTTTTGTCTTCGATCTCTGGGAGAGTAGGAACAGGGAGGGCCTGA
AAGTTGATTTAAAATGGAGAGTGGAGCCGGTATAGTGCAGTGTTTGAGCACCTGCTTTGC
ACATATGAGGTCCCAGGTTTAATCCTTGGTACCTCCTAAAAACAAACAAAAAACAACAAC
AAAAAAAAAAAAAAAAGGAAAGAAACTTCCATTTGAAGTCACCTGGCTCCATAAGCCTCT
AGGGTTAGGAATGACATTTCAGGGCCATATGAAGTAATTTGCAGAAGAGTGGGTGTGGTC
TAAGTTGTAGATTGATGTGATAAAGCCTATTTTTTTGAACAGATGCCTTTTGCTAATGCC
AACTCCTGTTTTTGAGGCTGCTGTGGGTAAAATTGAATTGGCAGACTTCCTACCATTCTC
CCCAAGGGGAACTAGGTTATTTGTCATTGAAGAGAATATCTAATGAACGGACACATTAAT
AATGGGGTCAGTGTAGAGTTAGATAGCAGGCATTTGGGACAGAAAATGAAAGTGGATATG
AAAGGAAGAGAAAGGACTCATGACTATTCATAACTGCCACAGAAGGGTATTATTTGCATT
TCTCTCCGTAGCACTGACCTTAAATCCTCGATCTTGTGCCATTTCTTAGACCAGATCATC
AACTGGAGGCAGATTTTTTTTGTTTTGTTTTTGTTTTTTTTGCAGTTTTCTCATTTAAAT
TTATTCAGAGTCTCAGGAAAATAGAAAGAATGGAGGAAAGCTTATATTCAAACAGATAAT
GGGCAAGGACTTTGCAAACTGATAAAAGACATGAATCCACAGATCACAAGGAATAACAAT
CAGTGAATTGGATGTGGCTCAAGTGATTGAGCTCCCACTTACCACATGGGAGGTCCCTGT
TTCGGCTCCCATTGCCGTGGAGGCAGATTTTATGGGGAATTTTAAATCTAAATTCTTGTC
TTTTTCTTTGGTAAATGCTTTATTTATAAATATTTTTTTATTAGAAAAGTTTTAGGTTTA
CAGAAAAATCTTACAGAAAACACAGAGTTCCCATTTCCCACCCCCATTGTTAACATTTTG
CATTAGTATGGTATCTTTGTTACAAGTGAATGAAAGACTTATAATTGTACTGTTAACAAT
AGTCCATAGTTTACATTAGGGTATATATGTATGTATATATATATATACTTTTTTTTTTCC
TTATATACCACCCTAATATTAACACCTTGCATTAGTGTGGCTCATTTGTTACAGTTCATG
AAATCTTAATAGTACTATTGAATATAGTCCATCATTTACAATAGGGTTCACTCTTACACA
GTATTATGTTTTTTCTTTTAATTTTTATTCTAGGATCGAGGCTAGAGTCACGCTTGGGTA
TTGGCTGTTGTCTTAGTGTGCTAGAGTCCTCGAAGAGTAACTGCTGACCTTATTCACTGG
CTGTGACCCTCATGGCATAGTCAGTCACCAGATCAGTGACAAGTTATCAGATTGACCTAT
ACAGTCTGTTGTAGGACTGTGCTGAGTTTCCATAGAATGTTATCAAGTGGTTTGAATTTC
TGAACTGGATCTGCGATTTAACCTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
TCCTTTCTCTATTATATCTTTTGTGTTCTCCTCTAGGCCTCTCTCTCCTGTCTTTTTATT
TCAGGTTCTAAGTCTTCCTTTAATATTTCCTGCAAAGGTAGATTCTTTTTTGCAAGCTCT
CTTAGTTTCTACTTGTTTGTGAATATTTTATACTCACCTTCATATTTGAAGGACAATTTT
GCTGGATAAAGAATTCTTAACTGGCAGTTTTTTCTCTTCCAGTATCCTAATTCTCGACTG
GCACTTTTTCTCCTTCAGCATCTAATTGTATCATACCACTATCTTCTTGCCTTCATAGTT
TCTGAAGAGGAATCAGCAGTAGTCTTAGTGGGCATCCCTTGTATGTGATGAGCTTTGTTA
TTTTTCTGTTCAGAATTTCAAATTCTTTGTGCTCTCTCAATGTCTTCCTTTTTTTTTTTT
TAAATAAAGATTGATTTATTTATTTCTCTCCCCTTCTCTCCCTGCCTCAGTTGTCTGTTC
TCTGTGTCTGTTTGCTGTGTGTTCTTTGTTGGCTTCTGTTGTTGTCCACGGCATGGGAAT
CTGTGTTTCTTTTTGTTGTGTCATCTTGTTGTGTCAGCTCTCCGTGTGTGCGGCGCCATT
CTTGGGCAGGCTGCACTTTCTTTCGCGCTGGGTGGCTGTCCTTATGGGGCAAACTCCTTG
CAGGTGGGGCTCCCCTATGCAGGGGACACTCCTGCTTGGCAGGGCACTCCTTGTGCGCAT
CAGCACTGCGTGTGGGCCAGCTCCACCCGGGTCAAGGAGGCCTGGGGTTTGAACCGCAGA
CCTCCCATGTGGTAAACAGACACCCTAACCACTGGGCCAAGTCCACTTCCTTCAGTGTCT
TCTTGATGTCCTTTATTTCTTTAGCCATATTATCTTGCAACTCATTAATTTGATTCTAGA
AATTGTTTACATCTCATTAATTAGTTTTCTCAAATCCTGCTCCTCTGGAGTTTTGATATA
TTTCTTTTCTTGGGCTGTGTCTTCCATTTTCTTATTATGGCTCATAATTTTTTGCTGATG
TCTAGGCCTCTGATTAGGATGTAATTGACTGAGATGTTTAATTTCTTTCTCTTTTGTAGG
GATTTAGTGATGGGAAGCTGTTTTACTGCTGCTTTTTGATTCTTGCCTCTATCTAGATCA
TTAGGATTGTCCCTGCTAGTTGCTCAAAACAGGGCTCTGGATCCAGTAATTGGTTGCACA
CCTGCTTCCCAGTTGCTTGGGGAGGGAGGCTATAAAGGCTGGGAAAAAACTCTTGTTTTT
AATTTTCTCACATGTACTTCCTTGTCTGCCAGCAGATGGTGCACTTTGGCAGCCCTCTCA
GTTCATTGCCTGCTGGGGGTGTATTTGTTGAAACACAGACAAGATCAATGTGGTAGAGGT
TCCTGCCTGGAGGCTAAGAGCCTTGTAATTCCAACTTTCTCAGAGACAGTTGTCCTGCTT
TCTCTGGCAGCCCCCTCCCTCTTCTGGGGTAATACAGACGGAGATTGGGAGGGTCTGATC
TCTGTAGCCCCTTGTGGGCTCCCAAGGCCAAGAATGGCATGGGCGCACCTGACCTGGAAG
GACTCATGGGACACAGCAGACCAACTTTGTGGGTCAAAAGCTGAGTCTGCCTTAGGCTGT
GTCCCTTTCTCTCCCCTTTCTGGGTTGGTAGATCCCTGGAGTCCCCTTTGTAGCTGCAGA
CCCAGAGGCCTGAGCATTCTAAAGTGTCTTTAGTGTGGGGGAGGGTGCTGGTTTCAACTC
ACAATTCTGTCACTGTAATTCCCCTCCATTGTCCTGTTGCTTACTGTCCCCTTTTTACTA
TACTTTTCAGTTCTGGGATCTACTCTGTCTTACAGCAATTCAGTCACTGCCCCTGTTCCC
TTTTTTTTCTCATGAGGCTTTTCTGCCTCTGATGTTTTCCCCATTAGTGTATCCTGTCCC
AGGGCACCAGATAGGGCCAATCCAGAAAGGTCTGTTTTGTGTGTAGGTGGTCTGGCAAAC
ACACTGGATTGAGTGTGCACCTCTTGCCAAAGTTCTGCCATGGTGGTCTCTTTCTTTGTT
TTTTGTTTTGCCTGGGGGCACTTGTGCACTTGGGCACCTATGGCTGGATATGTGTGGAGT
TTTTATTTTTTATTTTTAATAAGGTTTATTTTTAAAAATTTATTTCTCTTCCCTTCCTCC
CTCACCCACATTGTCTGCTGTCTGTGTCATTCACTGTGTGTTCTTCTGTGTCCGCCTGCA
CCCGTGTCAGTGGCACTGGAAATCTGTGTCTCTTCTTATTGCGTCATCTTGCTGCATCAG
CTCTCTGTGTGTGTGGCACCACTACTGGGCAGGCTGCGCTTTTTTTGCACGGGGCGGCTC
TCCTTGCAGGGCACACTCCTTGCGCATGGGGCTCCCTTATGTGGGGGACACCCCTGCATG
GCGTGGCACTCCTTGTGTGCTTCAGCACTGTGGTAGACCAGCTCACCACACTGGTCAGGA
GGCCCTGGGTTTGTACCCTGTACCTCCCATGTGGTAGGCGAACGCTCTATCAGTTGAGCC
AGATCTGCTTCCTTGTGTGGGGTTTTAACTATAGAGTTGTGAGTGGCTCTGTAGTCTGGG
TCCATGGCAGGAGGGGCCTGGGCTGTACTGCCTCTGTGGACTCTCAAGCTGTGTGGGCCA
GGTAGAGGAGGAAGGGTCCAAACTCGTGGGTCTGGGACATAAATCTCCTACTTACTTGTG
GTGTTTCTTTTTCTTTGATTCAGTATTTGTGGAATCTTCTCCAGTCTCTATCGTACTCCA
GCATTCTAAGCAAGTGCGATTTATTCTTTTAGTAGTTAATTATGAGGGGAGACTTTTCCA
GGGGCTGTCTTACGTTGCCATGTTAGTGACATCCTGGATACTTACCGTTTGTTTTGATTG
TTGGGAAAGGAAGCCTTGTACCTATTTATGGTGCTGTGGTTTCTAACTTACATGTAGTGT
GTTTCCTTTTGGAAGGGAAGGGAGGATGTCATTTTGCCTGGAGATGAATTGTAGGAGAAT
ATGTTGACGAGTTGATTAGATCCTATGATAGAGCTCTGAATGCCAGGACGAAGAGTTTAG
GCTTCATCTTGTAGGTATAGGAAAGCATCTGAGGGTTTTTTTGTTTGTTTGTTTCATTTT
TGAGTTAGGAAAACTTAAAACTAGTATAAGCATGTAGGATGAATTGGAAGGAAAAGTTCT
TTAAGTCTGCATTCTTATATCCTTTTGGCAGTCTCTTCTCTTCCATTCCATATGCCTGCA
TGTGTTAATTAGAATGTTCTCTTTGGAAATTGATCAGTACTCTTTAAACCAATTTAGAAT
AATACCCCACTTTTAAAATGCCTGGTGTTATTTAGGTCTGATATTATTAACATGGTATGT
TGTCTTTTTTTTCCTCATAACTGGGAGTTTTTTTTTTTTAAGATTTCTTTCTTTCTCTCC
CTCCCTTGCCCCATTGTCTGCTCTCTGTGTCCATTTGCTATGTGTTCTTCTGTGTCAGCT
TGTATTCTCATCAGGCAGCATTGGGGATCAGTGCCTCTTTTTATTGCATCTTCTTGCTAT
GCCAGCTTTTTGTGTGTATTGTACCTCTCCTAGGGTGGACTGCAGTTTCGCATGGCGTGG
CTCTCCTTGCGCAGGGGCCATTCCTTGCATGGGGTGCACCCTTACGTGGGGACATCCCTG
CATGGGTGGGCACTACTTGTGCACAGTAGCACTGTGCATGGGCCAGCTCACTGCACGAGC
CAGGAGGCCCTGGGTATCGAACCCTTGGACCTCCTATATGGTAGGCGGACGCTCTATCTG
TCGAGCCACATCCGCTTCCCATGACTGGCAGATTTGCCCATGGTTTCAGGAAGGAACTAG
AGGTAGAAAATTGCCTTTGAAAGGTTTTTGGATCAATAGAGAACATTATAGTAGGCTTTC
AAGGGGCTTCAAAAGTAGGTATTTTTCTTCTTCCAGGAAAATTTCAAAGATCCTCAGCAG
CTGACTATCTTATAGTTAGATATCTCTAGAGGAGGACATCTGTCTCTTATTTAAAGTAAC
ATTCTAGTGTTGGTAGCCCTTCTAATTTGACTGTCCTTTTTTACCTGACTGAAAATCTCT
TTCTGCTGCTTTTTTTTTTGGGGGGGAGTGGTTTCAGGACTGAACCCGGGACCTCATATG
TGGGAAGCTGGTGCTCAGCCTCTGAGTCACATTGGCTTCCCTGAGTTTTTTTTTTTGTTT
ATTTTGCTTGTTGTTTGTTTTGTTGGGAGGCTCTGGAAACCGAACCTGGGACCTCCCATG
TGGGAGGTGGTGGGCGTGTAACTGCATGAGCCACATCCACTCCCTTCTTTCTGCTGTTTA
AAGTGCTATTTAGGAAGGGTAAAACTATCCTTCTTAAAATAAGCCTTTGATCTTGAAATA
GATTTTTAAGTCATTTCCTAATTTTGGTCTACTCTGTTCTCGTCTGTATGAAACAATTTT
GGCTTTTAAAAAAAATAGTTTTGTTTCCCCTACTTTACAAATCCAGAAGAGATTTGATTT
TGAAAGGCAAGGTGGCCTAATCTGGGAGTGTTTTTGTTTTCTCTGTTGTGGCAGCTATTA
GGCTGTGTGGACTGGGTCCTGGCATTTCTTTTGGAGTTATTCATCAGTTTTTTGCCTCCT
AATATTATCTCCCATAACTGCTTTCCAAGGAATTGGATGTTTGCCACCCTTGCCTTTGAT
AAATCTTGTTTCTAGATATCTTTCATATCCACTGCTACATCTTTACCCTCAGTATCTTAG
GTTCTCACCATTTCTCATCTAGACTACTGTTAATTCCCCTCACTGGTCTCCCAGCCTCTA
ATCGCTTTCCTTCCAGCCATCTTCTGTGTTTGCAGGCTTGATTTGATTTGCAAATCTGAT
TATGTCACTCCCTATGTGTAATTTGTCTGTTTCCCAAAGTAAAATTAATTTTTTTCCCTT
GGCCTACAGGTTCTTGGTGATTTGTCCCCATTGATATCTCCAGCTTCATCTCTGGAGAGA
TGTCAACCGCCCTTCTGTATTTTATGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTGAGCTACTAGTTATTATCTGAATACACCATAGTTTACCTTTGCTTAATT
ACCTGGAAAATTCCTTCATTTTTTTGGACTTTTCAGCTCTAGTTCTCCTTCCCTTTGGTA
AGTCTTCCCTGACTTCCAGCAGATTTAGGTCCTTTTTCTCCTATATTTCTGCTTCACCTT
GTGTGTATGCATGTGAAATGGCACTTTCATATTATGCTGTATTTGTTTGCATGTCTGTCT
TCTCTCTGGTAGGTGAGCTACCTAAGGGTTGTCTTTTCATCTCTGCATCTTCATTGCTTA
ACACTGTATATGTTAAATTGTGTGCATGTATGTAACAATTTAAGAAGTACTGAGCAATTA
TGTGCCAGGTTCCCTGCCACAGTTGTGGGTATTCAGCTGTGAAACATACATATAATATGG
AATTTATAATCCAGTGGGAGATATAGACTGGTAAATATGTGTGTAGTGCGCTGATGAAAA
GTAATGGCCAGGATCGGAGCACAAATCTCAAATGGGCACTCAGCCCTGTCCACTAGTCTT
ACAATACTTTCCTAATATGTTTGCATTCCCAATATATGTTTCATAACTTCTCATTCTAGC
CTGTATTTCCGTTTTCTCTTTTCTCAGTTGATGTTCTTAGTTTATTCTTTCATTTAAAAA
ATGGAAGTAAACAAGCATCCCTTCATATTCCCACTACTGAGTCAGCAACCTATCTGCCCC
TACCCATACTCTTTGACTTATTTCCTCTTTTGGTGGATGATAAGTCCCTTCCTGTCAAAG
GCCAGCTCCTTCACTTGTGCAGGGATCCAGTCTTCTCTTCCTTTCTCAAGGACTCAGCTC
CTGCAATTATCTTCGATTCAGCATCTGTAAGTTCTTTCTCTCTACTGAATCATTCCTGTT
ATTGTACAAACATGCTCAGATATCATCCAATAAAAAAAAACAAACAACAAATTCCTTTGA
CCTCAGGTACCCCTCCAGCTACGATCCTATTTCTTCTCCTTCATCAACAAGGTTTCTTTA
AAGAATAGTCTAGTTGTAGTTTGCATTTTCTCACTTTCCAGTCATTCCTTAAGTCCCTCT
TGTTGGTGGTCTCTCCTTATCAATTCCCTAAAACTATTGTTGCCATCTGGCCAAATGTAA
CGATCATCTTTTACCTCACCCTGCCTGACCACTTAGCATTGAACACAGTTGACTCTGTCC
TTCTGTGTGGAATACGTTCTTCTCTAAGCTTTTGTGATATAATACTCTCCTGGTTGTTCT
TTTAAAAAAAATTTTAAAACAGTTTATTTATTCCCCTCCCCCCATGTCTCCCTCGTCTGC
CTGCTTGTTGTCTGTTTGTTTCTTCTCTAGGAGGCACCAGGAACCAAACTCAGGTCCTCC
CATGTGGGAGAAAGGCACCCAACAGCCTGAGCCATATATGCTCCCTTGGTTGTTCCTTCT
TACTGTTTGTGCTTGTGCTTTTCTGTTCTAGGGCCTGGTTCCAGACCCTTTCAGTTCTCT
GCCTTTCTTTCCATGGGTGACTTTAAATAATGCCTTTATATCTACATCTGCACATAGTTA
TATTTTAGAATATAACTATTCTAAAATTTGGTCCCCAAATTCTAGATTAGTTAACCACTT
GACAGTTTGACATCTCCACTTGATATCTAAAACCACTGTCAATGTAACATGTCCCGAATG
AACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATTTTACTTCTCTCCCCCAA
ACCCTGAAATGTTACAAGTAGAGAGGGAGAACTAAATCCAAATGCTTTCTTAGACTTACA
ATACCCCACAGAATTTGCCCCTTGCCTCCCTCTTTTTTTTTTTTAAAGATTTATTTATTA
TTTATTTCTCTCCCCTTCCCCCCCACCCTGTTTGTCTGTTCTCTGTGTCCATTTGCTGCA
TCCTCCCTGTCCGCTTCTGTTTTGAGTGGCACGGGAATCTATGTTTCCTTTTGTTGCATC
ATCTTGCTGTGTCAGCTCTCCATGTGCACGGCACCATTCCTGGGCAGGCTGCACTTTCTT
TCACGCTGGGCGGCTCTCCCTACGGGGCGTACCCCCTGCGCGTGGGGCTTCCCTATGCCG
GAGACACCCCTGCGTGGCAGGGCACTCCCCGCATGCACTAGCACTGCGCATGGGCCAGCT
GCACACGGGTCAAGGAGGCCCGGGGTTTGAACCACGGACCTCCCATGTGGTAGACGGACG
CCCTAACCACCGGGCCAAGTCTGCTGTCCCCTTGCCTCCCTCTTGCTCGTTATCACTATA
GGTTGGTTGCTCTGACCTTCTTGTTTTATGTAGACTGCTCTGCTACCTAGAATATTCTAT
CCCAAGATCTTTATATGGTTGGCTCCACATCATTCAGATATTAGTCTTAAATAGCACCTT
TTTTACAGAGACCTTCCATGATCACCAAATCAAAGGTAACTTCCTCATTCACTTCCTGGC
ACCCTGTTTTTCATTGCATATGTTACTACCTGATATTTCCTTGTTTATTATTCGACATAC
ATTTCTCTCCATAGGAGTATGAGTTCCTGGAAGCTAGAATCTTGTGCATCTTGCTCTGTG
CCATATTCCCAGTACTTGGAACAAAGCATGGCACATAGTAGGTGCTCAGTAAATATTTTG
CTGAATGAACATTTAAGGAAATAGATTCAATTAGAACTGCTAAAACAGAATGGGCTATCT
CAGGATGTAGTAAATTTCCATCTTTGCAAGTGCTCAGGGAGAGACTGTTCATTTGTGCAG
AAACTTTTCAGCAATTATTCTTGACTTTTCTGTATCCCAGGGCAACAGAGGGATATGACA
CACCCGGATCAGTAACATAGGCACTGGAAGGTTTGTAATTCTCTCTTTCTCCACCCAAAG
GTGGCTTATCAGATTCTGTAGGTGGTGAATATACTTTGGAAAGCTTCCCAGTGATTCATA
TAGCCTGCGCCAGCACAAGATCCTCCCCTTTTAGGAATTTTATGCATCAAATGGGGTTTA
TTTAGTCTTATGGCTTTCCAAGGTCCTTTCAATCTCTGTGGGATTCTTGGTGCTTATGTT
GTCATTGGAAAGACCTTGGGTTACTGTGGTCATGATAATGATAGCACATTAATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATACATTGGT
TCACAGATAGATGTTTCTTTATTTACTTTTTGCCCTTATCATTTCTAGAGATTTACAGCA
AGATTCTTAACAAGGGGTCTGTGAGCTTGAATTGAAATTCAGAAAAACATTATTCTTATG
GGGACATGTTGGTGTGGGTTTGATATGTTTATTAAATAATACACAGTATAGTGTGGACTT
AGTAAGGTTTTCACCTGACTGGCAAAGGGGTCTGTGGAACAAAAAAGGTTAAGAACCTCC
TGTTGTAAAGGTTGGTTGGGGTTTTTTGTTTTTTTTTTAAAATAGTTTTGCTACTAGAGA
GCAGGTTAGTGGAGATCCCCCTAACAGAGGTTGATCCTAGCTGGATTAACTTGGAAGAAG
ATTTTAAATATCAAACTCCCACCCCTCCTTTTTTTTTTCTTTTTTTTTTTTTTTTAACAG
TAGAGCTCTTTATTTCCAAACTTTTACTTAGAATTCCAGTATATAAAACAAATAGATGAG
CAGCTGGAGCGGTTTTGTTTGATGGATATTGGAAAACCCCTTTTGCTTGGCCTCCCCTTG
ATGTGTGGGACATCCTCCCCTCCCGTATCCCCTACCCCCTGCCTCTACCACAGCACCTTC
ATAGAATCCTAATGCACTAAGAAGAAAAGGGGTGACTTACAACTGTGTGTCTATATATGA
GAAAACAGGCTCAAAGAGGTCCAGGCCATATAGCTACGCAGTTACCAAGGAGTGCCTTAG
TCCAGTAGTACTCTTGACCAGTGCTCCTTCTAATAACCCACCCAGCTTACCGATGAATGA
GTGTACTACTCCTTGCACTATAAAAATTTAGTGTTTCTCTTACTGGATGGTAGAAAGGAG
CATCTTAGGAAATGCCTTCATTATTGGGGAAGAATAAATACCCTAGGACCAGCCCGTCTC
TATCACTGCTGGGAAAGCTATCATTTTTGCGCTAATCAGCAGAAATCTTTAACACAAGAG
TTGGAGCACCTCATGCAAGGTATATACAATAACAAGATGATTACAGTATTTCAGCTTCTG
ACATGAATTAACCTTTTTCTTTAAAAAAATTTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGATCATTTTTGTATTTTGCTCTACACAGTTTGTCT
GAGATACAGATCAACCCCACAGAACAAAGCGGATTTCCCAAGGAATCTCCCCCGAGCGTG
CCTTTGCTGATTTTCTCTTTGCCCAGCACCATCTTACATCTTGTTGTCATGAATTTTGTT
GGCTGAATCGTTCCCATTTACTCAATTGAGGAGTAGGAGACAAAAATGTAAGTTTTAATC
ATAGTCCTTGTCCCATAGTGTTGATTTTAGGAAGAGATATTGAATGGGGCTGTTTTTGAC
CATGGTTGCCAGAGTTCTCATATTGCTGATGGGATGTTGGCAGAATTTTCTAATGTTCTG
CAAAATATGCATTAATATCATAATGATTCATCAGGTTACCTCTGCTTCTGGTCGTTGTTT
TGTCTTCTCACTGTTCTGCAAATCATTAATATAACAGAAAATGAGTGTTTGTCTGCAGCT
AAAGCATTATTTCTGCAATAACTCCACAAAAACAATTCAGAGATCTTGCAGAAGTAAACT
GTCGGTTTTTCCTTAAGATTTAGTACAATTTTTTCCTGACTTTGATCTCAGATGACTAGA
AATGCTGAATCATAGTCCCCGTAGTTCTTAGCATAGTGCCTTTAACCCACTAGGCATCCA
GTATATGTTGAATGAATAACTGGCTATTTGCTAATATGTGTCCTAAAGTAGAAATAAGTG
GAAACTTGGATTAACTTACTCTCAGGCAGTTTCTGGTGCTCGCTGTTTTATCTAGTTTAT
GGGTCATAGATAACTGTTTCTTTGCATGCCTTGTAATTTTTTGTTGAAAACAGGTGTATT
AGTCAGGGTTCTTTTGGGACACAGAATCAACACAAGATATCTGTAAATAGTATGAGAAAT
TATAAGATTCTCTCATGTGACTGGGGATGCACAAGTCCAGGTTCCACAGGGAGGCTGCAA
ACCAGGCGCTTCACGTAAAGTCCAGTGAAGGTCCTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 31193..31203, 31206..31216, 31218..31237, 31239..31282, 31284..31325
1001..1211, 31193..31203, 31206..31216, 31218..31237, 31239..31282, 31284..31322
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved