Dasypus_novemcinctus Locus GLTSCR2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus GLTSCR2
Dasypus_novemcinctus
GLTSCR2
scaffold_52625
SNORD23
8680..8789
9486
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTCACGGACGAAGTCT
GTGGGAGCGAGGCAGTAGCAGGAGCAACGCTTGAGTGCCAGGCACAGTCTCCCGCGCCTA
ACGTCGACCACCACATTTAACCTTCGCAATAATCGTGTGAAGTAGAGGCGTCAGCACCCC
CGAAGTACAGATGAGGAAACTGAGGCACAGCCAAGTTACGGAAATTGCACTTCTAGGGTT
TCCACTAGCCTACGTTTGTAAACATTCCTCCAACCTTACGTACTGTGCCTCCAGCCTCGA
CATTCCTAGCGTTCTTTGATTCCCAGGATGTAAGGCTTGGTGCATTTCGAGAGGCCAGAT
GTTCCTTGATTGGAACGCGTCTCGTGCCGAATCTGCCACTAATGATTCGGTTTTTCCTTT
TTAAGAAAACGAGAATAAAAAATAATAACCCTCAAAAACAAAAACAGCCCTCTTGAGCAA
AGACCTCGGGTCGCTAGGAAAGGTGTTTTGTTTAGGGCGAGAGCCGAGGACCTAGAATCC
GCGGCCGCCACAACTCTGCAGGTTCTGCAGCGCAGACTCGAGGGAGGAGGAGCCATTTAG
CCCTTACCAAGATGGCAGCCTCCTCGCCCCTTCGCCGCTCCAGCCACCGTACCAAGATGG
CGGATGCAGGAAATACGTCACTGAAGAAGGCGGGAGACCTGCGCGCGCAGACCCCAAACG
GGAATTCTGGGCGCCGGAAAGAGAACTCTTTCTTTGACAAGATGGCGGCGGGAAGCAGTG
GCGGCGGTGGGAGGCCGTGCCCGAAAAGCGCGGCCGATTCGGGCTTTCTGGGGCTGCGGC
CCACTTCGGTGGACCCGGCGCTGAGGCGGCGCCGCCGAGGCCCGAGAAACAGAAAGCGGG
GCTGGCGGCGGCTCGCGGAGGAGCCGCTGGGGCTGGAAGTAGACCAGTTCCTGGAGGACG
TGCGGCTACAGGAGCGCACGAGCGGGTGCGTGGGGCGGGATTTCCGGGTGCGCGGCCGGG
AGTGGGGGCACGTGTGTCTGGGAAAATTGGGGGAGGGAGGCAGGACGCGTTTGTGTTACG
ATACCTGTTGTGTGCAACTTATTTCTACTAAGAAGATGTTTGTTATTGAAAATTCAGAGT
GTTCTGTAGTTTTATCTGGCAGCACTAGCTTGGGGAGTTTGAAGTTTTAGGTACTGGTAA
ACTGAGAAGTCAGGTTTTAGTACGGAAGGGTCCCTTGGTGGAAAGAGGGCAGGGCCCAAC
GGGTTAAATCTGATCCTTCCCAAAAGTCTCTGCCTGACGTTCTGCATTTCCGTCTCCAGT
GGCTTGGTGTCAGAGGCTCCCAATGAAAAACTGTTTTTCGTGGATACTGGCCCAAAGGAG
AAAGGTGAGGAGGGGGTTTTGTGGTACCCTTAAAGTAATATTTCCTTATGTAGAATCGCC
AGCCTCGGAGGACATCTGTATGAATAACCTAACTTGGAAGAATCTATTTAGTCACTTGCC
GAGGCATTTTTTCTCTAATATAATTAATATGGTCTCCAATGAGCAGAAAGTACGTTAAAG
GCTGACTTAAAGAAATCAGATTTTCTGGAGCCTTAGAGATTTCAGTGCACATTTAAACCA
GGCAGCGGTCTCCTGAGATGAGTAGGCTAGAAAGCGAGTCTGCAGTTAACTTGCAGAATA
AGGTTAAGAACCCGCTTTGAAGAATCAGGTCCTTTATCCTTACAAGGTATTTCCTTTAAT
GGAAAAAAAAAATCTATTTTAATGAATAGGTAAGAAACTAGTCTTAGCTTGCCTGTTTTG
ATTTGCCAAATAGCAACACCAGGATCTGATGAAACAAGTGGGCCTGCAGTGAGTCAGGGA
TTGCTTCATTGAGTAATAGGATTTATGTAAGATGTAGAAGAAGAAATAGAAAAAGCCATC
TGCCATAAGGAGGGGTTAGAAAGCGAGCTAAGGGTCATTTCTGGACTTTCTAGTTAAGTT
CTCCCAACCGTTCTATGGGGGGGAGTAGGTATTCGTATTCTCATTTTGAGGCATAGGGGA
GCAATCCCTTACACGAGATCCTCTGGGCTATAGAGGGGTAAGGATTCAGGCCTAGTATGT
TTCGTTCCAGAGTCCTTGCTTTTAGCCCTTAGGCTTTGGAAGTATAAGGGAGAGAATGCT
GTGCTGGAAATCAGCCATCCTGGATCCTAAGTCCAGTTCTCTTTCGTTTCCCACCCAGCC
TGTGGGCCTCAGTGTCACCTGACAGCTTGCTGTCTATCTGTTTAAATGTTGTGGGTCCCT
CCTGCGGCCTTTCCCCGCTGCATCTGGGAGCCCCACATGTGCAGGCCACGGCTCTGACCC
CCTCTGTGTCCCCAGCAAAGGACCTCCCTCCTGCTGGTCCAGAATGCAGGTGGGGTGGAG
GGCAGTGCTCGGGCACCCTTGGCCCTTCCCTTGGGGGGGCCTCTTCTGTCAGGCGGGAGC
TGGGATCAACCTGGAGATGTCCAGGTGTGCCCTGGGCTGCAGGTTCGATGGCATCAGTAG
AGGGGGGTGTCTCCAGCACTGGGGAGGCTTGAGGCCTTGACTCCTCTCCTTTCTCTCACT
CTCAGAGCGCAAGAAAAGGACTCAAAGGCCAGAAGAAGTCACTGCTCCTCAAGAAACCTC
TGCGGGTTGATCTCATCCTTGAAAACACATCTAAGATCCCTGCTCTAAAGAGTGAGTGTC
CCGTTACTCCAGACCCTGCTGTCTCACCAGCCCCATGCCCTTCTCTGTAGCAGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
ACAGTGAGTGACCCCACTCTCACCAGTGAGGAAGAGAACAGGGACACCTGTGCAGTTGTG
TGCGTGGTGCACTGCACAGAAGCACCATGTCTGAGGGGTTCTGTGGGTGTGACTTCAGCT
GTCTCACAGTGGTGTTGAGTTTCCTCAGTGGTTAGGGCACCTGCCCCTCAGCCTGACTCT
CCCTTGCTTTCTGGCTCCTGTTGGCAGGCTGGTTTCCTTGTCCTTCGAGGCCCCTTGGGG
TCTGGCAGTTGTCCTTCCCTTGGTGTCAGTGCCATCATTTGTAAAATGATAAAGAATGGG
GCAGAACCCAGAGGGACACGCCCCTTTCTCTGGCTGGAATGCGCCCCCCCCCCCCGCCCC
CAGCCTCTTGTCCCTGTCTCCGCAGACCCATTGGACCAGCCGTTGCTTGGCCAGGACACC
TTTTTCCTGGAGCAGACCAAGAAGAAAGGAGTCAAGGTGAGGTGTCTGGAAGGGCACTGA
GATCTGCGGAGTGGCGGGAGAGCAGCGGGCACGTGGCTTCTGGAGTCCGCCTTTCAGAGC
CATCTGTCCCCGTGGCTGGGCATGTGTGTGCTACAGAGGCACCTCGAGCTCTCCGGGCCA
TCGTTTCTTCTTCCTTTGTCAGGGGGCAGGGGGTTCGGGTGAATATAAAGAGTTAACGTG
TGCAAAGTCAGCTGCCCACGCAAGTGTGATAGAAGCAGTAGCTCTTCAGTTCCCATAATT
GCCTTCAGGAACTCTCCCAACCCAGAATACTCCAGTGGAGATGCTTTTTAATCTCCAGGG
TACAATTTCATTTATTTAACAGAAGACAAACATTTTCTCCATCCTGGGCACTATTTGGGG
TATAGCGGGGAGCAGAAAAGACGGGGGCATCGTTCTCACACGCTCCTGTCTAGCTGGGGG
ACAGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCTGAGC
CGCGCGGAGCCGCTGGAACTTCCAGTGCTCCGGGACTGAGGTTCTGCGTGTCTAACAGGC
TTCGTGGGTCCACGGGCCACGCCGAGCAGCGAGGCTCTAGAAGGTGCTGGGCTCAGCCCT
CTGCGCATGAGGCCTGGCTCTGGTGGCCAAGGAACTCTCCCGTGCCCGGCACGCGCTGCC
ATGCCTGCTGTGAGGAACGGCTACAAGGGAAACCAAGTCAGGACCCCCCTGTCGTGTGCC
TTCAAAAGCGTCCCCCCCCACCTGAGGGGCGCCGTGGGGCTCTTCCCAGGAAGACAGGGA
ATTGCTCCATGGCGCGGGCGCTGGCTCCCGCGGGCAGCCCCCTGGCTCTGTGGTTGTGGG
TGCACAGCCCGTCTGCAGCCCCAGCCTCCTGCTGCCGCCAGCCTCGAGTCTCAGTGCTGC
GGCTGCAAGAACGTGAGGCACAGGGCACGGGGCCTGACTGTGTCTGCTCGTCTTCCTCCA
GCGGCCGCTGCATCTCCACAGCAAGCCCTCCCAGGCACCCGCCGTGGAGGTGACGCCCGC
CGGGGCCTCCTACCACCCGTCCTTTGAGGACCACCAGGTAGGCAGCCTGGGTCCCCCTGT
CAGCACACCCACCCCGGCTGCTTCCTCGGGGCCTGGGCCTCTTCCCGGGGCCCGTGACGG
CCCCGGGTGGGCAGAGCTGGGCTCGTGGGCCCGAGGGACCAGGGCCCCGTCACGGGTCTC
ACCCGGCCTTGGGCAGGTTTTGGCTTCCTCGGCTGCTCAAGCACATGCCCCGCAGCGGTT
CAGCCTGAGCGGTGACGGTTGATGTGCTTGTGCTGAGGCCTCGAGGAAGTCCAAGGCAGG
GCGTCGGCAAGGCAGCCTGGCGGCTGGCTGCTGCTGGTCCTTGCTCCTGGCCGCCTCTGT
CACGTGGCAGCACACGTGGCAGCCTCTTTGGGCCTCTCCCCTCCAGGTTCCACTGATGTT
CAGCTCTGGCGGCTCCTACTGTGGCTTTTTCTCTGTCTTGATTCCTTTCTGCTTATAGCT
GATCCCACTAACAGGATGAAGACCAGTCCTGACTGAGGTGTAGCGCACCTTAACTGACGT
GACCTCATCAGAGGTCTACCTAGGGCGGGTTCGCACCTGCCGGAGTGGATTAAGTTTAGG
AACGTGTTCTGGGGTGTAGACAAGTCCAAACCACCATAGGAAGTCAGAGAGGCCTTCCTG
GAGGAAGGGACATCTGACTTGAGACTGAAGGATGAGGAGGAGTTTGCTCTGGGAGGAGGG
CAGTTGGGTTTTCCTGGCAGAGGGAGCAGTAGGTGCAAAGACCTACTGAGAGACTGCTAC
ATCTTTCAGGAAGTGCATGGGACAGAGGTGCAGAAGTTTTAAAGAATACATTAGCAGACA
AAAGCGCCACAAGCCAGTGAAGTGTCACCCGGGGATGGGGATGGCTGAGCGCGGCACGGG
TGCAGGGCGCTCGCCGGGGCTCGCGCAGCGTGTTCGTGTGTGAAGGCCTCTTGGCCGCTG
GGGGCGGGAGGCAGCATTCCTCAGCTGAGCAGGGCTGGATGGCAGCTGCAGAACAGAACC
CTCGTGTGCGGCGGCAAAAGGCGGAGGTTGCCGCCGAGTCGGGCATTCACCCGTGGACTG
GGCAGCCTGCGGGGCGAGCCAGGGTGCTGGGGGGAGGCGTGGGGGCTGGGGGTGAGGAGA
CTGTCAAAACAGCGTTGTTGAAACGCGCCTCGCACGTCACAGAGTTCATCTGACTTAAGC
CTCAGATTCATCAGGTCTTAGGAGATCGACAGCGGTGCAGCCGCCCCCGCGGTCATTTCA
GCGCATGTTGTCACCTCAGGCATGTCAGCCCCTCAGGCAGTTGCTCCCCAATCCCGCAGC
CTCTAATCTGTTTCCTGCCTGAGGAATTGCGAATCCTGGACCTTTCACATAAAAGGAAGC
CCCCGACATGTAGGGCCTGGGGGGCTTCACAGACCCCACGGGGCAGGTGGGGCAGGACTA
GCAGGTGCTTCCCCCACCGCAGCTGCTGCGTGGGGGGTGGGCTGAGCCCCTGGGTCTGGA
GACGGAGAGGAGGAGGAGCCAGGGCAGGGAGCCTGTTCTCACCCCCGTGCCCGTCCTGCC
CAGACCCTGCTCCTGGCGGCCCACGAGGTCGAGCTGCAGCGGCAGAAGGAAGCCGAGAAG
CTGGAGCGGCAGCTGGCCCTGCCCACCGCGGAGCAGGCTGCCACCCAGGTGAGCCCTACA
CCGCCCCCCCCCCCCCGCCGCCGCCGGCCTCACCTTGGCCCTGACCCCCTCCCCTGCCCC
AGGAGTCTGTGTTCCAGGAGATGTGCGAGGGGCTTCTGGAGGAGTCGGACGGGGAGGGGG
ACTCTGACCAGGGCGAGGACCCCGAGGCTGGAGGGGCTGCAGACTCGTCCATGCCCAGCC
GCATGGCCACCGTGGAGAAGAAGACGGAGCAGCAGCGGCGCCGGGAGAAGGCGGCGCGGA
CGCTGGTGAGCCCCCAGGGGCTGCCCTCCCCGTGGCCCGCGTCTTTCGGGCTCCCCCTCG
TCTCTTTCTGGGGTGTTTGTCTTGCCGCCTGCTGTTTCACGCTCTCGGGGGCCCGCAGCT
GTCAGGCGCCCCTCTGGCTCAGGATACAGTGGGGGCCCCTAGACGGTCCCTGCCGCCGGA
GGTGCTTCCTTGTGGGGTAGGGGGGAGTTACGAACCACAGGCAGAAACACGATGCCAGCC
AGTCCTAGGAAACTGCAGCGAAGTAACGAGCTGTGGCGCTTCGGGACTGGGAGCGGGGCG
GTCAGCGCGGGCCTCCTGGACAGAGGTGGCGTTGGGGGCGCCTCGGGGGGGCTCAGGCCG
ACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGTGGCGCGGTGGCTGGCAGAGCTGGCGCGGCGGCGGGAGTGGCGGCGGGCGCA
GTGGTTGGCTGAGGCAGACAAGCCCCGCTGGCTGGGGCGACTCAAGTGAGGCCCCGGTGG
GGTCCCCAAGCCCTCGTCCTGGAATTCCCGGCCTGGACGCTGGCTGCGTCCCTCCTGGGG
GGCCTCCCTCTGCCACTGGTGACCCTCTGTGCACCTCTCACCTGTGTTTTCAGGTACCAG
GCTCTCGACATCGACGTGCAGCTGAGCTCATAGCTGTCTGACTCCCTCAGGACTCTGAAG
GTGTGTGTGTGGTGGGATGGAGTGCTGTAGGGAGACTCTGTGTCCGGTGATGACATCTAT
CTTTGCTCTTCGTGCCTCTCAGGGCCATGGGCGACACTCTGGCTAGCTCTGGGCTGGGCC
GGTTGGGCCAGCGCCTGGGGGCTGAGGGCACAGGGTCTCTGACGGGGGATTGCGGGGGCT
GAGGGCTTGAGCTCTGTGACACTTGGGGGGCATTTTCTCTCAGCCAGACCCGCTACCCTG
GTCGCCGAGCTCCTCCTGCCTCGGTATCCTAGAGGGTCTTCCCAAGCTCAGACCTGACCT
TGTGCCTCCCCTGCTCTGCACCTTCCGTGGCTCCCCAGCACCCTGGGAGAACGCTCAGCT
CCTCCTGAGCCCAGTGAACGCCCTTCTGTGGCTTTGGCCTGCTGCCCTCCGCCTCTCATT
CCCTTTTCCACATCTTTACCAGCCTCGTTCCTGTCCATCCCTCAAAACCCAGCTCAGGCG
GCCCGCGGGGCAGGTCTGCTGGTCCCCGAGGCTGAGCACAGGGTCAGACACGAGGCCGGA
GTGGAGGCCTCGGCTGAGGGCAGCAGCAGGGGCCTGGGCCCTGGCCGGGCCCCTGGAGAG
GTCAGCGGCCCTCGGGGCTCCATGCTCAGGTCCCTCCCTGTCCCGCAGCCTGAGGGCAAC
ATCCTCCGGGACCGGTTCAAGAGCTTCCAGAGAAGAAACATGATCGAGCCTCGGGAGAGG
GCCAAGTGAGCGCGGGGGCGCCTGGGGGCGGGTCGCTGGGACCTCCCTCTGTTTGGTGGC
GGTGCTGGTCTCTGACCACGGTCTTTTCCCTTCCCCAGGTTCAAGCGCAAGTACAAAGTG
AAGCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1224, 1559..1623, 2825..2826, 2828..2920, 2923..2930, 3643..3842, 4225..4295, 5761..5856, 7383..7487, 7562..7744, 8269..8444, 8573..8609, 8613..8639, 9288..9364, 9458..9482
1001..1224, 1559..1623, 2825..2826, 2828..2920, 2923..2930, 3643..3842, 4225..4295, 5761..5856, 7383..7487, 7562..7744, 8269..8444, 8573..8609, 8613..8639, 9288..9364, 9458..9482
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved