Dasypus_novemcinctus Locus DKC1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus DKC1
Dasypus_novemcinctus
DKC1
GeneScaffold_3013
SNORA36, SNORA56
5858..5990, 10438..10566
12639
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGGCGGAGTGCCCTCGGCAATAACGGGAGGACCGCT
CTGTGGGGTGCGGGGAGCCGGGGGAACGAGGTCGGACTCGCTGCCGGGCCTTGCCGCTCT
TCCGTCCCTGTGCTGCACCCGCGGAGAGCACGAGACCTAGAGGCCCTCGCGGGGACGTGG
CGCCGCGGGGCCCGGGCCTCCCGCCGACGGTAAAAGCTCCCTAGGGCCCGCATCGCAATC
GAAAGGCGGCGCCAGCGGCGCGGCGGTGGCGGGAGCCCGGGGAGGACGAGTGTCGGCGCC
GCGCGGAGGGAGCAGGAGGGGGTGGGGTCGGTGGGGAAGAAGGAACGTTAGGTGCGCGGG
AACCTGCCTAGCGCCCAGTTGCAAGAAAGTCTCGGAGGCCACACACCGGTGGGGATAGTG
AGTGGGCGCTGGGGAAGTAGTGGCCGTCCAGCCGAGAGGTTCTGCAGGTTTTCTAAGCCC
CGCCACGGCCACGTGGTGAACCGGAAGGGGAGCCAACATGTGCGACAGCCTCCAGTTGGT
TCCCCTTCCGTGGGGAGAATTGGTTGATTTTACGGGCTTTGTTTTCAACAGAACTTTAAG
ACTGAAAATCTCTATTGGCCTGTCCTGATTTCCGTCTTTATTTTCAATTTCGTTGTCTTT
ATTTTGGGGAAAACTTCCAACTCTCGTCTATGTTTTTAGTAGTTATCTTGCCGAAGAAGC
ATAAGAAGAAGAAAGACCGAAAGTCACTAGCAGAAGAAGATGTAGCCGTGAGTAGGAGTA
TATTTGGTTTACCTAAAAAGTGACTTAACTAACAAAGTAAAGAAGAAAACTTTTTTAAAG
ACACCTTAGAAACTGGCCAGAGTTGGGTGGGCATTGCATAGAAATTACAAAGCACTAAAA
ATGAAACCACCTCGCCCTGTCCCTCAGCCAGCCTAAGTTTCTCATACTGGGAGATAGTTT
ACTATACCACATTATCTCCCTGATATTCTGTCTTCCCAATTCCACCCACAAACGGCCCAT
CCCCCCCTTTCTCTTTTCTCTTTAGAAGATGTGAACCAGTCTTAGTGGCACTTCATTTCC
CCTTCTGAGCTCCTAGGCATAGAATCGAATGCCTTGCCCTTGTTTTCTTTTTAAAGGGCA
AACTCGTCTGTAATGGTAATGGAGTTGCTAAAAATCAGGTGAGAAATCTAATAGAGAGTG
TTTCTGTCCTGTCAAAGGAAATTCAGCACATTGAAGAATTTCTTATCAAACCTGAATCCA
AAGTGGCTCAGTTGGACACATCTCAGTGGCCCCTGTTGTTGAAGGTATGAGGTTGAAATC
AGTATCGGGTAACTGCCTGACTGTACATTATTTCCGAATGTTAAGCATTTTTTTTATAAG
TTTTACAAATGGTTAAATGGGCACCAGTATAAGTTTAGAAGAAAAAGACTAGCAGGTTAC
TGAGACACCTTTTGACAAAGAGTTTTAATAAACCAGTTTATTTGGGTTAAAGGGTGAGAT
TTGCATATATAATTCTACACAGTTGAGTTTCTGCTTAGCAGATTTAGACATCTGCTTTTC
TGTTGTTAGCCCTGGGGGAACTAAAAATTGAGGGGTGGGAGATAAGAAATTAAAAAATAA
CTGTTGTTGGTCATAAGGCCATAATGAAACTAAATTTGGTGATGTAAAAGATGGACTTGG
AAGTTTATGAACTTTGACAGTTACCATATCGTTGTTGCTTGTTGATGCTGATTCTTTGTT
TTATATGTGTTAATGGTTCGAAAACAGGGACTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACTACAAGTGTGTAGGAATGGTTATAGAGAATTCTA
TTATGTTTTTAAAACTAGATGCTAGGATGGTTTATAAATGGGATTGTGACTGAAAAAGGT
AGTCTGGGGAAGTAAACGTCAGTAGAAGGAAAGCTAAAGAATAATGTAGGGACTGAATAA
CACAGTGAACCCAGAGGCAGTGGAGAATTGCTGTTAAGGGTACAAATGCAAGAGTCCTTC
TGTGAGCTAGAGCAGATGTACATCACTGTTTCAGGGTGATGGGAATATGGAGAAGCATGG
GAAAGCTGCATTTGGTCTGAACTTTAGACTGTGGTTAACAGTAATACTATAATAGTCTTG
CATCAATGTCAAAGCTGTACTGTGTTGATAATGGAGGTGTATGGAAAAAGTGTGCCAAAT
GTATGCTATGGACCATGATTGCTGGTAATAGTCTGATGATAATATCTCATAATCTGTAAC
AAAGTTTCCACCAGGGCGTGGAGTTATATGGGAAATCTACACATCTGTATAATTGTTTTG
CAAGTTCACAATATCTGTAACAAAAATATATTAAAAAAAAAGATAGTATGGGTTGGGGGA
AAAATACACCAAATGTAAGATAAGGAATAGTAATATTTTGATGATGCTCTTGCATAGTTT
ATAACAAATGTTTCATAACAATGCAAAGAATTGGTGGAGGGGTGATGTATGAGACCCCTA
TGTGATGTTATGTATGTTTATTTCGTAAGTTCACAATTTTTACACTTATTGTGTATGCAT
GTTCATGTATGAAATTACTTCAATAAAAAAATTGAAATAAAGATCTAGGGAGCTGGTGTA
GCTCAATGGTTGAGTGCCTGCATGTCATATACAAGGTCCCAGGTTTGGTCTCCTGTGCCT
CCTTAATAAATAAAAAATTGATAATAAAAGAAAAAAAAGTAATTAAAAAAAAGACGCTGC
TAGCTTGTTGTGTAGCATAGTTAATGCCTTTGTTATCACTAGACTCGATGGCTCAGGTGG
ACAAGTGATGTGTTTACTTTGGAAAATAATATGCTTTATTTTGTGTGTGTTTTAGGAATC
TTTTGGGTAAGTTGTGAGGCTGGCACCTACATTCGGACGCTGTGTGTGCACCTTGGTCTG
CTACTGGGAGTTGGAGGACAGATGCAGGAACTTCGGAGGGTTCGTTCTGGGGTTATGAGT
GAAAAGGTATGCTATTACGGTGCTGGAAGTTTTAGAACTGGTTGTTACCATATCTCCTTG
GTAGACCTCTACTTGTTTAACATCCTGGACAGGGTGATTTCCAAAGTGTTGAGTTCAGTT
CAGGGCAACTTCTCTGTTCTGTTAATTAAACTTTGGGAAATTGAAATGGGCTAGGGTAAG
TGTTTGGATAGAAAAGTACTGTTCTATTCATTTATGTCCTGGCCTACAAAATGTCTGCTT
AGATTTACTACCTCAGTGATTAAAGATCTTCAGAAGAAGATGAGTATTTTAAGTGACTGA
AGACTAATGATCTTGGACAAAACAAGTTGTATCATTCAGTTTTTGAAATTTTGGGTCCAG
TTGGCTATGGGATAAAGTGATATTGAATTGTTTTCGTATGTGGCTGCTTTTCCAGGACCA
CATGGTGACTATGCATGATGTGCTAGATGCGCAGTGGCTATATGATAATCACAAGGACGA
GAGTTACCTGCGGCGAGTTATATACCCGTTGGAAAAGCTGCTGACATCTCATAAACGGCT
GGTTATGAAAGACAGTGCGGTAAATTCTGAATTGGAAGTTCATCTTTGGACAAAATGTGA
CTTCAGAGAATGAGATGTCCTTGTTTAACTGAAAACCTCATTATATTTCAAGAGATCATA
CTTTGATAAGTTTATTATTTTCTTTTGGACTTAGTTTTGTTTCTCCTGGCTTAAGTTGAA
TGCTAGATTCTTTTATTCTTTGTTAATAGGAGCATTTATGACTGAAAAAATTACTCGAAA
CATAATATACTAATTTAAAATAAAAGTGTAGTTTTAGGCCTAATTCCATTTCAAAATGTA
GGCTATCTCCCAAAGCCAGTAGCTTGGTTCATGTAAAAGACTATCAGAGCCACTTAATTG
TGATCTCCTATAACCTGGTAGTTCTACATGTGCCTAAGAAACCTTGACTTATTTAAATTA
CATTAGAAAAATAGTATCCATGGGGGGGGGGGGGGAGAATTGGGACTAGTGTTTCAGAGC
TATAACAAAGTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGG
CTATACAACCTGACCTTCAAGCTGAGCTTATCTAGCCTATTTACATTAAGCTTTAAAGCT
GAGAGCAGTCCTGAATGTGAATAATACCATGTAGCTGAAAAAATTTTCTACTTGGATATA
AGCAGCTGTATATATTTGGGGTTGGTGGTTATTCATAATCAAATCTTAGATTATACACAC
ACTTGATGTATTTTTGTGTGTTACAGTCTGTAGTAAAAGACAAAAATCCAAGATATGCTA
AAACATCCCACTATAAAGAATGAAAATGGTGAATAACATAAATCTTTACTCCCCTTATCC
TGGGGTCATATGGTATACGCTTCTGGATGAATTTAAGGGAAGGGTAGAATATGGTCAGCA
AAAGAAACTAGGATAGGCATAAGGCATTGAGTGCATTAGGTGCCTTTGAACACAACAGGT
ATTGCTGAGAGGTGGCCTGGAGTTGTACCTTGACCTATAAATTACATGCGAAAACTTTTC
CGTGATTGGTTCAACAGGCCTTGTTAATCTTGCTTGTAATTACTGTTGGGGCCTGCTATT
ACTCAGATCTCCCAATAAATCTAATAGGTCTCCTAGTTCTATTGGGTTTGTCTTTTTCCT
TGATGCTGGGGAATAAAGGAGCAATTAAGGAAAACTAAGGCTGAGTTGTATAAAGTAAAA
ACACCTTTCAGCTCCATGGGAAGAATGTATAATCTTAAAACCTTGACTGCATAATTTATT
GGAGAAGAATGTTAATGAGGAAATCATTATTTTTTAGCAACTAAAATGTCTGGGACATAA
GAGAAGCACAGCTGATTTTAGTCAAGTCCTCTGTCTTTTTATTTTTTGAGTTAATGTATG
TAAAGTGCTTAGAGCAGTGCCTAGCACGTAGTATGTTGGCCTACTGTTTTAAATCCTTTC
ATAGTACTCGGTTCAGTGAGCTCTTGCTCTGTAGGTCCTCATAGTCCCATTTCACAGGTG
GAAGAGAAGGATGCCCTTAGACCCTCACTTCCCCTTTGTTTTCATTCGTTCTGACTTGGG
AGAGGGATGGAGGATATCAGAAGCTCCTGGGGGGCTTGTCAAAACAAAATGGCTGGGCCC
TACTCCCCTGCGTTTCTAATACAGTGGATCCGAGGTAGAGCTCAGGAGTTTGAATCTTTT
AACAAGTTCCCAGGGGATACTGTTACTGGTCTGGGGACCCCACTTTGAGAACCAAGGGTC
TTTTCGGAACATGTTGGGCCTTGATTGGTCCTTAGTCGGTTAGTGTTTGAATAAATTGGT
GACAGAACTAAGATTGGCCCTCATCTCTGCAGGTGAATGCAATCTGCTATGGAGCCAAGA
TTATGCTTCCAGGTGTTCTTCGATATGAAGATGGCATTGAAGTCAATCAAGAGATTGTGG
TCATCACCACCAAAGGGGAAGCCATTTGTATGGGTAAGAAAAGGGAGACAGTTCTTGAGC
TGGGCTCCATTCAGACCATCACAGCGAGAATTGCTGGGAGCAGGTTACCCGATTCCCAAT
TATTGACTAGACCTAATCATGGTTTTTCTGGAGTCTGAGTTCTCACAGTGAAGGGAAATG
TCAGGTACAAGTGGGAAAGTTAAGTGGGGTTTCAGTTTGCACACCACTTAGGATTCTAGG
TGGCTGCATTAGAGGTCATTTCTCTGATGAGTAAAGACAGGTAAGGTGAAGAGTAATAGC
TGGTTGTGGATGGGAGTCAAAATGAAGAGCTTTTAATCCATTCCTTGTCTGCTTGCCACA
GTTAATGGTAAAATCTGGTTTCTTACGAGCTAATATTGAAAGCTTTGCATCCTTTATGGA
CCTGAGGGGTTTGTGCCTGCCATTCCTTGTACTTGTCCTGAGTCACAATCCTGACATGTA
TTTCTTTAGGGTACACTGTTTTGGTGTTCTCTTCCCCTCTGGCTGCTGTCAGTGGGACTG
GAACCGACCCTCTGTGGTTGTCCTGCCTGCTTGCAGACCCGAGAGAATAAATCCTGGTGG
CATGCTTTATTTCTGGTGCAAATTAGGCCCATTAGAAGAGTAATGCCGATTTATTCATTA
AGATGTTTCCTGAAGACCTAGGAAGCATTGACTTTTATTAGTATGGTTGGTACTGGTATC
TTTTAACTTCATAATTTTAGCATTTCTAAGATTTTCTTCCCATAATTGAGGATATTCTGC
CAGGATGCAGCTTTTGCTGTGCTTATACATAAACTGAGCTAAGGAAACCTCAGTTAAGGC
AGCAGAACTCAAAGAGTTTTAAATGAGTTTTAAAGCAGATTTTGGGTCTTTGCACTTCAG
TTTGTTCTTTTCTCTCTTTTCTTAGCTATTGCATTAATGACCACAGCAGTAATCTCTACC
TGTGACCATGGTATAGTAGCTAAGATCAAAAGAGTGATCATGGAGAGAGATACTTACCCT
CGGAAGTGGGGTTTAGGTCCGAAGGTAAGTGGAATTGGGTAATGTGCTCTGCTGTATTTT
ATTTTGCATTTTTGATTACTTAAGTTGAGCAGCTCTTGGTGTAACCCCATCATCATTTAT
TTCACTAGGCTTTGGGGCATCAATGGTGAGTGGAAACAGGTCCCTTTTGGGACCTTAAGA
GATTTCAGTCTAATGAGAGGAGAGCCATTACTCAATCACACAGTGAAATGCTGAATTTCC
ATTAAGAGCTAAAGGAGTGCACAGAGGTTCACGGTGCCCTGAGAACCCACAGTGAGAGCT
TTTACCTAGTGGGGGAGGTGTCTGGGGTAATGATCTTCTCTTAAAACTGTGCCAGTGTGG
AGGGTGGGTTAGATGCTGATAATGTGAAGAGGGAGGGAGTTGTAGGCAGTTGGAATGGAA
CAGCGTGTGCAAAGGCCCTGTGGTTGGCTGGAGTGGGGTACACAGTGTCTGCAGAAAGTG
GTAGGTGAAATTTCTTTGGAGAATATAATGTTGTAAGGTTAATTATTGGTTGGTTTAGTA
GAAAATATGGGACTAAGTTTGGACACCTTAAATCCTGGTTCTGGTTCTCACTAATACAAT
AAGCTGTGACCTTAGATGAGTCATAATTGCTCATGCTGGAGATAGTGGGTGAATTCTGAA
TGTTCTTCAGAGGATTCTGAGGCCCAGGTGAGAATAGGCCTGGAAGGAGCATTGTGCACC
TCCTTGTAGATGAGGTCTGTTGAAGCCATGTGCATGTGTTAATACTTGCCTGCTTCCTGT
TTTCACTTTGTTCTTTCCATCAAGGCAAGTCAGAAGAAGATGATGATCAAGCAGGGCCTT
CTGGATAAGCATGGCAAGCCCACAGATAGCACACCTACTGCTTGGATGCAGGAATACGTT
GACTACAGGTGATGACAGTAGATTGCAAAGCTGAGGGGGAGGGGGAGATTTTGTTTGGGG
AAGCCTTGGAAAATGCAAGACCATAGTACTTGGAATTGGGTGTTGGATAAGTAGCCTTAG
TTTTCCTTGCTCAGCTCCTATGAAACTGCTGGACTATATGAAAACCTTGAGACTCTGTAG
GTTTTTGGCAGCAGGGCCCCTCTTGTCGGCCTGGGTCAGTTAGGGATTCAGGCCGACATA
GCAGACAGTTATCCCTTTCTAGTCTGGCTCACGGGACTCTAGAGGGAGTCAGTCTGCAAC
ATTAAGTGGTGAGTTTTTCTGTCCAGCGTCAGTATTTTGATGGTGGCTTTAGACTTACCA
GATATCACCCACTAATTGAGGATACAACTTTATCTTTGCGGAGAGCCATTCAGTGAATTT
GACTCTGTTACCTCTTCTCTTTTAGTGATACTTCGAAGAGAGAAGCGGTTGCTGAAGCAG
TAAAAGCCCCACAGGTAGTTGCTGAAGCAGCAAAAGCCCCGAAGGTGAGTGGTATGTTGT
GATCAGTTAAGAATGTGCTTATCATTGGCTTGTCTTGGTGACTGCATTCCAGCAGGATGA
TGTCTGGGCTCTTGGAATTTATGTTCCCTATTGTGTCTGCTGGGAGGAGGGGGTGGACTC
TAACCCATCTTAGCTGAGGCAAGAGAAGAAAGGTATACAGCATTTGAACAGAATGTGGGT
GGTGTAAATTCTACTCTGTCCCCTCCTCTGGGTCCAGCAGCATAGGTATGTTTTAAGGTC
CTGCAGATCACTTAAAGTAAGAGGTCGTAGCATATCGTAGTTTATGTCAGGGGATGGGGG
GAGGCCATGTAAAACTCATCAGGGAGCAGAATCTCCAAAAGATGGCAAATCTCTCAAGAG
TCAAAGTAAAACATGTTGACAGCTCAGCTCCCTGGGGTTGGGGACCGCTGGCGGTTGAGC
ACTTAAGAATCCTTGAGTATGGAGGGTTGTACTAAGTGGCCGGAAACAAGCTGTTGGGGT
AGGGACTGGTAAGTTCTAGGTTGGTGTTCAAGTCCTTTAGTTTCTCCTGGCCTGTCACAT
GTGACATCCTGGTCTACCTGCCTACTTTTGTTGAAGATTCACAGAACTTAGAGCTGGGAC
ACTCCTACTAGAGGTCATGTATTTCAAACCCTTCCCTCAGAATGCGCTTGCTCAGGGTCT
TTGAGTAACAGCCTGGCACTGCTGTTTTGGTGGTGCTCCTGTACCACACAACTTCTTGGG
GCTTATTGGATAAGATGCCTTTCAGGTACTCAGTAAACACAGTTACTGATGAGGAAAATT
GTTCCTGTGGGATTTAGTTGGGCTCTTTCTTGGGTACTTCCTCATTTTTGACTTATTGTC
CAAGATGTAATTTCTCATTAATTGTCTTCATCTTAGCGGAAGCGAGAGAGTGAAAGTGAG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 1517..1603, 2944..3035, 3136..3320, 3421..3485, 3586..3712, 5635..5765, 6175..6318, 8192..8312, 9205..9323, 10104..10207, 10645..10723, 11616..11639
1001..1066, 1517..1603, 2944..3035, 3136..3320, 3421..3485, 3586..3712, 5635..5765, 6175..6318, 8192..8312, 9205..9323, 10104..10207, 10645..10723, 11616..11639
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved